CN100417730C

CN100417730C - DNA sequence measurement based on primer extension

Info

Publication number: CN100417730C
Application number: CNB2006100967053A
Authority: CN
Inventors: 施小龙; 唐超; 陆祖宏
Original assignee: Southeast University
Current assignee: Southeast University
Priority date: 2006-10-10
Filing date: 2006-10-10
Publication date: 2008-09-10
Anticipated expiration: 2026-10-10
Also published as: CN1940088A

Abstract

A method for measuring DNA sequence based on primer extension is carried out by inducing a section of DNA sequence on DNA template, fixing it onto solid-phase substrate, designing 1-15 oligonucleotide DNA primer combination to make it contain a section of DNA sequence, whose 3'end of 1-15 oligonucleotide DNA primer contains 0,1,2......14 degeneracy nucleic acid, selecting one primer from the primer combination by site position to be measured, hybridizing it with fixed DNA template, adhering site to primer 3'end, nucleic acid extending for primer by dideoxynucleic acid substrate or deoxyribonucleotide or dideoxyribonucleotide and inspecting extended nucleic acid type. The base type on DNA template is complementary with extended nucleic acid type.

Description

Dna sequencing method based on primer extension

Technical field

The present invention relates to a kind of determined dna sequence method, relate in particular to a kind of dna sequencing method based on primer extension.

Background technology

Present two the most frequently used dna sequencing methods are chemical chop sequencing of dideoxy chain termination and Maxam and the Gilbert of Sanger, but the two all depends on the dna fragmentation that electrophoretic separation varies in size.The Sanger sequencing has been used dideoxy nucleotide and has been stopped polyreaction at random, has produced the extended chain of all lengths like this, separates by electrophoresis.Because the Nucleotide of termination can be identified, and all there is termination the everywhere, therefore can read sequence.Though the electrophoretic technique particularly application of capillary electrophoresis makes the level of automation of order-checking obtain large increase; but its flux still is subjected to restriction to a certain degree, is not optimum method for needs high cost and high-throughout extensive genome plan or diagnosis and treatment order-checking therefore.In recent years along with gene chip develops rapidly in life science, the advantage of its high throughput testing is referred in the dna sequencing, and development or proposed some non-electrophoretic sequence measurement, for example chip hybridization sequencing, the tetra-sodium sequencing, light cutting fluorescent nucleotide method.

The chip hybridization sequencing is utilized highdensity oligonucleotide sequence dot matrix and target sequence hybridization on the chip, splice the sequence of target DNA then, need synthetic very highdensity dot matrix could effectively measure the target DNA sequence, and the making of high-density dot matrix is still very difficult at present.

The common ground of tetra-sodium sequencing and light cutting fluorescent nucleotide sequencing is to adopt archaeal dna polymerase progressively to extend primer strand, belongs to synthesis method order-checking (sequencing by synthesis).Therefore earlier synthesis method order-checking process is done general general introduction: at first make single-stranded template DNA, the dna molecular that primer and the annealing of template DNA chain obtain hybridizing, in the presence of archaeal dna polymerase, add the Nucleotide substrate then, each dideoxy nucleotide substrate that only adds a kind of Nucleotide substrate or four kinds of tape labels, if the base complementrity of correspondence on Nucleotide that adds and the template, then polysaccharase can be incorporated into primer strand with it.The integration incident of Nucleotide can detect by the whole bag of tricks, and for example the tetra-sodium order-checking is by detecting the release of tetra-sodium; Also marker such as the fluorescigenic material that detects easily can be connected on the Nucleotide, detect then.

Tetra-sodium sequencing (pyrosequencing) is to mix by the luminous Nucleotide that determined whether of biocatalysis, when its principle is the Nucleotide substrate that adds and template base complementrity, its polymerization of archaeal dna polymerase catalysis, can discharge tetra-sodium simultaneously, tetra-sodium is ATP by enzymatic conversion, and ATP can produce photon and be detected by highly sensitive photodetector under the effect of luciferase.It comes definite kernel thuja acid kind by the substrate addition sequence, is a kind of instant (real-time) sequencing.The high throughput testing of a plurality of enzymatic reactions of this method and biochip combines for gene order-checking certain advantage.But there is order-checking length limited (about 50bp) in it and can not accurately checks order to a plurality of same Nucleotide continuously, and needs the specific instrument equipment.

