CN110951852B

CN110951852B - Single-base continuous extension flow type target sequencing method

Info

Publication number: CN110951852B
Application number: CN201911165464.7A
Authority: CN
Inventors: 兰文军; 张静; 胡岳
Original assignee: Qilu University of Technology
Current assignee: Qilu University of Technology
Priority date: 2019-11-25
Filing date: 2019-11-25
Publication date: 2022-11-25
Anticipated expiration: 2039-11-25
Also published as: WO2021103695A1; CN110951852A

Abstract

The invention discloses a single-base continuous extension flow-type targeted sequencing method, which utilizes a single-stranded nucleotide fragment containing a complementary sequence of a nucleic acid fragment to be detected, a primer, microspheres, nucleic acid polymerase, a fluorescence-labeled ddNTP, a ribose 3' -OH protected fluorescence-labeled dNTP, a ribose 3' -OH protected dNTP, a ribose 3' -OH deprotecting agent and the like to obtain a series of sequencing microspheres suitable for detecting a nucleic acid base sequence by a flow cytometer through single-base extension of the primer, and the sequencing microspheres are further detected by the flow cytometer to obtain the base sequence of the nucleic acid fragment to be detected. Compared with the existing sequencing method, the method has the obvious advantages of simplicity, accuracy, easy data interpretation and the like, and can be widely applied to the nucleic acid sequencing fields of gene detection, microbial examination, genetics, exons, single Nucleotide Polymorphisms (SNPs), genomics, proteomics and the like.

Description

Single-base continuous extension flow type target sequencing method

Technical Field

The invention relates to a single-base continuous extension flow type target sequencing method, in particular to a preparation method of sequencing microspheres suitable for flow cytometry detection and a method for detecting nucleic acid base sequences by adopting the sequencing microspheres, belonging to the technical field of gene sequencing.

Background

The genome carries all genetic information of a life individual, and gene sequencing not only can deepen understanding of molecular mechanisms of diseases, particularly malignant tumors, but also plays an important role in guiding targeted drug delivery. After the human genomics plan is completed, the gene sequencing technology is developed more rapidly and is applied more widely in clinical practice and basic research. At present, the nucleic acid sequencing method has been developed to three generations, from the first generation of direct detection technology represented by Sanger sequencing and indirect sequencing technology represented by linkage analysis, to the second generation sequencing (NGS) marked by the Solexa technology of illumina and the SOLiD technology of ABI in 2005, to the third generation sequencing represented by SMRT and Nanopore methods, which continuously improve the efficiency and accuracy of gene sequencing, but still have the problems of complicated operation and difficult data interpretation (such as gene structure rearrangement and repetitive region), and the like, and restrict the large-scale clinical application thereof.

The flow cytometry is a technology for carrying out multi-parameter and rapid quantitative analysis on single cells or particles by using a flow cytometer, has the advantages of high speed, high precision and good accuracy, and is one of advanced biosensing technologies. Existing flow cytometry based on primer or probe coated microspheres can only be used for recognition of single base and nucleotide fragments, but not for base sequencing. Therefore, the development of a single-base continuous extension flow type target sequencing method suitable for a flow cytometer has great value.

Disclosure of Invention

The invention aims to provide a single-base continuous extension flow-type targeted sequencing method suitable for detecting a nucleic acid base sequence by a flow cytometer.

Currently, gene detection has important applications in the medical fields of genetics, prenatal diagnosis, companion diagnosis, and the like. For example: the mutation site of the specific gene segment of the patient is determined through gene detection, so that targeted drug delivery can be guided, and the treatment effect of the tumor is improved. However, the existing flow cytometry technology can only identify single bases and oligonucleotide fragments and cannot be used for base sequencing. The invention provides a single-base continuous extension flow-type targeted sequencing method suitable for nucleic acid sequencing by a flow cytometer, wherein the method is used for preparing sequencing microspheres and detecting the sequencing microspheres by the flow cytometer, so that a specific nucleic acid base sequence can be obtained, and further, the information of gene mutation can be read, and the method has important significance for pathogenesis explanation and diagnosis and treatment of sick individuals.

The technical scheme of the invention is as follows:

a single base continuous extension flow-type target sequencing method, which comprises the following steps:

(1) Coating a modified unidirectional primer for guiding the synthesis of a nucleic acid fragment to be detected or a single-stranded nucleotide fragment containing a complementary sequence of the nucleic acid fragment to be detected on the surface of the microsphere to obtain a coated microsphere;

(2) Mixing the coated microspheres, the single-stranded nucleotide fragment containing the complementary sequence of the nucleic acid fragment to be detected or a modified unidirectional primer (referred to as unidirectional primer or modified unidirectional primer for short, the same below) for guiding the synthesis of the nucleic acid fragment to be detected and a buffer solution, and incubating and hybridizing the obtained mixture;

(3) Washing the microspheres with a buffer solution, suspending the microspheres, dividing the microspheres into two parts, mixing one part of microspheres with nucleic acid polymerase, the buffer solution and dNTP (deoxynucleoside triphosphate) with protected ribose 3' -OH, and incubating the obtained mixture; mixing the other microsphere with nucleic acid polymerase, buffer solution, fluorescently-labeled ddNTP (dideoxynucleoside triphosphate) or/and fluorescently-labeled dNTP (deoxynucleoside triphosphate) with protected ribose 3' -OH, and incubating the obtained mixture;

(4) Washing the microsphere incubated after the previous step is mixed with the dNTP with the protected ribose 3'-OH, adding a ribose 3' -OH protective agent, and uniformly mixing;

(5) Washing and suspending the microspheres in the previous step by using a buffer solution, dividing the microspheres into two parts, mixing one part of microspheres with nucleic acid polymerase, the buffer solution and ribose 3' -OH protected dNTP, and incubating the obtained mixture; mixing the other microsphere with nucleic acid polymerase, buffer solution, fluorescence-labeled ddNTP or/and ribose 3' -OH protected fluorescence-labeled dNTP, and incubating the obtained mixture;

(6) Continuously repeating the steps (4) and (5), continuously preparing n groups of microspheres by sequencing n bases of the nucleic acid fragment to be detected, and obtaining n groups of microspheres which are mixed with the fluorescence-labeled ddNTP or/and the fluorescence-labeled dNTP with protected ribose 3' -OH and then incubated;

(7) If all bases cannot be detected by using the n groups of microspheres obtained in the step (6), replacing the fluorescently-labeled ddNTPs and/or the fluorescently-labeled dNTPs with protected ribose 3' -OH obtained in the steps (3) and (5), replacing the container, and continuing to prepare microspheres by using the steps (2) to (6) to obtain 4 xn or 2 xn groups of microspheres;

(8) And (4) washing and suspending the microspheres of 4 xn, 2 xn or n groups obtained in the steps (6) and (7), and then detecting by using a flow cytometer to obtain the base sequence of the nucleic acid fragment to be detected.

Further, in the above method, n is the number of bases of the nucleic acid fragment to be detected.

Further, in the above method, when the types of the fluorescently labeled ddNTP or/and ribose 3' -OH protected fluorescently labeled dNTP added in steps (3) and (5) are 4, all base sequences of the nucleic acid fragment to be detected can theoretically be obtained by using the obtained sequencing microsphere. Depending on the type of the fluorescently labeled ddNTP or/and the ribose 3' -OH protected fluorescently labeled dNTP added in steps (3) and (5), the number of populations of the finally obtained sequencing microspheres differs, which means that not one but a plurality of microspheres are obtained at a time, and thus the populations are referred to. Depending on the manner of adding the fluorescently labeled ddNTP or/and the ribose 3' -OH protected fluorescently labeled dNTP, the number of the finally obtained sequencing microspheres can be n groups, 2n groups or 4n groups.

Further, when the microspheres are coated with modified unidirectional primers for guiding the synthesis of the nucleic acid fragment to be detected, the single-stranded nucleotide fragment containing the complementary sequence of the nucleic acid fragment to be detected is added in the step (2); when the microsphere is coated with a single-stranded nucleotide fragment containing a complementary sequence of the nucleic acid fragment to be detected, a modified unidirectional primer for guiding the synthesis of the nucleic acid fragment to be detected is added in the step (2).

