CN1460722A

CN1460722A - Nucleic acid amplification detection method

Info

Publication number: CN1460722A
Application number: CN 03123596
Authority: CN
Inventors: 田敬东; 龚启洪
Original assignee: Individual
Current assignee: Individual
Priority date: 2003-05-19
Filing date: 2003-05-19
Publication date: 2003-12-10
Anticipated expiration: 2023-05-19
Also published as: CN1233847C

Abstract

The nucleic acid amplification detection method includes: adding at least one line probe and at least one ring probe into the detection sample, the mole concentration ratio of both them is 1:100 to 100:1 in which the line probe at least contains (1) 5' end and target nucleic acid matched sequence; (2) 3' end and ring probe matched sequence, the ring probe at least contains (1), sequence matched with target nucleic acid and (2), sequence matched with 3' end of line probe; and (3) filling sequence for regulating total length of ring probe. The invention can implement several operations of nucleic acid hybridization, amplification and detection in same reaction tube, by only using one kind of DNA polymerase and by means of one-step constant temp. reaction. Said invention is applicable to detection of RNA and DNA.

Description

Nucleic acid amplification detection method

Technical Field

The present invention relates to the field of nucleic acid detection, and more particularly to a method for specifically detecting the presence and concentration of a target nucleic acid in a sample in vitro by nucleic acid hybridization and isothermal amplification.

Background

One problem frequently encountered in the medical and biological fields is to confirm the presence or absence of a target nucleic acid corresponding to a certain disease pathogen in a certain sample (e.g., a blood sample for transfusion or a blood or body fluid sample extracted from a patient, etc.) and to determine the concentration of the target nucleic acid. However, when the concentration of the target nucleic acid is below a certain limit or when it is mixed with a plurality of other nucleic acids derived from different sources, the concentration cannot be directly measured by an instrument. One common method for solving such problems is specific nucleic acid amplification, and the object of amplification may be the sequence of the target nucleic acid itself or the sequence of a specific probe recognizing the target nucleic acid. By detecting the amplified nucleic acid product and its concentration, the presence and original concentration of the target nucleic acid in the sample can be indirectly determined.

There are several methods for specific nucleic acid amplification, and they can be classified into two types according to whether they require temperature cycling. One requiring temperature cycling, such as Polymerase Chain Reaction (PCR), Ligase Chain Reaction (LCR); another class of systems does not require temperature cycling and performs amplification at constant temperature, such as transcription-based amplification systems (TAS), self-sustained sequence replication (3 SR), Q.beta.replicase systems, and the like. Although these methods can amplify nucleic acids at high magnification, they have respective disadvantages and limitations in practical clinical tests, such as poor quantification, low multiplex degree (multiplexing), easy product cross-contamination, applicability to detection of only one of DNA or RNA, or requirement of multiple enzymes, multiple steps, etc.; moreover, the temperature cycling method has a significant disadvantage over the isothermal method in that it requires the use of special, expensive temperature cycling equipment. The above reasons affect the clinical application and popularization of these methods. Therefore, it is an urgent need to solve the above-mentioned problems by finding a more ideal method for in vitro amplification and detection of nucleic acids.

A new nucleic acid amplification method with a great development prospect is called Rolling-circle amplification (RCA). Rolling circle amplification is a DNA amplification method in which a primer hybridized with a circular template is continuously extended in a linear manner under a constant temperature condition using a DNA polymerase and a single-stranded circular DNA template. Such amplificationAlso known as Linear Rolling Circle Amplification (LRCA), the amplification product is a very long single-stranded DNA concatemerized from copies of the complementary sequence of the circular template (Fire and Xu, 1995, PNAS Proc. Natl. Acad. Sci. 92: 4641-45; Liu et al.1996 J.Am.chem.Soc. J.Chem.118: 1587-94). The presence of two primers, one complementary to a sequence on the circular template and the second identical to the other fragment of the circular template, results in spontaneous, sequential, bidirectional, multi-branched, strand-displacement reactions, known as hyper branched Rolling-circle amplification (HRCA). HRCA exponentially and continuously amplifies DNA, and can amplify 10 hours in more than one hour^9-12The amplification speed exceeds that of Polymerase Chain Reaction (PCR). The final amplification product was double-stranded DNA whose length increased in integer multiples of the circular template unit (Lizardi et al 1998 Nature Genet. Nature genetics 19: 225-32).

The RCA reaction has the advantages of simplicity, sensitivity, quantification, high complexing degree, no product cross contamination and the like, so the method has great development prospect in the field of molecular detection. However, at the present stage, the application of RCA in vitro nucleic acid detection is limited, mainly for in situ signal amplification and detection of Single-nucleotide polymorphism (SNP) using open-loop probes. When the probe is used for in situ signal amplification, one end of a linear nucleic acid probe is generally used for forming stable hybridization with a target nucleic acid attached to a solid phase carrier, then the probe which is not hybridized is washed away, a circular DNA template is added, and the stable hybridization is formed with the other end of the linear probe to initiate linear rolling circle amplification; the amplified single-stranded DNA product is then hybridized with a labeled probe to directly or indirectly detect the amplified signal. The method has the following disadvantages: 1) only one probe recognizing the target nucleic acid is used, and thus specificity is not high; 2) multiple steps of operation are needed, and the operation is relatively complicated; 3) incomplete washing results in higher background.

Therefore, a more novel and improved design is needed to overcome the defects of the existing method, fully exert the advantages of the rolling circle amplification principle and expand the application range of the rolling circle amplification principle in nucleic acid detection.