Some investigators have synthesized many light and have cut group or chemical reagent cutting group and be used for dna sequencing research.The route of taking is to detect after mixing fluorescent marker with the DNA synthetic enzyme substantially, removes fluorophor with laser or other chemical reagent then.Add next labeled substrate afterwards.Also there is research that light cutting and Nucleotide 3 '-OH are combined with the chemical group protection, can realizes only mixing a Nucleotide so at every turn and enter primer strand.Light cutting fluorescent nucleotide method has been used for reference DNA and chemiluminescent polypeptide synthetic thought; but the catalyzer that adopts is the high degree of specificity enzyme; because 3 '-OH end is protected; can only mix a Nucleotide at every turn; the kind of each Nucleotide that extends is decided by template; but we can learn which kind of Nucleotide what mix is at every turn by its fluorescence color, so sequence can be learnt.But because 3 '-OH relates to the formation of phosphodiester bond, 3 ' of Nucleotide-OH is very near the avtive spot of archaeal dna polymerase, and is therefore very responsive to the modification of 3 '-OH, seldom the polymerization that archaeal dna polymerase can this substrate of catalysis.The shortcoming one of these routes is to need synthetic complicated cutting group; The 2nd, fluorophor not necessarily can cut away and take off fully, can produce background interference when extending to certain-length.Light cutting fluorescent nucleotide method is the new technology that nearest new development rises, and also in the starting stage, its light cutting fluorescent nucleotide does not also have commercialization, and its accuracy and length are also treated further to determine.

(single base extension SBE), has another name called little sequencing (minisequencing) to single base extension.SNP site sequence according to detected sample designs primer (not comprising the SNP site) and directly is fixed on it on chip, with the PCR product of testing sample as template, then 3 ' of Oligonucleolide primers end base is adjacent in template polymorphism base site, behind template and primer hybridization, used 4 kinds of ddNTP of fluorescence of all kinds or other marker marks, under the catalysis of DNA polymerase, directly on chip, carry out solid single base extension, learn the kind of the Nucleotide substrate that mixes the SNP site by the kind that detects fluorescence with template paired primer.The specificity of DNA polymerase makes the susceptibility of this method and resolving power all higher, but its shortcoming is to use multicolor fluorescence system and corresponding detecting system, and the spectrum of the exciting light of multiple dyestuff and emitting fluorescence often has the overlapping of major part, thereby disturbs the measuring accuracy to fluorescence intensity.

Summary of the invention

The objective of the invention is to overcome the deficiency in the above-mentioned method for nucleic acid sequencing of mentioning, propose the dna sequencing method of a kind of high-throughput based on biochip, have the order-checking advantage that price is low, accuracy is high and workable based on primer extension.

The present invention adopts following technical scheme:

A kind of method for determining nucleic acid sequence that is used for determining unknown nucleotide sequence: A) introduce one section known general dna sequence dna, and make it to be fixed on the solid-phase matrix at tested dna profiling; B) 1-15 oligonucleotide DNA combination of primers of design makes it contain one section general dna sequence dna complementary sequence with above-mentioned adding, and 3 ' of this 1-15 oligonucleotide DNA primer held contain respectively 0,1,2 ..., 14 degeneracy Nucleotide; C) according to the position of nucleotide site to be measured, from above-mentioned combination of primers, select a kind of primer, and itself and the fixed dna template described in the A are hybridized, make and then primer 3 ' end of nucleotide site to be measured; D) with archaeal dna polymerase and with the dideoxy nucleotide substrate of four kinds of distinguishable marker marks or use the four kinds of deoxynucleotides or the dideoxy nucleotide of one or more marker marks respectively, on the primer that hybridizes on the template, carry out a kind of Nucleotide and extend; E) be extended the Nucleotide kind among the detection D, the kind of the tested base of dna profiling and the complementation of extension Nucleotide kind among the A.

Compared with prior art, the present invention has following advantage:

1, high-throughput.The present invention combines dna sequencing technology and biochip, can fix thousands of hundreds thousand of samples that arrive simultaneously on chip, can check order to thousands of samples.

2, cheap.The present invention only needs the combination of number cover sequencing primer, and the tricks of combination of primers is identical with order-checking length, can a large amount of samples be checked order.

3, convenient.The present invention takes the order-checking of degenerated primers extension method, can measure the sequence of primer one a side 8-9 base easily.And if specificity restriction restriction endonuclease is used in combination and can records longer sequence.

4, accuracy height.

Description of drawings

Fig. 1 is the primer extension synoptic diagram that usefulness of the present invention contains 0 degeneracy Nucleotide.X is capable, and primer strand and the primer bonded zone represented is PBR (in template strand); The capable template strand of representing of Y,? represent calling sequence to be measured, the labeled nucleotide that the B* representative is mixed.

Fig. 2 is the primer extension synoptic diagram that usefulness of the present invention contains 1 degeneracy Nucleotide.3 ' end has 1 degeneracy Nucleotide (N) in the primer strand; Base (base to be measured) the complementary labeled nucleotide B* of the second position is mixed primer strand by covalency in the polymerization of process archaeal dna polymerase and the template.Be the second position in the template with B* complementary Nucleotide? Nucleotide.

Fig. 3 is the primer extension synoptic diagram that usefulness of the present invention contains 2 degeneracy Nucleotide.3 ' end has 2 degeneracy Nucleotide (NN) in the thing chain; Base (base to be measured) the complementary labeled nucleotide B* of the 3rd position is mixed primer strand by covalency in the polymerization of process archaeal dna polymerase and the template.Be the 3rd position in the template with B* complementary Nucleotide? Nucleotide.