Furthermore, the invention takes a single-stranded nucleotide fragment containing a complementary sequence of a nucleic acid fragment to be detected as a template, under the catalysis of nucleic acid polymerase, one part of microsphere extends a single non-fluorescence labeled base from the end of the unidirectional primer by adding ribose 3'-OH protected dNTP, the other part of microsphere extends a single fluorescence labeled base from the end of the unidirectional primer by adding fluorescence labeled ddNTP or/and ribose 3' -OH protected fluorescence labeled dNTP, and the part of microsphere is reserved for base sequencing. After extending a single non-fluorescent labeled base at the tail end of the unidirectional primer, deprotecting ribose 3'-OH of the nucleic acid at the tail end of the extended strand of the unidirectional primer by adding a ribose 3' -OH deprotecting agent, dividing the microsphere into two parts, continuously adding ribose 3 '-OH-protected dNTPs to one part, adding fluorescently-labeled ddNTPs and/or ribose 3' -OH-protected fluorescently-labeled dNTPs to the other part, adding ribose 3 '-OH-protected dNTPs, extending a single non-fluorescent labeled base at the tail end of the unidirectional primer again, adding fluorescently-labeled ddNTPs and/or ribose 3' -OH-protected fluorescently-labeled dNTPs to the tail end of the unidirectional primer, extending a single fluorescently-labeled base at the tail end of the unidirectional primer, and reserving the microsphere for sequencing. Adding ribose 3'-OH protected dNTP into microspheres incubated by adding ribose 3' -OH protected dNTP for deprotection, then dividing into two parts again, adding ribose 3'-OH protected dNTP and fluorescence labeled ddNTP or/and ribose 3' -OH protected fluorescence labeled dNTP according to the same steps, and repeating the operation until all sequencing microspheres needed for sequencing n bases are obtained. The invention selects microspheres obtained by adding fluorescence-labeled ddNTP or/and ribose 3' -OH protected fluorescence-labeled dNTP for incubation as sequencing microspheres, and the sequencing microspheres can be detected by a flow cytometer and used for identifying the base sequence of a nucleic acid fragment to be detected.

Further, in the above preparation method, the microspheres are microspheres used in flow cytometry, such as polystyrene microspheres, and the microspheres can be obtained commercially. The microspheres used in the present invention may be uniformly sized or dimensionally encoded microspheres, or may be non-fluorescent or fluorescently encoded microspheres. The diameter of the microspheres may be chosen in the range of 0.5-50 μm, preferably 1-10 μm.

Further, the microsphere of the present invention is a microsphere modified by one or more of the following means: modified with at least one of carboxyl, amino, hydroxyl, hydrazide, aldehyde, chloromethyl, oxirane, antibody, aptamer, streptavidin, poly thymidylate (poly T), poly adenylate (poly a), poly guanylate (poly G), polycytidylic acid (poly C), polyuridylate (poly U), and methylated CpG binding domain (MBD) protein, dimethylamine, thiol. The purpose of microsphere modification is to introduce a group capable of combining with a modified unidirectional primer or a single-stranded nucleotide fragment containing a complementary sequence of a nucleic acid fragment to be detected on the surface of the microsphere so as to coat the modified unidirectional primer or the single-stranded nucleotide fragment containing the complementary sequence of the nucleic acid fragment to be detected on the surface of the microsphere. The most widely used microspheres are those modified with carboxyl groups, i.e. carboxylated microspheres. The modification of the microspheres can be carried out by methods reported in the prior art, or the modified microspheres can be purchased directly.

Furthermore, in the above preparation method, the nucleic acid fragment to be detected is a single-stranded deoxyribonucleic acid (DNA) fragment, the nucleic acid fragment to be detected in the present invention refers to a certain fragment specifically required, for example, a human whole genome sequence has been disclosed, a whole genome sequence of other animals or microorganisms has been reported, and if a certain sequence specific to a human, an animal or a microorganism of a known whole genome sequence is to be detected, the sequence to be detected is the nucleic acid fragment to be detected. A one-way primer is designed for the complementary sequence of the nucleic acid fragment to be detected.

Further, in the above preparation method, the one-way primer is a primer capable of extending a base at the end by nucleic acid polymerase catalysis using a single-stranded nucleotide fragment containing a sequence complementary to a nucleic acid fragment to be detected as a template. If the one-way primer is coated on the surface of the microsphere, it needs to be modified so that a group capable of binding with the modification group on the microsphere is formed on the one-way primer. Therefore, the modified unidirectional primer coated on the surface of the microsphere used in the invention is a unidirectional primer modified by at least one of amino, carboxyl, digoxin, biotin, poly A, poly G, poly C, poly T, poly U and methyl. The design and modification of the one-way primer can be carried out by a corresponding company, such as Shanghai Biotech.

Furthermore, in the above preparation method, the modified unidirectional primer that guides the synthesis of the nucleic acid fragment to be detected or the single-stranded nucleotide fragment containing the complementary sequence of the nucleic acid fragment to be detected is coated on the surface of the microsphere, and the coating means that the modified unidirectional primer or the single-stranded nucleotide fragment is immobilized on the surface of the microsphere through a covalent bond or a non-covalent bond. The skilled person can coat the surface of the microsphere with the modified unidirectional primer or the single-stranded nucleotide fragment containing the complementary sequence of the nucleic acid fragment to be detected according to the methods disclosed in the prior art, for example, by electrostatic adsorption, chemical bonding, etc.

Further, in the above preparation method, the nucleic acid polymerase is a DNA-dependent DNA polymerase, and includes Taq DNA polymerase, klenow fragment, and sequencing enzyme (Sequenase).

Further, in the above preparation method, the dNTP is one of deoxyadenosine triphosphate (dATP), deoxyguanosine triphosphate (dGTP), deoxycytidine triphosphate (dCTP), deoxyuridine triphosphate (dUTP), deoxythymidine triphosphate (dTTP), or a combination of two or more thereof, and the deoxyuridine triphosphate and the deoxythymidine triphosphate do not occur simultaneously.

Further, in the above preparation method, the ddNTP is one of dideoxy adenosine triphosphate (ddATP), dideoxyguanosine triphosphate (ddGTP), dideoxycytidine triphosphate (ddCTP), dideoxyuridine triphosphate (ddUTP), dideoxythymidine triphosphate (ddTTP), or a combination of two or more of them, and the dideoxynucleotide triphosphate and the dideoxythymidine triphosphate do not occur simultaneously.

Further, in the above preparation method, among the fluorescently labeled ddNTP and ribose 3' -OH protected fluorescently labeled dntps, ddNTP and ribose 3' -OH protected dntps are fluorescently labeled for use in a subsequent sequencing process, and in the present invention, the ddNTP and ribose 3' -OH protected dntps may be labeled with any one or more of the following fluorescent substances: fluorescein Isothiocyanate (FITC), alexa Fluor 610, alexa Fluor 488, alexa Fluor 633, alexa Fluor 647, alexa Fluor 700, cyanine dye Cy5 (cyanine 5), texas Red (Texas Red), cyanine dye Cy3 (cyanine 3), cyanine dye Cy7 (cyanine 7), hydroxyfluorescein (FAM), lucifer yellow (luciferase yellow), cyanine dye Cy5.5 (cyanine 5.5), rhodamine 110 (rhodomine 110, R110), ROX, rhodamine 6G (rhodomine 6G, R6G), TAMRA.

Further, in the above-mentioned preparation method, the ribose 3 '-OH-protected dNTP, the fluorescently labeled ddNTP, and the ribose 3' -OH-protected fluorescently labeled dNTP can be purchased from the market, and can be prepared by a method described in "171chemical protecting group" published by Wunzenpei, li Kunmeng, chemical industry Press, beijing, 2007), "171," Bioconjugate technologies, "Mass. (second edition, greg T. Hermanson, elsevier press, 2008).

Further, in the above preparation method, the buffer solution comprises Tris-HCl (pH 7-7.5) and MgCl as basic components ₂ 、NaCl。

