WO2021096605A1 - Compositions and methods for high-efficiency recombination of rna molecules - Google Patents

Compositions and methods for high-efficiency recombination of rna molecules Download PDF

Info

Publication number
WO2021096605A1
WO2021096605A1 PCT/US2020/053643 US2020053643W WO2021096605A1 WO 2021096605 A1 WO2021096605 A1 WO 2021096605A1 US 2020053643 W US2020053643 W US 2020053643W WO 2021096605 A1 WO2021096605 A1 WO 2021096605A1
Authority
WO
WIPO (PCT)
Prior art keywords
rna
sequence
protein
composition
dimerization domain
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2020/053643
Other languages
English (en)
French (fr)
Inventor
Lukas Christoph BACHMANN
Samuel Lawrence PFAFF
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Salk Institute for Biological Studies
Original Assignee
Salk Institute for Biological Studies
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from PCT/US2020/025430 external-priority patent/WO2020205604A1/en
Priority to CA3157799A priority Critical patent/CA3157799A1/en
Application filed by Salk Institute for Biological Studies filed Critical Salk Institute for Biological Studies
Priority to KR1020227019191A priority patent/KR20220113940A/ko
Priority to AU2020384996A priority patent/AU2020384996A1/en
Priority to CN202080092659.8A priority patent/CN114945666A/zh
Priority to MX2022005670A priority patent/MX2022005670A/es
Priority to IL292904A priority patent/IL292904A/en
Priority to BR112022009006A priority patent/BR112022009006A2/pt
Priority to EP20793875.4A priority patent/EP4058571A1/en
Priority to JP2022526727A priority patent/JP7759106B2/ja
Publication of WO2021096605A1 publication Critical patent/WO2021096605A1/en
Priority to US17/741,311 priority patent/US20220265855A1/en
Anticipated expiration legal-status Critical
Priority to JP2025079571A priority patent/JP2025118824A/ja
Ceased legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/115—Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/64—General methods for preparing the vector, for introducing it into the cell or for selecting the vector-containing host
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/16—Aptamers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011—Details
    • C12N2750/14011—Parvoviridae
    • C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141—Use of virus, viral particle or viral elements as a vector
    • C12N2750/14143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2840/00—Vectors comprising a special translation-regulating system
    • C12N2840/44—Vectors comprising a special translation-regulating system being a specific part of the splice mechanism, e.g. donor, acceptor
    • C12N2840/445—Vectors comprising a special translation-regulating system being a specific part of the splice mechanism, e.g. donor, acceptor for trans-splicing, e.g. polypyrimidine tract, branch point splicing

Definitions

  • the present disclosure provides systems, kits, compositions, and methods that allow for recombination of two or more RNA molecules, allowing expression of a full-length protein.
  • Gene therapy is a promising method for treating genetic diseases caused by loss-of-function mutations.
  • Replacement genes are typically reintroduced into target cells using vectors such as AAV because the virus is generally safe and efficient at entering cells.
  • AAV it is difficult to encapsulate more than about 5000 nucleotides using conventional capsids. Since the length of genes that encode large proteins often exceed the packaging constraints of AAV, many genetic diseases remain untreatable. Strategies to overcome this limitation have been explored in the past, but proved inefficient, led to expression of high levels of potentially toxic truncated protein, or both. Safe, high efficiency strategies for delivery of large proteins to treat disease are needed.
  • compositions for expressing a target protein includes (a) a first RNA molecule, the RNA molecule comprising from 5’ to 3’: (i) a coding sequence for an N-terminal portion of the target protein; (ii) a splice donor; and (iii) a first dimerization domain; and (b) a second RNA molecule, the RNA molecule comprising from 5’ to 3’: (i) a second dimerization domain, wherein the second dimerization domain binds to the first dimerization domain; (ii) a branch point sequence; (iii) a polypyrimidine tract; (iv) a splice acceptor; and (v) a coding sequence for a C-terminal portion of the target protein.
  • the first and second dimerization domains bind by direct binding, indirect binding, or both.
  • the dimerization domains are kissing loop domains or hypodiverse domains.
  • the first and/or second RNA molecule comprise at least one splice enhancer.
  • compositions for expressing a target protein comprising: (a) a first synthetic DNA molecule that encodes the first RNA molecule of any one of claims 1 to 16, wherein the first synthetic DNA molecule comprises (i) a first promoter operably linked to a sequence encoding the first RNA molecule; and (b) a second synthetic DNA molecule that encodes the second RNA molecule of any one of claims 1 to 16, wherein the second synthetic DNA molecule comprises (i) a second promoter operably linked to a sequence encoding the second RNA molecule.
  • Also provided are systems for expressing a target protein comprising the described compositions.
  • RNAs encoded by the systems to express a protein in a cell.
  • Such a method can include introducing the system into a cell, and expressing the synthetic first and second RNA molecules in the same cell.
  • the cell is in a subject, and the method treats a disease in the subject such as a genetic disease caused by a mutation in a gene encoding the target protein.
  • the genetic disease is Duchenne Muscular Dystrophy, Hemophilia A, Stargardt’s Disease, or Usher Syndrome.
  • FIG. 1 A depicts a schematic of vector designs (left) and RNA interactions and splicing (right).
  • SD splice donor sequence
  • DISE downstream intronic splicing enhancer
  • 2xISE two intronic splicing enhancers
  • BD binding domain
  • n-yfp segment has a small intron inserted (white segment within n-yfp).
  • 3’ trsp DNA vector Open arrows are two opposing promoters. BFP coding domain and 3’UTR with poly adenylation elements are expressed opposite from complementary binding domain (anti-BD, also referred to as dimerization domain), followed by three intronic splicing enhancer sequences (3xISE), a branch point (BP), a polypyrimidine tract (PPT), a splice acceptor sequence (SA), the c-terminal proton of the YFP coding sequence, ending with a 3’
  • anti-BD also referred to as dimerization domain
  • 3xISE three intronic splicing enhancer sequences
  • BP branch point
  • PPT polypyrimidine tract
  • SA splice acceptor sequence
  • FIG. IB depicts transfection of only the N-terminal expression plasmid does not lead to YFP fluorescence.
  • FIG. 1C depicts transfection of only the C-terminal expression plasmid does not lead to YFP fluorescence.
  • FIG. ID depicts expression of N-terminal and C-terminal fragments without binding domains shows low levels of YFP induction.
  • FIG. IE depicts rationally designed dimerization/binding domain in a looped configuration (hypodiverse sequence consisting of either all pyrimidines or all purines that are interrupted by complementary sequences that form double stranded stem structures).
  • FIG. IF depicts 3D rendering of the “looped” dimerization domain configuration.
  • FIG. 1G depicts negative control with no binding domain on the C-terminal half.
  • FIG. 1H depicts negative control with no binding domain on the N-terminal half.
  • FIG. II depicts matching binding domains in a looped configuration on both N- and C-terminal half shows strong YFP induction in 90% of the cells.
  • FIGS. 1 J-1N depict data equivalent to that in FIGS. 1E-1I for a configuration of a binding domain with a 150 nucleotide hypodiverse sequence comprised exclusively of pyrimidine (or alternatively exclusively purine) containing sequence resulting in a fully open configuration.
  • FIG 1 J depicts a 150 nucleotide hypodiverse pyrimidine sequence resulting in a fully open configuration for complimentary base pairing.
  • FIG IK depicts a 3D rendering of the 150 nucleotide hypodiverse pyrimidine sequence from
  • FIG 1L depicts a control HEK293T cell transfection with the C-terminal -YFP encoding construct lacking a complimentary hypodiverse binding domain. Few transfected cells express YFP.
  • FIG 1M depicts a control HEK293T cell transfection with the N-terminal-YFP encoding construct lacking a complimentary hypodiverse binding domain. Few transfected cells express YFP.
  • FIG IN depicts a HEK293T cell transfection with N-terminal-YFP and C-terminal-YFP constructs that both have complimentary hypodiverse dimerization binding domains. Many cells express YFP at high levels.
  • FIG. 10 depicts representative fluorescence images for cells shown in FIG. lG.
  • the positive markers for transfection (RFP+BFP) are expressed, but YFP protein is not reconstituted efficiently.
  • FIG. IP depicts representative fluorescence images for cells shown in FIG. 1L.
  • the positive markers for transfection (RFP+BFP) are expressed, and YFP protein is reconstituted at high levels in cells that are both RFP and BFP double positive.
  • FIG. IQ depicts a comparison of conditions shown in FIG. ID, FIGS. 1G-1I, and FIGS. 1L-1N.
  • N no binding domain
  • Loop looped hypodiverse binding domain configuration
  • Lin linear hypodiverse configuration.
  • FIG. 2A depicts schematic of vector designs.
  • the protein coding sequence of a yellow fluorescent protein (YFP) is split into an N-terminal, a middle fragment (m-yfp) and a C-terminal fragment.
  • the junction of RNAs encoding the n and m fragments is joined by a looped design binding domain (BD1) and the junction between m and c fragments is joined by a looped binding domain (BD2).
  • BD1 looped design binding domain
  • BD2 looped binding domain
  • the pyrimidine (Y) and purine (R) sequences are arranged in such a way as to avoid self circularization of the m-fragment and avoid direct recombination of the N- and C-fragment.
  • the N- terminal fragment is co-expressed with red fluorescent protein as a transfection control, the C-terminal fragment is coexpressed with blue fluorescent protein as a transfection control.
  • Promoter sequences are indicated with open arrows.
  • Splice donor (SD) and splice acceptor (SA) sites are indicated.
  • Intronic splicing elements including splice enhancers, polypyrimidine tracts and branch points are included, analogous to the elements used upstream (5’) of the SA and downstream (3’) of the SD in FIG. 1A.
  • FIG. 2B depicts human cell line transfection of plasmids I+II+III (see FIG. 2A) efficiently reconstituting high level YFP expression in 80% of the transfected cells.
  • FIG. 2C depicts representative fluorescent image of expression of the n and m fragment (plasmid I+II, see FIG. 2A) shows no yfp fluorescence (negative control).
  • FIG. 2D depicts representative fluorescent image of expression of the m and c fragment (plasmid II+III, see FIG. 2A) shows no yfp fluorescence (negative control).
  • FIG. 2E depicts representative fluorescent image showing that strong YFP fluorescence is induced by co-transfection of all three fragments (plasmid I+II+IP, see FIG. 2A).
  • FIGS. 3 A-3D depict efficient reconstitution of yellow fluorescent protein (YFP) from two fragments (SEQ ID NOS: 1 and 2) expressed from two AAV2/8s after systemic administration in the newborn (P3) mouse pup.
  • A depicts AAV 1 encoding the n-terminal half fragment of YFP, and AAV 2 encoding the c-terminal half fragment.
  • AAV 1+AAV 2 were mixed at equal titer and injected intravenously into mice. Tissue sample were collected 3 weeks following injection.
  • (B) depicts YFP fluorescence in the liver of the juvenile mouse at the time of sacrifice (green). Uninjected liver is shown for comparison (control: no YFP detected).
  • DRAQ5 nuclear stain is shown in magenta for context.
  • FIG. C depicts strong YFP fluorescence in the heart muscle at the time of sacrifice (green). Top panels show macroscopic view and red autofluorescence for context (in magenta). Bottom panel shows cross-section with DRAQ5 nuclear stain for context (in magenta). Uninjected mouse heart lacking YFP is shown for control. (D) depicts strong YFP fluorescence in the skeletal muscles of the leg at the time of sacrifice. Uninjected mouse legs are shown for comparison (negative control, no YFP detected). Top panels show macroscopic view with red autofluorescence in magenta. Bottom panel shows microscopic image of a cross-section through the leg. Bottom panel shows DRAQ5 nuclear stain in magenta for context.
  • FIGS. 4A-4B depict efficient reconstitution of yellow fluorescent protein (YFP) from three fragments (SEQ ID NOS: 145, 146 and 2, respectively) in the mouse tibialis anterior muscle after intramuscular injection of three AAV2/8 in the newborn (P3) mouse pup.
  • YFP yellow fluorescent protein
  • FIGS. 4A-4B depict efficient reconstitution of yellow fluorescent protein (YFP) from three fragments (SEQ ID NOS: 145, 146 and 2, respectively) in the mouse tibialis anterior muscle after intramuscular injection of three AAV2/8 in the newborn (P3) mouse pup.
  • A depicts a schematic of three AAV particles with separate N-, M-, and C-terminal fragments of YFP (analogous to Fig 2A).
  • B Shows strong YFP fluorescence in a longitudinal section of the tibialis anterior muscle of a mouse injected with all three viral particles.
  • DRAQ5 nuclear stain is shown in magenta for context.
  • FIGS. 5A-5F depict efficient reconstitution of yellow fluorescent protein (YFP) from two and from three fragments in adult mouse tibialis anterior muscle.
  • YFP yellow fluorescent protein
  • A depicts N-terminal and C-terminal halves of YFP coding sequence are equipped with synthetic RNA-dimerization and recombination domains.
  • B depicts two AAV transfer plasmids expressing these two fragments were electroporated transcutaneously into adult mouse tibialis anterior (TA) muscle and strong fluorescence was detected at 5 days post electroporation.
  • C depicts no fluorescence was detectable in contralateral non-injected TA.
  • (D) depicts n-terminal, middle, and c-terminal YFP coding sequence are equipped with synthetic RNA-dimerization and recombination domains linking each fragment to its adjacent fragment(s).
  • (E) depicts transcutaneous electroporation of three AAV transfer plasmids expressing these three fragments. Strong YFP fluorescence is detected indicating efficient reconstitution of YFP from three fragments.
  • (F) depicts fluorescence in contralateral non-injected TA. Fluorescent channel is overlaid onto grey scale photographs for context.
  • FIG. 6A is a schematic drawing providing an exemplary system for the disclosed RNA recombination methods, using two nucleic acid molecules 110, 150, wherein the target protein is divided into two portions and each portion is encoded by a different nucleic acid molecule.
  • the nucleic acid molecules 110, 150, of the system are DNA, and include promoters 112,
  • nucleic acid molecules 110, 150, of the system are RNA, and thus lack the promoters 112, 152. Drawing not to scale.
  • FIG. 6B is a schematic drawing providing an exemplary dimerization domain (e.g ., 122, 154 of FIG. 6A) that includes hypodiverse sequences interspersed with sequences that can form a stem, which results in local RNA loops that are open and available for basepairing in the absence of pseudoknot formation. Drawing not to scale.
  • exemplary dimerization domain e.g ., 122, 154 of FIG. 6A
  • FIG. 6C is a schematic drawing showing the interaction and hybridization (base pairing) between a pre-mRNA dimerization domain 122 of molecule 110 (FIG. 6A) and a pre-mRNA dimerization domain 154 of molecule 150 (FIG. 6A) allows the spliceosome components to recombine N-terminal coding sequence 114 and C-terminal coding sequence 164. This results in the 3’ end of the N-terminal protein coding sequence 114 fusing to the 5’ end of the C terminal protein sequence 164, and a seamless junction between the N- and C-terminal portions. Drawing not to scale.
  • FIG. 6D is a schematic drawing providing an exemplary system for the disclosed RNA recombination methods, using three nucleic acid molecules 110, 200, 150, wherein the target protein is divided into three portions (N-terminal, middle, C-terminal) and each portion is encoded by a different nucleic acid molecule.
  • nucleic acid molecules 110, 150, 200 of the system Prior to transcription, nucleic acid molecules 110, 150, 200 of the system are DNA, and include promoters 112, 152, 202. Following transcription, nucleic acid molecules 110, 150, 200 of the system are RNA, and thus lack the promoters 112, 152, 202. Drawing not to scale.
  • FIG. 6E is a schematic drawing showing the interaction and hybridization (base pairing) between dimerization domain 122 of molecule 110 (FIG. 6D) and dimerization domain 204 of molecule 200 (FIG 6D), and between dimerization domain 226 of molecule 200 (FIG. 6D) and dimerization domain 154 of molecule 150 (FIG 6D), allows the spliceosome components to recombine N-terminal coding sequence 114, middle coding sequence 216, and C-terminal coding sequence 164.
  • FIG. 6F is a schematic drawing providing an exemplary system for the disclosed RNA recombination methods, using two nucleic acid molecules 110, 150, wherein the target protein is divided into two portions and each portion is encoded by a different nucleic acid molecule.
  • the DNA has been transcribed into RNA, such that nucleic acid molecules 110, 150, of the system are RNA, and thus lack the promoters 112, 152 present in the DNA (see FIG. 6A). Drawing not to scale.
  • FIG. 7A is a schematic drawing providing an exemplary system for the disclosed RNA recombination methods, that like FIG. 6A uses two nucleic acid molecules 500, 600, but the dimerization domains are aptamers 512, 602, that recognize the same target molecule 700.
  • the elements shown are RNA. Drawing not to scale.
  • FIG. 7B is a schematic drawing providing an exemplary system for the disclosed RNA recombination methods, that, related to FIG. 7A, uses dimerization domains that recognize the same target molecule.
  • the target recognized by the dimerization domain is a specific RNA molecule (instead of molecule 700 in FIG. 7A, e.g., protein or small molecule).
  • Each domain recognizes a different portion of an mRNA molecule only expressed in target cells (i.e., cells where target protein expression is desired), such as a cancer-specific transcript.
  • target cells i.e., cells where target protein expression is desired
  • the elements shown are RNA. Drawing not to scale.
  • FIG. 7C is a schematic drawing providing an exemplary system for the disclosed RNA recombination methods, that like FIG.
  • 6A and 7A uses two nucleic acid molecules 800, 900, and shows the dimerization domains 812, 902 hybridizing to an oligonucleotide 1000 that prevents the dimerization domains from interacting with one another, and therefore prevents or reduces recombination of the N-terminal coding sequence 802 and C-terminal coding sequence 914.
  • the elements shown are RNA. Drawing not to scale.
  • FIG. 9A is a schematic drawing providing an example for the use of dimerization domain (e.g 122, 154 of FIG. 6A) that includes kissing loop interaction for high affinity dimerization.
  • dimerization domain e.g 122, 154 of FIG. 6A
  • any of the disclosed coding portions e.g., YFP
  • FIG. 9B depicts RFP, BFP, and YFP signal in HEK293T cells transfected with both halves of the split YFP. Equipped with either a linear dimerization domain adhering to the hypodiverse design principle or a structured dimerization domain designed for kissing loop -loop interactions. Strong yellow fluorescent signal indicates efficient reconstitution.
  • FIGS. 10A-10Z are exemplary synthetic nucleic acid molecules that can be used with the systems and methods.
  • a synthetic nucleic acid molecule as at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at last 99% or 100% sequence identity to the sequence of any one of SEQ ID NOS: 1 (FIGS. 10A-10B), 2 (FIGS. lOC-lOE), 7 (FIG. 10E), 8 (FIG. 10F), 9 (FIG. 10G), 10 (FIG. 10H), 11 (FIG. 101), 12 (FIG. 10J), 13 (FIG. 10K), 14 (FIG. 10L), 15 (FIG. 10M), 16 (FIG. 10N), 17 (FIG.
  • an intronic region using with any of the systems or methods provided herein can have at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at last 99% or 100% sequence identity to any intronic sequence of SEQ ID NOS: 1, 2, 3, 4,
  • FIGS. 10A-D show exemplary (A,B) first (SEQ ID NO: 1) and (C,D) second (SEQ ID NO: 2) synthetic molecules that can be used to express full-length YFP, while SEQ ID NO: 3 and 4 provide the corresponding synthetic intron portion without the YFP coding portion.
  • a synthetic intron sequence has at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at last 99% or 100% sequence identity to SEQ ID NO: 3 or 4.
  • FIG. 11 is a bar graph showing the reconstitution efficiency of different length random complimentary base-pairing binding domains (50 bp, 100 bp, 150 bp, 200 bp, 300 bp, 400 bp, and 500 bp).
  • FIGS. 12A-12B show that inclusion of a splice enhancer into the synthetic intron increases the reconstitution efficiency.