Fig. 4 is the primer extension synoptic diagram that usefulness of the present invention contains 7 degeneracy Nucleotide.3 ' end has 7 degeneracy Nucleotide (NNNNNNN) in the primer strand; Base (base to be measured) the complementary labeled nucleotide B* of 8 positions is mixed primer strand by covalency in the polymerization of process archaeal dna polymerase and the template.Be 8 positions in the template with B* complementary Nucleotide? Nucleotide.

Fig. 5 is the chip scanning figure as a result of the embodiment of the invention 2.Each square formation has 4 row, is respectively seq1 from top to bottom, seq2, seq3 and seq4.Each sequence repeats 4 times.A, C, G, T represent added labeled nucleotide respectively, and P1-P7 represents seq5～seq11 primer (extending with seq1-seq4 hybridization back).

Fig. 6 is the fluorescence intensity histogram of the embodiment of the invention 2.Seq1, seq2, seq3 and seq4 are respectively 4 synthetic templates among the figure, and be corresponding with listed sequence in the material method.The digital 1-7 of X-axis is corresponding with sequencing primer seq5 one seq1 1 that is added respectively; Y-axis is the resulting fluorescence intensity in scanning back.Can read sequence: CTACCTG by comparing fluorescence intensity in seq1: reading sequence in seq2 is: GACGCAC: reading sequence in seq3 is: TCGTCTG; In seq4, read: AGGACTA.

Fig. 7 is the PCR product agarose gel electrophoresis figure as a result of the embodiment of the invention 3.

Fig. 8 is the chip scanning figure as a result of the embodiment of the invention 3.

Fig. 9 is the embodiment of the invention 3 usefulness Sanger methods order-checking order-checking partial results figure.

Embodiment

Embodiment 1

A kind of method for determining nucleic acid sequence that is used for determining unknown nucleotide sequence:

A) in tested dna profiling, introduce one section known general dna sequence dna, and make it to be fixed on the solid-phase matrix; B) 1-15 oligonucleotide DNA combination of primers of design makes it contain one section general dna sequence dna complementary sequence with above-mentioned adding, and 3 ' of this 1-15 oligonucleotide DNA primer held contain respectively 0,1,2 ..., 14 degeneracy Nucleotide; C) according to the position of nucleotide site to be measured, from above-mentioned combination of primers, select a kind of primer, and itself and the fixed dna template described in the A are hybridized, make and then primer 3 ' end of nucleotide site to be measured; D) with archaeal dna polymerase and with the dideoxy nucleotide substrate of four kinds of distinguishable marker marks or use the four kinds of deoxynucleotides or the dideoxy nucleotide of one or more marker marks respectively, on the primer that hybridizes on the template, carry out a kind of Nucleotide and extend; E) be extended the Nucleotide kind among the detection D, the kind of the tested base of dna profiling and the complementation of extension Nucleotide kind among the A.

Present embodiment can detect different positions Nucleotide successively with the primer repetition A-E operation of the degeneracy Nucleotide that contains different numbers.

Above-mentioned steps D) Nucleotide of described mark is the Nucleotide that is marked with the fluorescence chemical group that is used for polymerase extension.

The method of labeled nucleotide is to connect by vitamin H, digoxin, is used for the enzyme of color reaction or the antibody or the affine labeled nucleotide usually of nm gold particles mark.

Above-mentioned steps A) described solid substrate is meant dull and stereotyped matrix, microwell plate or microballoon.

Above-mentioned steps A) described tested dna profiling is the PCR product, rolling circle amplification product, the dna segment after DNA plasmid or the enzyme processing.

Above-mentioned steps A) method of one section known general dna sequence dna of described introducing can be one of following: (1) adds joint by dna ligase at sequence two ends to be measured, and this joint be the known array with primer hybridization; (2) DNA to be measured is connected in the carrier, transformed into escherichia coli obtains carrying out carrying out PCR with the carrier sequence of inserting the dna sequence dna two ends as primer behind single colony clone, thereby makes a part of known array of carrier introduce dna sequence dna to be measured then; (3) DNA to be measured to the known portions sequence information checks order, can be directly with the known array part as PBR, part to be measured is PBR and then.

Below in conjunction with Fig. 1-Fig. 4, the specific embodiment of the present invention is made more detailed description:

At first DNA sample to be measured is fixed on the bio-chip substrate, produces dna single chain template by sex change.The PBR that known array is arranged on the template.Dna sequence dna to be measured is the sequence of PBR 5 ' direction one side and then, as shown in fig. 1 indicate "? " the zone.

In order to record in the template kind of the base of first position after the PBR 5 ' direction and then, with the and then primer and the template hybridization in site to be measured of 3 ' end, use dideoxy nucleotide or the deoxynucleotide and the reaction buffer extension (see figure 1) of archaeal dna polymerase, mark then.Can extend simultaneously with the dideoxy nucleotide substrate of four kinds of different marking signals during extension; Four kinds of dideoxy nucleotides of also available a kind of marking signal mark or deoxynucleotide carry out four times respectively and extend.Extend the back and detect, according to marking signal and base complementrity pair principle (being A and T, C and G complementary pairing), then the base kind of first position can be determined.