Further, in the steps (2), (3) and (5), different components are added to prepare an incubation system, and then incubation is performed under appropriate conditions. The incubation can be performed in containers such as 24-well plate wells, 24-well filter plate wells, 96-well filter plate wells, 384-well filter plate wells, centrifuge tubes, EP tubes, and the like, and the containers used for each incubation can be the same or different. The total volume of the incubation system is 10. Mu.l-10 ml, preferably 10. Mu.l-1000. Mu.l, for each incubation. The incubation system refers to a mixture formed by mixing various components as required for each incubation. At each incubation time, the final concentration of microspheres in the incubation system was 5X 10 ² Per ml to 2.5X 10 ⁸ Nucleic acid polymerase at a final concentration of 2-480 units/ml, ribose 3'-OH protected dNTP at a final concentration of 0.1-50. Mu. Mol/L, fluorescently labeled ddNTP at a final concentration of 0.1-50. Mu. Mol/L, and ribose 3' -OH protected fluorescently labeled dNTP at a final concentration of 0.1-50. Mu. Mol/L. Ribose 3' -OH protected dntps are: ribose 3 '-OH-protected dATP, ribose 3' -OH-protected dTTP/dUTP (dTTP/dUTP means dTTP or dUTP, the same applies hereinafter), a mixture of ribose 3 '-OH-protected dGTP and ribose 3' -OH-protected dCTP, and the final concentration of any one of ribose 3 '-OH-protected dATP, ribose 3' -OH-protected dTTP/dUTP, ribose 3 '-OH-protected dGTP and ribose 3' -OH-protected dCTP is 0.1 to 50. Mu. Mol/L. The fluorescence labeling ddNTP is any one or more of fluorescence labeling ddATP, fluorescence labeling ddTTP/ddUTP, fluorescence labeling ddGTP and fluorescence labeling ddCTP, and the final concentration of any one (if added) of the fluorescence labeling ddATP, the fluorescence labeling ddTTP/ddUTP, the fluorescence labeling ddGTP and the fluorescence labeling ddCTP is 0.1-50 mu mol/L. Ribose 3' -OH is protectedThe fluorescently labeled dNTPs of (1) are any one or more of ribose 3'-OH protected fluorescently labeled dATP, ribose 3' -OH protected fluorescently labeled dTTP/dUTP, ribose 3'-OH protected fluorescently labeled dGTP and ribose 3' -OH protected fluorescently labeled dCTP, and the final concentration of any one of ribose 3'-OH protected fluorescently labeled dATP, ribose 3' -OH protected fluorescently labeled dTTP/dUTP, ribose 3'-OH protected fluorescently labeled dGTP and ribose 3' -OH protected fluorescently labeled dCTP (if added) is 0.1-50. Mu. Mol/L.

Further, in the above steps (2), (3) and (5), the temperature for each incubation is 20 to 95 ℃, preferably 32 to 70 ℃. The time of each incubation can be selected according to actual needs.

Further, in the step (4), a ribose 3'-OH deprotecting agent is added to the incubated microspheres to deprotect ribose 3' -OH. The ribose 3' -OH deprotecting agent can be purchased from the market. The final concentration of the ribose 3' -OH protective agent is 0.1-10mol/L.

Further, in the above steps (3) and (5), the microspheres are divided into two parts, wherein one part of the microspheres is added with ribose 3'-OH protected dNTP, and the other part of the microspheres is added with fluorescently labeled ddNTP or/and ribose 3' -OH protected fluorescently labeled dNTP. According to the method, the sequencing microspheres with the same group number as the base number of the nucleic acid fragment to be detected can be obtained by continuously repeating the steps (4) and (5) according to the base number of the nucleic acid fragment to be detected, for example, when the base number of the nucleic acid fragment to be detected is n, the steps (4) and (5) are repeated to obtain n groups of sequencing microspheres, the n groups of sequencing microspheres are detected by a flow cytometer, and the sequence of the microsphere groups corresponds to the base arrangement sequence, so that the base sequence of the nucleic acid fragment to be detected can be obtained. When 4 kinds of fluorescence respectively labeled ddATP, ddTTP/ddUTP, ddGTP, ddCTP or/and ribose 3' -OH protected dATP, dTTP/dUTP, dGTP and dCTP are added in the steps (3) and (5), the base sequence of the fragment to be detected can be obtained only by preparing n groups of sequencing microspheres and sequencing the sequencing microspheres, for example, when 4 kinds of fluorescence respectively labeled ddATP, ddTTP/ddUTP, ddGTP and ddCTP are simultaneously added, the base sequence of the nucleic acid fragment can be obtained by preparing n groups of microspheres and detecting. And when 1-2 kinds of fluorescence respectively labeled ddATP, ddTTP/ddUTP, ddGTP, ddCTP or/and ribose 3'-OH protected dATP, dTTP/dUTP, dGTP and dCTP are added in the steps (3) and (5), the base sequence of the whole nucleic acid fragment to be detected cannot be obtained by only the n groups of sequencing microspheres, and the step (7) is required to replace the fluorescence labeled ddNTP or/and the ribose 3' -OH protected fluorescence labeled dNTP, replace the container and repeat the steps (2) - (6) to obtain 4 Xn or 2 Xn groups of sequencing microspheres so as to ensure that all possible bases of all sites can be detected. In a specific embodiment of the present invention, when only 2 kinds of ddntps labeled with fluorescence respectively or 2 kinds of dntps labeled with fluorescence respectively and protected with ribose 3'-OH are added, the obtained n groups of sequencing microspheres can only detect the two specific bases, so in order to obtain the whole base sequence, the fluorescence-labeled ddntps or the ribose 3' -OH-protected dntps need to be replaced, the experiment is repeated to obtain n groups of sequencing microspheres for detecting another two bases, and the microspheres are combined to obtain the whole base sequence.

Further, in the step (7), the number of sequencing repetitions is determined by the number of fluorescently labeled ddNTP and/or ribose 3' -OH protected fluorescently labeled dNTP species added per time, the number of sequencing repetitions is small for a large number of species added per time, and the number of sequencing repetitions is large for a small number of species added per time. When only n groups of sequencing microspheres are prepared and all possible bases are detected at one time, the configuration requirement on the flow cytometer is high, and in order to reduce the cost, the method is suitable for the existing flow cytometer, and 2n groups of sequencing microspheres are preferably prepared. When the 2 n-group microspheres are prepared by adopting the method, any two kinds of fluorescently-labeled ddNTP or ribose 3' -OH protected fluorescently-labeled dNTPs are added in the steps (3) and (5) to obtain n-group microspheres, then the two kinds of fluorescently-labeled ddNTP or ribose 3' -OH protected fluorescently-labeled dNTPs in the steps (3) and (5) are replaced by the other two kinds of fluorescently-labeled ddNTPs or ribose 3' -OH protected fluorescently-labeled dNTPs, a container is replaced, the steps (2) to (6) are repeated to obtain n-group microspheres, and the 2 n-group microspheres are obtained. Compared with the 4n group microspheres, the 2n group microspheres are simple and convenient to operate, and compared with the n group microspheres, the method has low configuration requirements on a flow cytometer and low sequencing cost. The two fluorescently-labeled ddNTPs or the fluorescently-labeled dNTPs with ribose 3' -OH protected added at each time can be combined at will, for example, the fluorescently-labeled ddTTP/ddUTP and ddATP can be added to obtain n groups of microspheres, and then the microspheres are replaced by the fluorescently-labeled ddGTP and ddCTP to obtain n groups of microspheres; or adding the fluorescence labeled ddTTP/ddUTP and ddGTP to obtain n groups of microspheres, and replacing the microspheres with fluorescence labeled ddATP and ddCTP to obtain n groups of microspheres; or adding the fluorescence labeled ddTTP/ddUTP and ddCTP to obtain n groups of microspheres, and replacing the microspheres with fluorescence labeled ddATP and ddGTP to obtain n groups of microspheres, and the like.

Furthermore, the invention provides a specific method for single-base continuous extension flow-type targeted sequencing, which comprises the following steps:

(2) Adding a coating microsphere, a single-stranded nucleotide fragment containing a complementary sequence of the nucleic acid fragment to be detected or a modified unidirectional primer and a buffer solution for guiding the synthesis of the nucleic acid fragment to be detected into the container I, uniformly mixing, and carrying out incubation hybridization;

(3) Washing and suspending the microspheres by using a buffer solution, keeping part of the microspheres in a container I, transferring the other part of the microspheres from the container I to a container II, and adding dNTP protected by ribose 3' -OH, nucleic acid polymerase and the buffer solution into the container I for incubation; adding one or a combination of the fluorescence labeled ddNTP and the ribose 3' -OH protected fluorescence labeled dNTP, nucleic acid polymerase and buffer solution into a container II for incubation (preferably, the final volume of liquid in each container is 10 mu l to 10ml, mixing uniformly, and incubating at 20 ℃ to 95 ℃);

(4) Washing microspheres in a container I, adding a ribose 3' -OH protective agent into the container I, and mixing uniformly;

(5) Washing and suspending the microspheres in the container I by using a buffer solution, wherein part of the microspheres are remained in the container I, the rest microspheres are moved into a container III from the container I, and dNTP protected by ribose 3' -OH, nucleic acid polymerase and the buffer solution are added into the container I for incubation; adding one or a combination of the fluorescence labeled ddNTP and the ribose 3' -OH protected fluorescence labeled dNTP, nucleic acid polymerase and buffer solution into a container III for incubation (preferably, the final volume of liquid in each container is 10 mu l to 10ml, mixing uniformly, and incubating at 20 ℃ to 95 ℃);

(6) Continuously repeating the operations from (4) to (5), and continuously preparing microspheres with n containers for sequencing the n bases of the nucleic acid fragment; (the microspheres are microspheres incubated with fluorescently labeled ddNTPs or/and ribose 3' -OH protected fluorescently labeled dNTPs added);

(7) If all bases cannot be detected by using the n containers of microspheres, replacing the fluorescently-labeled ddNTP or/and ribose 3' -OH protected fluorescently-labeled dNTP in the steps (3) and (5), replacing the containers, and repeating the steps (2) to (6) to obtain 4 xn or 2 xn containers of microspheres, wherein the microspheres in all the containers are sequencing microspheres;

(8) And (3) washing and suspending the 4 xn or 2 xn or n groups of microspheres obtained in the steps (6) and (7), and further detecting by a flow cytometer to obtain the base sequence of the nucleic acid fragment to be detected.