  • FIG. 12A is a schematic drawing of the 5’-N and 3’-C-terminal constructs used (SEQ ID NO: 1 and 2). (see FIG. 1 A for abbreviations).
  • FIGS. 13A-13D shows midline-crossing cortical neuron tracing by reconstitution of full-length Up recombinase (Flpo) from two fragments (SEQ ID NOS: 147 and 148).
  • Flpo full-length Up recombinase
  • A Schematic representation of the 5’- and 3 ’-sequences used to reconstitute flpo (analogous to constructs in Fig 12 A)
  • C and D show neuronal cell body and axon labeling of cortical neurons that project to the contralateral hemisphere of the brain and therefore were infected by both the N-flpo and C-flpo viruses. Hoechst staining (nuclei) is shown for context.
  • FIGS. 14A-14D show expression of oversized cargo (i.e. proteins encoded by long RNAs) in cell culture and in vivo in the mouse primary motor cortex.
  • A Schematic representation of the 5’- and 3 ’-sequences used to reconstitute YFP, which include long stuffer sequences (uninterrupted open reading frames; SEQ ID NOS: 22 and 23, respectively).
  • C Reconstituted YFP protein expression from full-length oversized YFP expression and split-REJ expression assessed by flow cytometry of transiently transfected HEK 293t cells.
  • FIGS. 15A-15C show efficient reconstitution of full-length human coagulation factor VIII (FVIII) with N-terminal HA tag (substituting the N-terminal signal peptide) (2317 aa).
  • FVIII human coagulation factor VIII
  • N-terminal HA tag substituted with N-terminal signal peptide
  • FIGS. 15A-15C show efficient reconstitution of full-length human coagulation factor VIII (FVIII) with N-terminal HA tag (substituting the N-terminal signal peptide) (2317 aa).
  • A Schematic representation of the 5’- and 3’-sequences used to reconstitute FVIII (SEQ ID NOS: 24 and 25, respectively).
  • B PCR amplification of the junction.
  • C Western blot showing expression of FVIII. Lanes 1-3: expression of full-length FVIII (290kDa band shows full length, unprocessed FVIII). Lanes 4-6: expression of re
  • Lanes 7 and 8 expression of the N-terminus only shows absence of full-length FVIII band at 290 kDa.
  • Expected proteolytic processing products are observed ranging from ⁇ 75kDa to ⁇ 210kDa.
  • FVIII is probed for using a mouse anti-HA primary antibody. All lanes were loaded with 5micrograms of cleared cell protein extract.
  • GAPDH rabbit anti-GAPDH is probed for as loading control.
  • FIGS. 16A-16F show efficient reconstitution of full-length human Abca4 with C-terminal FLAG-tag (2300 aa).
  • A Schematic representation of the 5’ - and 3 ’-sequences used to reconstitute Abca4 (SEQ ID NOS: 20 and 21, respectively), and a Sanger sequencing trace across the junction.
  • B PCR amplification of the junction.
  • C Schematic representation of the probes used to assay recombination of the 5’ - and 3 ’-fragments.
  • E Western blot showing expression of Abca4.
  • Lanes 1-3 expression of full-length Abca4 ( ⁇ 260kDa band shows full length Abca4). Lanes 4- 6: expression of reconstituted Abca4 (band at 260kDa shows successfully reconstituted Abca4). Lanes 7 and 8: no transfection control (i.e., HEK 293t lysate only) shows absence of any signal.
  • Abca4 is probed for using a mouse anti -FLAG primary antibody. All lanes were loaded with 5micrograms of cleared cell protein extract. GAPDH (rabbit anti-GAPDH) is probed for as loading control.
  • F Quantification of the western blot in (E) normalized for differential BFP concentration. Data is shown as normalized to the average of full-length expression control.
  • FIGS. 17A and 17B provide (A) HIV-1 based kissing loop dimerization domain (N-fragment, SEQ ID NO: 139, C-fragment SEQ ID NO: 140); and (B) HIV-2 based kissing loop dimerization domain (N-fragment, SEQ ID NO: 141, C-fragment SEQ ID NO: 142).
  • FIGS. 18A-18C show efficient reconstitution of full-length murine Otof with C-terminal FLAG- tag (2019 aa).
  • the DNA sequences of the 5’ and 3’ molecules used are shown in SEQ ID NOS: 155 and 156.
  • FIGS. 19A-19C show efficient reconstitution of full-length human Myo7a with C-terminal FLAG-tag (2243 aa).
  • the DNA sequences of the 5’ and 3’ molecules used are shown in SEQ ID NOS: 157 and 158.
  • GAPDH rabbit anti- GAPDH
  • B Raw quantification of the western blot
  • C normalized for differential BFP concentration. Data is shown as normalized to the average of full- length expression control.
  • FIGS. 20A-20D show efficient reconstitution of full-length DCas9-VPR (1951 aa).
  • the DNA sequences of the 5’ and 3’ molecules used are shown in SEQ ID NOS: 159 and 160.
  • DCas9-VPR is probed for using a mouse anti-Cas9 primary antibody. All lanes were loaded with 5micrograms of cleared cell protein extract. GAPDH (rabbit anti- GAPDH) is probed for as loading control.
  • B Raw quantification of the western blot and
  • C normalized for differential BFP concentration. Data is shown as normalized to the average of full- length expression control.
  • D Example of transcriptional activation of a YFP expressing plasmid in HEK 293t cells.
  • Full-length (upper panels) or two-way split REJ-dual dCas9-VPR (lower panels) is transiently transfected together with non-targeting guide RNA (left panels) or UAS-targeting guide RNA (right panels) expressing plasmids. All cells are also transfected with a UAS-YFP plasmid that is transcriptionally inactive until dCas9-VPR is targeted to the upstream region of a minimal promoter which results in expression of yellow fluorescent protein.
  • Red fluorescent protein is expressed with the N-terminal fragment of dCas9-VPR
  • Blue fluorescent protein is expressed with the full- length dCas9-VPR or the C-terminal fragment of dCas9-VPR, respectively.
  • RFP and BFP serve as transfection control.
  • yellow fluorescent protein expression is observed, confirming functionality of the reconstituted full-length protein.
  • FIGS. 21A-21D show efficient reconstitution of full-length humanized Prime Editor (2118 aa).
  • the DNA sequences of the 5’ and 3’ molecules used are shown in SEQ ID NOS: 161 and 162.
  • GAPDH (rabbit anti-GAPDH) is probed for as loading control.
  • B Raw quantification of the western blot and
  • C normalized for differential BFP concentration. Data is shown as normalized to the average of full-length expression control.
  • D Shows Prime Editor induced Gto T transversion mutations induced in the FANCF and the VEGFA3 loci of HEK293t cells. The top panel shows the sequence context for the FANCF and VEGFA3 loci respectively. The grey arrow indicates the sequence targeted by the prime editor guide RNA (pegRNA). The protospacer adjacent motif (PAM) is indicated with a grey box. The Gthat is targeted for transversion to T is highlighted in the sequence. Genomic loci are sequenced using Sanger sequence in three conditions.
  • the top panel shows a representative sanger trace for unedited wild type condition.
  • the second from the top panel shows a representative sanger trace that represents the full-length expressed prime editor construct.
  • the area highlighted with the black box shows the appearance of a T band in the sanger sequence, indicative of successful incorporation of the edit in a portion of the cells.
  • the lowest panels show representative sanger traces for cells edited with a two-way split reconstituted prime editor.
  • the appearance of a T trace (black box) demonstrates functionality of the prime editor when reconstituted from two fragments.
  • FIGS. 22A-22C show efficient reconstitution of full-length humanized Cytosine Base Editor (AncBE4) (1854 aa).
  • the DNA sequences of the 5’ and 3’ molecules used are shown in SEQ ID NOS: 163 and 164.
  • Lanes 4-6 expression of reconstituted AncBE4 (band at 230k Da shows successfully reconstituted AncBE4).
  • Lane 7 no transfection control ( i. e. , HEK 293t lysate only) shows absence of any signal.
  • AncBE4 is probed for using a mouse anti-Cas9 primary antibody.
  • Genomic loci are sequenced using Sanger sequence in three conditions.
  • the top panel shows a representative sanger trace for unedited wild type condition.
  • the second from the top panel shows a representative sanger trace that represents the full-length expressed AncBE4 construct.
  • the area highlighted with the black box shows the appearance of a T band in the sanger sequence, indicative of successful incorporation of the edit in a portion of the cells.
  • the lowest panels show representative sanger traces for cells edited with a two-way split reconstituted AncBE4.
  • the appearance of a T trace (black box) demonstrates functionality of the AncBE4 when reconstituted from two fragments.
  • FIGS. 23A-23C show efficient reconstitution of full-length humanized Adenine Base Editor (Abe8e) (1606 aa).
  • the DNA sequences of the 5’ and 3’ molecules used are shown in SEQ ID NOS:
  • (C) Shows Abe8e induced A to G transition mutations induced in the BCL11 A and the HGBl/2 loci of HEK293t cells.
  • the top panel shows the sequence context for the BCL11 A and HGBl/2 loci respectively.
  • the grey arrow indicates the sequence targeted by the Abe8e guide RNA (sgRNA).
  • the protospacer adjacent motif (PAM) is indicated with a grey box. The As that are targeted for transition to G are highlighted in the sequence.
  • Genomic loci are sequenced using Sanger sequence in three conditions.
  • the top panel shows a representative sanger trace for unedited wild type condition.
  • the second from the top panel shows a representative sanger trace that represents the full-length expressed Abe8e construct.
  • the area highlighted with the black box shows the appearance of a G band in the sanger sequence, indicative of successful incorporation of the edit in a portion of the cells.
  • the lowest panels show representative sanger traces for cells edited with a two-way split reconstituted Abe8e.
  • the appearance of a G trace (black box) demonstrates functionality of the Abe8e when reconstituted from two fragments.
  • FIGS. 24A-24C Influence of downstream intronic splicing enhancers (DISE) and intronic splicing enhancers (ISE) and acceptor sequences on the efficiency of RNA end joining.
  • the 5’ fragment is an RNA molecule which is transcribed from a DNA construct using the human CMV promoter and enhancer.
  • the RNA molecule produced contains a long stuffer open reading frame to simulate large cargo size. This stuffer sequence ends in a 2A self cleaving peptide sequence and is followed by the coding region for the 5’ fragment of a Yellow Fluorescent Protein (n-yfp).
  • the 5’ fragment of yfp ends in a splice donor site (SD).
  • This splice donor site is followed by the 5’ intronic portion of the RNA end joining module.
  • the 5’ intronic portion is subdivided into three fragments: from 5’ to 3’: ds: downstream segment; m: mid intronic segment; dd: donor distal segment.
  • the 5’ intronic portion is followed by a trimodal kissing loop RNA dimerization domain. The message is terminated with a short poly adenylation signal.
  • the overall length of this 5’ RNA molecule is ⁇ 4kb to simulate a large cargo reconstitution scenario.
  • the 3’ fragment is an RNA molecule which is transcribed from a DNA construct using the human CMV promoter and enhancer.
  • the 3 ’ fragment starts with a trimodal kissing loop RNA dimerization domain that is complementary to the one on the 5’ fragment encoding RNA molecule.
  • the dimerization domain is followed by the 3’ intronic portion of the RNA end joining module.
  • This 3’ intronic portion is subdivided into three segments: ad: acceptor distal segment; m: mid-intronic segment; ap: acceptor proximal segment.
  • the acceptor proximal segment contains variations of the branch point and polypyrimidine tracts which are both essential for the spliceosome mediated RNA joining reaction.
  • the splice acceptor (SA) site is followed by the 3’ yfp coding sequence which is followed by a self-cleaving 2A sequence that is followed by a long stuffer open reading frame.
  • the message is terminated by an SV40 poly adenylation signal.
  • the overall length of the 3’ RNA molecule is ⁇ 4kb to simulate a large cargo reconstitution scenario.
  • the association of the two RNA molecules (the 5’ fragment and the 3’ fragment) is mediated by the trimodal kissing loop RNA dimerization domain, the recruitment of the spliceosome and the RNA end joining reaction are mediated by the intronic segments. Successful RNA end joining results in reconstitution of the yfp open reading frame and subsequent translation of YFP.
  • nucleic and amino acid sequences listed in the accompanying sequence listing are shown using standard letter abbreviations for nucleotide bases, and three letter code for amino acids, as defined in 37 C.F.R. 1.822. Only one strand of each nucleic acid sequence is shown, but the complementary strand is understood as included by any reference to the displayed strand.
  • sequence Listing is submitted as an ASCII text file, created on September 30, 2020, 157 KB, which is incorporated by reference herein. In the accompanying sequence listing:
  • SEQ ID NOS: 1 and 2 are N- and C-terminal sequences, respectively, used to express full- length YFP.
  • SEQ ID NO: 1 CMV promoter nt 1 to 543, YFP coding sequence nt 544 to 1032, synthetic intron nt 1033 to 1436, and untranslated poly A region nt 1437 tol491.
  • SEQ ID NO: 2 CMV promoter nt 1 to 522, synthetic intron nt 523 to 904, YFP coding sequence nt 905 to 1141, and nt 1142 to 1302 is the untranslated poly A region.
  • SEQ ID NOS: 3 and 4 are 5’- and 3’-intronic sequences, respectively, that can be used to express a desired full-length protein, wherein a N-terminal portion of the full-length protein can be added at nt 1 of SEQ ID NO: 3, and C-terminal portion of the full-length protein can be added at nt 382 of SEQ ID NO: 4.
  • SEQ ID NOS: 5 and 6 are N- and C-terminal coding sequences, respectively, used to express full-length YFP.
  • SEQ ID NO: 7 is an exemplary synthetic intron dimerization domain (FIG. 10E).
  • SEQ ID NO: 8 is an exemplary synthetic intron without intronic splicing enhancers (FIG. 10F).
  • SEQ ID NO: 9 is an exemplary synthetic intron without intronic splicing enhancers (FIG. 10G).
  • SEQ ID NO: 10 is an exemplary synthetic intron without intronic splicing enhancers (FIG.
  • SEQ ID NO: 11 is an exemplary synthetic intron without binding domain (FIG. 101).
  • SEQ ID NO: 12 is an exemplary synthetic intron with dimerization domain (FIG. 10J).
  • SEQ ID NO: 13 is an exemplary synthetic intron with dimerization domain (FIG. 10K).
  • SEQ ID NO: 14 is an exemplary synthetic intron without intronic splicing enhancers (FIG.
  • SEQ ID NO: 15 is an exemplary synthetic intron with DISE only (FIG. 10M).
  • SEQ ID NO: 16 is an exemplary synthetic intron without HHrz (FIG. 10N).
  • SEQ ID NO: 17 is an exemplary synthetic intron without intronic splicing enhancers (FIG.
  • SEQ ID NO: 18 is an exemplary U12 dependent intron with binding domain (FIG. 10P).
  • SEQ ID NO: 19 is an exemplary U12 dependent intron with binding domain (FIG. 10Q).
  • SEQ ID NOS: 20 and 21 are the N- and C-terminal DNA sequences, respectively, used to express RNAs (pre-mRNAs) resulting in full-length Abca4.
  • the sequence corresponding to the N-terminal Abca4 coding region is at nt 22 to 3702, and nt 3703 to 3912 is the synthetic intron, and 3921 to 3969 is the untranslated poly A region.
  • SEQ ID NO: 20 also comprises a splice donor at nt 3703-3711, a Rat FGFR2 DISE at nt 3714-3737, a cTNT intronic splicing enhancer at nt 3747-3770, an M2 intronic splicing enhancer at nt 3782-3794, and a kissing loop dimerization domain at nt 3801-3975.
  • nt 1 to 228 is the synthetic intron
  • nt 229 to 3366 is the C- terminal Abca4 coding region
  • 3367 to 3447 is the FFAG epitope tag
  • nt 3476 to 3607 is the untranslated poly A region (signal).
  • SEQ ID NO: 21 also comprises a kissing loop dimerization domain at nt 3-114, an M2 intronic splicing enhancer at nt 121-133, a cTNT intronic splicing enhancer at nt 140-163, an M2 intronic splicing enhancer at nt 175-187, a Branch Point Motif at nt 194-201, a poly pyrimidine tract at nt 207-226, and a splice acceptor at nt 228.
  • SEQ ID NOS: 22 and 23 are the N- and C-terminal DNA sequences, respectively, used to express RNAs (pre-mRNAs) resulting in a long full-length YFP, wherein each includes splice enhancers.
  • the N-terminal YFP coding region is nt 22 to 3702, nt 3703 to 3912 is the synthetic intron, and 3921 to 3969 is the untranslated poly A region.
  • SEQ ID NO: 22 also comprises a splice donor at nt 3703-3711, a Rat FGFR2 DISE at nt 3714-3737, a cTNT intronic splicing enhancer at nt 3747-3770, an M2 intronic splicing enhancer at 3782-3794, and a kissing loop dimerization domain at 3801-3975.
  • nt 1 to 225 is the synthetic intron
  • nt 3748 to 3912 is the untranslated poly A region.
  • SEQ ID NO: 23 comprises a kissing loop dimerization domain at nt 3-114, an M2 intronic splicing enhancer at nt 118- 130, a cTNT intronic splicing enhancer at nt 137-160, a M2 intronic splicing enhancer at nt 172-184, a Branch Point Motif at nt 191-198, a poly pyrimidine tract at nt 204-223, and a splice acceptor at nt 225.
  • SEQ ID NOS: 24 and 25 are the N- and C-terminal sequences, respectively, used to express RNAs (pre-mRNAs) resulting in full-length human Factor VIII.
  • N-terminal FVIII coding region with N-terminal HA epitope tag nt are at nt 22 to 3561, nt 3562 to 3771 is the synthetic intron, and nt 3780 to 3828 is the untranslated poly A region.
  • SEQ ID NO: 24 also comprises a splice donor at nt 3562-3570, a Rat FGFR2 DISE at nt 3573-3596, a cTNT intronic splicing enhancer at nt 3606-3629, an M2 intronic splicing enhancer at nt 3641-3653, and a kissing loop dimerization domain at nt 3660-3834.
  • nt 1 to 225 is the synthetic intron
  • nt 226 to 3636 is the C-terminal FVIII coding region
  • nt 3665 to 3797 is the untranslated poly A region.
  • SEQ ID NO: 25 also comprises a splice donor at nt 3703-3711, a Rat FGFR2 DISE at nt 3714-3737, a cTNT intronic splicing enhancer at nt 3747-3770, an M2 intronic splicing enhancer at 3782-3794, and a kissing loop dimerization domain at nt 3801-3975.
  • SEQ ID NOS: 26-136 are exemplary splicing enhancers that can be used with the systems provided herein ( e.g ., 118, 120, 156 of FIG. 6A).
  • SEQ ID NOS: 137 and 138 are exemplary splice donor sequences.
  • SEQ ID NOS: 139 and 140 are the N- and C-fragment respectively, of an HIV-1 based kissing loop dimerization domain.
  • SEQ ID NOS: 141 and 142 are the N- and C-fragment, respectively, of an HIV-2 based kissing loop dimerization domain.
  • SEQ ID NO: 143 is an exemplary cryptic splice acceptor sequence.
  • SEQ ID NO: 144 is an exemplary branch point consensus sequence.
  • SEQ ID NOS: 145 and 146 are the N- and middle sequences, respectively, used to express a full-length YFP, along with SEQ ID NO: 2 (C-terminal fragment).
  • nt 1 to 543 is the CMV promoter sequence
  • nt 850 to 1305 is the synthetic intron.
  • nt 1 to 522 is the CMV promoter sequence
  • nt 523 to 901 is the synthetic intron
  • nt 902 to 1084 is the middle YFP coding region
  • nt 1085 to 1543 is the untranslated poly A region.
  • SEQ ID NOS: 147 and 148 are the 5’ and 3’- synthetic sequences, respectively, used to express a full-length Flpo.