In order to record in the template kind of the base of second position after the PBR 5 ' direction and then, used primer comprises two parts, and a part is and the known array of PBR that a part is and unknown nucleotide sequence bonded district.Because first position is unknown nucleotide sequence after the PBR 5 ' direction, the possibility of its kind has four kinds.Therefore primer its corresponding base that neutralizes also has four kinds.This position is a degeneracy Nucleotide when synthetic primer, and promptly this position is for containing Nucleotide A, G, and the mixture of C and T is represented with N as shown in Figure 2.After this primer and template to be measured hybridization, Nucleotide and archaeal dna polymerase with mark extend, because the specificity of archaeal dna polymerase is selected, when the base complementrity in labeled substrate Nucleotide and second site, labeled substrate can mix primer strand (representing with B*) in Fig. 2, detect with detecting instrument afterwards,, just can determine which kind of base mixes primer strand according to marker character or labeled nucleotide addition sequence.

In order to record in the template kind of the base of the 3rd position after the PBR 5 ' direction and then, with 3 ' end the primer hybridization of two degeneracy Nucleotide is arranged, primer and the template hybridization of two N are promptly arranged.See Fig. 3.Extend with archaeal dna polymerase and labeled substrate afterwards, detect then.

So analogizing, is with the primer hybridization that three degeneracy Nucleotide are arranged with 3 ' end when surveying the 4th base, and the primer hybridization (see figure 4) of seven degeneracy Nucleotide is arranged with 3 ' end when surveying the 8th base.

By above method as can be known, the present invention can record the kind of PBR one side specific position base.In order to record the base kind in site to be measured, available solutions one: with template break into portions to be measured, be fixed on the different positions of chip, or on the chip of several Zhang Chongfu making.Extend with the degenerated primers hybridization back of containing different numbers respectively each position, can obtain the base kinds of information of different positions to be measured simultaneously.Also can use scheme two: extend with wherein a kind of primer and fixed template hybridization back earlier, back to be detected makes primer strand separate with template strand by denaturing treatment, extends after adding second kind of primer hybridization then, carries out repeatedly so repeatedly.The method that more than provides can be measured the information of the base sequence of about 10 of PBR one sides very easily.In order to measure longer base sequence, can check order in conjunction with the restriction enzyme site of restriction enzyme.Just measure the sequence of specific restriction enzyme site one side, restriction enzyme site generally has the sequence that 4-6 particular bases formed, and therefore can increase the length of order-checking effectively.

Sequence measurement provided by the invention be with double-stranded DNA sample Covalent Immobilization to be measured on biochip matrix.Biochip matrix is meant dull and stereotyped matrix (as sheet glass, silicon chip, gel coat, plastics, rubber, pottery, nitrocellulose filter, nylon membrane etc.), microwell plate (as plastic plate, metal sheet, rubber plate, sheet glass etc.) and microballoon (as the magnetic bead of avidin bag quilt).There is several different methods the DNA sample can be fixed to the sheet primary surface of biochip.At first, bio-chip substrate is modified, make its surface have aldehyde radical, amino, sulfydryl, carboxyl, epoxy group(ing) etc. or other active groups, or with bag such as Streptavidin, avidin quilt, to select to substrate with modified dna molecules such as amino, vitamin H, phosphate or sulfydryls then, be connected on the chip substrate of modified; Can react with amido modified DNA as aldehyde group modified substrate, the substrate of carboxyl modified reacts with the amido modified DNA of getting in the presence of catalyzer such as EDC; What use always for microballoon is the magnetic bead of Streptavidin bag quilt, and DNA and the microballoon that is modified with vitamin H mixed in little centrifuge tube, and DNA can be attached to magnetic bead surfaces after placement for some time.

Being recorded dna sequence dna contains one section known array and is used for hybridizing with sequencing primer.The introducing of this sequence has several different methods: for example add joint by dna ligase at sequence two ends to be measured, joint can be used as the sequence with primer hybridization; DNA to be measured is connected in the carrier, and transformed into escherichia coli obtains carrying out carrying out PCR with the carrier sequence of inserting the dna sequence dna two ends as primer behind single colony clone, thereby makes a part of known array of carrier introduce dna sequence dna to be measured then.DNA to be measured to known array information checks order again, can be directly with the known array part as PBR, part to be measured is PBR and then.

Tested dna profiling is the PCR product, be fixed to chip matrix as the PCR product after, by high temperature or add denaturing agent such as NaOH, methane amide, denatured DNA doubly-linkeds such as urea separate the chain that is not connected to matrix.Tested dna profiling also can be the rolling circle amplification product, as dna profiling being used dna ligase Cheng Huan, use 5 ' terminal modified primer and the hybridization of template ring then, the hybridization back will be hybridized product by primer and will be fixed on the chip matrix, add very strong DNA synthetic enzyme of processivity such as phi29 archaeal dna polymerase or Bst archaeal dna polymerase and dNTP substrate then and carry out rolling circle amplification, the ring hybridization that also can be earlier primer be formed with template after fixing is again extended then or the rolling circle amplification product directly is fixed on the matrix.Tested dna profiling also can be the DNA plasmid, the dna segment after the enzyme processing etc.