Disclosure of Invention

The present invention has been made in view of the above-mentioned problems, and an object of the present invention is to provide a method for rapidly amplifying a target nucleic acid (including DNA and RNA) in a sample solution by a single-step isothermal reaction in the same reaction tube using only one enzyme, so that the concentration of the target nucleic acid can be accurately measured in a short time using an instrument.

Another object of the present invention is to provide a special kit for carrying out the above method.

As a result of intensive studies to achieve the above object, the present inventors have found that the above object can be achieved by changing the conventional rolling circle amplification technique to one in which only one probe is used to hybridize with a target nucleic acid and then the amplification is carried out after washing, to a technique in which one linear probe and one circular probe are used to hybridize with a target nucleic acid fragment while limiting the concentration ratio of the two probes to a certain range and a pair sequence having a certain length therebetween is limited, and have completed the present invention. That is, the technical scheme of the invention is as follows:

1. a method of nucleic acid amplification detection, the method comprising: adding a nucleic acid probe and other known necessary auxiliary components to a sample to be detected, carrying out an amplification reaction at a set temperature, detecting an amplification signal with an instrument during or after the completion of the reaction and quantitatively analyzing the target nucleic acid, judging the presence or absence of the target nucleic acid in the sample based on the result of the analysis and determining the concentration thereof, characterized in that,

the above-mentioned nucleic acid probe is a probe set comprising at least one linear probe and one cyclic probe, wherein the molar concentration ratio of the linear probe to the cyclic probe is in the range of 1: 100 to 100: 1; wherein,

the linear probe comprises at least the following two parts: (1) a sequence at the 5' end that pairs with the target nucleic acid and that is in the range of 15-35 nucleotides in length; (2) a short sequence at the 3' end which is paired with the circular probe and has the length in the range of 2-10 nucleotides; and the interval between the two parts (1) and (2) is in the range of 0 to 5 nucleotides.

The total length of the circular probe is in the range of 35-200 nucleotides, and at least comprises the following 3 parts: (1) a sequence that pairs with a target nucleic acid and is in the range of 15-35 nucleotides in length; (2) a sequence paired with the 3' end of the linear probe, the length of which is in the range of 2-10 nucleotides; (3) a filling sequence for adjusting the total length of the circular probe; and the interval between the two parts (1) and (2) is in the range of 0 to 5 nucleotides.

2. The method according to claim 1, wherein the molar concentration ratio of the linear probe to the cyclic probe is in the range of 1: 10 to 10: 1.

3. The method according to claim 1, wherein the sequence at the 5' end of the linear probe that pairs with the target nucleic acid has a length in the range of 18 to 32 nucleotides.

4. The method according to claim 1, wherein the sequence of the circular probe that is paired with the target nucleic acid is in the range of 18 to 32 nucleotides in length.

5. The method according to claim 1, wherein the linear probe is in any one of the following 3 states: (a) a free state; (b) attaching to a carrier; (c) part is in a free state and part is attached to the carrier; any modified nucleotides or other components may also be included in the composition.

6. The method of claim 1, wherein said set of probes further comprises at least one linear amplification primer having a length in the range of 15-35 nucleotides; all or part of the sequence is identical to a fragment of the stuffer sequence of the circular probe.

7. The method of claim 1, wherein the amplification reaction components comprise a DNA product detection reagent.

8. The method according to claim 1, wherein the method for detecting a signal of nucleic acid amplification by the instrument is any method used for detecting single-stranded or double-stranded DNA.

9. The method according to any one of claims 1 to 8, wherein the entire nucleic acid amplification detection process is carried out in the same reaction vessel.

10. A kit for performing the method of any one of claims 1 to 9, wherein reagents necessary for detecting the type and relative amount of target nucleic acid species that may be present in the sample are contained.

The present invention is described in detail below.

The action mechanism of the method provided by the invention is roughly as follows: after the linear probe and the circular probe are hybridized with the target nucleic acid, the 3' end of the linear probe is used as a primer, the circular probe is used as a template, and linear rolling circle amplification is carried out under the catalysis of DNA polymerase; the chain substitution amplification primer in the reaction solution is continuously hybridized with the single-stranded DNA product generated by rolling circle amplification, and is used as a template to carry out secondary amplification in a chain substitution reaction mode to continuously generate single-stranded DNA with different lengths; the 3' ends of these secondary single-stranded DNA products hybridize with free linear probes in solution and synthesize the final double-stranded DNA product; in this process, the target nucleic acid is continuously detached from the previous set of hybridized linear and circular probes, and then hybridized with a new set of linear and circular probes to cause a new round of amplification, and the process is continuously cycled until the starting material is exhausted (see FIGS. 1-3).

The invention designs a novel probe combination consisting of a linear probe and a ring probe (figure 1). In combination, each portion of the linear and circular probes can be paired with two adjacent (no gap) or adjacent (one to several nucleotides apart) fragments of the target nucleic acid, respectively. Preferably, each partner fragment is generally 15 to 35 nucleotides in length, more preferably 18 to 32 nucleotides in length. The specific length depends on the amplification reaction temperature and the composition of the oligonucleotide, and the dissolving temperature (Tm) of the paired fragments is generally 3-6 ℃ higher than the amplification reaction temperature. The short 3' end segment of the linear probe is not paired with the target nucleic acid; only when the linear probe and the circular probe hybridize simultaneously to the correct sites on the target nucleic acid, the fragment can be paired with the adjacent and corresponding short fragments on the circular probe (see FIG. 1). The appropriate length of the pairing fragment is 2-10 nucleotides, the specific length depends on the nucleotide composition of the fragment, and the selection principle is as follows: in the absence of the target nucleic acid, the fragment is insufficient to hybridize to the circular probe to cause rolling circle replication under the same reaction conditions and temperatures. The two portions of the linear probe are generally not spaced apart, but may be spaced apart by one to several nucleotides or filled with other elements, which may in some cases help to improve the specificity of the reaction. The 5' -end of the linear probe is not particularly limited, and other sequences and modifying groups may be added, or various carriers and surface groups may be linked.