Further, the invention also provides a preferred single-base continuous extension flow-type target sequencing method, which comprises the following steps:

(2) Adding the coated microspheres obtained in the step (1), a single-stranded nucleotide fragment containing a complementary sequence of a nucleic acid fragment to be detected or a modified unidirectional primer and a buffer solution for guiding the synthesis of the nucleic acid fragment to be detected into a container I, uniformly mixing, and carrying out incubation hybridization;

(3) Washing and suspending the microspheres by using a buffer solution, keeping part of the microspheres in a container I, transferring the other part of the microspheres from the container I to a container II, and adding nucleic acid polymerase, the buffer solution and ribose 3' -OH protected dNTP into the container I for incubation; adding nucleic acid polymerase, buffer solution, two kinds of fluorescence-labeled ddNTP or two kinds of fluorescence-labeled dNTP with ribose 3' -OH protected into a container II, and incubating, wherein the sequencing microsphere obtained in the container II is marked as A1; the ribose 3' -OH protected dNTP is dATP with ribose 3' -OH protected, dTTP/dUTP with ribose 3' -OH protected, dGTP with ribose 3' -OH protected and dCTP with ribose 3' -OH protected; preferably, the final volume of the reaction in each container is 10 mu l to 10ml, the mixture is mixed evenly and incubated at the temperature of 20 ℃ to 95 ℃;

(4) Washing microspheres in a container I, adding a ribose 3' -OH deprotecting agent into the container I, and uniformly mixing;

(5) Washing and suspending the microspheres in the container I by using a buffer solution, wherein part of the microspheres are remained in the container I, the other part of the microspheres are moved into a container III from the container I, and nucleic acid polymerase, the buffer solution and ribose 3' -OH protected dNTP are added into the container I for incubation; adding nucleic acid polymerase, buffer solution, two kinds of fluorescence-labeled ddNTP or two kinds of fluorescence-labeled dNTP with ribose 3' -OH protected into a container III, and incubating, wherein the sequencing microsphere obtained in the container III is marked as A2; the ribose 3' -OH protected dNTP is ribose 3' -OH protected dATP, ribose 3' -OH protected dTTP/dUTP, ribose 3' -OH protected dGTP and ribose 3' -OH protected dCTP; preferably, the final volume of the reaction in each container is 10 mu l to 10ml, the mixture is mixed evenly and incubated at the temperature of 20 ℃ to 95 ℃;

(6) Continuously repeating the steps similar to (4) and (5) to obtain n groups of sequencing microspheres added with fluorescence-labeled ddNTP or ribose 3' -OH protected fluorescence-labeled dNTP for incubation, wherein the last group of sequencing microspheres is marked as An, and n is the number of basic groups of the nucleic acid fragment to be detected;

(7) Adding the coated microspheres obtained in the step (1), a single-stranded nucleotide fragment containing a complementary sequence of the nucleic acid fragment to be detected or a modified unidirectional primer and a buffer solution for guiding the synthesis of the nucleic acid fragment to be detected into the container (1), uniformly mixing, and carrying out incubation hybridization;

(8) Washing and suspending the microspheres by using a buffer solution, transferring the retained part of microspheres in a container (1), transferring the other part of microspheres from the container (1) to a container (2), adding nucleic acid polymerase, the buffer solution and ribose 3' -OH protected dNTP into the container (1), and incubating; adding nucleic acid polymerase, buffer solution, another two kinds of fluorescence labeled ddNTP different from the step (3) or another two kinds of fluorescence labeled dNTP protected by ribose 3' -OH different from the step (3) into a container (2), and incubating, wherein the sequencing microsphere obtained in the container (2) is marked as B1; the ribose 3' -OH protected dNTP is ribose 3' -OH protected dATP, ribose 3' -OH protected dTTP/dUTP, ribose 3' -OH protected dGTP and ribose 3' -OH protected dCTP; preferably, the final volume of the reaction in each container is 10 mu l to 10ml, the mixture is mixed evenly and incubated at the temperature of 20 ℃ to 95 ℃;

(9) After the microspheres in the container (1) are washed, adding a ribose 3' -OH deprotecting agent into the container (1), and uniformly mixing;

(10) Washing and suspending the microspheres in the container (1) by using a buffer solution, transferring the remaining part of microspheres in the container (1) and transferring the other part of microspheres from the container (1) to a container (3), and adding nucleic acid polymerase, the buffer solution and dNTP with protected ribose 3' -OH into the container (1) for incubation; adding nucleic acid polymerase, buffer solution, another two kinds of fluorescence labeled ddNTP different from the step (5) or another two kinds of fluorescence labeled dNTP protected by ribose 3' -OH different from the step (5) into a container (3), and incubating, wherein the sequencing microsphere obtained in the container (3) is marked as B2; the ribose 3' -OH protected dNTP is ribose 3' -OH protected dATP, ribose 3' -OH protected dTTP/dUTP, ribose 3' -OH protected dGTP and ribose 3' -OH protected dCTP; preferably, the final volume of the reaction in each container is 10 mu l to 10ml, the mixture is mixed evenly and incubated at the temperature of 20 ℃ to 95 ℃;

(11) Continuously repeating the steps similar to (9) and (10) to obtain n groups of sequencing microspheres added with the fluorescence-labeled ddNTP or the fluorescence-labeled dNTP with protected ribose 3' -OH for incubation, wherein the last group of sequencing microspheres is marked as Bn, and n is the number of bases of the nucleic acid fragment to be detected;

(12) Washing and suspending the microspheres A1-An and B1-Bn, and further detecting by a flow cytometer to obtain the base sequence of the nucleic acid fragment to be detected.

Further, the invention also provides a more preferable single-base continuous extension flow-type target sequencing method, which comprises the following steps:

(1) Coating amino modified unidirectional primers for guiding the synthesis of the nucleic acid fragment to be detected or a single-stranded nucleotide fragment containing the complementary sequence of the nucleic acid fragment to be detected on the surface of a carboxylated polystyrene microsphere with the diameter of 1-10 mu m to obtain a coated microsphere;

(2) Based on a full-automatic pipetting workstation, adding coating microspheres, single-stranded nucleotide fragments containing complementary sequences of nucleic acid fragments to be detected or modified unidirectional primers and buffer solution for guiding the synthesis of the nucleic acid fragments to be detected into holes I of a 96-hole filter plate A, uniformly mixing, and carrying out incubation hybridization;

(3) Washing and suspending the microspheres by using a buffer solution, wherein the retained microspheres are partially placed in a hole I of a 96-hole filter plate A, the other microspheres are moved to a hole I of a 96-hole filter plate B from the hole I of the 96-hole filter plate A, nucleic acid polymerase, buffer solution, dATP protected by ribose 3'-OH, dUTP/dTTP protected by ribose 3' -OH, dGTP protected by ribose 3'-OH and dCTP protected by ribose 3' -OH are continuously added into the hole I of the 96-hole filter plate A, the nucleic acid polymerase, the buffer solution, ddATP marked by fluorescence and ddUTP/ddTTP marked by fluorescence are continuously added into the hole I of the 96-hole filter plate B, the total reaction volumes of the holes I of the 96-hole filter plate A and the 96-hole filter plate B are respectively 10 mu l-1000 mu l, the two holes are uniformly mixed and incubated at 37 ℃ for 60 seconds, and the sequencing microspheres obtained after incubation in the hole I of the 96-hole filter plate B are marked as A1;

(4) Carrying out suction filtration and washing on microspheres in the holes I of the 96-hole filter plate A, adding a ribose 3' -OH deprotecting agent into the holes I of the 96-hole filter plate A, and uniformly mixing;

(5) Washing and suspending microspheres in a hole I of a 96-hole filter plate A by using a buffer solution, wherein a part of microspheres are remained in the hole I of the 96-hole filter plate A, and the other part of microspheres are moved from the hole I of the 96-hole filter plate A to a hole II of a 96-hole filter plate B;