Whether annealing, polymerase elongation reaction that this order-checking process relates to primer and template detect Nucleotide and mix.DNA sample to be measured in the present invention is as the template of primer, polymerase extension.Any known or suitable archaeal dna polymerase can be used; When template was RNA, polysaccharase was the reverse transcription polysaccharase.Substrate Nucleotide is any Nucleotide that can be used for polymerase extension, deoxynucleotide dATP for example, dCTP, dGTP, dTTP, dideoxy nucleotide; Dideoxy nucleotide is meant that 3 '-OH does not exist or modified, and it can be aggregated enzyme and be incorporated in the primer strand but can not continue to prolong, as ddATP, and ddCTP, ddGTP, ddTTP.Nucleotide is labeled the detection to make things convenient for Nucleotide to mix; One or more Nucleotide are by usefulness, as Cy3, and Cy5, TexasRed, FRET, the Nucleotide of marks such as FITC.The mark of Nucleotide and detection method mainly are some fluorescence dyes shown in some documents, as fluorescein, anthocyanidin, rhodamine etc., also can wait labeled nucleotide by the antibody or the avidin of connection nm gold particles marks such as vitamin H, digoxin.Because fluorescent mark and fluoroscopic examination are to study the most sophisticated method, for convenience's sake, fluorescence is main mark of the present invention and detection method, but does not get rid of other marks and detection method.Is that primer is dissolved in solution such as 2XSSC or the TE solution with primer with the template hybridization that is fixed on matrix, and making final concentration is that 1 micromole can to 100 micromoles.The solution that is dissolved with primer is added on the matrix that is fixed with template, hatches 5 minutes to a few hours in wet box or Eppendorf tube, and incubation temperature is generally 37 ℃ or other temperature.Afterwards with the washings washing, to wash the primer in the not hybridization off.The extension system comprises: archaeal dna polymerase and enzyme buffer liquid such as klenow archaeal dna polymerase, and Taq archaeal dna polymerase etc., the Nucleotide of mark also adds BSA sometimes, single strand binding protein etc.Elongating temperature 37 ℃-72 ℃ all can, the extension time can be that half a minute was to several minutes.Extension can stop by chip being put into washings or being added 50mM EDTA solution, and the washing back is detected with chip scanner or other detecting instrument.

Embodiment 2: the dna profiling to synthetic checks order

Following dna sequence dna is synthetic by invitrogen company:

Seq1：5’NH2-(T)25?TT?CT C?AGG?TAG?AGT?TGG?AGC?TCA?GGA?CAT?GGC?AT

Seq2：5’NH2-(T)25?TT?AC G?TGC?GTC?AGT?TGG?AGC?TCA?GGA?CTG?GGC?TG

Seq3：5’NH2-(T)25?TT?GT C?AGA?CGA?AGT?TGG?AGC?TCA?GGA?ATA?CTT?AT

Seq4：5’NH2-(T)25?T T?AGT?CCT?AGT?TGG?AGC?TCA?GGA?TCC?TTG?GA

Seq5：5’-CTGAGCTCCAACT3’

Seq6：5’-TGAGCTCCAACTN3’

Seq7：5’-GAGCTCCAACTNN3’

Seq8：5’-GAGCTCCAACTNNN3’

Seq9：5’-AGCTCCAACTNNNN3’

Seq10：5’-GCTCCAACTNNNNN3’

Sequ11：5’-CTCCAACTNNNNNN3’

Seq1-seq4 is as dna profiling, and seq5-seq11 is a sequencing primer.The part of template sequence medium dip overstriking is a PBR, and underscore is a sequence to be measured partly, and NH2 is expressed as amido modified.N is a degeneracy Nucleotide, and this position adds the substrate of four kinds of synthetic DNAs simultaneously when the chemical synthesising DNA template.Cy5-dATP, Cy5-dCTP, Cy5-dGTP and Cy5-dUTP is available from Perkin Elmer company.The Therminator archaeal dna polymerase is available from NEB company.(Poly (acrylic acid, sodiumsalt)) is available from Sigma company for polyacrylic acid.

1, the preparation of substrate

(1) cleaning of slide: the NaOH with 1M soaked slide 1 hour, and distilled water is rinsed well, used dichromic acid (potassium bichromate+vitriol oil) to soak again 12 hours, and distilled water repeatedly washes clean residual acid.

(2) processing of amino sheet:, dry up earlier with 95% washing with alcohol slide; Silane ethanolic soln with 3% (the 3ml aminosilane adds 95% ethanol to final volume 100ml) soaks slide 30 minutes or ultrasonic wave was soaked 15 minutes; Clean with 95% ethanol, clean with distilled water, dry up, 110 ℃ were dried by the fire 30 minutes.