The circular probe in the probe set is roughly composed of three parts: the first portion is paired with a fragment on the target nucleic acid. As mentioned above, the fragment is preferably 15-35 nucleotides in length, more preferably 18-32 nucleotides in length, the specific length depends on the amplification reaction temperature and the oligonucleotide composition, and the dissolution temperature (Tm) of the paired fragments is generally 3-6 ℃ higher than the amplification reaction temperature; the second portion comprises a short segment which can be paired with the 3 'end of the linear probe, preferably a paired short segment of 2-10 nucleotides in length, which portion is generally upstream (5' of) and adjacent to the first portion; the remaining third portion may have a variety of motorized functions, such as: 1) the portion may comprise the same sequence as one or more of the linear primers used for secondary amplification; 2) the portion may comprise a sequence, the corresponding portion of which in the replication product is hybridizable to a labelled probe as a means for detecting the amplification product; 3) this portion may contain sequences for any other purpose, e.g.as a filling, to adjust the overall length of the circular probe, etc., and typically a suitable overall length of the circular probe is in the range of 35-200 nucleotides. Too short to facilitate the rolling circle amplification reaction; too long increases the difficulty and cost of making the ring probe.

The probe set may further comprise one or more synthetic linear primers. The linear primer is used for hybridizing with the pairing sequence on the primary amplification product and performing secondary amplification in a chain replacement reaction mode by taking the linear primer as a template. The preferable length of the linear primer is usually 15-35 nucleotides, more preferably 18-32 nucleotides, and the specific length depends on the amplification reaction temperature and the composition of the oligonucleotide, and the dissolution temperature (Tm) of the paired fragments is usually 3-6 ℃ higher than the amplification reaction temperature.

The main differences between the probe combination provided by the present invention and the primer and circular template pairs used in the general RCA are: 1) both the linear probe and the circular probe of the present invention hybridize to the target nucleic acid; whereas in general RCA, only one of the copy primer and the circular template hybridizes to the target nucleic acid, and the primer and the circular template do not hybridize to the target nucleic acid at the same time; 2) the length of the sequence of the linear probe which is matched with the circular probe at the 3' end is shorter, generally not more than 10 nucleotides, and stable hybridization is not formed when no target nucleic acid exists; the length of the copy primer and the matched fragment on the circular template usually used in RCA is longer than 16 nucleotides, at least not shorter than 10 nucleotides. A stable hybridization can be formed between the two in advance without the aid of a target nucleic acid.

The stability of nucleic acid hybridizations contemplated in the present invention can be calculated by methods published in the literature, such as: lesnick and Freeer, 1995, Biochemistry 34: 10807-10815; McGraw et al, 1990, Biotechniques biotechnology 8: 674-678; rychliket al, 1990 Nucleic Acids res. Nucleic Acids research 18: 6409-6412.

The reaction mechanism and reaction kinetics of the method of the invention are different from those of the HRCA reaction due to the use of the novel probe combination (see FIGS. 2 and 3). The differences in the reaction mechanism are: 1) in the HRCA reaction, the free linear probe can hybridize with the copy of each circular template on the single-stranded DNA product generated by the strand displacement reaction to initiate another strand displacement reaction; in the reaction of the present invention, the linear probe forms a stable hybridization with only the 3' end of the complete single-stranded DNA product generated by the strand displacement reaction, i.e., the self-copy of the linear probe, and synthesizes the final product in the form of double-stranded DNA; 2) in HRCA reactions, each target nucleic acid molecule typically causes only one rolling circle amplification; in the present reaction, each target nucleic acid molecule is cyclically hybridized with a probe pair, a rolling circle amplification reaction is initiated, and then detached, followed by hybridization with a new probe pair (FIG. 3). It can be concluded from the reaction mechanism that the amplification reaction kinetics of the method is more moderate than that of HRCA, and the defect that HRCA is too sensitive can be avoided. In addition, the concentration of the target nucleic acid is in a predictable relationship with the time taken for fluorescence to reach a certain intensity, and thus the method has a great potential for development as a method for quantitative nucleic acid detection.

The linear probe and the linear primer in the present invention may be in one of the following two states or a mixed state of the two states: 1) free, meaning that the linear probes and linear primers are dissolved in solution and may carry any known label or modification; 2) the linear probe or the linear primer is immobilized on a carrier, and one end (most of the 5' -end portion) of the linear probe or the linear primer is directly or indirectly immobilized or attached to the carrier before or after the reaction. Preferably, the immobilization is carried out by immobilizing one end (most of which means the 5 '-end portion) of the probe or the linear primer and allowing the other end (generally, the 3' -end) to extend freely. The carrier may be made of any material, and may be in any shape, such as microbeads, microparticles, micropores, chain polymers, planes (chip surfaces), etc., by any surface treatment.