(6) Adding nucleic acid polymerase and buffer solution into the first hole of the 96-hole filter plate A and the second hole of the 96-hole filter plate B, continuously adding dATP with protected ribose 3'-OH, dUTP/ddTTP with protected ribose 3' -OH, dGTP with protected ribose 3'-OH and dCTP with protected ribose 3' -OH into the first hole of the 96-hole filter plate A, continuously adding ddATP with fluorescent label and ddUTP/ddTTP with fluorescent label into the second hole of the 96-hole filter plate B, wherein the total reaction volumes of the first hole of the 96-hole filter plate A and the second hole of the 96-hole filter plate B are 10-1000 mul, uniformly mixing the two holes, and incubating at 37 ℃ for 60 seconds, wherein the sequencing microsphere obtained after incubation in the second hole of the 96-hole filter plate B is marked as A2;

(7) Repeating the operations from (4) to (6) continuously to obtain n groups of sequencing microspheres added with fluorescence labeled ddATP and fluorescence labeled ddUTP/ddTTP for incubation, and marking the last group of sequencing microspheres as An, wherein n is the number of bases of the nucleic acid fragment to be detected;

(8) Replacing the fluorescence-labeled ddATP and the fluorescence-labeled ddUTP/ddTTP in the steps (3) and (6) with fluorescence-labeled ddGTP and fluorescence-labeled ddCTP, repeating the operations from (2) to (7) in a 96-hole filter plate C to obtain n groups of sequencing microspheres added with the fluorescence-labeled ddGTP and the fluorescence-labeled ddCTP for incubation, wherein the first group of sequencing microspheres is marked as B1, and the last group of sequencing microspheres is marked as Bn, wherein n is the base number of the nucleic acid fragment to be detected; the A1-An group microspheres prepared in the step (7) are used for identifying thymine (T) and adenine (A) in a nucleic acid fragment to be detected, and the B1-Bn group microspheres prepared in the step (8) are used for identifying cytosine (C) or guanine (G) in the nucleic acid fragment to be detected;

(9) Washing and suspending the microspheres A1-An and B1-Bn, and further detecting by a flow cytometer to obtain the base sequence of the nucleic acid fragment to be detected.

Furthermore, in the sequencing method, the obtained sequencing microspheres are n groups, or 2n groups, or 4n groups, so that correct bases of each site of the nucleic acid fragment can be detected, the preparation sequence of the sequencing microspheres corresponds to the base arrangement sequence during detection, and the detection results are integrated to obtain the whole base sequence of the nucleic acid fragment.

Further, in the above sequencing method, the nucleic acid fragment is a single-stranded DNA fragment. The nucleic acid fragment may be any biological nucleic acid fragment, and may be human, animal or microbial. The method is simple, accurate in result and easy to read data, and has good application prospects in the fields of gene detection, disease screening, gene-guided targeted drug delivery, single nucleotide polymorphism and the like.

Furthermore, in the sequencing method, a plurality of nucleic acid fragment sequences can be detected in parallel by selecting the coding microspheres and regulating the preparation process of the sequencing microspheres.

The invention establishes a single-base continuous extension flow-type target sequencing method through single-base continuous extension of a primer, can obtain sequencing microspheres by applying the method, and can obtain a base sequence of a nucleic acid fragment to be detected by detecting the sequencing microspheres by a flow cytometer. Compared with the existing sequencing method, the single-base continuous extension flow type target sequencing method for carrying out nucleic acid target sequencing has the obvious advantages of simplicity, accuracy, easiness in reading and the like, is suitable for detecting a nucleic acid base sequence by a flow cytometer, can be widely applied to the nucleic acid sequencing fields of gene detection, microbial detection, genetics, exons, single Nucleotide Polymorphism (SNP), genomics, proteomics and the like, has good application prospects in disease screening, gene-guided target drug delivery and particularly in the tumor companion diagnosis field.

Drawings

FIG. 1 is a flow chart of the single-base continuous extension flow-type target sequencing method of example 1. A. Coating the microspheres with a one-way primer; B. hybridizing a single-stranded nucleotide fragment containing a complementary sequence of the nucleic acid fragment to be detected with a unidirectional primer; C. taking a single-stranded nucleotide fragment containing a complementary sequence of a nucleic acid fragment to be detected as a template, and continuously extending a single fluorescence labeling base from the tail end of a microsphere coating primer under the catalysis of nucleic acid polymerase; D. the microspheres were detected by flow cytometry to identify base sequences.

FIG. 2 is a Sanger sequencing map of a T790M nucleic acid fragment of the EGFR gene, wherein FIG. 2A is a wild type T790M nucleic acid fragment Sanger sequencing map; FIG. 2B is a Sanger sequencing diagram of a mutant T790M nucleic acid fragment.

FIG. 3 is a flow chart showing parallel targeted sequencing of the 1 st base starting from a mixed sample of an EGFR gene exon 21 L858R nucleic acid fragment (wild-type plasmid DNA fragment) and an exon 18 G719X nucleic acid fragment (mixture of wild-type and mutant plasmid fragments), wherein FIG. 3 (i) is the detection result of thymine (T), FIG. 3 (ii) is the detection result of adenine (A), FIG. 3 (iii) is the detection result of cytosine (C), and FIG. 3 (iv) is the detection result of guanine (G); as a result, the base at the 1 st position from exon 21 L858R was thymine (T), and the allelic bases at the 1 st position from exon 18 G719X were adenine (A) and guanine (G).

Detailed Description

The following examples are given to further illustrate the present invention, but not to limit the scope of the invention.

The functionalized polystyrene microspheres used in the examples were obtained from Spherotech, inc., cyanine dye Cy 3-labeled ddATP, cyanine dye Cy 3-labeled ddGTP, cyanine dye Cy 5-labeled ddGTP, FITC-labeled ddUTP, FITC-labeled ddCTP, and ROX-labeled ddCTP, PE, ribose 3 '-OH-protected dNTP, ribose 3' -OH deprotecting agent, sequenase, DNA polymerase klenow fragment ThermoFisher Scientific, USA, and the like.

Unless otherwise stated, the following asymmetric PCR products and modified one-way primers were obtained according to the PCR amplification method reported in the prior art or were obtained by the corresponding company.

Example 1 Single-base continuous extension flow-directed sequencing of T790M nucleic acid fragment of EGFR Gene [ FIG. 1]

(1) Searching a base sequence of an EGFR gene T790M fragment from NCBI Genebank, designing a unidirectional primer according to the sequence, and performing amino modification, wherein the amino-modified unidirectional primer is as follows: 5'GGAAGCCTACGTGATGG CCA3', coating the amino modified unidirectional primer on the surface of carboxylated polystyrene microspheres with the diameter of 7 mu m;

(2) Based on a full-automatic pipetting workstation, adding 4 multiplied by 10 into a hole I of a 96-hole filter plate A ⁵ Carrying out incubation hybridization on microspheres coated by each primer, T790M fragment (wild type/mutant type plasmid mixture) asymmetric PCR products and buffer solution at the temperature of 2min 65 ℃ and naturally cooling for 45 minutes; washing and suspending the microspheres with a buffer solution, sucking 4000 microspheres in a well I of a 96-well filter plate A into a well I of a 96-well filter plate B, continuously adding 10 units of DNA polymerase Sequenase, the buffer solution, 10 mu M of dATP protected by ribose 3'-OH, 10 mu M of dUTP protected by ribose 3' -OH, 10 mu M of dGTP protected by ribose 3'-OH and 10 mu M of dCTP protected by ribose 3' -OH into the well I of the 96-well filter plate A, continuously adding 10 units of DNA polymerase Sequenase, the buffer solution, 0.5 mu M of ddATP marked by cyanine dye Cy3 and 0.5 mu M of ddUTP marked by FITC into the well I of the 96-well filter plate B, uniformly mixing the mixture, and incubating the mixture at 37 ℃ for 60 seconds;

(3) Carrying out suction filtration and washing on microspheres in the holes I of the 96-hole filter plate A, adding a ribose 3' -OH protective agent into the holes I of the 96-hole filter plate A, and mixing uniformly;

(4) Washing and suspending microspheres in a hole I of a 96-hole filter plate A by buffer solution suction filtration, and sucking 4000 microspheres in the hole I of the 96-hole filter plate A to a hole II of a 96-hole filter plate B;

(5) Adding 10 units of DNA polymerase Sequenase and buffer solution into the first hole of the 96-hole filter plate A and the second hole of the 96-hole filter plate B, continuously adding 10 mu M of ribose 3'-OH protected dATP, 10 mu M of ribose 3' -OH protected dUTP, 10 mu M of ribose 3'-OH protected dGTP and 10 mu M of ribose 3' -OH protected dCTP into the first hole of the 96-hole filter plate A, continuously adding 0.5 mu M of cyanine dye Cy3 labeled ddUTP and 0.5 mu M of FITC labeled ddUTP into the second hole of the 96-hole filter plate B, wherein the final volume of each hole is 10 mu l-1000 mu l, uniformly mixing, and incubating for 60 seconds at 37 ℃;