  • nt 1 to 540 is the CMV promoter sequence
  • nt 541 to 1112 N- terminal Flpo coding region is the synthetic intron.
  • nt 1113 to 1571 is the synthetic intron.
  • nt 1 to 522 is the CMV promoter sequence
  • nt 523 to 904 is the synthetic intron
  • nt 905 to 1604 is the C- terminal Flpo coding region
  • nt 1605 to 1765 is the untranslated poly A region.
  • SEQ ID NOS: 149 and 150 are exemplary hypodiverse sequences.
  • SEQ ID NOS: 151 and 152 are exemplary splice donor consensus sequences.
  • SEQ ID NO: 153 is an exemplary kissing loop based on the HIV-2 kissing loop dimerization domain (SEQ ID NOS: 141 and 142, FIG. 17B).
  • SEQ ID NO: 154 is an exemplary Kozak enhanced start codon.
  • SEQ ID NOS: 155 and 156 are exemplary constructs that can be used to express a murine Otof coding sequence in vivo.
  • SEQ ID NO: 155 is used to produce the N-terminal Otof RNA. It comprises a human CMV enhancer and promoter at nt 1-522, a putative transcription start site at nt 523, and a poly adenylation signal at nt 4263-4311.
  • Otof RNA encodes the N-terminal Otof RNA elements as follows: 5’ untranslated region including Kozak sequence nt 523-546; 5’ Otoferlin coding sequence nt 547-4044; 5’ synthetic intron sequence nt 4045-4142; 5’ trimodal kissing loop dimerization domain nt 4143-4254; and linker at nt 4255-4262.
  • SEQ ID NO: 155 is used to produce the C-terminal Otof RNA. It comprises a human CMV enhancer and promoter at nt 1-522, a putative transcription start site at nt 523, and a poly adenylation signal at nt 3335-3467.
  • SEQ ID NOS: 157 and 158 are exemplary constructs that can be used to express a human MYOSIN VIIA (Myo7a) coding sequence in vivo.
  • SEQ ID NO: 157 is used to produce the N-terminal Myo7a RNA. It comprises a human CMV enhancer and promoter at nt 1-522, a putative transcription start site at nt 523, and poly adenylation signal at nt 4344-4392.
  • N-terminal Myo7A RNA elements as follows: 5’ untranslated region including Kozak sequence nt 523-543; 5’ Myo7a coding sequence nt 544-4125; 5’ synthetic intron sequence nt 4126-4223; 5’ trimodal kissing loop dimerization domain nt 4224-4335; and linker at nt 4336-4343.
  • SEQ ID NO: 158 is used to produce the C-terminal Myo7a RNA. It comprises a human CMV enhancer and promoter at nt 1-522, a putative transcription start site at nt 523, and a poly adenylation signal at nt 3923-4055.
  • SEQ ID NOS: 159 and 160 are exemplary constructs that can be used to express a full-length enzymatically dead Cas9 fused to a VPR transcriptional activator domain (dCas9-VPR) coding sequence in vivo.
  • SEQ ID NO: 159 is used to produce the N-terminal DCas9-VPR RNA.
  • It comprises a human CMV enhancer and promoter at nt 1-522, a putative transcription start site at nt 523, and poly adenylation signal at nt 4112-4161. It encodes the N-terminal DCas9-VPR RNA elements as follows: 5’ untranslated region including Kozak sequence nt 523-543; 5’ DCas9-VPR coding sequence nt 544- 3894; 5’ synthetic intron sequence nt 3895-3992; 5’ trimodal kissing loop dimerization domain nt 3993- 4104; and linker nt 4105-4112. SEQ ID NO: 160 is used to produce the C-terminal DCas9-VPR RNA.
  • It comprises a human CMV enhancer and promoter at nt 1-522, a putative transcription start site at nt 523, and poly adenylation signal zt nt 3278-3410. It encodes the C-terminal DCas9-VPR RNA elements as follows: 3’ trimodal kissing loop dimerization domain nt 525-636; 3’ synthetic intron sequence nt 637-747; 3’ DCas9-VPR coding sequence nt 748-3249; and linker at nt 3250-3277.
  • SEQ ID NOS: 161 and 162 are exemplary constructs that can be used to express a full-length humanized Cas9 Prime Editor (Prime Editor) coding sequence in vivo.
  • SEQ ID NO: 161 encodes the N-terminal Prime Editor sequence as follows: Human CMV enhancer and promoter nt 1-522; putative transcription start site nt 523; 5’ untranslated region including Kozak sequence nt 523-543; 5’ Prime Editor coding sequence nt 544-3894; 5’ synthetic intron sequence nt 3895-3992; 5’ trimodal kissing loop dimerization domain nt 3993-4104; linker nt 4105-4112; poly adenylation signal nt 4112-4161.
  • SEQ ID NO: 162 encodes the C-terminal Prime Editor sequence as follows: Human CMV enhancer and promoter nt 1-522; putative transcription start site nt 523; 3’ trimodal kissing loop dimerization domain nt 525-636; 3’ synthetic intron sequence nt 637-747; 3’ Prime Editor coding sequence nt 748- 3750; linker nt 3751-3778; poly adenylation signal nt 3779-3911.
  • SEQ ID NOS: 163 and 164 are exemplary constructs that can be used to express a full-length humanized Cytosine Base Editor (AncBE4) coding sequence in vivo.
  • SEQ ID NO: 163 encodes the N- terminal AncBE4 sequence as follows: Human CMV enhancer and promoter nt 1-522; putative transcription start site nt 523; 5’ untranslated region including Kozak sequence nt 523-540; 5’ AncBE4 coding sequence nt 541-2892; 5’ synthetic intron sequence nt 2893-2990; 5’ trimodal kissing loop dimerization domain nt 2991-3102; linker nt 3103-3110; poly adenylation signal nt 3111-3159.
  • SEQ ID NO: 164 encodes the C-terminal AncBE4 sequence as follows: Human CMV enhancer and promoter nt 1-522; putative transcription start site nt 523; 3’ trimodal kissing loop dimerization domain nt 525- 636; 3’ synthetic intron sequence nt 637-747; 3’ AncBE4 coding sequence nt 748-3957; linker nt 3958- 3982; poly adenylation signal nt 3983-4115.
  • SEQ ID NOS: 165 and 166 are exemplary constructs that can be used to express a full-length humanized Adenine Base Editor (Abe8e) coding sequence in vivo.
  • SEQ ID NO: 165 encodes the N- terminal Abe8e sequence as follows: Human CMV enhancer and promoter nt 1-522; putative transcription start site nt 523; 5’ untranslated region including Kozak sequence nt 523-540; 5’ Abe8e coding sequence nt 541-2706; 5’ synthetic intron sequence nt 2707-2804; 5’ trimodal kissing loop dimerization domain nt 2805-2916; linker nt 2917-2924; poly adenylation signal nt 2925-2973.
  • SEQ ID NO: 166 encodes the C-terminal Abe8e sequence as follows: Human CMV enhancer and promoter nt 1-522; putative transcription start site nt 523; 3’ trimodal kissing loop dimerization domain nt 525- 636; 3’ synthetic intron sequence nt 637-747; 3’ Abe8e coding sequence nt 748-3399; linker nt 3400- 3427; poly adenylation signal nt 3428-3560.
  • SEQ ID NO: 167 is an exemplary kissing loop domain (GATTTTTGACCTGCTCGATTGTCCACTGCGAGCAGGTCTTTTGGAGTCGGGCGAGGCGGA AGCCCGACTCCTTTTGGCATGCACGCTAGCCGCGTCGTGCATGCCTTTTATC).
  • SEQ ID NO: 168 is an exemplary ISE, M2 (GGGTTATGGGACC).
  • SEQ ID NO: 169 is an exemplary ISE, cTNT (GGCT GAGGGAAGGACT GTCCT GGG) .
  • SEQ ID NO: 170 is an exemplary DISE, Rat FGFR2 (CTCTTTCTTTCCATGGGTTGGCCT).
  • SEQ ID NOS: 171 and 172 are exemplary constructs that can be used to express a full-length YFP coding sequence.
  • SEQ ID NO: 171 encodes the N-terminal YFP sequence as follows: Human CMV enhancer and promoter nt 1-522; putative transcription start site nt 523; 5’ untranslated region including Kozak sequence nt 523-543; 5’ Stuffer open reading frame nt 544-3654; self cleaving 2A sequence nt 3655-3729; 5’ yellow fluorescent protein segment nt 3730-4224; 5’ synthetic intron sequence (variable) nt 4225-4294; 5’ trimodal kissing loop dimerization domain (uppercase): 4295- 4406; linker nt 4407-4414; poly adenylation signal nt 4415-4463.
  • SEQ ID NO: 172 encodes the C- terminal YFP sequence as follows: Name: 3’ intron screening split YFP; Human CMV enhancer and promoter nt 1-522; Putative transcription start site nt 523; 3’ trimodal kissing loop dimerization domain nt 525-636; 3’ synthetic intron sequence (variable) nt 637-706; 3’ yfp coding sequence nt 707-940; self cleaving 2A sequence nt 941-1006; 3’ stuffer open reading frame nt 1007-4228; linker nt 4229-4265; poly adenylation signal nt 4257-4388.
  • SEQ ID NOS: 173-180 are exemplary intronic splicing enhancer sequences.
  • SEQ ID NO: 181 is a scrambled sequence.
  • SEQ ID NOS: 182-196 are exemplary intronic splicing enhancer sequences.
  • SEQ ID NO: 197-198 are scrambled sequences.
  • SEQ ID NOS: 199-203 are exemplary intronic splicing enhancer sequences.
  • SEQ ID NO: 204 is a scrambled sequence.
  • SEQ ID NO: 205 is an exemplary branch point sequence (TACTAACA).
  • SEQ ID NO: 206 is an exemplary polyadenylation signal A AT A A AAT AT CTTT ATTTT C ATT AC AT CTGT GT GTT GGTTTTTT GT GT G. DETAILED DESCRIPTION
  • nucleic acid molecule means “including a nucleic acid molecule” without excluding other elements. It is further to be understood that any and all base sizes given for nucleic acids are approximate, and are provided for descriptive purposes, unless otherwise indicated. Although many methods and materials similar or equivalent to those described herein can be used, particular suitable methods and materials are described below. In case of conflict, the present specification, including explanations of terms, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting. All references, including patent applications and patents, and GenBank Accession Nos., are herein incorporated by reference in their entireties.
  • Administration To provide or give a subject an agent, such as a therapeutic nucleic acid molecule provided herein, or other therapeutic agent, by any effective route.
  • routes of administration include, but are not limited to, injection (such as subcutaneous, intramuscular, intradermal, intraperitoneal, intrathecal, intratumoral, intraosseous, and intravenous), transdermal, intranasal, and inhalation routes. Administration can be systemic or local.
  • Aptamer Nucleic acid molecules (such as DNA or RNA) that bind a specific target agent or molecule with high affinity and specificity. Aptamers can be used in the disclosed nucleic acid molecules as a dimerization domain. In one example, two aptamers can bind to each other, e.g., by standard basepairing, non-canonical base pair interactions, non-base pairing interactions, or a combination thereof, to mediate dimerization. In one example, aptamers allow RNA dimerization (and subsequent recombination) only in the presence of one or more targets recognized by the aptamer.
  • DNA or RNA molecules that are capable of binding a target molecule of interest are selected from a nucleic acid library consisting of 10 14 -10 15 different sequences through iterative steps of selection, amplification and mutation.
  • aptamers are available that recognize metal ions such as Zn(II) (Ciesiolka et al, RNA 1: 538-550, 1995) and Ni(II) (Hofmann et al, RNA, 3:1289-1300, 1997); nucleotides such as adenosine triphosphate (ATP) (Huizenga and Szostak, Biochemistry, 34:656-665, 1995); and guanine (Kiga et al, Nucleic Acids Res., 26:1755-60, 1998); co-factors such as NAD (Kiga et al, Nucleic Acids Res., 26:1755-60, 1998) and flavin (Lauhon and Szostak, J. Am.
  • metal ions such as Zn(II) (Ciesiolka et al, RNA 1: 538-550, 1995) and Ni(II) (Hofmann et al, RNA, 3:1289-1300, 1997); nucleo
  • toxins such as cholera whole toxin and staphylococcal enterotoxin B (Bruno and Kiel, BioTechniques, 32: pp. 178-180 and 182-183, 2002); and bacterial spores such as the anthrax (Bruno and Kiel, Biosensors & Bioelectronics , 14:457-464, 1999).
  • Binding An association between two substances or molecules, such as the hybridization of one nucleic acid molecule to another (or itself), such as between two dimerization domains, or the binding of an aptamer to its target.
  • An oligonucleotide molecule binds or stably binds to another nucleic acid molecule if there are a sufficient number of complementary base pairs between the oligonucleotide molecule and the target nucleic acid to permit detection of that binding.
  • binding between nucleic acid molecules may occur directly.
  • binding between nucleic acid molecules may occur indirectly, e.g., through an intermediate molecule.
  • Either direct binding or indirect binding may occur by standard base pairing, by non-canonical base pair interactions, by non-base pair interactions, or a combination thereof.
  • Non-canonical base pair interactions may occur by any means of stabilization known to those of skill in the art, including but not limited to Hoogsteen base pairs and wobble base pairs.
  • Non-base pair interactions can include binding through an intermediate molecule.
  • direct binding is between kissing loop dimerization domains.
  • direct binding is between hypodiverse dimerization domains.
  • direct binding is between aptamer regions.
  • direct binding between aptamer regions involves non-canonical base pair interactions.
  • direct binding between aptamer regions involves standard base pairing and non-canonical base pair interactions.
  • indirect binding occurs through a nucleic acid bridge.
  • the nucleic acid bridge is an mRNA.
  • a nonlimiting example of a nucleic acid bridge is depicted in Fig. 7B.
  • indirect binding occurs through an aptamer molecule.
  • a nonlimiting example of indirect binding through an aptamer molecule is depicted in Fig. 7A.
  • indirect binding through an aptamer molecule involves non-base pair interactions between the aptamer molecule and the binding regions.
  • indirect binding through an aptamer molecule involves non-base pair interactions between the aptamer molecule and the binding regions, and base pairing interactions between the binding regions.
  • C-terminal portion A region of a protein sequence that includes a contiguous stretch of amino acids that begins at or near the C-terminal residue of the protein.
  • a C-terminal portion of the protein can be defined by a contiguous stretch of amino acids (e.g ., a number of amino acid residues).
  • Cancer A malignant tumor characterized by abnormal or uncontrolled cell growth. Other features often associated with cancer include metastasis, interference with the normal functioning of neighboring cells, release of cytokines or other secretory products at abnormal levels and suppression or aggravation of inflammatory or immunological response, invasion of surrounding or distant tissues or organs, such as lymph nodes, etc.
  • Metastatic disease refers to cancer cells that have left the original tumor site and migrate to other parts of the body for example via the bloodstream or lymph system.
  • Complementarity The ability of a nucleic acid to form hydrogen bond(s) with another nucleic acid sequence by either traditional Watson-Crick base pairing or other non-traditional types.
  • a percent complementarity indicates the percentage of residues in a nucleic acid molecule which can form hydrogen bonds (e.g., Watson-Crick base pairing) with a second nucleic acid sequence (e.g., 5, 6, 7, 8,
  • “Perfectly complementary” means that all the contiguous residues of a nucleic acid sequence will hydrogen bond with the same number of contiguous residues in a second nucleic acid sequence.
  • “Substantially complementary” as used herein refers to a degree of complementarity that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% over a region of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, or more nucleotides, or refers to two nucleic acids that hybridize under stringent conditions.
  • a first dimerization domain and a second dimerization domain have perfect complementary to one another (e.g., 100%).
  • a first dimerization domain and a second dimerization domain are substantially complementary to one another ( e.g ., at least 80%).
  • Contacting can occur in vitro or ex vivo, for example, by adding a reagent to a sample (such as one containing cells), or in vivo by administering to a subject.
  • Downregulated or knocked down When used in reference to the expression of a molecule, such as a target nucleic acid or protein, refers to any process which results in a decrease in production of the target RNA or protein, but in some examples not complete elimination of the target RNA product or target RNA function. In one example, downregulation or knock down does not result in complete elimination of detectable target nucleic acid/protein expression or activity. In some examples, downregulation or knock down of a target nucleic acid includes processes that decrease translation of the target RNA and thus can decrease the presence of corresponding proteins. The disclosed system can be used to downregulate any target nucleic acid/protein of interest.
  • Downregulation or knock down includes any detectable decrease in the target nucleic acid/protein.
  • detectable target nucleic acid/protein in a cell or cell free system decreases by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% (such as a decrease of 40% to 90%, 40% to 80% or 50% to 95%) as compared to a control (such an amount of target nucleic acid/protein detected in a corresponding untreated cell or sample).
  • a control is a relative amount of expression in a normal cell (e.g., a non-recombinant cell that does not include a nucleic acid molecule for RNA recombination provided herein).
  • Effective amount The amount of an agent (such as a system providing multiple vectors, each encoding a different portion of a therapeutic protein, such as dystrophin) that is sufficient to effect beneficial or desired results.
  • An effective amount also can refer to an amount of correctly joined RNA or therapeutic protein produced that is sufficient to effect beneficial or desired results.
  • An effective amount may vary depending upon one or more of: the subject and disease condition being treated, the weight and age of the subject, the severity of the disease condition, the manner of administration and the like, which can be determined by one of ordinary skill in the art.
  • the beneficial therapeutic effect can include enablement of diagnostic determinations; amelioration of a disease, symptom, disorder, or pathological condition; reducing or preventing the onset of a disease, symptom, disorder or condition; and generally counteracting a disease, symptom, disorder or pathological condition.
  • an “effective amount” of two or more synthetic nucleic acid molecules provided herein sufficient to treat a disease, such as a genetic disease or cancer.
  • an “effective amount” of two or more synthetic nucleic acid molecules provided herein is amount sufficient to increase the survival time of a treated patient, for example by at least 10%, at least 20%, at least 25%, at least 50%, at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, at least 99%, at least 100%, at least 200%, at least 300%, at least 400%, at least 500%, or at least 600% (as compared to no administration of the two or more synthetic nucleic acid molecules provided herein).
  • an “effective amount” of two or more synthetic nucleic acid molecules provided herein is an amount sufficient to increase the survival time of a treated patient, for example by at least 6 months, at least 9 months, at least 1 year, at least 1.5 years, at least 2 years, at least 2.5 years, at least 3 years, at least 4 years, at least 5 years, at least 10 years, at least 12 years, at least 15 years, or at least 20 years (as compared to no administration of the two or more synthetic nucleic acid molecules provided herein).
  • an “effective amount” of two or more synthetic nucleic acid molecules provided herein is an amount sufficient to increase mobility of a treated patient (such as a DMD patient), for example by at least 10%, at least 20%, at least 25%, at least 50%, at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, at least 99%, at least 100%, at least 200%, at least 300%, at least 400%, at least 500%, or at least 600% (as compared to no administration of the two or more synthetic nucleic acid molecules provided herein).
  • an “effective amount” of two or more synthetic nucleic acid molecules provided herein is an amount sufficient to increase mobility of a treated patient (such as a DMD patient), for example by at least 10%, at least 20%, at least 25%, at least 50%, at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, at least 99%, at least 100%, at least 200%, at least 300%, at least 400%, at least 500%, or at least 600% (as compared to no administration of the two or more synthetic nucleic acid molecules provided herein).
  • an “effective amount” of two or more synthetic nucleic acid molecules provided herein is an amount sufficient to increase cognitive ability of a treated patient (such as a DMD patient), for example by at least 10%, at least 20%, at least 25%, at least 50%, at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, at least 99%, at least 100%, at least 200%, at least 300%, at least 400%, at least 500%, or at least 600% (as compared to no administration of the two or more synthetic nucleic acid molecules provided herein).