The linear probes used in the present invention have different characteristics and uses in different states. When in a free state, the probability of hybridization between the probe and the target nucleic acid in the solution is high, so that the detection speed is high and the sensitivity is high. The probe is immobilized on a support, and the target nucleic acid hybridized therewith can be captured and separated from the solution and then amplified. This avoids inhibition of the amplification reaction by certain components in the sample. Meanwhile, the reaction product of the rolling circle amplification may be generated by extension of a probe or primer immobilized on a carrier, and may be immobilized on the carrier in situ. By using this principle, a plurality of different linear probes or primers can be immobilized on a carrier to detect a plurality of target nucleic acids in parallel. The use of a mixed state of the free probe and the immobilized probe on the DNA chip is advantageous for accelerating the amplification reaction and increasing the sensitivity of detection.

Target nucleic acids that can be detected using the methods of the invention include RNA and DNA, either chain or circular, single-or double-stranded, free or immobilized on a carrier. When the target nucleic acid is double-stranded with the hybridized portion of the probe set, the double strand is typically broken into single strands by heating or other melting agent, and then annealed to allow the probe to hybridize to the target nucleic acid.

The DNA polymerase used in the method of the present invention may be selected from a wide variety of enzymes, and in principle any DNA polymerase capable of catalyzing the rolling circle replication of DNA is suitable. These enzymes generally have the following properties: 1) has melting activity; 2) is not easy to fall off from the template DNA; 3) no 5 'to 3' DNA exonuclease activity. Some of the enzymes which meet the above criteria which are suitable for use in the present invention are: klenow fragment of DNA polymerase I, phi-29 DNA polymerase, phage M2 DNA polymerase, phage PRD1 DNA polymerase, BST large fragment DNA polymerase, Vent DNA polymerase, T5 DNA polymerase, T4 DNA polymerase, and mutations or modifications of certain enzymes. More suitable enzymes include: phi-29 DNA polymerase, Vent DNA polymerase and BST DNA polymerase, etc. Wherein Vent DNA polymerase and BST DNA polymerase are thermophilic DNA polymerase, so that the reaction can be carried out at higher temperature, and the detection specificity can be improved.

In addition, the addition of DNA helicase factors to the reaction aids in melting, such as DNA helicase and single stranded DNA attachment proteins.

There are various methods for detecting amplified signals, and basically, methods for detecting single-stranded or double-stranded DNA can be used. For example, but not limited to:

1) the label is incorporated directly into the amplification product using a labeled nucleotide or nucleotide analog in the amplification reaction. The label may be a fluorescent label, a hapten, a radioactive label, or the like. Among the more suitable fluorescent labels are: cyanine Dyes (Cy2, Cy3, Cy3.5, Cy5, Cy5.5, Cy7), Fluorescein (FITC), Rhodamine, Texas red, nitrobenz-2-oxa-1, 3-diazol-4-yl (NBD), coumarins, and dansyl chloride, etc.; more suitable semi-antigens: biotin(biotin), digoxigenin), etc.; suitable radiolabels are:³²P，³³P，³⁵S，¹²⁵i, etc.; suitable nucleotide analogs with a detectable label include BrdUrd and BrUTP.

2) A common feature of fluorescent dyes that are specific for single-stranded or double-stranded DNA is a significant increase in luminescence intensity following chimerization with nucleic acids. The fluorescent dye suitable for detecting the single-stranded DNA product comprises SYBR Green II and the like; as a fluorescent dye for detecting a double-stranded DNA product, SYBR Green I and the like are preferable.

3) The signal generated by the label is detected by hybridizing a nucleic acid probe, to which a label or signal generating substance is attached, to the single-stranded DNA product. The label may be, but is not limited to, a fluorophore, a chromogen, a chemiluminescent group, a hapten, an antibody, an enzyme label, or the like. More commonly used enzymes are labeled with alkaline phosphatase, horseradish peroxidase, and the like.

4) Molecular beacons (Molecular beacons), amplified fluorescent labels (amplifluors), and other various probes designed using Fluorescence quenching or Energy Transfer techniques, such as Fluorescence Resonance Energy Transfer (FRET), Delayed Fluorescence Energy Transfer (DEFRET), and the like, are used.

Suitable detection reagents for simultaneous signal detection and amplification reaction include, but are not limited to: molecular beacons, amplification fluorescent labels, and chimeric fluorescent dyes (e.g., SYBR Green), among others. Other detection methods may be selected and used as desired by a person having ordinary expertise and skills, such as electrophoresis, and the like.

The scope of the present invention also includes various biological detection kits and detection chips designed according to the above principles and having different forms and uses. In these kits, at least the probe set described above in the present specification is used directly or indirectly, the reaction mixture generally contains 4 kinds of deoxyribonucleic acid (dATP, dTTP, dCTP, and dGTP) at equal concentrations, a pH buffer component, various ions at appropriate concentrations, a nucleic acid detection reagent, and an appropriate nucleic acid extraction method, and the specific formulation can be selected by the user as needed.

Compared with the existing in vitro nucleic acid detection method, the method provided by the invention has the following advantages and beneficial effects:

the invention realizes that only one DNA polymerase is used in the same reaction tube under the condition of constant temperature, and multiple operations such as nucleic acid hybridization, amplification, signal detection and the like are completed through one-step reaction. The entire process can be completed in about one hour without product cross contamination and is equally applicable to the detection of RNA and DNA.

The method of the present invention can amplify the amount of DNA in about one hour by 10¹⁰And the detection sensitivity reaches the single copy level. The reaction kinetics is more moderate than HRCA, and the method is more suitable for quantitative detection.