(6) Washing microspheres in a well I of a 96-well filter plate A, adding a ribose 3' -OH deprotecting agent, dividing the microspheres into two wells after washing, adding 10 units of DNA polymerase Sequenase into the well I of the 96-well filter plate A, a buffer solution, 10. Mu.M of dATP with ribose 3' -OH protected, 10. Mu.M dUTP with ribose 3' -OH protected, 10. Mu.M dGTP with ribose 3' -OH protected, 10. Mu.M dCTP with ribose 3' -OH protected, 10 units of DNA polymerase Sequenase into a well III of the 96-well filter plate B, a buffer solution, 0.5. Mu.M of cyanine dye Cy3 labeled ddATP, and 0.5. Mu.M FITC labeled dCUTP, repeating the steps (3) to (5), and continuously preparing 76-well microspheres in the 96-well filter plate B;

(7) By replacing "0.5. Mu.M cyanine dye Cy 3-labeled ddATP and 0.5. Mu.M FITC-labeled ddUTP" in the above-mentioned (2), (5) and (6) with "0.5. Mu.M cyanine dye Cy 3-labeled ddGTP and 0.5. Mu.M FITC-labeled ddCTP", similar operations were repeated in the 96-well filter plate C according to the procedures of (2) to (6), and 76-well microspheres were prepared continuously.

(8) And (4) carrying out suction filtration and washing on the 76-hole microspheres prepared in the step (6) and the 76-hole microspheres prepared in the step (7), and respectively loading the microspheres and the 76-hole microspheres to a flow cytometer for detection.

Since the DNA fragment does not contain uracil (U), when the detection result shows that uracil is uracil, the base is thymine (T). The 76-well microspheres in the 96-well filter plate B prepared in (6) above were used for sequencing of thymine (T) and adenine (A) in the T790M fragment, and the 76-well microspheres in the 96-well filter plate C prepared in (7) above were used for sequencing of cytosine (C) and guanine (G) in the T790M fragment.

All the examination results were integrated to obtain the sequencing results of the T790M nucleic acid fragment: the result of the simultaneous occurrence of C and T in the 67 th base of GCGTG GACAA CCCCCCTG ACGTG TGCCG CCTGC TGGGC ATCTG CCTCC ACCGTT GCAGC TCATC AC (C → T, T790M) GCA GCTCA T shows that wild type and mutant type exist in the nucleic acid fragment. The detection result is consistent with a sample Sanger sequencing method, and as can be seen from FIG. 2A, the target base of the wild type T790M plasmid DNA fragment is C (in a bar frame); as can be seen in FIG. 2B, the target base of the mutant T790M plasmid DNA fragment is T (bar box).

Example 2 Single-base continuous extension flow-based Targeted sequencing of the T790M nucleic acid fragment of the EGFR Gene

(1) Finding out a base sequence of an EGFR gene T790M from NCBI Genebank, artificially synthesizing wild type/mutant plasmids according to the sequence, taking the plasmids as a template, synthesizing a single-stranded DNA fragment containing a T790M target fragment complementary sequence by asymmetric PCR, designing a one-way primer according to the single-stranded DNA fragment, and coating the single-stranded DNA fragment on the surface of a dimethylamine modified polystyrene microsphere with the diameter of 5 mu M to obtain a coated microsphere;

(2) Based on a full-automatic pipetting workstation, 4 multiplied by 10 is added into a hole I of a 96-hole filter plate A ⁵ Carrying out incubation hybridization on the coated microspheres, the one-way primers and the buffer solution at 2min and 65 ℃ and naturally cooling for 45 minutes; washing and suspending the microspheres with a buffer solution, and pipetting 4000 microspheres from well I of a 96-well filter plate A into well I of a 96-well filter plate B, adding 100 units of DNA polymerase Sequenase, the buffer solution, 20. Mu.M of dATP protected by ribose 3'-OH, 20. Mu.M of dUTP protected by ribose 3' -OH, 20. Mu.M of dGTP protected by ribose 3'-OH, 20. Mu.M of dCTP protected by ribose 3' -OH, adding 100 units of DNA polymerase Sequenase, the buffer solution, 2. Mu.M of ddATP labeled with cyanine dye Cy3, 2. Mu.M of ddUTP labeled with FITC, 2. Mu.M of ddGTP labeled with cyanine dye Cy5, 2. Mu.M of ROXLabeled ddCTP, the final volume of each hole is 10-1000 mul, the mixture is mixed evenly and incubated for 60 seconds at 37 ℃;

(3) Carrying out suction filtration and washing on microspheres in the holes I of the 96-hole filter plate A, adding a ribose 3' -OH deprotecting agent into the holes I of the 96-hole filter plate A, and uniformly mixing;

(4) Washing and suspending microspheres in the hole I of the 96-hole filter plate A by buffer solution suction filtration, and sucking 4000 microspheres in the hole I of the 96-hole filter plate A to the hole II of the 96-hole filter plate B;

(5) Adding 100 units of DNA polymerase Sequenase and buffer solution into the first hole of the 96-hole filter plate A and the second hole of the 96-hole filter plate B, continuously adding 20 mu M of dATP protected by ribose 3'-OH, 20 mu M of dUTP protected by ribose 3' -OH, 20 mu M of dGTP protected by ribose 3'-OH and 20 mu M of dCTP protected by ribose 3' -OH into the first hole of the 96-hole filter plate A, continuously adding 2 mu M of ddATP marked by cyanine dye Cy3, 2 mu M of ddUTP marked by FITC, 2 mu M of ddGTP marked by cyanine dye Cy5 and 2 mu M of ddCTP marked by ROX into the second hole of the 96-hole filter plate B, wherein the final volume of each hole is 10 mu l-1000 mu l, uniformly mixing, and incubating for 60 seconds at 37 ℃;

(6) Washing the microspheres in the wells I of the 96-well filter plate A, adding a ribose 3' -OH deprotecting agent, dividing the washed microspheres into two wells after washing, adding 100 units of DNA polymerase Sequenase to the wells I of the 96-well filter plate A, a buffer solution, 20. Mu.M of dATP protected by ribose 3' -OH, 20. Mu.M of dUTP protected by ribose 3' -OH, 20. Mu.M of dGTP protected by ribose 3' -OH, 20. Mu.M of dCTP protected by ribose 3' -OH, adding 100 units of DNA polymerase Sequenase to the wells III of the 96-well filter plate B, a buffer solution, 2. Mu.M of cyanine dye Cy 3-labeled ddATP, 2. Mu.M FITC-labeled ddUTP, 2. Mu.M of cyanine dye Cy 5-labeled ddGTP, 2. Mu.M ROX-labeled ddCTP, repeating the steps (3) - (5), and preparing 76-well microspheres in the 96-well filter plate B successively;

(7) And (4) washing the 76-hole microspheres in the 96-hole filter plate B prepared in the step (6), and detecting by using a sample flow cytometer to obtain a detection result at one time.

The data analysis shows that the sequencing result of the T790M nucleic acid fragment is as follows: GCGTG GACAA CCCCCCCC ACGTG TGCCG CCTGC TGGGC ATCTG CCTCC ACCGTT GCAGC TCATC AC (C → T, T790M) GCA GCTCA T, wherein the result that C and T simultaneously appear at the 67 th base indicates that wild type and mutant type simultaneously exist in the nucleic acid fragment.

The sequencing result of the EGFR gene T790M nucleic acid fragment sample by the Sanger method is consistent with that of the invention.