  • an “effective amount” of two or more synthetic nucleic acid molecules provided herein is an amount sufficient to increase respiratory function of a treated patient (such as a DMD patient), for example by at least 10%, at least 20%, at least 25%, at least 50%, at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, at least 99%, at least 100%, at least 200%, at least 300%, at least 400%, at least 500%, or at least 600% (as compared to no administration of the two or more synthetic nucleic acid molecules provided herein).
  • an “effective amount” of two or more synthetic nucleic acid molecules provided herein is an amount sufficient to increase blood clotting of a treated patient (such as a hemophilia patient), for example by at least 10%, at least 20%, at least 25%, at least 50%, at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, at least 99%, at least 100%, at least 200%, at least 300%, at least 400%, at least 500%, or at least 600% (as compared to no administration of the two or more synthetic nucleic acid molecules provided herein).
  • an “effective amount” of two or more synthetic nucleic acid molecules provided herein is an amount sufficient to increase vision of a treated patient (such as a Usher or Stargardt patient), for example by at least 10%, at least 20%, at least 25%, at least 50%, at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, at least 99%, at least 100%, at least 200%, at least 300%, at least 400%, at least 500%, or at least 600% (as compared to no administration of the two or more synthetic nucleic acid molecules provided herein).
  • a treated patient such as a Usher or Stargardt patient
  • an “effective amount” of two or more synthetic nucleic acid molecules provided herein is an amount sufficient to increase hearing of a treated patient (such as a Usher patient), for example by at least 10%, at least 20%, at least 25%, at least 50%, at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, at least 99%, at least 100%, at least 200%, at least 300%, at least 400%, at least 500%, or at least 600% (as compared to no administration of the two or more synthetic nucleic acid molecules provided herein).
  • an “effective amount” of two or more synthetic nucleic acid molecules provided herein is an amount sufficient to reduce calf muscle size of a treated DMD patient, for example by at least 10%, at least 20%, at least 25%, at least 50%, at least 70%, at least 75%, at least 80%, at least 90%, or at least 95% (as compared to no administration of the two or more synthetic nucleic acid molecules provided herein).
  • an “effective amount” of two or more synthetic nucleic acid molecules provided herein is an amount sufficient to reduce cardiomyopathy muscle size of a treated DMD patient, for example by at least 10%, at least 20%, at least 25%, at least 50%, at least 70%, at least 75%, at least 80%, at least 90%, or at least 95% (as compared to no administration of the two or more synthetic nucleic acid molecules provided herein). In some examples, combinations of these effects are achieved.
  • Increase or Decrease A statistically significant positive or negative change, respectively, in quantity from a control value (such as a value representing no therapeutic agent, such as no administration of the two or more synthetic nucleic acid molecules provided herein).
  • An increase is a positive change, such as an increase at least 50%, at least 100%, at least 200%, at least 300%, at least 400% or at least 500% as compared to the control value.
  • a decrease is a negative change, such as a decrease of at least 20%, at least 25%, at least 50%, at least 75%, at least 80%, at least 90%, at least 95%, at least 98%, at least 99%, or at least 100% decrease as compared to a control value. In some examples the decrease is less than 100%, such as a decrease of no more than 90%, no more than 95%, or no more than 99%.
  • Hybridization of a nucleic acid occurs when two nucleic acid molecules undergo an amount of hydrogen bonding to each other.
  • the stringency of hybridization can vary according to the environmental conditions surrounding the nucleic acids, the nature of the hybridization method, and the composition and length of the nucleic acids used. Calculations regarding hybridization conditions required for attaining particular degrees of stringency are discussed in Sambrook et al, Molecular Cloning: A Laboratory Manual (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 2001); and Tijssen, Laboratory Techniques in Biochemistry and Molecular Biology Hybridization with Nucleic Acid Probes Part I, Chapter 2 (Elsevier, New Y ork, 1993 ).
  • the T m is the temperature at which 50% of a given strand of nucleic acid is hybridized to its complementary strand.
  • Isolated An “isolated” biological component (such as a nucleic acid molecule or a protein) has been substantially separated, produced apart from, or purified away from other biological components in the cell or tissue of an organism in which the component occurs, such as other cells ( e.g ., RBCs), chromosomal and extrachromosomal DNA and RNA, and proteins.
  • Nucleic acids and proteins that have been “isolated” include nucleic acids and proteins purified by standard purification methods. The term also embraces nucleic acids and proteins prepared by recombinant expression in a host cell as well as chemically synthesized nucleic acids and proteins.
  • Kissing loop/kissing stem loop An RNA structure that forms when bases between two hairpin loops form pair interactions. These intermolecular “kissing interactions” occur when the unpaired nucleotides in one hairpin loop, base pair with the unpaired nucleotides in another hairpin loop to form a stable interaction complex. See FIG. 9A for an example.
  • N-terminal portion A region of a protein sequence that includes a contiguous stretch of amino acids that begins at the N-terminal residue of the protein.
  • An N-terminal portion of the protein can be defined by a contiguous stretch of amino acids (e.g., a number of amino acid residues).
  • Non-naturally occurring, synthetic, or engineered Terms used herein as interchangeably and indicate the involvement of the hand of man.
  • the terms, when referring to nucleic acid molecules or polypeptides indicate that the nucleic acid molecule or the polypeptide is at least substantially free from at least one other component with which they are naturally associated in nature and as found in nature.
  • the terms can indicate that the nucleic acid molecules or polypeptides have a sequence not found in nature.
  • Nucleic acid molecule A deoxyribonucleotide (DNA) or ribonucleotide (RNA) polymer, which can include natural nucleotides/ribonucleotides and/or analogues of natural nucleotides/ribonucleotides that hybridize to nucleic acid molecules in a manner similar to naturally occurring nucleotides.
  • a nucleic acid molecule can be a single stranded (ss) DNA or RNA molecule or a double stranded (ds) nucleic acid molecule.
  • RNA or mRNA as used herein may refer to a pre-mRNA molecule, or a mature RNA transcript.
  • a pre-mRNA molecule comprises sequences to be removed by processing, e.g., intron sequences removed by splicing following binding of the dimerization domains described herein.
  • Nucleic acid molecules described herein can be DNA molecules from which an RNA is transcribed from a promoter on the DNA, e.g., in the context of a DNA expression vector. Operably linked: A first nucleic acid sequence is operably linked with a second nucleic acid sequence when the first nucleic acid sequence is placed in a functional relationship with the second nucleic acid sequence.
  • a promoter sequence is operably linked to a nucleic acid sequence if the promoter affects the expression of the nucleic acid sequence, for example, the promoter effects transcription of a pre-mRNA, which when spliced may result in expression of a protein (such as a portion of a DMD, factor 8, factor 9, or ABCA4 coding sequence).
  • compositions and formulations suitable for pharmaceutical delivery of a therapeutic agent such as a nucleic acid molecule disclosed herein.
  • parenteral formulations usually comprise injectable fluids that include pharmaceutically and physiologically acceptable fluids such as water, physiological saline, balanced salt solutions, aqueous dextrose, glycerol or the like as a vehicle.
  • pharmaceutical compositions to be administered can contain minor amounts of non-toxic auxiliary substances, such as wetting or emulsifying agents, preservatives, and pH buffering agents and the like, for example sodium acetate or sorbitan monolaurate.
  • Polypeptide, peptide and protein refer to polymers of amino acids of any length.
  • the polymer may be linear or branched, it may include modified amino acids, and it may be interrupted by non-amino acids.
  • the terms also encompass an amino acid polymer that has been modified; for example, disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation, such as conjugation with a labeling component.
  • amino acid includes natural and/or unnatural or synthetic amino acids, including glycine and both the D or L optical isomers, and amino acid analogs and peptidomimetics.
  • a protein is one associated with disease, such as a genetic disease ( e.g ,.
  • a protein is a therapeutic protein, such as one used in the treatment of a disease, such as cancer.
  • a protein is at least 50 aa in length, at least 100 aa in length, at least 500 aa in length, at least 1000 aa in length, at least 1500 aa in length, such as at least 2000 aa, at least 2500 aa, at least 3000 aa, or at least 5000 aa.
  • Polypyrimidine tract A region of pre-messenger RNA (mRNA) that promotes the assembly of the spliceosome, the protein complex specialized for carrying out RNA splicing during the process of post-transcriptional modification.
  • This tract can be primarily pyrimidine nucleotides, such as uracil, and in some examples is 15-20 base pairs long, located about 5-40 base pairs before the 3' end of the intron to be spliced.
  • Promoter/Enhancer An array of nucleic acid control sequences which direct transcription of a nucleic acid sequence.
  • a promoter includes necessary nucleic acid sequences near the start site of transcription, such as, in the case of a polymerase II type promoter, a TATA element.
  • a promoter also optionally includes distal enhancer or repressor elements which can be located as much as several thousand base pairs from the start site of transcription.
  • a promoter sequence + its corresponding coding sequence is larger than the capacity for an AAV.
  • a promoter sequence of a target protein is at least 3500 nt, at least 4000 nt, at least 5000 nt, or even at least 6000 nt.
  • a “constitutive promoter” is a promoter that is continuously active and is not subject to regulation by external signals or molecules.
  • the activity of an “inducible promoter” is regulated by an external signal or molecule (for example, a transcription factor).
  • an external signal or molecule for example, a transcription factor.
  • a tissue-specific promoter can be used in the methods and systems provided herein, for example to direct expression primarily in a desired tissue or cell of interest, such as muscle, neuron, bone, skin, blood, specific organs (e.g., liver, pancreas), or particular cell types (e.g., lymphocytes).
  • a promoter used herein is endogenous to the target protein expressed.
  • a promoter used herein is exogenous to the target protein expressed.
  • promoter elements which are sufficient to render promoter-dependent gene expression controllable for cell-type specific, tissue-specific, or inducible by external signals or agents; such elements may be located in the 5' or 3' regions of the gene. Promoters produced by recombinant DNA or synthetic techniques can also be used to provide for transcription of the nucleic acid sequences.
  • Exemplary promoters that can be used with the methods and systems provided herein include, but are not limited to an SV40 promoter, cytomegalovirus (CMV) promoter (optionally with the CMV enhancer), a pol PI promoter (e.g., U6 and HI promoters), a pol II promoter (e.g., the retroviral Rous sarcoma virus (RSV) LTR promoter (optionally with the RSV enhancer), the dihydrofolate reductase promoter, the b-actin promoter, the phosphoglycerol kinase (PGK) promoter, and the EF1 a promoter).
  • CMV cytomegalovirus
  • a pol PI promoter e.g., U6 and HI promoters
  • a pol II promoter e.g., the retroviral Rous sarcoma virus (RSV) LTR promoter (optionally with the RSV enhancer)
  • a recombinant nucleic acid molecule or protein sequence is one that has a sequence that is not naturally occurring or has a sequence that is made by an artificial combination of two otherwise separated segments of sequence (e.g., a viral vector that includes a portion of a dystrophin coding sequence, such as about a third, half, or two-thirds of a coding sequence).
  • This artificial combination can be accomplished by, for example, chemical synthesis or the artificial manipulation of isolated segments of nucleic acids, such as by genetic engineering techniques.
  • a recombinant or transgenic cell is one that contains a recombinant nucleic acid molecule.
  • Sequence identity The similarity between amino acid (or nucleotide) sequences is expressed in terms of the similarity between the sequences, otherwise referred to as sequence identity. Sequence identity is frequently measured in terms of percentage identity (or similarity or homology); the higher the percentage, the more similar the two sequences are.
  • NCBI Basic Local Alignment Search Tool (BLAST) (Altschul et al., J. Mol. Biol. 215:403, 1990) is available from several sources, including the National Center for Biotechnology Information (NCBI, Bethesda, MD) and on the internet, for use in connection with the sequence analysis programs blastp, blastn, blastx, tblastn and tblastx. A description of how to determine sequence identity using this program is available on the NCBI website on the internet.
  • Variants of a native protein or coding sequence are typically characterized by possession of at least about 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity counted over the full length alignment with the amino acid sequence using the NCBI Blast 2.0, gapped blastp set to default parameters.
  • the Blast 2 sequences function is employed using the default BLOSUM62 matrix set to default parameters, (gap existence cost of 11, and a per residue gap cost of 1).
  • sequence identity When aligning short peptides (fewer than around 30 amino acids), the alignment should be performed using the Blast 2 sequences function, employing the PAM30 matrix set to default parameters (open gap 9, extension gap 1 penalties). Proteins with even greater similarity to the reference sequences will show increasing percentage identities when assessed by this method, such as at least 95%, at least 98%, or at least 99% sequence identity.
  • homologs and variants When less than the entire sequence is being compared for sequence identity, homologs and variants will typically possess at least 80% sequence identity over short windows of 10-20 amino acids, and may possess sequence identities of at least 85% or at least 90% or at least 95% depending on their similarity to the reference sequence. Methods for determining sequence identity over such short windows are available at the NCBI website on the internet. These sequence identity ranges are provided for guidance only; it is possible that strongly significant homologs could be obtained that fall outside of the ranges provided.
  • Variants of the disclosed nucleic acid sequences are typically characterized by possession of at least about 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity counted over the full length alignment with the nucleic acid sequence using the NCBI Blast 2.0, gapped blastn set to default parameters.
  • sequence identity ranges are provided for guidance only; it is possible that functional sequences could be obtained that fall outside of the ranges provided.
  • a mammal for example a human. Mammals include, but are not limited to, murines, simians, humans, farm animals, sport animals, and pets.
  • the subject is a non human mammalian subject, such as a monkey or other non-human primate, mouse, rat, rabbit, pig, goat, sheep, dolphin, dog, cat, horse, or cow.
  • the subject is a laboratory animal/organism, such as a mouse, rabbit, or rat.
  • the subject treated using the methods disclosed herein is a human.
  • the subject has genetic disease, such as one listed in Table 1, that can be treated using the methods disclosed herein.
  • the subject treated using the methods disclosed herein is a human subject having a genetic disease.
  • the subject treated using the methods disclosed herein is a human subject having cancer
  • Therapeutic agent refers to one or more molecules or compounds that confer some beneficial effect upon administration to a subject.
  • the disclosed synthetic nucleic acid molecules and systems provided herein are therapeutic agents.
  • the beneficial therapeutic effect can include enablement of diagnostic determinations; amelioration of a disease, symptom, disorder, or pathological condition; reducing or preventing the onset of a disease, symptom, disorder or condition; and generally counteracting a disease, symptom, disorder or pathological condition.
  • a virus or vector “transduces” a cell when it transfers nucleic acid molecules into a cell.
  • a cell is “transformed” or “transfected” by a nucleic acid transduced into the cell when the nucleic acid becomes stably replicated by the cell, either by incorporation of the nucleic acid into the cellular genome, or by episomal replication.
  • nucleic acid molecule can be introduced into such a cell, including transfection with viral vectors, transformation with plasmid vectors, and introduction of naked DNA by electroporation, lipofection, particle gun acceleration and other methods in the art.
  • the method is a chemical method (e.g ., calcium-phosphate transfection), physical method (e.g., electroporation, microinjection, particle bombardment), fusion (e.g., liposomes), receptor-mediated endocytosis (e.g., DNA-protein complexes, viral envelope/capsid-DNA complexes) and biological infection by viruses such as recombinant viruses (Wolff, J.
  • nucleic acid molecules A., ed, Gene Therapeutics, Birkhauser, Boston, USA, 1994.
  • Methods for the introduction of nucleic acid molecules into cells are known (e.g., see U.S. Patent No. 6,110,743). These methods can be used to transduce a cell with the disclosed nucleic acid molecules.
  • Transgene An exogenous gene, for example supplied by a vector, such as AAV.
  • a transgene encodes a portion of a target protein, such as about a third, half, or two-thirds of a target protein, for example operably linked to a promoter sequence.
  • a transgene includes a portion of a dystrophin coding sequence, such as about a third, half, or two -thirds of a dystrophin coding sequence (or other therapeutic coding sequence, such as one encoding a protein listed in Table 1), for example operably linked to a promoter sequence.
  • Treating, Treatment, and Therapy Any success or indicia of success in the attenuation or amelioration of an injury, pathology or condition, including any objective or subjective parameter such as abatement, remission, diminishing of symptoms or making the condition more tolerable to the patient, slowing in the rate of degeneration or decline, making the final point of degeneration less debilitating, improving a subject’s physical or mental well-being, or prolonging the length of survival.
  • the treatment may be assessed by objective or subjective parameters; including the results of a physical examination, blood and other clinical tests, and the like.
  • treatment with the disclosed methods results in a decrease in the number or severity of symptoms associated with a genetic disease, such as increasing the survival time of a treated patient with the genetic disease.
  • treatment with the disclosed methods results in a decrease in the number or severity of symptoms associated with DMD or other genetic disease, such as increasing survival, increasing the mobility (e.g ., walking, climbing), improving cognitive ability, reducing calf muscle size, reduce cardiomyopathy, improving vision, improving hearing, improving blood clotting, or improve respiratory function. In some examples, combinations of these effects are achieved.
  • Tumor, neoplasia, malignancy or cancer A neoplasm is an abnormal growth of tissue or cells which results from excessive cell division. Neoplastic growth can produce a tumor. The amount of a tumor in an individual is the “tumor burden” which can be measured as the number, volume, or weight of the tumor. A tumor that does not metastasize is referred to as “benign.” A tumor that invades the surrounding tissue and/or can metastasize is referred to as “malignant.” A “non-can cerous tissue” is a tissue from the same organ wherein the malignant neoplasm formed, but does not have the characteristic pathology of the neoplasm. Generally, noncancerous tissue appears histologically normal. A “normal tissue” is tissue from an organ, wherein the organ is not affected by cancer or another disease or disorder of that organ. A “cancer-free” subject has not been diagnosed with a cancer of that organ and does not have detectable cancer.
  • Exemplary tumors such as cancers, that can be treated with the disclosed methods and systems include solid tumors, such as breast carcinomas (e.g. lobular and duct carcinomas), sarcomas, carcinomas of the lung (e.g., non-small cell carcinoma, large cell carcinoma, squamous carcinoma, and adenocarcinoma), mesothelioma of the lung, colorectal adenocarcinoma, stomach carcinoma, prostatic adenocarcinoma, ovarian carcinoma (such as serous cystadenocarcinoma and mucinous cystadenocarcinoma), ovarian germ cell tumors, testicular carcinomas and germ cell tumors, pancreatic adenocarcinoma, biliary adenocarcinoma, hepatocellular carcinoma, bladder carcinoma (including, for instance, transitional cell carcinoma, adenocarcinoma, and squamous carcinoma), renal cell adenocarcinoma, endometrial
  • the methods and systems can also be used to treat liquid tumors, such as a lymphatic, white blood cell, or other type of leukemia.
  • the tumor treated is a tumor of the blood, such as a leukemia (for example acute lymphoblastic leukemia (ALL), chronic lymphocytic leukemia (CLL), acute myelogenous leukemia (AML), chronic myelogenous leukemia (CML), hairy cell leukemia (HCL), T-cell prolymphocytic leukemia (T-PLL), large granular lymphocytic leukemia , and adult T-cell leukemia), lymphomas (such as Hodgkin’s lymphoma and non -Hodgkin’s lymphoma), and myelomas).
  • ALL acute lymphoblastic leukemia
  • CLL chronic lymphocytic leukemia
  • AML acute myelogenous leukemia
  • CML chronic myelogenous leukemia
  • HCL hairy cell leuk
  • Upregulated When used in reference to the expression of a molecule, such as a target nucleic acid/protein, refers to any process which results in an increase in production of the target nucleic acid/protein.
  • upregulation or activation of a target RNA includes processes that increase translation of the target RNA and thus can increase the presence of corresponding proteins.
  • Upregulation includes any detectable increase in target nucleic acid/protein.
  • detectable target nucleic acid/protein expression in a cell or cell free system increases by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, at least 100%, at least 200%, at least 400%, or at least 500% as compared to a control (such an amount of target nucleic acid/protein detected in a corresponding sample not treated with a nucleic acid molecule provided herein).