The double-probe combination provided by the invention has higher specificity than methods such as PCR, RCA and the like in principle and actual effect. The reason is that the probe combination used in the present invention not only uses two probes, but also has strict control over the relative positions at which the two probes hybridize on the target nucleic acid, i.e., the two probes must hybridize at two adjacent or very close positions on the target nucleic acid to cause amplification. When either or both of the probes occasionally non-specifically hybridize to the target nucleic acid, amplification may be disabled due to improper distance. In contrast, RCA has only one probe hybridized to a target nucleic acid, and therefore has a high probability of nonspecific hybridization. In addition, incomplete washing can also lead to false positives. Other RCA formats using DNA ligase can give false positives due to spontaneous ligation independent of the target nucleic acid. Although two primers are used in PCR, amplification reaction may occur when either of the two primers non-specifically hybridizes to a target nucleic acid. The accuracy of actual detection of the method can approach and reach 100%.

The invention can be used for detecting whether the specified nucleic acid sequence exists in various biological samples or not and quantitatively detecting the concentration of the specified nucleic acid sequence, and can be used for rapid gene detection of various types. For example: detecting the presence and concentration of various viruses in serum or other biological samples; rapidly determining the infection source of bacteria, fungi or other microorganisms. The method has wide application in the fields of medical health, quarantine, food, environmental protection, scientific research and the like.

Drawings

FIG. 1 is a schematic diagram showing an example of hybridization between a probe set composed of a linear probe and a circular probe and two adjacent fragments on a target nucleic acid. Wherein the linear probe is composed of at least 2 parts: the 3' end is matched with the circular probe matching part (1), and the length is preferably 2-10 nucleotides; the sequence (2) is preferably paired at the 5' end with the target nucleic acid and has a length of 15 to 35 nucleotides, more preferably 18 to 32 nucleotides. The circular probe consists of three parts: a portion (3) which is paired with a target nucleic acid, preferably 15 to 35 nucleotides in length, more preferably 18 to 32 nucleotides in length; a sequence (4) which is paired with the 3' end of the linear probe, preferably 2 to 10 nucleotides in length; the remaining multifunctional portion (5), for example, may comprise the same sequence as one or more of the amplification primers used for secondary strand displacement.

FIG. 2 shows that when a pair of probes are hybridized to two adjacent sites on a target nucleic acid, respectively, the 3' -end of a linear probe undergoes rolling circle type replication under DNA polymerization catalysis using a circular probe as a template to produce a single-stranded DNA product. The circular probe is separated from the target nucleic acid under the action of DNA polymerase; the single-stranded DNA product resulting from rolling circle replication is hybridized to a secondary strand displacement amplification primer.

FIG. 3 is a schematic diagram showing an example of a reaction process in which a strand displacement amplification primer in a reaction solution is continuously hybridized with a single-stranded DNA product produced by rolling circle amplification and secondary amplification is performed by means of a strand displacement reaction using the same as a template to continuously produce single-stranded DNAs of different lengths; the 3' ends of these secondary single-stranded DNA products hybridize to free linear probes in solution and synthesize the final double-stranded DNA product (process C, D); simultaneously, the target nucleic acid is continuously detached from the previous set of hybridized linear probes and circular probes, and then hybridized with a new set of linear probes and circular probes, resulting in a new round of amplification (process A, B); the above process is repeated continuously until the reaction is terminated or stopped by the exhaustion of the starting material.

FIG. 4 shows that single-stranded DNA produced by rolling circle replication can hybridize to a labeled probe, thereby quantitatively indicating the target nucleic acid concentration.

FIG. 5 shows the results of example 1. 1) Negative control without target nucleic acid; 2) relative fluorescence intensity of the experimental samples.

FIG. 6 shows a 1% DNA electropherogram of the reaction result in example 2. 1) A negative control without target nucleic acid; 2) an experimental sample; m) DNA molecular weight standards.

FIG. 7 shows the results of the experiment in example 3.

FIG. 8 shows the results of the experiment in example 4. 1) Average negative control without target nucleic acid; 2) a hepatitis B virus sequence group; 3) a hepatitis c virus sequence group; 4) human macrophage virus sequence group.

Detailed Description

The invention and its use are further illustrated by the following examples and figures. The particular methods, procedures, reagents, equipment, etc. used in the examples can be suitably varied and substituted as desired, and the examples and figures are not intended to limit the scope of the invention in any way. Example 1 detection of target RNA (hepatitis C Virus RNA sequence) in a sample

This example describes a method for specifically probing a target RNA sequence in solution using the principles and probe combinations described in this patent. In this example, nucleic acid amplification was performed at a constant temperature using BST DNA polymerase, and the concentration of the double-stranded DNA amplification product was detected using SYBR Green I fluorescent dye. The whole process, including isothermal amplification reaction and detection of nucleic acid, is completed in the same tube for about 1 hour.

The total volume of the reaction is 20 microliters, and the reaction solution comprises the following components: 10⁶Copy target RNA, 0.5. mu.M circular probe, 0.5. mu.M linear probe (ratio 1: 1), 0.5. mu.M linear guideSubstance, 20mM Tris-Cl (pH8.8, 25 ℃), 10mM KCl, 10mM (NH)₄)₂SO₄，2mM MgSO₄0.1% Triton X-100, 0.5mM dNTP, 0.5U/. mu.l BST DNA polymerase, SYBR green I (1X). No target nucleic acid was added to the zero control group.