(3) processing of carboxyl sheet: the slide of aminosilaneization Poly (acrylic acid, sodium salt) the 2mg/ml aqueous solution (preparation: Poly (acrylic acid, sodium salt) 35wt%solutionin water 572ul adds distilled water to 100ml) soaked 20 minutes, distilled water washing three times dries up.

2, template is fixing: the amido modified template of 5 ' end is dissolved in 0.1M Mes damping fluid (2-(N-morpholino) ethyl sulfonic acid), pH 5.1, contain 5mM EDC (1-ethyl-3 (3-dimethylaminopropyl)-carbodiimide) in the solution, the final concentration that makes template is 5 micromoles.By point sample instrument amido modified template is put to the slide of carboxyl processing, each template repeats a little four times, and four templates are a square formation, 28 square formations of concurrent.At room temperature be positioned in the wet box of sealing three hours.Used deionized water wash then 5 minutes, used 2 * SSC/0.2%SDS solution washing then 5 minutes, use 0.2 * SSC washing 5 minutes again, dry up with nitrogen after 5 minutes with distilled water wash at last.

3, polymerase-mediated primer extension reaction: final concentration is that (be dissolved in 2 * SSC/0.2%SDS) and be added on the dot matrix that contains sequencing template, per 4 square formations add a kind of primer, add seq5-seq11 and template annealing respectively for the primer of 50uM.Annealing reaction was 42 ℃ of reactions 30 minutes.Dry up after using the washing of 2 * SSC/0.2%SDS washing lotion then.Four square formations that are added with same primers as add respectively and contain 0.4uM Cy5-dATP, Cy5-dCTP, Cy5-dGTP and Cy5-dUTP extension liquid.Extension liquid comprises: the Nucleotide substrate that Cy5 modifies, 0.5U Therminator archaeal dna polymerase, polymerase buffer.Be reflected at 60 ℃ of reactions 2 minutes.With 50mM EDTA termination reaction, dry up after the washing.Scan with chip scanner then.

The result: with Seq1-seq4 as dna profiling, when with seq5 as sequencing primer and their hybridization after, extend the Nucleotide of mark with archaeal dna polymerase, can be aggregated the base that enzyme mixes in seq1 is C; Seq2 is G; Seq3 is T; Seq4 is A; From scanning back result such as Fig. 6 as can be seen, X-axis is that the intensity of C is the highest in four fluorescence intensities of A, C, G, T of 1 in seq1.X-axis is that the intensity of G is the highest in four fluorescence intensities of A, C, G, T of 1 in seq2.X-axis is that the intensity of T is the highest in four fluorescence intensities of A, C, G, T of 1 in seq3.X-axis is that the intensity of A is the highest in four fluorescence intensities of A, C, G, T of 1 in seq4.

After seq6 was as sequencing primer and Seq1-seq4 hybridization, X-axis was the strongest being respectively of fluorescence intensity in 2:

seq1：T；seq2：A；seq3：C；seq4：G。

After seq7 was as sequencing primer and Seq1-seq4 hybridization, X-axis was the strongest being respectively of fluorescence intensity in 3:

seq1：A；seq2：C；seq3：G；seq4：G。

After seq8 was as sequencing primer and Seq1-seq4 hybridization, X-axis was the strongest being respectively of fluorescence intensity in 4:

seq1：C；seq2：G；seq3：T；seq4：A。

After seq9 was as sequencing primer and Seq1-seq4 hybridization, X-axis was the strongest being respectively of fluorescence intensity in 5:

seq1：C；seq2：C；seq3：C；seq4：C。

After seq10 was as sequencing primer and Seq1-seq4 hybridization, X-axis was the strongest being respectively of fluorescence intensity in 6:

seq1：T；seq2：A；seq3：T；seq4：T。

After seq11 was as sequencing primer and Seq1-seq4 hybridization, X-axis was the strongest being respectively of fluorescence intensity in 7:

seq1：G；seq2：C；seq3：G；seq4：A。

By the result as can be known present method can measure the kind of primer one several bases of side exactly.

Embodiment 3: T7 phage DNA library clone is checked order

Material: the T7 phage DNA is available from Shanghai bio-engineering corporation; Tsp509I is available from NEB company; PUC118 carrier, competence bacterium and conversion reagent box, T4DNA ligase enzyme are available from the precious biotech firm in Dalian; The klenow archaeal dna polymerase is available from fermentas company; Following sequence is ordered from invitrogen company: primer before the M13:

NH ₂-CAGGAAACAGCTATGAC (seq12); Primer behind the M13: GTAAAACGACGGCCAGT (seq13);

Sequencing primer: GCATGCCTGCAGGTCAATT (seq14); CATGCCTGCAGGTCAATTN (seq15);

ATGCCTGCAGGTCAATTNN(seq16)；ATGCCTGCAGGTCAATTNNN(seq17)；

TGCCTGCAGGTCAATTNNNN(seq18)；

Experimental procedure:

1, the T7 phage DNA is carried out enzyme with Tsp509 I and cut, reaction system is:

T7 phage DNA 2 μ g

Tsp509?I(10U/μl)0.5μl

Tsp509 I reaction buffer (10 *) 2 μ l

H2O?17.5μl

65 ℃, 2 hours;

It is the PCR purification kit purifying of company with the sky that enzyme is cut product.