  • a control is a relative amount of expression in a normal cell (e.g., a non-recombinant cell that does not include a system provided herein).
  • a phrase that is used to describe any environment that permits a desired activity is increased expression or activity of a protein needed to treat a disease.
  • the desired activity is treatment of or slowing the progression of a genetic disease such as DMD (or other genetic disease listed in Table 1) in vivo, for example using the disclosed methods and systems.
  • Vector A nucleic acid molecule into which a foreign nucleic acid molecule can be introduced without disrupting the ability of the vector to replicate and/or integrate in a host cell.
  • Vectors include, but are not limited to, nucleic acid molecules that are single-stranded, double-stranded, or partially double-stranded; nucleic acid molecules that comprise one or more free ends, no free ends ( e.g ., circular); nucleic acid molecules that comprise DNA, RNA, or both; and other varieties of polynucleotides.
  • a vector can include nucleic acid sequences that permit it to replicate in a host cell, such as an origin of replication.
  • a vector can also include one or more selectable marker genes and other genetic elements.
  • An integrating vector is capable of integrating itself into a host nucleic acid.
  • An expression vector is a vector that contains the necessary regulatory sequences to allow transcription and translation of inserted gene or genes.
  • vector refers to a circular double stranded DNA loop into which additional DNA segments can be inserted, such as by standard molecular cloning techniques.
  • viral vector refers to a viral vector, wherein virally-derived DNA or RNA sequences are present in the vector for packaging into a virus (e.g., retroviruses, replication defective retroviruses, adenoviruses, replication defective adenoviruses, and adeno-associated viruses).
  • Viral vectors also include polynucleotides carried by a virus for transfection into a host cell.
  • the vector is a lentivirus (such as an integration-deficient lentiviral vector) or adeno-associated viral (AAV) vector.
  • lentivirus such as an integration-deficient lentiviral vector
  • AAV adeno-associated viral
  • the vector is an AAV, such as AAV serotypes AAV9 or AAVrh.10.
  • the vector is one that can penetrate the blood-brain barrier, for example following intravenous administration.
  • the adeno-associated virus serotype rh.lO (AAV.rhlO) vector partially penetrates the blood-brain barrier, providing high levels and spread of transgene expression.
  • gene replacement therapy generally referred to as gene therapy
  • the defective gene is replaced by an intact version of it, delivered through e.g., a viral vector, which achieves sustained expression from months to years.
  • adeno associated viruses AAVs
  • AAVs adeno associated viruses
  • they have a limited packaging capacity (e.g., about less than 5 kb).
  • strategies to overcome this packaging limitation are needed to achieve gene replacement of genes that exceed the about 5 kb size limit.
  • some promoters alone, coding sequences alone, or the combined promoter + coding sequence exceed the about 5 kb size limit of an AAV.
  • such proteins encoded by such promoters and coding sequences can be expressed using the disclosed systems.
  • these natural intron sequences are sequences from naturally occurring introns and are comprised of a mix of all four RNA nucleotides. Such sequences tend to fold up into structures that can obstruct trans -interaction by forming strong intramolecular base pairs rather than being available for intermolecular interactions.
  • these naturally occurring intron sequences have not evolved to strongly attract the spliceosome components, since exon rather than introns drive the exon definition in higher eukaryotes.
  • the inventors developed a novel nucleic acid based element that can be used to efficiently reconstitute the coding sequence of large genes from multiple serial fragments.
  • the disclosed methods and systems differ from prior methods.
  • the disclosed highly efficient synthetic introns utilize an optimal arrangement of RNA elements (or DNA encoding these elements) that efficiently drive the RNA splicing reaction between non-covalently linked RNAs (pre-mRNAs).
  • pre-mRNAs non-covalently linked RNAs
  • the innovation is based on selecting non-natural RNA domains that inherently are incapable of forming strong cis-binding interactions that interfere with trans -interactions with a second RNA having a complementary strand (also having inherently low cis-binding capacity).
  • These optimized dimerization domains and/or synthetic introns can include non-natural sequences ( e.g ., sequences not found in human cells and/or not found in another biological system) used in combination with optimized motifs that facilitate RNA splicing (including splice donor, splice acceptor, splice enhancer, and splice branch point sequences).
  • a synthetic nucleic acid can be a non-natural nucleic acid sequence, e.g., a sequence not found in human cells and/or not found in another biological system).
  • the disclosed method/system promotes a more efficient reaction in which two protein coding RNA fragments are joined together on the pre-mRNA level with less risk of producing recombination products that encode non-functional and/or deleterious products.
  • each individual synthetic RNA molecule includes a synthetic intron sequence, containing a dimerization domain and elements needed for RNA splicing, which upon binding of dimerization domains to one another in the correct order, mediates efficient RNA recombination of individual fragments.
  • reconstitution of a coding sequence from two fragments is achieved by appending a first synthetic intron (A) to the 3 ’ end of the N-terminal coding fragment and a complimentary second synthetic domain (A’) to the 5’ end of the C- terminal coding fragment.
  • RNA molecules are recombined by a cell’s intrinsic RNA splicing machinery (i.e., the spliceosome machinery).
  • the synthetic intron domains contain two functional elements: (1) a dimerization domain to mediate base pairing between the two halves that are to be recombined and (2) a domain optimized to efficiently recruit the splicing machinery to mediate efficient reconstitution of the two RNA molecules.
  • a synthetic intron includes a sequence having at least 50% at least 60%, at least 70%, at least 75%, 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to any synthetic intron provided in SEQ ID NOS: 1, 2, 3, 4, 5, 6,
  • a synthetic intron is an RNA molecule encoded by a sequence having at least 50% at least 60%, at least 70%, at least 75%, 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to any synthetic intron provided in SEQ ID NOS: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12,
  • any of the molecules provided in SEQ ID NOS: 1, 2, 20, 21, 22, 23, 24, 25, 145, 146, 147, 148, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, and 166 can be modified to replace the protein coding portions (e.g., 114 and 164 of FIG. 6A) with another protein coding sequence of interest (e.g., YFP coding sequence of SEQ ID NO: 1, 2, 22 or 23 can be replaced with a therapeutic protein coding sequence).
  • synthetic intron molecules having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to any synthetic intron portion provided in SEQ ID NO: 1, 2, 20, 21, 22, 23, 24, 25, 145, 146, 147, 148, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, and 166 (e.g., nt 3703-3975 of SEQ ID NO: 22 and nt 1-225 of SEQ ID NO: 23).
  • synthetic intron RNA molecules encoded by a sequence having at least 50% at least 60%, at least 70%, at least 75%, 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to any synthetic intron provided in
  • Exemplary dimerization domains were bioinformatically selected to minimize/optimize their internal secondary /tertiary structure.
  • the dimerization domains tested contained long stretches of low diversity nucleotide sequences to avoid intramolecular annealing. By avoiding intramolecular annealing, these dimerization domains are present in an open configuration and therefore are available for pairing with the corresponding complementary dimerization domain sequence.
  • the synthetic intron domains contain intronic splice enhancing elements which lead to efficient recruitment of the splicing machinery.
  • RNA molecules are designed to have at least an open and available single- stranded region that is available to bind to the complementary dimerization domain to allow efficient splicing and recombination of the RNAs. In some examples, this is achieved by utilizing only purines or only pyrimidines for the binding domains. Due to the inability of purines to pair with themselves (and pyrimidines likewise) these stretches of RNA have an open predicted structure.
  • RNA molecules are present as a single strand in the cells. Being single stranded they are inherently prone to hybridize to themselves and thereby form strong secondary and tertiary structures. The most stable base pairs will be G with C, A with U, and the G with U wobble pair. Thermodynamically, the pairing of two bases is favored over an open configuration.
  • two dimerization domains having complementarity to one another are present in an open configuration such that the dimerization domains are available for inter-molecular base pairing.
  • a long stretch of non-diverse sequences containing incompatible bases can be included.
  • a long stretch of pyrimidines i.e., C and T
  • purines i.e., A and G
  • Pyrimidines cannot form canonical base pairs with other pyrimidines
  • purines cannot form canonical base pairs with other purines.
  • Such a stretch of purines or pyrimidines can range from a couple bases to a couple hundreds of bases. Since these stretches cannot intra- molecularly bind, they are available for inter-molecular base pairing with a complementary fragment.
  • the synthetic nucleic acid molecules A and A’ may be configured with A containing a pyrimidine stretch (e.g., 5’-CCUU((7)CCUU-3’) and A’ containing the complementary purine sequence (e.g., 5’-AAGG((7)AAGG-3’).
  • the disclosed synthetic nucleic acid molecules are designed to minimize any off-target binding to incorrect sites in the genome. Off target binding can be reduced by altering the sequence of the nucleic acid molecule.
  • RNA bases can be extended to using stretches of single bases e.g. using a series of Gs that would base pair with a series of Cs and a series of As that would base pair with a series of Us, in the dimerization domains.
  • RNA splicing depends on the recruitment of spliceosome components to the 5’ end of the intron (the splice donor site) and the 3 ’ end of the intron (the splice acceptor site, with its associated branch point sequence and the polypyrimidine tract).
  • Different ribonucleoproteins are recruited to the intron through base pairing of protein associated small nuclear RNA (snRNA) with intronic sequences.
  • snRNA protein associated small nuclear RNA
  • Previously characterized intronic splice enhancer sequences can recruit additional splicing promoting factors that are referred to as intronic splice enhancers.
  • consensus sequences are used instead of using naturally occurring RNA sequences for the RNA splicing sequences.
  • consensus sequences can be used for any of the sequences that are involved in splicing, including splice donor, splice acceptor, splice enhancer and splice branch point sequences.
  • synthetic nucleic acid molecules two (or more) RNA molecules can be serially joined together in a cell ex vivo, in vitro, or in vivo. Outside of the encoded synthetic intronic domains, synthetic nucleic acid molecules can include any promoter and coding sequence.
  • two synthetic nucleic acid molecules could carry two halves of a single gene. This was tested in vitro and in vivo by reconstituting two halves of a yellow fluorescent protein (YFP), and was shown to be efficient (see FIGS. 3A-3D).
  • YFP yellow fluorescent protein
  • the modular nature of the synthetic nucleic acid molecules allowed for testing the efficiency of achieving serial recombination (i.e., >2) of multiple RNA fragments using a combinatorial set of optimized complimentary dimerization domains (FIGS. 4A-4B).
  • a three-way split yellow fluorescent protein was efficiently reconstituted and expressed at high levels in >80% of transfected cells.
  • the synthetic nucleic acid molecules e.g., synthetic DNA molecules, of the inventive compositions, systems, kits, and methods, are produced by transcription of an RNA virus genome by reverse transcriptase.
  • reconstitution efficiency is represented by a measure of correctly joined RNA relative to a control RNA, or a measure of full-length protein or protein activity relative to that of a control protein.
  • control RNA is the unjoined RNA, wherein reconstitution efficiency is represented by a measure of joined RNA relative to unjoined RNA.
  • junction RNA e.g., junction RNA: 3’ RNA
  • reconstitution efficiency is represented by a measure of full-length or active protein relative to a protein fragment or inactive protein.
  • the reconstitution, recombination or splicing efficiency (a measure of the correct joining of the two or more different coding sequences present on different RNA molecules, and/or the production of the desired full-length protein) is about 10% to about 100%.
  • the reconstitution efficiency is about 10% to about 15%, about 10% to about 20%, about 10% to about 25%, about 10% to about 30%, about 10% to about 40%, about 10% to about 50%, about 10% to about 60%, about 10% to about 70%, about 10% to about 80%, about 10% to about 90%, about 10% to about 100%, about 15% to about 20%, about 15% to about 25%, about 15% to about 30%, about 15% to about 40%, about 15% to about 50%, about 15% to about 60%, about 15% to about 70%, about 15% to about 80%, about 15% to about 90%, about 15% to about 100%, about 20% to about 25%, about 20% to about 30%, about 20% to about 40%, about 20% to about 50%, about 20% to about 60%, about 20% to about 70%, about 20% to about 80%, about 20% to about 90%, about 20% to about 100%,
  • the reconstitution efficiency is about 10%, about 15%, about 20%, about 25%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or about 100%. In some examples, the reconstitution efficiency is at least about 10%, about 15%, about 20%, about 25%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, or about 90%. In some examples, the reconstitution efficiency is at most about 15%, about 20%, about 25%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or about 100%.
  • the reconstitution, recombination or splicing efficiency (in this example a measure of the correct joining of two different coding sequences present on different RNA molecules, and/or the production of the desired full-length protein, wherein the two different coding sequences encode a transcript of about 3200 nt to 9000 nt, such as about 4000 to 9000 nt, about 4400 to 9000 nt, about 3200 to 4000 nt, about 3200 to 3600 nt, for example about 4500 nt, about 4000 nt, about 3800 nt, about 3600 nt, or about 3200 nt), is about 10% to about 100%.
  • the reconstitution efficiency using a two-part system is about 10% to about 15%, about 10% to about 20%, about 10% to about 25%, about 10% to about 30%, about 10% to about 40%, about 10% to about 50%, about 10% to about 60%, about 10% to about 70%, about 10% to about 80%, about 10% to about 90%, about 10% to about 100%, about 15% to about 20%, about 15% to about 25%, about 15% to about 30%, about 15% to about 40%, about 15% to about 50%, about 15% to about 60%, about 15% to about 70%, about 15% to about 80%, about 15% to about 90%, about 15% to about 100%, about 20% to about 25%, about 20% to about 30%, about 20% to about 40%, about 20% to about 50%, about 20% to about 60%, about 10% to about 25%, about 10% to about 30%, about 10% to about 40%, about 20% to about 50%, about 20% to about 60%, about 10% to about 25%, about 10% to about 30%, about 10% to about 40%, about 20% to about 50%, about 20% to about 60%, about 10% to about 25%, about 10% to about 30%, about 10% to about 40%, about 10% to about 50%,
  • the reconstitution efficiency is about 10%, about 15%, about 20%, about 25%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or about 100%. In some examples, the reconstitution efficiency is at least about 10%, about 15%, about 20%, about 25%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, or about 90%. In some examples, the reconstitution efficiency is at most about 15%, about 20%, about 25%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or about 100%.
  • the reconstitution, recombination or splicing efficiency (in this example a measure of the correct joining of the two different coding sequences present on different RNA molecules, and/or the production of the desired full-length protein, wherein the two different coding sequences encode a transcript of about 4000 nt), is about 40% to about 60%, such as about 40% to about 50%, about 42% to about 47%, for example about 45%.
  • the reconstitution, recombination or splicing efficiency (in this example a measure of the correct joining of the two different coding sequences present on different RNA molecules, and/or the production of the desired full-length protein, wherein the two different coding sequences encode a transcript of about 3800 nt), is about 40% to about 60%, such as about 40% to about 50%, about 42% to about 47%, for example about 45%.
  • the reconstitution, recombination or splicing efficiency (in this example a measure of the correct joining of the two different coding sequences present on different RNA molecules, and/or the production of the desired full-length protein, wherein the two different coding sequences encode a transcript of about 3600 nt), is about 25% to about 50%, such as about 30% to about 40%, for example about 35%.
  • the reconstitution, recombination or splicing efficiency (in this example a measure of the correct joining of the two different coding sequences present on different RNA molecules, and/or the production of the desired full-length protein, wherein the two different coding sequences encode a transcript of about 3200 nt), is about 25% to about 50%, such as about 30% to about 40%, for example about 35%.
  • the reconstitution, recombination or splicing efficiency (in this example a measure of the correct joining of three different coding sequences present on different RNA molecules, and/or the production of the desired full-length protein, wherein the three different coding sequences encode a transcript of about 3200 nt to about 13,500 nt, such as about 4000 nt to about 5,000 nt, about 4000 nt to about 13,500 nt, about 6000 nt to about 12,000 nt, about 6000 nt to about 10,000 nt, or about 8000 nt to about 12,000 nt, for example up to about 13,500 nt), is about 10% to about 100%.
  • the reconstitution efficiency using a three-part system is about 10% to about 15%, about 10% to about 20%, about 10% to about 25%, about 10% to about 30%, about 10% to about 40%, about 10% to about 50%, about 10% to about 60%, about 10% to about 70%, about 10% to about 80%, about 10% to about 90%, about 10% to about 100%, about 15% to about 20%, about 15% to about 25%, about 15% to about 30%, about 15% to about 40%, about 15% to about 50%, about 15% to about 60%, about 15% to about 70%, about 15% to about 80%, about 15% to about 90%, about 15% to about 100%, about 20% to about 25%, about 20% to about 30%, about 20% to about 40%, about 20% to about 50%, about 20% to about 60%, about 20% to about 70%, about 20% to about 80%, about 20% to about 90%, about 20% to about 100%, about 25% to about 30%, about 25% to about 40%, about 25% to about 50%, about 25% to about 60%, about 25% to about 70%, about 25% to about 80%, about 25% to about 90%, about 25% to about 100%, about 30% to about 40%, about 10% to about
  • the reconstitution efficiency is about 10%, about 15%, about 20%, about 25%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or about 100%. In some examples, the reconstitution efficiency is at least about 10%, about 15%, about 20%, about 25%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, or about 90%. In some examples, the reconstitution efficiency is at most about 15%, about 20%, about 25%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or about 100%.
  • the reconstitution, recombination or splicing efficiency (in this example a measure of the correct joining of four different coding sequences present on different RNA molecules, and/or the production of the desired full-length protein, wherein the four different coding sequences encode a transcript of about 3200 nt to about 18,000 nt, such as about 4000 nt to about 18,000 nt, about 4000 nt to about 5,000 nt, about 10,000 nt to about 18,000 nt, about 15,000 nt to about 18,000nt, or about 12,000 nt to about 15,000 nt, for example up to about 18,000 nt), is about 10% to about 100%.
  • the reconstitution efficiency using a four-part system is about 10% to about 15%, about 10% to about 20%, about 10% to about 25%, about 10% to about 30%, about 10% to about 40%, about 10% to about 50%, about 10% to about 60%, about 10% to about 70%, about 10% to about 80%, about 10% to about 90%, about 10% to about 100%, about 15% to about 20%, about 15% to about 25%, about 15% to about 30%, about 15% to about 40%, about 15% to about 50%, about 15% to about 60%, about 15% to about 70%, about 15% to about 80%, about 15% to about 90%, about 15% to about 100%, about 20% to about 25%, about 20% to about 30%, about 20% to about 40%, about 20% to about 50%, about 20% to about 60%, about 20% to about 70%, about 20% to about 80%, about 20% to about 90%, about 20% to about 100%, about 25% to about 30%, about 25% to about 40%, about 25% to about 50%, about 25% to about 60%, about 25% to about 70%, about 25% to about 80%, about 25% to about 90%, about 25% to about 100%, about 30% to about 40%, about 10% to about
  • the reconstitution efficiency is about 10%, about 15%, about 20%, about 25%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or about 100%. In some examples, the reconstitution efficiency is at least about 10%, about 15%, about 20%, about 25%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, or about 90%. In some examples, the reconstitution efficiency is at most about 15%, about 20%, about 25%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or about 100%. In some examples, the compositions, systems or methods of the disclosure are evaluated by determining an RNA or protein production level using any suitable method known to one of skill in the art.
  • the RNA production level is represented by a measure of correctly joined RNA relative to a control RNA, or a measure of full-length protein relative to a control.
  • the control RNA is a corresponding mutant RNA or an endogenous RNA.
  • the ratio of the amount of joined RNA to the amount of mutant or endogenous RNA produced in the transfected cell is compared with same ratio in nontransfected cells, to determine the production level of the correctly joined RNA.
  • the ratio of the amount of the correctly joined RNA, full-length protein, or the protein activity, to the amount of the control RNA, or the amount or activity of the control protein are compared.