The operation process is as follows: and mixing the probe group and the target nucleic acid solution in the microtube, and putting the microtube into a fluorescence analyzer to read the initial fluorescence intensity, wherein the fluorescence excitation wavelength is 487nm, and the emission wavelength is 525 nm. Then heating at 95 ℃ for 3 minutes, cooling to 65 ℃, adding a proper amount of BST DNA polymerase, and continuously preserving the temperature at 65 ℃ for 60 minutes. After the reaction is finished, the fluorescence intensity after the reaction can be immediately read, and the change of the fluorescence intensity before and after the reaction is calculated. FIG. 5 compares a sample containing 10⁶Relative changes in fluorescence intensity before and after reaction in the experimental group (2) and the zero control group (1) in which the target RNA was copied. The relative change in fluorescence intensity (0.97) in the experimental group was 193 times higher than that in the zero control group (0.005), indicating that this method can amplify the target nucleic acid signal at a high magnification in a short time and can detect it with a common fluorescence detector.

The nucleic acid sequence (5 '- > 3') used in this example is as follows, with specific features in the sequence listing: target nucleic acid RNA sequence: GCCACCAUAGAUCACUCCCCUGUGAGGAACUACUGUCUUCACGCAGAAAGCGUCUAGCCAUGGCGUUAGU (SEQ ID NO: 1) RNA was synthesized by an in vitro reaction using T7 RNA polymerase, the sequence of the DNA template was: CGAAATTAATACGACTCACTATAGGGCCACCATAGATCACTCCCCTGTGAGGAACTACTGTCTTCACGCAGAAAGCGTCTAGCCATGGCGTTAGT (SEQ ID NO: 2) circular probe sequence: GATATACAACCACATCAGCTAGACAGTAGTTCCTCACAGGGGAGTGATATCAGCATAGCAGTAGACTTGCGTACCTAAG (SEQ ID NO: 3) line Probe sequence: TGGCTAGACGCTTTCTGCGTGAATAGCTGAT (SEQ ID NO: 4) amplification primer sequence: TCAGCATAGCAGTAGACTTGCG (SEQ ID NO: 5) EXAMPLE 2 detection of target DNA (human macrophage virus DNA sequence) in a sample

This example describes a method for specifically probing a target DNA sequence in a solution using the principles and probe combinations described in this patent. In this example, nucleic acid amplification was performed at a constant temperature using BST DNA polymerase, and the amplified product was visualized by agarose gel electrophoresis after the reaction.

The operation process is as follows: a total volume of 18 microliters of reaction mixture was added to the microtube, including: 0.5. mu.M circular probe, 0.5. mu.M linear probe (ratio 1: 1), 0.5. mu.M linear primer, 20mM Tris-Cl (pH8.8, 25 ℃), 10mM KCl, 10mM (NH)₄)₂SO₄，2mM MgSO₄0.1% Triton X-100, 0.5mM dNTP, 10 in the experimental group⁴Copying the target DNA; no target nucleic acid was added to the zero control group. Heating at 95 ℃ for 3 minutes, cooling to 65 ℃, then adding 2 microliters (16U) of BST DNA polymerase, and continuing to keep the temperature at 65 ℃ for 60 minutes. After the reaction, 10. mu.l of the reaction solution was analyzed by 1% agarose gel electrophoresis.

As is apparent from the gel electrophoresis pattern shown in FIG. 6, a large amount of double-stranded DNA products were produced in the experimental group (2) after the amplification reaction, the length of which was increased in units of the length of the circular probe to form a DNA "step", which was consistent with the result predicted by the reaction mechanism; in the zero control group (1), no amplification product was detected. M is a DNA molecular weight marker.

The nucleic acid sequence (5 '- > 3') used in this example is as follows, with specific features in the sequence listing: target DNA sequence (taken from human macrophage virus sequence): CCTAATCGCATCCTGCATCAAAGCGTCAATCAGACTTTCGACGTGCGCCAG (SEQ ID NO: 6) circular probe sequence: GATATACAACCACATCAGCTAACGCTTTGATGCAGGATGCGATTTATCAGCATAGCAGTAGACTTGCGTACCTAAG (SEQ ID NO: 7) line Probe sequence: GCGCACGTCGAAAGTCTGATTGATAGCTGAT (SEQ ID NO: 8) amplification primer sequence: TCAGCATAGCAGTAGACTTGCG (SEQ ID NO: 5) example 3 recording of amplification reaction curves with a real-time fluorescent PCR Instrument

Real-time fluorescent PCR instruments are currently used to quantitatively determine the amount of target DNA in a sample. The method provided by the invention does not need temperature cycle, and only uses the rapid fluorescence scanning part of the instrument to record the fluorescence intensity released by the reaction in real time, thereby carrying out relative quantitative detection on the target nucleic acid in the sample.

In this example, the procedure was substantially the same as in example 1, and the isothermal nucleic acid amplification reaction and detection were carried out in the same tube using BST large fragment DNA polymerase and SYBRGREEN I fluorescent dye. The total volume of the reaction solution was 20. mu.l. Multiple reactions can be performed in 8, 12 tube strips or 96 well plates.

Mixing the probe set and target nucleic acid solution in microtube, heating at 95 deg.C for 3 min, cooling to 65 deg.C, adding small amount of mixture of BST DNA polymerase, etc., wherein the total volume of reaction solution is 20. mu.l, the final composition of reaction solution is the same as that in example 1, and the total amount of target DNA is about 10⁵And 10²Another 500ng of human genomic DNA was added as background. In the negative control, only 500ng of human genomic DNA was present, and no target nucleic acid was present. 0.2ml of the PCR tube was placed in a 96-well reaction chamber of ABI 7700(Perkin Elmer) sequence detector and incubated at 65 ℃ for 80 minutes (2 minutes. times.40 cycles). The fluorescence excitation wavelength is 487nm, and the emission wavelength is 525 nm.