Example 3 Single-base continuous extension flow-type targeted sequencing of EGFR gene exon 21 L858R and exon 18 G719X point mutation

(1) Finding out base sequences of EGFR genes containing exon 21 L858R and exon 18 G719X targets from NCBI Genebank, respectively designing unidirectional primers according to the two sequences, and performing biotin modification at the tail ends of the unidirectional primers, wherein the biotin-modified exon 21 L858R unidirectional primers are as follows: 5 'TGTCAAGATCACAGATTTTTTGGGC3'; the biotin-modified exon 18 G719X unidirectional primer is as follows: 5'CTGAATTCAAAAAGATCAAAGTGCTG3', coating the surface of two streptavidin-modified clusters of polystyrene microspheres encoded by PE-Cy5 with a diameter of about 3 μm with two biotin-modified one-way primers respectively;

(2) Based on a full-automatic pipetting workstation, 20000 exon 21 L858R primer-coated microspheres, 20000 exon 18 G719X primer-coated microspheres, two asymmetric PCR products of mixed samples of exon 21 L858R fragments (wild-type plasmid fragments) and exon 18 G719X fragments (mixture of wild-type/mutant-type plasmid fragments) and buffer solution are added into a hole I of a 96-hole filter plate A, and incubation hybridization is carried out at 2min 65 ℃ for 45 minutes after natural cooling; washing and suspending the microspheres with a buffer solution, sucking 2000 microspheres in a well I of a 96-well filter plate A into a well I of a 96-well filter plate B, continuously adding 50units of DNA polymerase klenow fragment, the buffer solution, 5 mu M of dATP protected by ribose 3'-OH, 5 mu M of dUTP protected by ribose 3' -OH, 5 mu M of dGTP protected by ribose 3'-OH and 5 mu M of dCTP protected by ribose 3' -OH in the well I of the 96-well filter plate A, continuously adding 50units of DNA polymerase klenow fragment, the buffer solution, 5 mu M of ddATP marked by cyanine dye Cy3 and 5 mu M of ddUTP marked by FITC in the well I of the 96-well filter plate B, mixing the mixture, and incubating the mixture for 15 minutes at 37 ℃;

(4) Washing and suspending microspheres in the hole I of the 96-hole filter plate A by buffer solution suction filtration, and sucking 2000 microspheres in the hole I of the 96-hole filter plate A to the hole II of the 96-hole filter plate B;

(5) Adding 50units of DNA polymerase klenow fragment and buffer solution into the first hole of the 96-hole filter plate A and the second hole of the 96-hole filter plate B, continuously adding 5 mu M of dATP with ribose 3'-OH protected, 5 mu M dUTP with ribose 3' -OH protected, 5 mu M dGTP with ribose 3'-OH protected and 5 mu M dCTP with ribose 3' -OH protected into the first hole of the 96-hole filter plate A, continuously adding 5 mu M cyanine dye Cy3 labeled ddATP and 5 mu M FITC labeled ddUTP into the second hole of the 96-hole filter plate B, wherein the final volume of each hole is 10 mu l-1000 mu l, mixing uniformly, and incubating for 15 minutes at 37 ℃;

(6) Washing microspheres in a well I of a 96-well filter plate A, adding a ribose 3' -OH deprotecting agent, dividing the microspheres into two wells after washing, adding 50units of DNA polymerase klenow fragment, buffer solution, 5. Mu.M of dATP with ribose 3' -OH protected, 5. Mu.M of dUTP with ribose 3' -OH protected, 5. Mu.M of dGTP with ribose 3' -OH protected, 5. Mu.M of dCTP with ribose 3' -OH protected, 50units of DNA polymerase klenow fragment, buffer solution, 5. Mu.M of ddATP with cyanine dye Cy3 labeled and 5. Mu.M of ddUTP with FITC labeled into a well I of a 96-well filter plate A, adding 50units of DNA polymerase klenow fragment, buffer solution, 5. Mu.M of ddATP with cyanine dye Cy3 labeled and 5. Mu.M of ddUTP labeled according to the operations of the steps (3) to (5), and continuously preparing 10-well microspheres in the 96-well filter plate B;

(7) The "5. Mu.M cyanine dye Cy 3-labeled ddATP, 5. Mu.M FITC-labeled ddUTP" in the above (2), (5), (6) was replaced with "5. Mu.M cyanine dye Cy 3-labeled ddGTP, 5. Mu.M FITC-labeled ddCTP", and similar operations were repeated in 96-well filter plates C according to the procedures of (2) to (6), to prepare 10-well microspheres successively.

The 10-well microspheres in the 96-well filter plate B prepared in (6) above were used for parallel sequencing of thymine (T) and adenine (A) in the exon 21 L858R and exon 18 G719X fragments, and the 10-well microspheres in the 96-well filter plate C prepared in (7) above were used for parallel sequencing of cytosine (C) and guanine (G) in the exon 21 L858R and exon 18 G719X mutant fragments.

All flow cytometry examination results were integrated to give the sequencing results for the exon 21 L858R nucleic acid fragment as: TGGCCAAACT; the sequencing result of the exon 18 G719X nucleic acid fragment is as follows: g (G → A, G719X) GCTC CGGTG. The detection result of the first base of the two nucleic acid segments is shown in figure 3, the initial first base of the exon 21 L858R nucleic acid segment is T, and no mutation exists; and the first base in the exon 18 G719X fragment appears G and A at the same time, which indicates that the wild type and the mutant type exist in the nucleic acid fragment at the same time.

The result of the Sanger sequencing method of the EGFR gene nucleic acid fragment sample is consistent with the sequencing result of the invention.

Example 4

The EGFR gene T790M nucleic acid fragment was sequenced according to the method of example 1, except that: in each incubation system, the final concentration of the nucleic acid polymerase was 200 units/ml, the final concentration of each fluorescently labeled ddNTP was 10. Mu. Mol/L, and the final concentration of each ribose 3' -OH protected dNTP was 10. Mu. Mol/L. The results were the same as in example 1.

Example 5

The EGFR gene T790M nucleic acid fragment was sequenced according to the method of example 1, except that: in each incubation system, the final concentration of the nucleic acid polymerase is 2 units/ml, the final concentration of each fluorescently-labeled ddNTP is 50 mu mol/L, the final concentration of each ribose 3' -OH protected dNTP is 50 mu mol/L, and the incubation time is prolonged. The test results were the same as in example 1.

Claims

1. The single-base continuous extension flow type target sequencing method is characterized by comprising the following steps:

(2) Mixing the coated microspheres, the single-stranded nucleotide fragment containing the complementary sequence of the nucleic acid fragment to be detected or the modified unidirectional primer for guiding the synthesis of the nucleic acid fragment to be detected and a buffer solution, and carrying out incubation hybridization on the obtained mixture;

(3) Washing and suspending the microspheres by buffer solution, dividing the microspheres into two parts, mixing one part of microspheres with nucleic acid polymerase, buffer solution and dNTP with protected ribose 3' -OH, and incubating the obtained mixture; mixing the other microsphere with nucleic acid polymerase, buffer solution, fluorescence-labeled ddNTP or/and ribose 3' -OH protected fluorescence-labeled dNTP, and incubating the obtained mixture;

(4) Washing the microsphere incubated after mixing the previous step with the dNTP with protected ribose 3'-OH, adding a ribose 3' -OH deprotecting agent, and uniformly mixing;

(5) Washing and suspending the microspheres in the previous step by using a buffer solution, dividing the microspheres into two parts, mixing one part of microspheres with nucleic acid polymerase, the buffer solution and the dNTP with protected ribose 3' -OH, and incubating the obtained mixture; mixing the other microsphere with nucleic acid polymerase, buffer solution, fluorescently-labeled ddNTP or/and fluorescently-labeled dNTP with ribose 3' -OH protected, and incubating the obtained mixture;

(7) If all bases cannot be detected by using the n groups of microspheres in the step (6), replacing the fluorescently-labeled ddNTP or/and ribose 3' -OH protected fluorescently-labeled dNTP in the steps (3) and (5), replacing the container, and continuously preparing the microspheres by using the steps (2) to (6) to obtain 4 Xn or 2 Xn groups of microspheres;

(8) Washing and suspending the 4 xn or 2 xn or n groups of microspheres obtained in the steps (6) and (7), and detecting by using a flow cytometer to obtain a base sequence of the nucleic acid fragment to be detected;

the fluorescence-labeled ddNTP is at least one of fluorescence-labeled ddATP, ddGTP, ddCTP and ddUTP/ddTTP;

the ribose 3'-OH protected fluorescently labeled dNTP is at least one of ribose 3' -OH protected fluorescently labeled dATP, dGTP, dCTP and dUTP/dTTP;

the ribose 3'-OH protected dNTP is a mixture of ribose 3' -OH protected dATP, dTTP/dUTP, dGTP and dCTP;

when the microspheres are coated with modified unidirectional primers for guiding the synthesis of the nucleic acid fragments to be detected, adding single-stranded nucleotide fragments containing complementary sequences of the nucleic acid fragments to be detected in the step (2); when the microsphere is coated with a single-stranded nucleotide fragment containing a complementary sequence of the nucleic acid fragment to be detected, a modified unidirectional primer for guiding the synthesis of the nucleic acid fragment to be detected is added in the step (2).