  • the RNA production level achieved is 5% to 100%. In some examples, the RNA production level achieved is about 5% to about 100%. In some examples, the RNA production level achieved is about 5% to about 10%, about 5% to about 20%, about 5% to about 25%, about 5% to about 30%, about 5% to about 40%, about 5% to about 50%, about 5% to about 60%, about 5% to about 70%, about 5% to about 80%, about 5% to about 90%, about 5% to about 100%, about 10% to about 20%, about 10% to about 25%, about 10% to about 30%, about 10% to about 40%, about 10% to about 50%, about 10% to about 60%, about 10% to about 70%, about 10% to about 80%, about 10% to about 90%, about 10% to about 100%, about 20% to about 25%, about 20% to about 30%, about 20% to about 40%, about 20% to about 50%, about 20% to about 60%, about 20% to about 70%, about 20% to about 80%, about 20% to about 90%, about 20% to about 100%, about 25% to about 30%, about 25% to about 40%, about 25% to about
  • the RNA production level achieved is about 5%, about 10%, about 20%, about 25%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or about 100%. In some examples, the RNA production level achieved is at least about 5%, about 10%, about 20%, about 25%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, or about 90%. In some examples, the RNA production level achieved is at most about 10%, about 20%, about 25%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or about 100%.
  • the protein production level is represented by a measure of the amount of full-length protein or protein activity relative to that of a control protein.
  • the control protein is a corresponding mutant protein or an endogenous protein.
  • the ratio of the amount of full-length protein or protein activity to the amount of mutant or endogenous protein produced in the transfected cell is compared with same ratio in nontransfected cells.
  • control protein is the full-length protein produced in, e.g., a cell that is engineered to express a control full-length protein (wherein the cell is not transfected with the inventive constructs) or a non transfected cell from a normal subject that expresses a control full-length protein, and the protein production level is determined by measuring the amount or activity of the protein in the transfected cell and comparing it to that of the control protein.
  • control protein is a mutant form of the protein, produced in a cell that is transfected or nontransfected with the construct, and the amount of full-length protein or protein activity is compared with that of the control protein to determine the protein production level.
  • the amount of full-length protein or protein activity is compared with that of an endogenous, or housekeeping, protein to determine the protein production level.
  • the protein production level achieved is about 1% to about 100%. In some examples, the protein production level achieved is about 10% to about 100%. In some examples, the protein production level achieved is about 10% to about 20%, about 10% to about 30%, about 10% to about 40%, about 10% to about 50%, about 10% to about 60%, about 10% to about 70%, about 10% to about 75%, about 10% to about 80%, about 10% to about 85%, about 10% to about 90%, about 10% to about 100%, about 20% to about 30%, about 20% to about 40%, about 20% to about 50%, about 20% to about 60%, about 20% to about 70%, about 20% to about 75%, about 20% to about 80%, about 20% to about 85%, about 20% to about 90%, about 20% to about 100%, about 30% to about 40%, about 30% to about 50%, about 30% to about 60%, about 30% to about 70%, about 30% to about 75%, about 30% to about 80%, about 30% to about 85%, about 30% to about 90%, about 30% to about 100%, about 40% to about 50%, about 40% to about 60%, about 40% to about 70%, about 40% to about 75%, about
  • the protein production level achieved is about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, or about 100%. In some examples, the protein production level achieved is at least about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, or about 90%. In some examples, the protein production level achieved is at most about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, or about 100%.
  • the protein activity level achieved is about 50% to about 100%. In some examples, the protein activity level achieved is about 50% to about 100%. In some examples, the protein activity level achieved is about 50% to about 55%, about 50% to about 60%, about 50% to about 65%, about 50% to about 70%, about 50% to about 75%, about 50% to about 80%, about 50% to about 85%, about 50% to about 90%, about 50% to about 95%, about 50% to about 100%, about 55% to about 60%, about 55% to about 65%, about 55% to about 70%, about 55% to about 75%, about 55% to about 80%, about 55% to about 85%, about 55% to about 90%, about 55% to about 95%, about 55% to about 100%, about 60% to about 65%, about 60% to about 70%, about 60% to about 75%, about 60% to about 80%, about 60% to about 85%, about 60% to about 90%, about 60% to about 95%, about 60% to about 100%, about 65% to about 70%, about 65% to about 75%, about 65% to about 80%, about 60% to about 85%
  • the protein activity level achieved is about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or about 100%. In some examples, the protein activity level achieved is at least about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, or about 95%. In some examples, the protein activity level achieved is at most about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or about 100%.
  • the amount of correctly joined RNA or full-length protein produced in a cell is sufficient to ameliorate or cure a condition or disease in a subject, as understood by one of skill in the art for the particular condition or disease.
  • the amount of correctly joined RNA or full-length protein produced in a cell is an effective amount. In some examples, this amount is equivalent to about 50% to 100% the amount of the RNA or protein produced in a normal cell. In some examples, this amount is equivalent to about 40% to about 100% the amount of the RNA or protein produced in a normal cell.
  • this amount is equivalent to about 40% to about 45%, about 40% to about 50%, about 40% to about 55%, about 40% to about 60%, about 40% to about 65%, about 40% to about 70%, about 40% to about 75%, about 40% to about 80%, about 40% to about 85%, about 40% to about 90%, about 40% to about 100%, about 45% to about 50%, about 45% to about 55%, about 45% to about 60%, about 45% to about 65%, about 45% to about 70%, about 45% to about 75%, about 45% to about 80%, about 45% to about 85%, about 45% to about 90%, about 45% to about 100%, about 50% to about 55%, about 50% to about 60%, about 50% to about 65%, about 50% to about 70%, about 50% to about 75%, about 50% to about 80%, about 50% to about 85%, about 50% to about 90%, about 50% to about 100%, about 55% to about 60%, about 55% to about 65%, about 55% to about 70%, about 55% to about 75%, about 55% to about 80%, about 55% to about
  • this amount is equivalent to about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, or about 100% the amount of the RNA or protein produced in a normal cell. In some examples, this amount is equivalent to about at least about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, or about 90% the amount of the RNA or protein produced in a normal cell.
  • this amount is equivalent to about at most about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, or about 100% the amount of the RNA or protein produced in a normal cell.
  • RNA or protein used to determine recombination efficiency or production level can be made by any suitable method known to those of skill in the art.
  • recombination efficiency or production level is determined by measuring an amount of functional protein expressed, for example by Western blotting.
  • recombination efficiency or production level is determined by measuring the RNA transcript, for example using two probe based quantitative real-time PCR. For example, the first assay spans a sequence fully contained in the 3’ exonic coding sequence (labelled 3’ probe). The second assay spans the junction between the 5’ and the 3’ exonic coding sequence (labelled junction probe). Reconstitution efficiency can be calculated as the ratio of (junction probe count)/(3’ probe count). “Reconstitution efficiency,” “recombination efficiency,” and “splicing efficiency” are used interchangeably herein.
  • a dimerization domain is about 20 to about 1000 nt, or about 50 to about 160 nt, or about 50 to about 500 nt, or about 50 to 1000 nt, wherein reconstitution efficiency results in production of an effective amount of correctly joined RNA or full-length protein. In some examples, a dimerization domain is about 50 to about 160 nt, wherein reconstitution efficiency results in production of an effective amount of correctly joined RNA or full-length protein.
  • Achieving efficient recombination between multiple RNA molecules allows for packaging and delivery of transgenes into AAVs, which exceed the packaging limit of a single AAV.
  • AAV packaging limits represent a major hurdle for gene therapy approaches for diseases caused by the absence/defect of large genes.
  • One application of this system is expression of large disease-causing genes using viral vectors with restricted packaging capacity.
  • Disease and genes include but are not limited to (Disease (gene, OMIM gene identifier)): 1) Duchenne muscular dystrophy and Becker muscular dystrophy (dystrophin, OMIM:300377); 2) Dysferlinopathies (Dysferlin, OMIM:603009); 3) Cystic fibrosis (CFTR, OMIM: 602421); 4) Usher’s Syndrome IB (Myosin VIIA, OMIM:276903); 5) Stargardt disease 1 (ABCA4, OMIM: 601691); 6) Hemophilia A (Coagulation Factor VIII, OMIM:300841); 7) Von Willebrand disease (von Willebrand Factor, OMIM:613160); 8) Marfan Syndrome (Fibrillin 1,
  • OMIM 134797
  • OMIM Von Recklinghausen disease
  • OTOF OMIM: 603681
  • Others are provided in Table 1.
  • Cas9 proteins (such as those exemplified in Examples 20-23, can be expressed using the disclosed systems provided herein, for example to treat genomic point mutations or activate or overexpress genes. Delivery of a transgene can be achieved by splitting it into multiple fragments using the approach provided herein.
  • Additional applications of the disclosed methods and systems include intersectional gene delivery for targeted gene expression.
  • the reconstituted protein will get expressed in an overlapping population of cells that represents the intersection of what either virus would express in on its own.
  • Examples for such an application may include: (1) delivery of two halves (or three thirds, or other portions) of a protein using retrogradely transported viral vectors from two (or more) projection targets to label bifurcating dual projection neurons, (2) delivery of one fragment under the control of a promoter that is active in population A and the second fragment from a promoter active in population B to specifically tag/manipulate the AuB population, (3) delivery of the first half of a protein with a viral vector that has a tropism for population A and the second half with a viral vector that has a tropism for population B to specifically tag/manipulate the AuB population. Or, combinations of these approaches.
  • the dimerization domains are aptamer sequences, for example to facilitate dimerization in the presence of a (a) small molecular trigger recognized by the aptamers, or a (b) protein that is present in the cell binding to the two halves and therefore stimulating dimerization.
  • RNA-RNA interactions necessary for end-joining can be controlled positively or negatively by other nucleotides such as (a) an antisense oligonucleotide sequence with homology to the two halves (ssDNA triggered dimerization).
  • an antisense oligonucleotide having a complementary sequence to both halves bridges the two molecules together, thus facilitating spliceosome mediated recombination of the two molecules
  • an antisense oligonucleotide sequence with homology to one of the two joining-RNAs could occlude RNA- dimerization of the two molecules and serve as an off-switch for gene expression
  • an endogenous cellular RNA with homology to the two halves RNA triggered dimerization
  • a cellular RNA e.g., mRNA or retroelement
  • having a complementary sequence to both halves bridges the two molecules together, thus facilitating spliceosome mediated recombination of the two molecules.
  • molecule, protein, or RNA mediated interactions allow for controllable/fme tuned gene expression levels: Through titrating in molecules that interact with the binding domains (e.g., antisense oligonucleotides, small molecules, endogenous cellular RNAs), dimerization efficiency between the two halves can be modulated to regulate expression levels independent of promoter activity. Such an installment can be used if a narrow range of protein expression levels are needed.
  • binding domains e.g., antisense oligonucleotides, small molecules, endogenous cellular RNAs
  • RNA molecules such as at least two, at least three, at least four, or at least five different RNA molecules (such as 2, 3, 4, 5, 6, 7, 8, 9 or 10 different RNA molecules) using synthetic introns containing dimerization sequences.
  • the disclosed approach does not require extensive protein engineering to find a suitable split point. Reconstitution on an RNA level allows for seamless joining of two fragments of a protein.
  • the disclosed methods and systems allow for large genes (and corresponding proteins), such as those greater than about 4.5 kb, at least 5 kb, at least 5.5 kb, at least 6 kb, at least kb, at least 8 kb, at least 8 kb, at least 10 kb, at least 13.5 kb, or at least 18 kb, to be divided into two or more fragments or portions, which can each be introduced into a cell or subject via separate vectors, such as multiple AAV.
  • the system includes two portions for recombining two RNA molecules, for example wherein the target protein is encoded by at least about 4500 nt to about 9000 nt, such as 4000 nt to 5000 nt.
  • the system includes three portions for recombining three RNA molecules, for example wherein the target protein is encoded by up to about 13,500 nt, such as about 4500 nt to about 13,500 nt or 4000 nt to 5000 nt.
  • the system includes four portions for recombining four RNA molecules, for example wherein the target protein is encoded by up to about 18,000 nt, such as about 4500 nt to about 18,000 nt or 4000 nt to 5000 nt.. This helps to overcome the limited space available in vectors.
  • an endogenous promoter length limits the capability of its corresponding gene to be expressed in an AAV.
  • a coding sequence length limits its capability to be expressed in an AAV.
  • an endogenous promoter length and its coding sequence length limits their capability to be expressed together in an AAV.
  • the disclosed systems can be used to express such long sequences that have been previously difficult to express in AAV.
  • the target protein to be reconstituted is a protein associated with disease, such as a monogenic disease, recessive genetic disease, a disease caused by a mutation in a large gene (e.g ., greater than about 4500 nt, such as those of at least 5 kb, at least 5.5 kb, at least 6 kb, at least kb, at least 8 kb, at least 8 kb, at least 10 kb, at least 13.5 kb, or at least 18 kb), and/or disease caused by a gene (such as a promoter + coding sequence) that exceed AAV’s capacity (e.g,. greater than 5000 nt).
  • a gene such as a promoter + coding sequence
  • hemophilia A (caused by mutations in the F8 gene, 7kb coding region), hemophilia B (caused by mutations in the F9 gene), Duchenne muscular dystrophy (caused by mutations in the dystrophin gene, 11 kb coding region), sickle cell anima (caused by mutation in beta globin domain of hemoglobin, which has a promoter of about 3.5 kb), Stargardt disease (caused by mutations in the ABCA4 gene, 6.9 kb coding region), Usher syndrome (caused by a mutation in MY07A, 7 kb coding region, resulting in hearing loss and visual impairment).
  • the target protein to be reconstituted is one that can treat a disease, such as a cancer, such as a cancer of the breast, lung, prostate, liver, kidney, brain, bone, ovary, uterus, skin, or colon.
  • a disease such as a cancer
  • the therapeutic target protein to be reconstituted is a toxin, such as an AB toxin, such as diphtheria toxin A or pseudomonas exotoxin A, or a form that lacks receptor binding activity ( e.g ., diphtheria toxin DAB389, DAB486, DT388, DT390, or pseudomonas exotoxin A PE38 or PE40).
  • an RNA sequence encoding the target protein and used in the disclosed methods and systems are codon optimized for expression in a target organism or cell, such as codon optimized for expression in a human, canine, pig, feline, mouse, or rat cell.
  • the RNA coding sequence includes preferred codons (e.g., does not include rare codons with low utilization). Codon optimization can be performed by identifying abundant tRNA levels in the target organism or cells.
  • an RNA sequence encoding the protein is de-enriched for cryptic splice donor and acceptor sites to maximize an RNA recombination reaction.
  • a protein is divided into two portions, such as about two equal halves (or other proportions, such as portion A expressing about 1/3 and portion B expressing about 2/3, or portion A expressing about 1/4 and portion B expressing about 3/4, etc.).
  • each portion be the same number of nucleotides (or encode the same number of amino acids).
  • the method can use two synthetic nucleic acid molecules (e.g., RNA or DNA encoding such RNA), one which includes a coding sequence for an N-terminal portion of the protein, and another which includes a coding sequence for a C-terminal portion of the protein.
  • proteins of interest can be divided or split into more than two fragments, such as three fragments.
  • the design principle of the intronic sequences of three RNA molecules is similar to that of the two, but instead a different pair of dimerization domains for one of the two junctions is utilized.
  • an N-terminal protein coding sequence is followed by an intronic sequence with a specific binding domain (e.g., first dimerization sequence)
  • the middle coding sequence includes an intronic sequence with a complementary sequence to the first dimerization sequence (second dimerization sequence).
  • the middle coding fragment is followed by another intronic fragment with another dimerization sequence (third dimerization sequence, different from the second dimerization sequence).
  • the third fragment includes the C-terminal coding sequence of the protein, and includes an intronic region with a dimerization sequence (fourth dimerization sequence) complementary to the third dimerization sequence.
  • the two middle portions may be referred to as a middle portion and a first middle portion, or as a first middle portion and a second middle portion, or as a first middle portion, a second middle portion and a third middle portion, etc., in a way understood to distinguish the respective portions.
  • a desired protein is divided into an N-terminal portion and a C-terminal portion (e.g., divided in roughly half, or unequal apportionment, such as 1/3 and 2/3 or 1/4 and 3/4), which can be reconstituted using the disclosed systems and methods.
  • the system includes at least two synthetic nucleic acid molecules 110, 150.
  • Each nucleic acid molecule 110, 150 can be composed of DNA or RNA (if RNA, promoter 112, 152 are absent).
  • each of 110, 150 is about at least 100 nucleotides/ribonucleotides (nt) in length, such as at least 200, at least 300, at least 500, at least 1000, at least 2000, at least 3000, at least 4000, at least 5000, at least 6000, at least 7000, at least 8000 nt, at least 10,000 nt, such as 200 to 10,000 nt, 200 to 8000 nt, 500 to 5000 nt, or 200 to 1000 nt.
  • the molecules 110, 150 can include natural and/or non -natural nucleotides or ribonucleotides.
  • Molecule 110 is the 5 ’-located molecule of the system, as it includes a splice donor 116.
  • molecule 110 includes a promoter 112 operably linked to a sequence encoding an RNA molecule, the RNA molecule comprising from 5’ to 3’: a coding sequence for an N- terminal portion of the target protein 114, wherein the coding sequence for an N-terminal portion of the target protein 114 comprises a splice junction at a 3’-end of the target protein coding sequence, SD 116, optional DISE 118, optional ISE 120, dimerization domain 122, and optional polyadenylation sequence 124.
  • promoter 112 can be used, such as one that utilizes RNA polymerase II, such as a constitutive or inducible promoter.
  • promoter 112 is a tissue-specific promoter, such as one constitutively active in muscle tissue (such as skeletal or cardiac), optical tissue (such as retinal tissue), inner ear tissue, liver tissue, pancreatic tissue, lung tissue, skin tissue, bone, or kidney tissue.
  • promoter 112 is a cell-specific promoter, such as one constitutively active in a cancer cell, or a normal cell.
  • promoter 112 is an endogenous promoter of the target protein expressed, and in some example is long ( e.g at least 2500 nt, at least 3000 nt, at least 4000 nt, at least 5000 nt, or at least 7500 nt).
  • promoter 112 is at least about 50 nucleotides (nt) in length, such as at least 100, at least 200, at least 300, at least 500, at least 1000, at least 2000, at least 3000, at least 4000, at least 5000, at least 6000, at least 7000, at least 8000 nt, at least 9000 nt, or at least 10,000 nt, such as 50 to 10,000 nt, 100 to 5000 nt, 500 to 5000 nt, or 50 to 1000 nt in length.
  • nt nucleotides
  • molecule 110 is DNA, and is at least 200, at least 300, at least 500, at least 1000, at least 2000, at least 3000, at least 4000, at least 5000, at least 6000, at least 7000, or at least 8000 nt, such as 200 to 10,000 nt, 200 to 8000 nt, 500 to 5000 nt, or 200 to 1000 nt in length.
  • molecule 110 is RNA
  • molecule 110 does not include promoter 112
  • 114 is the RNA encoded by the coding sequence for an N-terminal portion of the target protein.
  • molecule 110 is RNA, does not include promoter 112, and is at least 200, at least 300, at least 500, at least 1000, at least 2000, at least 3000, at least 4000, at least 5000, at least 6000, at least 7000, or at least 8000 nt, such as 200 to 10,000 nt, 200 to 8000 nt, 500 to 5000 nt, or 200 to 1000 nt in length.
  • the molecule 110 (with or without promoter 112) can include natural and/or non-natural nucleotides or ribonucleotides.
  • the splice junction around the 3’ end of the N-terminal coding sequence (or RNA sequence encoded thereby) 114 can match the consensus sequence found in the target cell or organism into which molecules 110, 150 are introduced.
  • the splice junction sequence is AG (adenine -guanine) or UG (uracil -guanine) at position -1 and -2 of the 5’ splice site for U2-dependent introns or AG, UG, CU (cytosine-uracil), or UU for U12-dependent introns.
  • the splice junction is 2 nt in length
  • the 3’ end of the N-terminal coding portion 114 is AG, UG, CU or UU.