FIG. 7 records the curve of the change in fluorescence intensity during the amplification reaction. It can be seen that the larger the amount of target nucleic acid in the reaction, the shorter the time required for fluorescence to occur and reach a certain intensity, and thus can serve as a basis for the relative quantitative detection of nucleic acids. The nucleic acid sequence used in this example was the same as in example 2. Example 4 Simultaneous detection of multiple target nucleic acids in a reaction

This example describes a method for detecting multiple target nucleic acid sequences that may be present in a solution using the principles described in this patent and a variety of different probe combinations. The simultaneous detection of multiple target nucleic acids in the same tube by a single reaction can reduce the amount of nucleic acid sample, reduce the detection cost and increase the detection flux.

In this example, the target nucleic acid sequences to be detected were taken from the genomes of hepatitis B virus, hepatitis C virus and human macrophage virus, respectively. Three different probe sets are correspondingly mixed in the reaction solution, a linear probe in each probe set carries an amplification fluorescent label with different wavelengths, and the fluorescence excitation wavelength (EX)/emission wavelength (EM) are respectively as follows: hepatitis b virus, FAM 495/519 nm; hepatitis c virus, HEX 530/553 nm; human macrophage virus, TAMRA 560/583 nm. After the reaction is completed, the presence and relative concentration of the target nucleic acid can be determined based on the color and intensity of the fluorescence. The reaction amplifies nucleic acids using BST DNA polymerase at a constant temperature. The whole process, including isothermal amplification reaction and detection of nucleic acid, is completed in the same tube for about 1 hour.

The operation process is as follows: mixing the probe group and the target nucleic acid solution in a 96-well plate microtube, putting the microtube into a fluorescence analyzer to read the initial fluorescence value of each wavelength, heating at 95 ℃ for 3 minutes, cooling to 65 ℃, adding a proper amount of BST DNA polymerase, and continuing to preserve heat at 65 ℃ for 75 minutes. And reading the fluorescence value after reaction at each corresponding wavelength immediately after the reaction is finished. The fluorescence change values before and after the reaction were calculated.

The total volume of the reaction is 40 microliters, and the reaction solution comprises the following components: 0 or 10⁶Copy target nucleic acid, 0.5. mu.g human genomic DNA, 0.5. mu.M each circular probe (total 3), 0.5. mu.M each amplified fluorescent linear probe (total 3), 1. mu.M common linear primer, 20mM Tris-Cl (pH8.8, 25 ℃), 10mM KCl, 10mM (NH)₄)₂SO₄，2mM MgSO₄0.1% Triton X-100, 0.5mM dNTP, 0.5U/. mu.l BST DNA polymerase.

As can be seen from FIG. 8, the fluorescence intensity of the experimental groups after amplification was approximately 200 times higher than that of the zero control group. It was demonstrated that by using different probe sets and fluorescent labels, the method of the invention can be used to detect a plurality of different target nucleic acids simultaneously in the same reaction.

The nucleic acid sequence (5 '- > 3') used in this example is as follows, with specific features in the sequence listing: hepatitis b virus target sequence: ACCACATCATCCATATAACTGAAAGCCAGACAGTGGGGGAAAGCCCTACGAACCACTGAACAAATGGCACTAGTAAACTGAGCCA (SEQ ID NO: 9) circular probe sequence: GATATACAACCACATCAGCTAGCTTTCCCCCACTGTCTGGCTTTTATCAGCATAGCAGTAGACTTGCGTACCTAAG (SEQ ID NO: 10) amplified fluorescent marker Probe sequence: 5' FAM-TCGATGACTGACGGTCATCG (DABCYL-dT) ACTAGTGCCATTTGTTCAGTGGTTCGTAGGTAGCTGAT (SEQ ID NO: 11) hepatitis C virus target nucleic acid RNA sequence (SEQ ID NO: 1), circular probe sequence (SEQ ID NO: 3), amplification fluorescent marker linear probe sequence: 5' HEX-TCGATGACTGACGGTCATCG (DABCYL-dT) ACTTGGCTAGACGCTTTCTGCGTGAATAGCTGAT (SEQ ID NO: 12) human macrophage virus target sequence (SEQ ID NO: 6), circular probe sequence (SEQ ID NO: 7) amplification fluorescent marker linear probe sequence: 5' TAMRA-TCGATGACTGACGGTCATCG (DABCYL-dT) ACTGCGCACGTCGAAAGTCTGATTGATAGCTGAT (SEQ ID NO: 13) Universal amplification primer sequence (SEQ ID NO: 5)