2. The method of claim 1, further comprising: the fluorescently labeled ddNTP or ribose 3' -OH protected fluorescently labeled dNTP is labeled with any one or more of the following fluorescent substances: fluorescein isothiocyanate, alexa Fluor 610, alexa Fluor 488, alexa Fluor 633, alexa Fluor 647, alexa Fluor 700, cyanine dye Cy5, texas Red, cyanine dye Cy3, cyanine dye Cy7, hydroxyfluorescein, lucifer yellow, cyanine dye Cy5.5, rhodamine 110, ROX, rhodamine 6G, TAMRA.

3. A method according to claim 1 or 2, characterized by: adding any two fluorescence-labeled ddNTPs or ribose 3' -OH protected fluorescence-labeled dNTPs in steps (3) and (5) to obtain n groups of microspheres, then replacing the two fluorescence-labeled ddNTPs or ribose 3' -OH protected fluorescence-labeled dNTPs in steps (3) and (5) with the other two fluorescence-labeled ddNTPs or ribose 3' -OH protected fluorescence-labeled dNTPs, replacing containers, and adopting steps (2) - (6) to obtain n groups of microspheres to obtain 2n groups of microspheres.

4. The method of claim 1, including the steps of:

(3) Washing and suspending the microspheres by using a buffer solution, keeping part of the microspheres in a container I, transferring the other part of the microspheres from the container I to a container II, and adding nucleic acid polymerase, the buffer solution and ribose 3' -OH protected dNTP into the container I for incubation; adding nucleic acid polymerase, buffer solution, two kinds of fluorescence-labeled ddNTP or two kinds of fluorescence-labeled dNTP with ribose 3' -OH protected into a container II, and incubating, wherein the sequencing microsphere obtained in the container II is marked as A1; the ribose 3' -OH protected dNTP is ribose 3' -OH protected dATP, ribose 3' -OH protected dTTP/dUTP, ribose 3' -OH protected dGTP and ribose 3' -OH protected dCTP;

(4) After the microspheres in the container I are washed, adding a ribose 3' -OH deprotecting agent into the container I, and uniformly mixing;

(5) Washing and suspending the microspheres in the container I by using a buffer solution, wherein part of the microspheres are remained in the container I, the other part of the microspheres are moved into a container III from the container I, and nucleic acid polymerase, the buffer solution and ribose 3' -OH protected dNTP are added into the container I for incubation; adding nucleic acid polymerase, buffer solution, two fluorescence-labeled ddNTPs or two fluorescence-labeled dNTPs with protected ribose 3' -OH into a container III, and incubating, wherein the sequencing microsphere obtained in the container III is marked as A2; the ribose 3' -OH protected dNTP is dATP with ribose 3' -OH protected, dTTP/dUTP with ribose 3' -OH protected, dGTP with ribose 3' -OH protected and dCTP with ribose 3' -OH protected;

(6) Continuously repeating the steps similar to (4) and (5) to obtain n groups of sequencing microspheres added with the fluorescence-labeled ddNTP or the fluorescence-labeled dNTP with protected ribose 3' -OH for incubation, wherein the last group of sequencing microspheres is marked as An, and n is the number of bases of the nucleic acid fragment to be detected;

(7) Adding the coated microspheres obtained in the step (1), a single-stranded nucleotide fragment containing a complementary sequence of a nucleic acid fragment to be detected or a modified unidirectional primer and a buffer solution for guiding the synthesis of the nucleic acid fragment to be detected into a container (1), uniformly mixing, and carrying out incubation hybridization;

(8) Washing and suspending the microspheres by using a buffer solution, transferring the retained part of microspheres in a container (1), transferring the other part of microspheres from the container (1) to a container (2), adding nucleic acid polymerase, the buffer solution and ribose 3' -OH protected dNTP into the container (1), and incubating; adding nucleic acid polymerase, buffer solution, another two different fluorescently-labeled ddNTPs (different from those in step (3)) or another two different fluorescently-labeled dNTPs (different from those in step (3)) with ribose 3' -OH protected into a container (2), and incubating, wherein the sequencing microspheres obtained in the container (2) are marked as B1; the ribose 3' -OH protected dNTP is ribose 3' -OH protected dATP, ribose 3' -OH protected dTTP/dUTP, ribose 3' -OH protected dGTP and ribose 3' -OH protected dCTP;

(9) After the microspheres in the container (1) are washed, adding a ribose 3' -OH deprotecting agent into the container (1) and mixing uniformly;

(10) Washing and suspending the microspheres in the container (1) by using a buffer solution, wherein the remaining part of the microspheres are in the container (1), the other part of the microspheres are moved from the container (1) to a new container (3), and nucleic acid polymerase, the buffer solution and ribose 3' -OH protected dNTP are added into the container (1) for incubation; adding nucleic acid polymerase, buffer solution, another two different fluorescently-labeled ddNTPs (in step 5) or another two different fluorescently-labeled dNTPs (in step 5) with protected ribose 3' -OH) into a container (3), and incubating, wherein the sequencing microspheres obtained in the container (3) are marked as B2; the ribose 3' -OH protected dNTP is dATP with ribose 3' -OH protected, dTTP/dUTP with ribose 3' -OH protected, dGTP with ribose 3' -OH protected and dCTP with ribose 3' -OH protected;

(11) Continuously repeating the steps (9) and (10) to obtain n groups of microspheres added with the fluorescence-labeled ddNTP or the fluorescence-labeled dNTP with protected ribose 3' -OH for incubation, wherein the last group of microspheres is marked as Bn, and n is the number of basic groups of the nucleic acid segment to be detected;

5. The method of claim 4, wherein: in steps (3) and (5), the 2 fluorescently labeled ddNTPs are fluorescently labeled ddATP and fluorescently labeled ddTTP/ddUTP, and the 2 ribose 3' -OH protected fluorescently labeled dNTPs are ribose 3' -OH protected fluorescently labeled dATP and ribose 3' -OH protected fluorescently labeled dTTP/dUTP; in steps (8) and (10), the fluorescently labeled ddNTP is fluorescently labeled ddGTP and fluorescently labeled ddCTP, and the ribose 3' -OH-protected fluorescently labeled dNTP is ribose 3' -OH-protected fluorescently labeled dGTP and ribose 3' -OH-protected fluorescently labeled dCTP.

6. The method of claim 1, 2, 4 or 5, wherein: the microspheres are microspheres with uniform size, size-coded microspheres, microspheres without fluorescence or fluorescence-coded microspheres.

7. The method of claim 1, 2, 4 or 5, wherein: the diameter of the microspheres is 0.5-50 μm.

8. The method of claim 7, wherein: the diameter of the microsphere is 1-10 μm.

9. The method of claim 1, 2, 4 or 5, wherein: the microsphere is modified by at least one of carboxyl, amino, hydroxyl, hydrazide group, aldehyde group, chloromethyl, ethylene oxide, antibody, aptamer, streptavidin, poly T, poly A, poly G, poly C, poly U and methylated CpG binding domain protein, dimethylamine and sulfydryl.

10. The method as claimed in claim 9, wherein: the microspheres are carboxylated microspheres.

11. The method of claim 1, 2, 4 or 5, wherein: the nucleic acid fragment to be detected is a single-stranded DNA fragment.

12. The method of claim 1, 2, 4 or 5, wherein: the nucleic acid polymerase is a DNA-dependent DNA polymerase.

13. The method of claim 1, 2, 4 or 5, wherein: the modified unidirectional primer is a unidirectional primer modified by at least one of amino, carboxyl, digoxin, biotin, poly A, poly G, poly C, poly T, poly U and methyl.

14. The method as recited in claim 13, wherein: the modified unidirectional primer is an amino-modified unidirectional primer.

15. The method of claim 1, 2 or 5, wherein: the final concentration of microspheres in the incubation system was 5X 10 for each incubation ² 2.5X 10 cells/ml ⁸ Nucleic acid polymerase at a final concentration of 2-480 units/ml, each fluorescently labeled ddNTP at a final concentration of 0.1-50. Mu. Mol/L, each ribose 3'-OH protected fluorescently labeled dNTP at a final concentration of 0.1-50. Mu. Mol/L, and each ribose 3' -OH protected dNTP at a final concentration of 0.1-50. Mu. Mol/L.

16. The method of claim 1, wherein: the incubation was carried out in the following containers: a 24-well plate well, a 24-well filter plate well, a 96-well filter plate well, a 384-well filter plate well, a centrifuge tube, or an EP tube, with the same or different container used for each incubation.

17. The method of claim 1, further comprising: the temperature for each incubation was 20-95 ℃.

18. The method as recited in claim 17, wherein: the temperature for each incubation was 32-70 ℃.

19. The method of claim 1, further comprising: the total volume of the incubation system was 10. Mu.l-10 ml for each incubation.

20. The method as recited in claim 19, wherein: the total volume of the incubation system was 10. Mu.l-1000. Mu.l for each incubation.