2, be flush end with klenow archaeal dna polymerase polishing sticky end, reaction system is:

The disconnected 20 μ l of T7 phage DNA enzyme section of purifying

Klenow archaeal dna polymerase (10U/ μ l) 0.5 μ l

dNTP(10mM) 0.5μl

37 ℃, 2 hours; 70 ℃ then, 15 minutes inactivations.

The product of archaeal dna polymerase polishing is the PCR purification kit purifying of company with the sky.

3, T7DNA flush end segment is connected with pUC118

The disconnected 20 μ l of T7 phage DNA enzyme section of purifying

T4DNA ligase enzyme 1 μ l

T4DNA ligase enzyme reaction buffer (10 *) 2 μ l

16 ℃, 2 hours; 70 ℃ then, 15 minutes inactivations.

(4) with the carrier transform bacteria that connects: method transforms by the step that the precious bio-transformation test kit in Dalian provides.

(5) bacterium that transforms is carried out dull and stereotyped the cultivation: the bacterium that transforms is coated on LB solid medium (containing 50 μ g/ml penbritins) incubated overnight.

(6) choose a single bacterium colony and carry out bacterium liquid PCR: choose single bacterium colony and cultivated 4 hours, get 0.5 μ l and add in the PCR reaction solution at LB liquid nutrient medium (containing 50 μ g/ml penbritins):

Bacterium liquid 0.5 μ l

dNTP(10mM) 1μl

Taq dna polymerase reaction damping fluid (10 *) 5 μ l

Taq archaeal dna polymerase (5U/ μ l) 1 μ l

Primer (10 μ M) 2 μ l before the M13

Primer behind the M13 (10 μ M) 2 μ l

H2O 38.5μl

Reaction conditions: 94 ℃ 30 seconds, 54 ℃ 30 seconds, 72 ℃ 30 seconds, 35 circulations.It is the PCR purification kit purified pcr product of company that reaction finishes with the sky.In the final step of purifying, replace elutriant with deionized water.Sepharose with 1% carries out electrophoresis and detects.

(7) template is fixing: the amido modified template of 5 ' end is dissolved in 0.1M Mes damping fluid (2-(N-morpholino) ethyl sulfonic acid), and pH 5.1, contain 5mM EDC (1-ethyl-3 (3-dimethylaminopropyl)-carbodiimide) in the solution.Template is put to the slide of carboxyl processing, and each template repeats a little 4 times, and four templates are a square formation, 28 square formations of concurrent.At room temperature be positioned in the wet box of sealing three hours.Used deionized water wash then 5 minutes, used 2 * SSC/0.2%SDS solution washing then 5 minutes, use 0.2 * SSC washing 5 minutes again, dry up with nitrogen after 5 minutes with distilled water wash at last.The substrate that is fixed with the PCR product was immersed in the boiling water 10 minutes denatured DNA two strands, thereby single-stranded template.

(8) polymerase-mediated primer extension reaction: final concentration is that (be dissolved in 2 * SSC/0.2%SDS) and be added on the dot matrix that contains sequencing template, per 4 square formations add a kind of primer, add sequencing template seq14-seq18 and template annealing respectively for the primer of 50uM.Annealing reaction was 42 ℃ of reactions 30 minutes.Dry up after using the washing of 2 * SSC/0.2%SDS washing lotion then.Four square formations that are added with same primers as add respectively and contain 0.4uM Cy5-dATP, Cy5-dCTP, Cy5-dGTP and Cy5-dUTP extension liquid.Extension liquid comprises: the Nucleotide substrate that Cy5 modifies, 0.5U Therminator archaeal dna polymerase, polymerase buffer.Be reflected at 60 ℃ of reactions 2 minutes.With 50mM EDTA termination reaction, dry up after the washing.Scan with chip scanner then.

The result:

1, PCR reaction product agarose gel electrophoresis qualification result:

The T7 phage DNA carries out enzyme with Tsp509 I to be cut, and produces the sticky end of AATT; Transform after inserting in the pUC118 carrier then and the picking clone, then with the sequence in the M13 primer amplification insertion carrier.Position that T7DNA inserts and insertion both sides sequence are as follows:

NH2- CAGGAAACAGCTATGACCATGATTACGAATTCGAGCTCGGTACCCGGGGATCCTCTAGAGTC↓AATTNNNNNNNNNNNNNNNNNNNNNNN AAGCTTGGC ACTGGCCGTCGT TTTAC

The line part is the M13 primer; Arrow is that T7DNA inserts the position, position in carrier; The part of drawing frame is the sequencing primer land; ↓ AATTNNNNNNNNNNNNNNNNNNNNNNNAATT ↓ be insertion sequence.