  • a DNA molecule encoding a portion of a target protein comprises sequences that encode parts of multiple splice junctions, e.g., at the 3’ end of the DNA molecule encoding the N-terminal portion of the target protein, and at the 5’ end of the DNA molecule encoding the C-terminal portion of the target protein.
  • intronic sequence 130 is about at least 10 nt, such as at least 20 nt, at least 50 nt, at least 100 nt, at least 250 nt, at least 250 nt, at least 300 nt, at least 400 nt, or at least 500 nt in length, such as 20 to 500, 20 to 250,
  • SD splice donor
  • intronic sequence 130 is 3’ to N-terminal coding sequence 114.
  • SD 116 forms a recognition sequence for the spliceosome components to bind to the RNA molecule.
  • the sequence of SD 116 can be a SD consensus sequence found in the target cell or organism into which molecules 110, 150 are introduced.
  • SD 116 is at least 2 nt, such as at least 5 nt, or at least 10 nt in length, such as 2 to 10, 2 to 8, 2 to 5 or 5 to 10 nt.
  • the SD 116 can be used to recruit U2 or U12 dependent splicing machinery.
  • U2 dependent splicing is used in human cells, and the SD 116 sequence includes or is GUAAGUAUU.
  • U12 dependent splicing is used in human cells, and the SD 116 sequence includes or is AUAUCCUUUUUA (SEQ ID NO: 137) or GUAUCCUUUUUA (SEQ ID NO: 138).
  • RNA sequences can be described using nucleotides A,G,T and C, and that DNA sequences can be described using nucleotides A,G,U and C.
  • Intronic sequence 130 optionally includes one or both of a set of splicing enhancer sequences referred to as downstream intronic splice enhancer (DISE) 118 and intronic splice enhancer (ISE) 120, which stimulate action (e.g., increase activity) of the spliceosome.
  • intronic sequence 130 includes at least two splicing enhancer sequences, such as at least 3, at least 4, or at least 5 splicing enhancer sequences.
  • Exemplary splicing enhancer sequences include DISE 118 and ISE 120.
  • inclusion of one or more splicing enhancer sequences 118, 120 in intronic sequence 130 increases splicing efficiency by at least 20%, at least 30%, at least 40%, at least 50%, at least 75%, at least 80%, at least 90% or at least 95%.
  • Exemplary splicing enhancer sequences that can be used are provided in SEQ ID NOS: 26-136, 151, and 152, as well as GGGTTT, GGTGGT, TTTGGG, GAGGGG, GGTATT, GTAACG, GGGGGTAGG, GGAGGGTTT, GGGTGGTGT TTCAT, CCATTT, TTTTAAA, TGCAT, TGCATG, TGTGTT, CTAAC, TCTCT, TCTGT, TCTTT, TGCATG, CTAAC, CTGCT, TAACC, AGCTT, TTCATTA, GTTAG, TTTTGC, ACTAAT, ATGTTT, CTCTG,
  • DISE 118 can be at least 3 nt, at least 4 nt, at least 5 nt, at least 10 nt, at least 25 nt, at least 50 nt, at least 75 nt, or at least 100 nt in length, such as 3 to 10, 3 to 11, 4 to 11, 5 to 11, 10 to 50, 5 to 100, 10 to 25, 10 to 20, or 20 to 75 nt, the sequence of DISE 118 is or comprises
  • CUCUUUCUUUTCCAUGGGUUGGCU SEQ ID NO: 134
  • TGCATG CTAAC, CTGCT, TAACC, AGCTT, TTCATTA, GTTAG, TTTTGC, ACTAAT, ATGTTT or CTCTG.
  • ISE 120 can be about at least 3 nt, at least 4 nt,at least 5 nt, at least 10 nt, such as at least 20 nt, at least 25 nt, at least 30 nt, at least 40 nt, or at least 50 nt in length, such as 3 to 10, 3 to 11, 4 to 11, 5 to 11, 10 to 50, 20 to 25, 10 to 25, 10 to 20, or 20 to 40 nt in length.
  • the sequence of ISE 120 is or comprises GGCUGAGGGAAGGACUGUCCUGGG (SEQ ID NO: 135), GGGUUAUGGGACC (SEQ ID NO: 136), TTCAT, CCATTT, TTTTAAA, TGCAT, TGCATG, TGTGTT, CTAAC, TCTCT, TCTGT, or TCTTT.
  • intronic sequence 130 includes at least two, at least 3, or at least 4 ISEs 120.
  • ISE 120 is or comprises at least one sequence having at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ NO: 173, 174, 175, 176, 177, 178, 179, 180, 182, 183,
  • DISE 118 is or comprises at least one sequence having at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ NO: 173, 174, 175, 176, 177,
  • 201, 202, or 203 such as at least 2, at least 3 of such sequences, such as 1, 2, 3, 4 or 5 of such sequences.
  • Intronic sequence 130 portion of molecule 110 can optionally include at the 3 ’-end a polyadenylation site 124, which terminates transcription of that fragment.
  • polyadenylation sequence 124 is a polyA sequence of at least 15 As, such as 15 to 30 or 15 to 20 As.
  • first dimerization domain 122 (and second dimerization domain 154 of molecule 150) includes a plurality of unpaired nucleotides (that is, unpaired within the structure of the molecule 110 itself). Having unpaired nucleotides in the dimerization domain allows the 5’ (or first) dimerization domain 122 and the 3’ (or second) dimerization domain 154 to interact through base pairing. Through this interaction, molecules 110 and 150 are kept in proximity which prompts the spliceosome to recombine the two molecules by joining the N-terminal coding region (or RNA encoded thereby) 114 and the C terminal coding region (or RNA encoded thereby) 164.
  • dimerization domain 122 includes “hypodiverse sequences,” which contain a limited diversity of nucleotides and are thus unlikely to form stem loops with themselves in the secondary structure of each molecule 110, 150.
  • Such a hypodiverse dimerization domain 122 (and 154) can be a relatively open configuration, independent of the sequences of the DNA encoding the N- and C-terminus of the protein (or RNA encoded thereby) 114, 164.
  • first and second dimerization domain 122, 154 includes hypodiverse sequences interspersed with sequences that can form a stem, which results in local RNA loops that are open and available for basepairing in the absence of pseudoknot formation (FIG. 6B).
  • Exemplary hypodiverse sequences include a repeated series of Us (such as 30 to 500 Us), a repeated series of As (such as 30 to 500 As), a repeated series of Gs (such as 30 to 500 Gs), a repeated series of Cs (such as 30 to 500 Cs), a mixture containing only As and Gs (such as 30 to 500 As and Gs, e.g., AAAGAAGGAA(... ) (SEQ ID NO: 149) which can be repeated), a mixture containing only Cs and Us (such as 30 to 500 Cs and Us, e.g., CUUUCUUUCUU(... ) (SEQ ID NO: 150) which can be repeated).
  • Other exemplary hypodiverse sequences include complementary sequences that form helices flanked by hypodiverse sequences.
  • first and second dimerization domain 122, 154 only include purines or only include pyrimidines.
  • the first dimerization domain 122 only includes purines
  • the second dimerization domain 154 only includes pyrimidines.
  • the first dimerization domain 122 only includes pyrimidines
  • the second dimerization domain 154 only includes purines. Due to the inability of purines to pair with themselves (and pyrimidines likewise) these stretches of RNA have an open predicted structure.
  • first and second dimerization domain 122, 154 do not include cryptic splice acceptors that could compete with RNA recombination, such as sequences similar to the splice donor consensus sequence NNNAGGUNNNN (SEQ ID NO: 151) or NNNUGGUNNNN (SEQ ID NO: 152) (wherein N refers to any nucleotide).
  • first dimerization domain 122 is no more than 1000 nt, such as no more than 750 nt, or more than 500 nt, such as 6 to 1000 nt, 10 to 1000 nt, 20 to 1000 nt, 30 to 1000 nt, 30 to 750 nt, 30 to 500 nt, 50 to 500 nt, 50 to 100 nt, or 100 to 250 nt.
  • first dimerization domain 122 is greater than 50 nt, such as at least 51 nt, at least 100 nt, at least 150 nt, at least 161 nt, or at least 170 nt, such as 51 to 159 nt, 51 to 150 nt, 51 to 120 nt, 51 to 100 nt, or 51 to 70 nt.
  • first dimerization domain 122 is greater than 160 nt, such as at least 161 nt, at least 170 nt, at least 180 nt, at least 200 nt, at least 300 nt, at least 400 nt, at least 500 nt, at least 600 nt, at least 700 nt, at least 800 nt, at least 900 nt, or at least 1000 nt, such as 161 to 100 nt, 161 to 500 nt, 161 to 300 nt, 161 to 200 nt, or 161 to 170 nt. In some examples, first dimerization domain 122 is less than 50 nt, such 6 to 49 nt, 6 to 45 nt, 6 to 40 nt, 6 to 30 nt, 6 to 20 nt, or 6 to 10 nt.
  • a dimerization domain is 20 to 160 nt, 50-500 nt, or 500-1000 nt. In some examples, a dimerization domain is about 20 nt to about 160 nt. In some examples, a dimerization domain is about 20 nt to about 40 nt, about 20 nt to about 50 nt, about 20 nt to about 70 nt, about 20 nt to about 90 nt, about 20 nt to about 100 nt, about 20 nt to about 110 nt, about 20 nt to about 120 nt, about 20 nt to about 130 nt, about 20 nt to about 140 nt, about 20 nt to about 150 nt, about 20 nt to about 160 nt, about 40 nt to about 50 nt, about 40 nt to about 70 nt, about 40 nt to about 90 nt, about 40 nt to about 100 nt, about 40 nt to about 110
  • a dimerization domain is about 20 nt, about 40 nt, about 50 nt, about 70 nt, about 90 nt, about 100 nt, about 110 nt, about 120 nt, about 130 nt, about 140 nt, about 150 nt, or about 160 nt. In some examples, a dimerization domain is at least about 20 nt, about 40 nt, about 50 nt, about 70 nt, about 90 nt, about 100 nt, about 110 nt, about 120 nt, about 130 nt, about 140 nt, or about 150 nt.
  • a dimerization domain is at most about 40 nt, about 50 nt, about 70 nt, about 90 nt, about 100 nt, about 110 nt, about 120 nt, about 130 nt, about 140 nt, about 150 nt, or about 160 nt.
  • a dimerization domain is about 50 nt to about 500 nt. In some examples, a dimerization domain is about 50 nt to about 100 nt, about 50 nt to about 150 nt, about 50 nt to about 200 nt, about 50 nt to about 250 nt, about 50 nt to about 300 nt, about 50 nt to about 350 nt, about 50 nt to about 400 nt, about 50 nt to about 500 nt, about 100 nt to about 150 nt, about 100 nt to about 200 nt, about 100 nt to about 250 nt, about 100 nt to about 300 nt, about 100 nt to about 350 nt, about 100 nt to about 400 nt, about 100 nt to about 500 nt, about 150 nt to about 200 nt, about 150 nt to about 250 nt, about 150 nt to about 300 nt, about 150 nt to about 350
  • a dimerization domain is about 50 nt, about 100 nt, about 150 nt, about 200 nt, about 250 nt, about 300 nt, about 350 nt, about 400 nt, or about 500 nt. In some examples, a dimerization domain is at least about 50 nt, about 100 nt, about 150 nt, about 200 nt, about 250 nt, about 300 nt, about 350 nt, or about 400 nt. In some examples, a dimerization domain is at most about 100 nt, about 150 nt, about 200 nt, about 250 nt, about 300 nt, about 350 nt, about 400 nt, or about 500 nt.
  • the sequence of first and second dimerization domains 122 and 154 are determined by in silico structure prediction screening (e.g ., RNA folding structure prediction is used to screen a library of possible dimerization domain sequences; sequences with a large proportion of unpaired nucleotides in both the dimerization domain and the corresponding anti -dimerization domain are selected), hypodiverse nucleotide design (e.g., dimerization domain designed to include a stretch of hypodiverse sequence, such as a repeat sequence of only U, only A, only C, only G, only R (G and A), or only Y (U and C), the sequence cannot fold onto itself), or empirical screening (e.g., a library of dimerization domains and corresponding anti-dimerization domains are synthesized and screened for maximal recombination efficiency).
  • in silico structure prediction screening e.g ., RNA folding structure prediction is used to screen a library of possible dimerization domain sequences; sequences with a large
  • the sequence of first and second dimerization domains 122, 154 are designed to contain complementary RNA hairpin structures (also called stem loops) that can form strong kissing loop interactions with their counter parts.
  • kissing loops are used when three or more dimerization domains are used to join three or more portions of a coding sequence, such as four or more or five or more dimerization domains, such as 3, 4, 5, 6, 7, 8, 9 or 10 dimerization domains (e.g., FIG. 6E).
  • Each hairpin loop (or stem loop) of a kissing loop is composed of at least two complementary sequences (e.g., form a stem) separated by a region of non-complementary sequence (e.g., form a loop).
  • a dimerization domain can be composed of 1 or more (such as at least 2, at least 3, at least 4, or at least 5, such as 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20) loops. In some examples with multiple loops, all or some of the loops can be repeated. In some examples with multiple loops, all or some loops can be different In some examples, each complementary sequence is about 4 to 100 nt, which are separated by a loop of about 3 to 20 nt.
  • Base-pairing between the two complementary sequences results in a helix (or stem), for example of at least 4 bp, at least 5 bp, at least 10 bp, at least 20 bp, at least 30 bp, at least 40 bp, at least 50 bp, at least 75 bp, at least 90 bp, or at least 100 bp, such as 4 to 100 bp, 5 to 75 bp, or 10 to 50 bp.
  • the loop portion is at least 3 nt, at least 5 nt, at least 10 nt, at least 15 nt, or at least 20 nt, such as 3 to 20 nt, 5 to 15 nt or 5 to 10 nt, wherein the loop is not base paired.
  • Complementary sequences between two hairpin loops result in base pairing, and generation of a kissing loop/kissing stem loop interaction.
  • the complementary sequences between the two hairpin loops occurs between at least 3 nucleotides of one loop with at least 3 nucleotides of a second loop, such as at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 19, or at least 20 nt (such as 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20) of the first loop, with at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 19, or at least 20 nt (such as 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20) of the second loop.
  • a second loop such as at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least
  • the complementary sequences between the two hairpin loops occurs between at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or 100% of the total loop sequence.
  • the stems of the kissing loops are chosen to base pair in trans between the two RNA molecules.
  • the respective stem (or helix) regions of the initial hairpin loops can base pair in trans between the two RNA molecules through strand replacement/invasion and extended duplex formation.
  • up to about 85% of nucleotides can remain unpaired after extended duplex formation (e.g .. about 15% of the nt are paired between the two loops).
  • the kissing loop is based on the HIV-1 DIS loop (SEQ ID NOS: 139 and 140, FIG.
  • the kissing loop is based on the HIV-2 kissing loop dimerization domain (SEQ ID NOS: 141 and 142, FIG. 17B), and includes a G and an A nucleotide on the 5’ side of six nucleotides of complementary sequence followed by three A nucleotides on the 3’ side (e.g., GANNNNNNAAA (SEQ ID NO: 153) where N can be A, U, G, or C).
  • the helix or stem region of a hairpin loop can contain up to 30% of base pairs that are not paired initially (e.g., no more than 30%, no more than 20%, no more than 15%, no more than 10%, no more than 5%, or no more than 1%, such as 1 to 30%, 5 to 30%, 10 to 30%, or 25 to 30% of base pairs are not paired initially). These regions of non-pairing can form bulges, mismatches, or internal loops.
  • loop interaction In addition to an interaction of two hairpin loops (kissing loop interaction), other forms of loop interactions can be utilized for the first and second dimerization domains 122, 154.
  • the loops are bulges, where one strand of a base paired helix contains one or more nucleotides that bulge out from the stem structure.
  • Exemplary bulges are at least 1 nt, at least 2 nt, at least 3 nt, at least 4 nt, at least 5 nt, at least 10 nt or at least 20 nt, such as 1 to 20 nt, 1 to 15 nt, 1 to 10 nt, or 5 to 10 nt, or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 nt.
  • the loops are internal loops, for example, where 1 or more nucleotides in a helix are mismatched, resulting in a helix interrupted by an internal loop at the positions of mismatch.
  • the helix is at least 4 nt on each of the strands ( e.g ., at least 5 nt, at least 10 nt, at least 20 nt, at least 30 nt, at least 40 nt, at least 50 nt, at least 75 nt, at least 90 nt, or at least 100 nt, such as 4 to 100 nt, 5 to 75 nt, or 10 to 50 nt.
  • the loops are multi -branched loops, wherein three helices or stems from a triangle with one or more unpaired nucleotides connecting the three helices.
  • each of the helices is at least 4 bp (e.g., at least 5 bp, at least 10 bp, at least 20 bp, at least 30 bp, at least 40 bp, at least 50 bp, at least 75 bp, at least 90bp, or at least 100 bp, such as 4 to 100 bp, 5 to 75 bp, or 10 to 50 bp), and the unpaired nucleotides that form the triangle are at least 3 nt (e.g., at least 4 nt, at least 5 nt, at least 10 nt, at least 20, at least 15, at least 30, at least 40, at least 50, or at least 60 nt, such as 3 to 60 nt, 3 to 30 nt, 3 to 25 nt, or 5 to 20 nt, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 2, 25, 30, 35, 40, 45, 50, 55 or 60 nucleotides).
  • a kissing interaction can occur between any two of these types of loops (e.g., between two or more binding domains that each include one or more helices).
  • helices within one dimerization domain e.g., first dimerization domain 122
  • a direct counterpart in the other binding domain e.g., second dimerization domain 1514
  • dimerization domains containing helices to generate loops form a single kissing stem loop upon interaction between the two or more dimerization domains (e.g., 122, 154 of FIG. 6A).
  • dimerization domains containing helices form multiple loops for kissing loop interactions upon interaction between the two or more dimerization domains (e.g., 122, 154 of FIG. 6A).
  • one or more dimerization domains e.g., 122 of FIG. 6A
  • one or more dimerization domains e.g., 122 of FIG.
  • each dimerization domain can contain at least 1 individual stem loop, such as at least 2, at least 5, at least 10, at least 15, or at least 20, such as 1 to 20, 2 to 5 or 1 to 10 individual stem loops.
  • a kissing loop comprises multiple stem loops, e.g., 2 to 20 stem loops. In some examples, each of the multiple stem loops in the kissing loop are the same. In some examples, each of the multiple stem loops in the kissing loop are different.
  • a dimerization domain comprises 1 to 20 stem loops. In some examples, a dimerization domain comprises 1 stem loop to 20 stem loops.
  • a dimerization domain comprises 1 stem loop to 2 stem loops, 1 stem loop to 3 stem loops, 1 stem loop to 4 stem loops, 1 stem loop to 5 stem loops, 1 stem loop to 6 stem loops, 1 stem loop to 7 stem loops, 1 stem loop to 8 stem loops, 1 stem loop to 9 stem loops, 1 stem loop to 10 stem loops, 1 stem loop to 15 stem loops, 1 stem loop to 20 stem loops, 2 stem loops to 3 stem loops, 2 stem loops to 4 stem loops, 2 stem loops to 5 stem loops, 2 stem loops to 6 stem loops, 2 stem loops to 7 stem loops, 2 stem loops to 8 stem loops, 2 stem loops to 9 stem loops, 2 stem loops to 10 stem loops, 2 stem loops to 15 stem loops, 2 stem loops to 20 stem loops, 3 stem loops to 4 stem loops, 3 stem loops to 5 stem loops, 2 stem loops to 6 stem loops, 2 stem loops to 7 stem loops, 2 stem loops to 8 stem loop
  • a dimerization domain comprises 1 stem loop, 2 stem loops, 3 stem loops, 4 stem loops, 5 stem loops, 6 stem loops, 7 stem loops, 8 stem loops, 9 stem loops, 10 stem loops, 15 stem loops, or 20 stem loops. In some examples, a dimerization domain comprises at least 1 stem loop, 2 stem loops, 3 stem loops, 4 stem loops, 5 stem loops, 6 stem loops, 7 stem loops, 8 stem loops, 9 stem loops, 10 stem loops, or 15 stem loops.