Sequence Listing <110> Tanjiandong

Gong flood-opening <120> nucleic acid amplification detection method <130> PFO30007, Deng Dingji, Zhongzi Law Office <140> <141> <160>14<170> Patent In Version 3.1<210>1<211>70<212> RNA <213> hepatitis C virus <223> target RNA <400> SEQUENCE: 1gccaccauag aucacucccc ugugaggaac uacugucuuc acgcagaaag 50cgucuagcca uggcguuagu 70<210>2<211>95<212> DNA <213> recombination SEQUENCE <220> <223> Artificial Synthesis of double stranded DNA template <400> SEQUENCE: 2cgaaattaat acgactcact atagggccac catagatcac tcccctgtga 50ggaactactg tcttcacgca gaaagcgtct agccatggcg ttagt 95<210>3<211>79<212> DNA <213> recombination SEQUENCE <220> <223> circular probe <221> <222> (14) · (21) <223> hybridizing with linear probe fragment <221> <222> (22) · (47) <223> hybridizing with target nucleic acid fragment <221> <222> (49) · (71) <223> SEQUENCE <400> SEQUENCE: 3gatatacaac cacatcagct agacagtagt tcctcacagg ggagtgatat 50cagcatagca gtagacttgc gtacctaag 79<210>4<211>31<212> DNA <213> recombination SEQUENCE <220> <223> linear probe <221> <222> (1) · (23) <223> hybridizing with the target nucleic acid fragment <221> <222> (24) · (31) <223> hybridizing with the circular probe fragment <400> SEQUENCE: 4tggctagacg ctttctgcgt gaatagctga t 31<210>5<211>22<212> DNA <213> recombination SEQUENCE <220> <223> amplification primer <400> SEQUENCE: 5tcagcatagc agtagacttg cg 22<210>6<211>51<212> DNA <213> human macrophage virus <220> <223> artificially synthesized target DNA <400> SEQUENCE: 6cctaatcgca tcctgcatca aagcgtcaat cagactttcg acgtgcgcca g 51<210>7<211>76<212> DNA <213> recombination SEQUENCE <220> <223> circular probe <221> <222> (14) · (21) <223> hybridizing with a linear probe fragment <221> <222> (22) · (44) <223> hybridizing with a target nucleic acid fragment <221> <222> (47) · (68) <223> SEQUENCE <400> SEQUENCE: 7gatatacaac cacatcagct aacgctttga tgcaggatgc gatttatcag 50catagcagta gacttgcgta cctaag 76<210>8<211>31<212> DNA <213> recombination SEQUENCE <220> <223> linear probe <221> <222> (1) · (23) <223> hybridizing with the target nucleic acid fragment <221> <222> (24) · (31) <223> hybridizing with the circular probe fragment <400> SEQUENCE: 8gcgcacgtcg aaagtctgat tgatagctga t 31<210>9<211>85<212> DNA <213> hepatitis B Virus <220> <223> artificially synthesized target DNA <400> SEQUENCE: 9accacatcat ccatataact gaaagccagac agtggggga aagccctacg 50aaccactgaa caaatggcac tagtaaactg agcca 85<210>10<211>76<212> DNA <213> recombination SEQUENCE <220> <223> circular probe <221> <222> (14) · (21) <223> hybridizing with linear probe fragment <221> <222> (22) · (44) <223> hybridizing with target nucleic acid fragment <221> <222> (47) · (68) <223> SEQUENCE <400> SEQUENCE: 10gatatacaac cacatcagct agctttcccc cactgtctgg cttttatcag 50catagcagta gacttgcgta cctaag 76<210>11<211>59<212> DNA <213> recombination SEQUENCE <220> <223> amplification fluorescent reticulum probe <221> <222> (1) <223> FAM modification <221> <222> (21) <223> DABCYL modification <221> <222> (25) < 52 > <223> hybridization with target nucleic acid hybridization fragment <221> <222> (53) < 59 > <223> hybridization with circularity probe hybridization fragment <400> SEQUENCE: 11tcgatgactg acggtcatcg tactagtgcc atttgttcag tggttcgtag 50gtagctgat 59<210>12<211>55<212> DNA <213> recombination SEQUENCE <220> <223> amplification fluorescent strand-hybridized fragment <221> <222> (1) <223> HEX modification <221> <222> (21) <223> DABCYL modification <221> <222> (25) < 48 > <223> hybridization with target nucleic acid-hybridized fragment <221> <222> (49) > (55) <223> hybridization with loop-probe-hybridized fragment <400> sequencing: 12tcgatgactg acggtcatcg tacttggcta gacgctttct gcgtgaatag 50ctgat 55<210>13<211>55<212> DNA <213> recombination SEQUENCE <220> <223> amplification fluorescent strand-hybridized fragment <221> <222> (1) <223> TAMRA modification <221> <222> (21) <223> DABCYL modification <221> <222> (25) < 48 > <223> hybridization with target nucleic acid-hybridized fragment <221> <222> (49) < 55) <223> hybridization with loop-hybridized fragment <400> sequencing: 13tcgatgactg acggtcatcg tactgcgcac gtcgaaagtc tgattgatag 50ctgat 55

Claims

the linear probe comprises at least the following two parts: (1) a sequence at the 5' end that pairs with the target nucleic acid and that is in the range of 15-35 nucleotides in length; (2) a short sequence at the 3' end which is paired with the circular probe and has the length in the range of 2-10 nucleotides; and the interval between the two parts (1) and (2) is in the range of 0 to 5 nucleotides;

2. The method of claim 1, wherein the molar ratio of the linear probe to the circular probe is in the range of 1: 10 to 10: 1.

3. The method of claim 1, wherein the sequence at the 5' end of the linear probe that pairs with the target nucleic acid is in the range of 18-32 nucleotides in length.

4. The method of claim 1, wherein the sequence of the circular probe that is paired with the target nucleic acid is in the range of 18-32 nucleotides in length.

5. The method of claim 1, wherein said wire probe is in any one of 3 states: (a) a free state; (b) attaching to a carrier; (c) part is in a free state and part is attached to the carrier; any modified nucleotides or other components may also be included in the composition.

7. The method of claim 1, wherein said amplification reaction components include DNA product detection reagents.

8. The method of claim 1, wherein the means for detecting nucleic acid amplification signals by the instrument is any means used to detect single-stranded or double-stranded DNA.

9. The method of any one of claims 1-8, wherein the entire nucleic acid amplification detection process is performed in the same reaction vessel.

10. A kit for performing the method of any one of claims 1 to 9, wherein the kit contains reagents necessary for detecting the type and relative amount of target nucleic acid that may be present in the sample.