With reference to Fig. 7, the 1-8 road is the PCR product, and molecular weight is 330bp, and the 9th road is molecular weight marker: be followed successively by 100,250,500,750,1000 from bottom to up, 2000bp.

2, extend sequencing result with containing degenerated primers

Use Cy5-dATP respectively respectively with after the template hybridization with sequencing primer seq14-seq18, Cy5-dCTP, Cy5-dGTPand Cy5-dUTP extends, and the results are shown in Figure 9.Can from figure, read sequence: AACAC; Add known AATT restriction enzyme site then sequence be: AATTAACAC; Template strand then is: GTGTTAATT.

With reference to Fig. 8, the PCR product is fixed on the substrate, repeats in each dot matrix a little 4 times.P1-P5 is respectively sequencing primer, and is corresponding with seq14-seq18 respectively.A, C, G, T represent added labeled nucleotide respectively.

3, with sanger method sequence verification sequencing result.

Check order with the sanger method delivering to invitrogen company behind the PCR product purification.This PCR product sequence is as follows:

CCGGGGATCCTCTAGAGTCAATTGGACAAAATGCCAGCACTTCCGGCTAAAGGTAACTTGAACCTCCGTGACATCTTAGAGTCGGACTTCGCGTTCGCGTAACGCCAAATCAATACGACTCACTATAGAGGGACAAACTCAAGGTCATTCGCAAGAGTGGCCTTTATGATTGACCTTCTTCCGGTTAATACGACTCACTATAGGAGAACCTTAAGGTTTAACTTTAAGACCCTTAA GTGTTAATTGACC(seq19)

Can find the terminal portions sequence is: GTGTTAATT.With consistent with containing degenerated primers extension sequencing result.

The sequence that can be read near end by Figure 10 is: GTGTTAATTGACC.

Claims

1. a method for determining nucleic acid sequence that is used for determining unknown nucleotide sequence is characterized in that: A) introduce one section known general dna sequence dna in tested dna profiling, and make it to be fixed on the solid-phase matrix; B) 1-15 oligonucleotide DNA combination of primers of design, make it contain one section general dna sequence dna complementary sequence with above-mentioned adding, and the 3 ' end that makes this 1-15 oligonucleotide DNA primer contains 0,1,2 respectively ..., 14 degeneracy Nucleotide: C) according to the position of nucleotide site to be measured, from above-mentioned combination of primers, select a kind of primer, and with itself and steps A) described in the hybridization of fixed dna template, make and then primer 3 ends of nucleotide site to be measured; D) with archaeal dna polymerase and with the dideoxy nucleotide substrate of four kinds of distinguishable marker marks or use the four kinds of deoxynucleotides or the dideoxy nucleotide of one or more marker marks respectively, on the primer that hybridizes on the template, carry out a kind of Nucleotide and extend; E) detect step D) in be extended the Nucleotide kind, steps A) in the tested base of dna profiling kind with extend the complementation of Nucleotide kind.

2. method for determining nucleic acid sequence according to claim 1 is characterized in that successively the primer repeating step A with the degeneracy Nucleotide that contains different numbers)-E) operation, detect different positions Nucleotide.

3. according to the method for determining nucleic acid sequence of claim 1, it is characterized in that step D) Nucleotide of described mark is the Nucleotide that is marked with the fluorescence chemical group that is used for polymerase extension.

4. method for determining nucleic acid sequence according to claim 1 is characterized in that connecting by vitamin H, digoxin, is used for the enzyme of color reaction or the antibody or the affine labeled nucleotide usually of nm gold particles mark.

5. method for determining nucleic acid sequence as claimed in claim 1 is characterized in that steps A) described solid-phase matrix is meant dull and stereotyped matrix, microwell plate or microballoon.

6. method for determining nucleic acid sequence as claimed in claim 1 is characterized in that steps A) described tested dna profiling is the PCR product, rolling circle amplification product, the dna segment after DNA plasmid or the enzyme processing.

7. method for determining nucleic acid sequence as claimed in claim 1 is characterized in that steps A) method of one section known general dna sequence dna of described introducing is: add joint by dna ligase at sequence two ends to be measured, this joint be the known array with primer hybridization.

8. method for determining nucleic acid sequence as claimed in claim 1, it is characterized in that steps A) method of one section known general dna sequence dna of described introducing is: DNA to be measured is connected in the carrier, transformed into escherichia coli then, obtain carrying out carrying out PCR as primer behind single colony clone, thereby make a part of known array of carrier introduce dna sequence dna to be measured with the carrier sequence of inserting the dna sequence dna two ends.

9. method for determining nucleic acid sequence as claimed in claim 1, it is characterized in that steps A) method of one section known general dna sequence dna of described introducing is: the DNA to be measured to the known portions sequence information checks order, can be directly with the known array part as PBR, part to be measured is PBR and then.