  • a dimerization domain comprises at most 2 stem loops, 3 stem loops, 4 stem loops, 5 stem loops, 6 stem loops, 7 stem loops, 8 stem loops, 9 stem loops, 10 stem loops, 15 stem loops, or 20 stem loops.
  • the two or more dimerization domains are nucleic acid aptamers (such as RNA aptamers) that can interact with one another, for example through a non base pairing interaction, or can bind to a common molecule (e.g., protein, ATP, metal ion, co-factor, or synthetic ligand).
  • nucleic acid aptamers such as RNA aptamers
  • a common molecule e.g., protein, ATP, metal ion, co-factor, or synthetic ligand.
  • two or more dimerization domains do not hybridize to one another, but can both (or all) hybridize to the same bridge nucleic acid molecule.
  • such a bridge nucleic acid molecule can be exogenously provided to the cells, tissues, or organism.
  • such a bridge nucleic acid molecule can be a DNA or RNA sequence inside the cell, such as a transcript or genomic locus.
  • the two or more dimerization domains are sequences that can interact with one another, for example through a non-base pairing interaction.
  • Molecule 150 is the 3 ’-located molecule, and includes a splice acceptor (SA) 162 and a second dimerization domain 154.
  • molecule 150 is DNA, it includes a second promoter 152 followed by intronic sequence 170.
  • Promoter 152 can be is operably linked to intronic sequence 170. Any promoter 152 can be used, such as a constitutive or inducible promoter.
  • promoter 152 is a tissue-specific promoter, such as one constitutively active in muscle tissue (such as skeletal or cardiac), optical tissue (such as retinal tissue), inner ear tissue, liver tissue, pancreatic tissue, lung tissue, skin tissue, bone, or kidney tissue.
  • promoter 112 is a cell-specific promoter, such as one constitutively active in a cancer cell, or a normal cell.
  • promoter 112 is an endogenous promoter of the target protein expressed, and in some example is long (e.g., at least 2500 nt, at least 3000 nt, at least 4000 nt, at least 5000 nt, or at least 7500 nt).
  • promoter 112 is at least about 50 nucleotides (nt) in length, such as at least 100, at least 200, at least 300, at least 500, at least 1000, at least 2000, at least 3000, at least 4000, at least 5000, at least 6000, at least 7000, at least 8000 nt, at least 9000 nt, or at least 10,000 nt, such as 50 to 10,000 nt, 100 to 5000 nt, 500 to 5000 nt, or 50 to 1000 nt in length.
  • promoter 112 and promoter 152 are the same promoter. In other examples, promoter 112 and promoter 152 are the different promoters.
  • molecule 150 is DNA, and is at least 200, at least 300, at least 500, at least 1000, at least 2000, at least 3000, at least 4000, at least 5000, at least 6000, at least 7000, or at least 8000 nt, such as 200 to 10,000 nt, 200 to 8000 nt, 500 to 5000 nt, or 200 to 1000 nt in length.
  • molecule 150 is RNA
  • molecule 150 no longer includes promoter 152
  • 164 is the RNA encoded by the coding sequence for a C-terminal portion of the target protein.
  • molecule 150 is RNA, does not include promoter 152, and is at least 200, at least 300, at least 500, at least 1000, at least 2000, at least 3000, at least 4000, at least 5000, at least 6000, at least 7000, or at least 8000 nt, such as 200 to 10,000 nt, 200 to 8000 nt, 500 to 5000 nt, or 200 to 1000 nt in length.
  • Molecule 150 (with or without promoter 152) can include natural and/or non-natural nucleotides or ribonucleotides.
  • intronic sequence 170 includes a second dimerization domain 154, optional ISE 156, branching point 158, polypyrimidine tract 160, followed by a splice acceptor sequence 162.
  • intronic sequence 130 is about at least 10 nt, such as at least 20 nt, at least 30 nt, at least 50 nt, at least 100 nt, at least 250 nt, at least 250 nt, at least 300 nt, at least 400 nt, or at least 500 nt in length, such as 20 to 500, 20 to 250, 20 to 100, 50 to 100, 30 to 500, or 50 to 200 nt in length.
  • Second dimerization domain 154 has a sequence that is the reverse complement of first dimerization domain 122 sequence of molecule 110.
  • first dimerization domain 122 discussed above also apply to second dimerization domain 154.
  • the second dimerization domain 154 contains a stem loop that can form a kissing loop interaction the first dimerization domain 122.
  • second dimerization domain 154 does not include cryptic splice acceptors (e.g ., NNNAGGUNNN; SEQ ID NO: 143) that could compete with RNA recombination.
  • second dimerization domain 154 has a hypodiverse sequence.
  • second dimerization domain 154 is no more than 1000 nt, such as no more than 750 nt, or more than 500 nt, such as 30 to 1000 nt, 30 to 750 nt, 30 to 500 nt, 50 to 500 nt, 50 to 100 nt, or 100 to 250 nt. In some examples, second dimerization domain 154 is greater than 50 nt, such as at least 51 nt, at least 100 nt, at least 150 nt, at least 161 nt, or at least 170 nt, such as 51 to 159 nt, 51 to 150 nt, 51 to 120 nt, 51 to 100 nt, or 51 to 70 nt.
  • second dimerization domain 154 is greater than 160 nt, such as at least 161 nt, at least 170 nt, at least 180 nt, at least 200 nt, at least 300 nt, at least 400 nt, at least 500 nt, at least 600 nt, at least 700 nt, at least 800 nt, at least 900 nt, or at least 1000 nt, such as 161 to 100 nt, 161 to 500 nt, 161 to 300 nt, 161 to 200 nt, or 161 to 170 nt. In some examples, second dimerization domain 154 is less than 50 nt, such 6 to 49 nt, 6 to 45 nt, 6 to 40 nt, 6 to 30 nt, 6 to 20 nt, or 6 to 10 nt.
  • 3’- to second dimerization domain 154 is an optional ISE 156, branch point sequence 158 (such as a branch point consensus sequence), polypyrimidine tract 160, followed by a splice acceptor sequence 162.
  • ISE 156 like ISE 120 and DISE 118 of molecule 110, stimulates the spliceosome to catalyze the recombination reaction.
  • intronic sequence 150 includes at least two ISE 156, such as at least 3, at least 4, or at least 5 ISEs 156.
  • Exemplary splicing enhancer sequences include ISE 156.
  • inclusion of one or more splicing enhancer sequences 156 in intronic sequence 150 increases recombination or splicing efficiency by at least 10%, at least 20%, at least 30%, at least 40%, or at least 50%.
  • Exemplary splicing enhancer sequences that can be used are provided in SEQ ID NOS: 26-136, 151, and 152, as well as GGGTTT, GGTGGT, TTTGGG, GAGGGG,
  • ISE 156 can be about least 3 nt, at least 4 nt, at least 5 nt, at least 10 nt, such as at least 20 nt, at least 25 nt, at least 30 nt, at least 40 nt, or at least 50 nt in length, such as 3 to 10, 3 to 11, 4 to 11, 5 to 11, 10
  • the sequence of ISE 156 is or comprises GGCUGAGGGAAGGACUGUCCUGGG (SEQ ID NO: 135), GGGU UAUGGGACC (SEQ ID NO: 136), TTCAT, CCATTT, TTTTAAA, TGCAT, TGCATG, TGTGTT, CTAAC, TCTCT, TCTGT, or TCTTT.
  • ISE 120 and ISE 156 are the same sequence. In other examples, ISE 120 and ISE 156 are the different sequences.
  • branch point sequence 158 such as a branch point consensus sequence
  • polypyrimidine tract 160 followed by a splice acceptor sequence 162 (such as a splice acceptor consensus sequence).
  • the sequence of branch point 158 is based on the consensus sequence of the species of the target cell or organism.
  • the consensus sequence can include or be YUNAY.
  • a sequence that it uses can be CUAAC for U2-dependent introns, or for U12-dependent introns UUUUCCUUAACU (SEQ ID NO: 144).
  • Polypyrimidine tract 160 includes C, U, or both C and U nucleotides, such as CnUy, wherein n+y is greater than or equal to 10 nucleotides, and can include nucleotides -3 to -22 relative to the 3’- splice junction. In some examples, polypyrimidine tract 160 includes at least 80% Y nucleotides ( i.e .,
  • polypyrimidine tract 160 is a polyC or polyU sequence. In some examples, polypyrimidine tract 160 is a polyU sequence of at least 15 Us, such as 15 to 30 or 15 to 20 Us. Branch point 158 and polypyrimidine tract 160 are essential splicing components.
  • the sequence of SA 162 can be based on the consensus sequence of the species of the target cell or organism. For example, in humans, the SA sequence can be AG in positions -1 and -2 relative to the 3’- splice site for U2-dependnet introns and AC or AG for U12-dependnet introns. Thus, in some examples, SA 162 can be 2 nt in length, such as AG or AC.
  • splice junction Immediately following SA 162 is an exonic sequence which includes a DNA sequence encoding a C-terminal portion of a target protein 164 having a splice junction at its 5’end.
  • splice junction can be GA or GU at positon +1 and +2 of the 3’ splice site for U2-dependent introns or GU or AU for U12-dependent introns.
  • the splice junction is 2 nt in length, and the 5’ end of the C-terminal coding portion 164 is GA, GU, or AU.
  • the exonic sequence following intronic portion 170 of molecule 150 includes a second coding portion (e.g ., half) of the target protein, e.g., the C terminal fragment 164, and optional polyadenylation sequence 166.
  • molecule 150 includes sequence 164 encoding a C-terminal portion of a target protein.
  • the 3 ’-end of molecule 150 optionally includes a polyadenylation sequence 166, which promotes the assembly of the spliceosome.
  • polyadenylation sequence 166 is a polyA sequence of at least 15 As, such as 15 to 30 or 15 to 20 As.
  • polyadenylation sequence 166 and polyadenylation sequence 124 are the same sequence. In other examples, polyadenylation sequence 166 and polyadenylation sequence 124 are the different sequences.
  • the N-terminal coding region 114 and/or the C terminal coding region 164 is a native coding sequence.
  • the coding sequence is one that is found in the cell or organism into which the disclosed system is introduced (e.g., a human coding sequence when introduced into a human cell or subject).
  • the N-terminal coding region 114 and/or the C terminal coding region 164 is codon optimized relative to a native coding sequence, for example to maximize tRNA availability, or to de-enrich for cryptic splice sites (e.g., to reduce or avoid incorrect splicing and promote the correct junction formation).
  • a portion of the N-terminal coding region 114 and/or the C terminal coding region 164 is codon optimized relative to a native coding sequence, for example the about 200 nt adjacent to each junction (e.g., the 3 ’-end of 114, and the 5 ’end of 164) can be codon optimized or altered to contain exonic splice enhancer sites (ESE) (which would bind SR proteins).
  • ESE exonic splice enhancer sites
  • the coding sequence can be one not found in the cell or organism into which the disclosed system is introduced (e.g., a human coding sequence when introduced into a mouse cell or subject).
  • the N-terminal coding region 114 and/or the C terminal coding region 164 include an intron that is either natural or synthetic in nature and contains both a splice donor and acceptor site.
  • an intron embedded inside the to the coding sequence to be expressed can be included upstream (e.g., about 200 nt upstream) of sequence 116, inside the N-terminal coding region 114, an intron embedded inside the coding sequence to be expressed can be included downstream (e.g., about 200 nt downstream) of the sequence 162 and inside the C-terminal coding region 164, or both. Inclusion of such introns can be used to stimulate splicing machinery attachment to the trans-splicing intron donor and acceptor.
  • such (stimulatory-) introns could be derived from the host in which 110 and 150 are expressed. In some examples, such (stimulatory-) introns could be derived from other organisms, or viral in origin, or synthetic in origin. In some examples, inclusion of a sequence to stabilize the molecule 150 (e.g ., placed between 164 and 166 in the 3’ untranslated region of 150 in FIG. 6A) can increase expression efficiency of the recombined product by at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, or at least 75%, such as 25 to 95%, 25 to 75%, 25 to 60%, 25 to 50%, 40 to 95%, 40 to 60%, or 50 to 60%.
  • a sequence to stabilize the molecule 150 e.g ., placed between 164 and 166 in the 3’ untranslated region of 150 in FIG. 6A
  • inclusion of a sequence to stabilize the molecule 150 can increase expression efficiency of the recombined product by at least 25%, at least 30%, at least 40%,
  • woodchuck post-transcriptional regulatory element or truncations thereof (e.g. WPRE3) are included in the 3’-UTR as a stabilizing element to enhance recombined product expression efficiency.
  • WPRE sequence has at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to nt 1093 to 1684 of GenBank accession no. J04514 or to the 247 bp sequence of WPRE3.
  • interaction and hybridization allows the spliceosome components to recombine N-terminal coding sequence 114 and C-terminal coding sequence 164.
  • the 3’ end of the N terminal protein coding sequence 114 is fused to the 5’ end of the C terminal protein sequence 164 as a seamless junction between the two portions.
  • FIG. 6D shows a schematic of a system wherein a target protein is divided into three portions, an N-terminal, middle, and C-terminal portion (wherein each portion can be similar or different in size).
  • a protein can thus be divided into any number of desired segments or portions, and an appropriate number of molecules designed using the information provided herein.
  • the system includes at least three synthetic nucleic acid molecules 110,
  • nucleic acid molecule 110, 200, 150 can be composed of DNA, and following translation, can be RNA with promoters 112, 202, 152 absent.
  • each of 110, 200, 150 is at least about 100 nucleotides/ribonucleotides (nt) in length, such as at least 200, at least 300, at least 500, at least 1000, at least 2000, at least 3000, at least 4000, at least 5000, at least 6000, at least 7000, or at least 8000 nt, such as 200 to 10,000 nt, 200 to 8000 nt, 500 to 5000 nt, or 200 to 1000 nt.
  • the molecules 110, 150, 200 can include natural and/or non-natural nucleotides or ribonucleotides.
  • one of the two introns can be a U2-type intron and the second intron can be a U12-type intron.
  • Splice donor and acceptors of U2 and U12 dependent introns show minimal cross reactivity since the consensus recognition sequences between the two types of introns are different.
  • Molecule 110 of FIG. 6D includes the same features disclosed above for FIG.
  • RNA 1 A namely a promoter 112 operably linked to a sequence encoding an RNA molecule, the RNA molecule comprising from 5 ’ to 3 ’ : a coding sequence for an N-terminal portion of the target protein 114, wherein the coding sequence for an N-terminal portion of the target protein 114 comprises a splice junction at a 3’-end of the target protein coding sequence, , SD 116, optional DISE 118, optional ISE 120, dimerization domain 122, and optional polyadenylation sequence 124, but wherein first dimerization domain 122 has reverse complementary to third dimerization domain 204 of molecule 200.
  • FIG. 1 A namely a promoter 112 operably linked to a sequence encoding an RNA molecule, the RNA molecule comprising from 5 ’ to 3 ’ : a coding sequence for an N-terminal portion of the target protein 114, wherein the coding sequence for an N-terminal portion of the target protein 114 comprises
  • molecule 110 in embodiments where molecule 110 is RNA, for example after expression of the DNA into RNA, molecule 110 does not include promoter 112, and 114 is the RNA encoded by the coding sequence for an N-terminal portion of the target protein.
  • Molecule 110 (with or without promoter 112) can include natural and/or non-natural nucleotides or ribonucleotides.
  • Molecule 150 of FIG. 6D includes the same features disclosed above for FIG. 1A, namely promoter 152 operably linked to a sequence encoding an RNA molecule, the RNA molecule comprising from 5’ to 3’: a second dimerization domain 154, optional ISE 156, a branch point sequence 158, a polypyrimidine tract 160, a splice acceptor (SA) 162; and a coding sequence for a C-terminal portion of the target protein 164, wherein the coding sequence for the C-terminal portion of the target protein comprises a splice junction at a 5 ’-end of the target protein coding sequenc,, and optionally polyadenylation sequence 166.
  • the second dimerization domain 154 has reverse complementary to fourth dimerization domain 226 of molecule 200.
  • Molecule 150 (with or without promoter 152) can include natural and/or non-natural nucleotides or ribonucleotides.
  • Molecule 200 allows for the joining of the N- and C-terminal coding regions 114, 164, by providing dimerization domains having reverse complementarity to dimerization domains 122, 154 of molecule 110 and molecule 150, respectively.
  • Molecule 200 includes features from both molecule 110 and molecule 150, including two intronic sequences 230, 240.
  • molecule 220 includes promoter 210 (which can be the same or different than promoter 112 and/or 152) operably linked to a sequence encoding an RNA molecule, the RNA molecule comprising from 5’ to 3’: third dimerization domain 204 (which is the reverse complement to first dimerization domain 122 of molecule 110 in FIG.
  • optional ISE 206 optional ISE 206, branch point 208, polypyrimidine tract 210, SA 212, a coding sequence for a middle portion of the target protein 216, wherein the coding sequence for the middle portion of the target protein 216 comprises a splice junction at a 5 ’-end of the target protein coding sequence and a splice junction at a 3 ’-end of the target protein coding sequence, SD 220, optional DISE 222, optional ISE 224, fourth dimerization domain 226 (which is the reverse complement to fourth dimerization domain 154 of molecule 150 in FIG. 6D), and optional polyadenylation sequence 228.
  • molecule 220 is DNA, and is at least 200, at least 300, at least 500, at least 1000, at least 2000, at least 3000, at least 4000, at least 5000, at least 6000, at least 7000, or at least 8000 nt, such as 200 to 10,000 nt, 200 to 8000 nt, 500 to 5000 nt, or 200 to 1000 nt in length.
  • molecule 200 is RNA
  • molecule 200 no longer includes promoter 202
  • 216 is the RNA encoded by the coding sequence for a middle portion of the target protein.
  • molecule 200 is RNA, does not include promoter 202, and is at least 200, at least 300, at least 500, at least 1000, at least 2000, at least 3000, at least 4000, at least 5000, at least 6000, at least 7000, or at least 8000 nt, such as 200 to 10,000 nt, 200 to 8000 nt, 500 to 5000 nt, or 200 to 1000 nt in length.
  • the molecule 200 (with or without promoter 202) can include natural and/or non-natural nucleotides or ribonucleotides.
  • interaction and hybridization (base pairing) between first dimerization domain 122 of molecule 110 and third dimerization domain 204 of molecule 200, and interaction and hybridization (base pairing) between fourth dimerization domain 226 of molecule 200 and second dimerization domain 154 of molecule 150 allows the spliceosome components to recombine N- terminal coding sequence 114, middle coding sequence 216, and C-terminal coding sequence 164.
  • the 3’ end of the N terminal protein coding sequence 114 is fused to the 5’ end of the middle protein sequence 216
  • the 3’ end of middle protein sequence 216 is fused to the 5’ end of the C-terminal protein sequence 164 as a seamless junction between the three portions.
  • FIGS. 7A-7B and 9A Alternative dimerization domains are shown in FIGS. 7A-7B and 9A. That is, as an alternative to using dimerization domains that hybridize to one another (e.g ., 112 to 204, 226 to 154, FIGS. 6D, 6E), in one example aptamer sequences are used. As shown in FIG. 7A, in both synthetic nucleic acid molecules 500, 600, aptamer sequences 512, 602 are used instead of the dimerization domains, and the aptamers come together via their interaction with a target (such as adenosine, dopamine, or caffeine).
  • a target such as adenosine, dopamine, or caffeine
  • Molecule 500 of FIG. 7 A includes the same features disclosed above for molecule 110 of FIG. 6A, which when DNA includes a promoter operably linked to a sequence encoding an RNA molecule, the RNA molecule comprising from 5’ to 3’: a coding sequence for an N- terminal portion of the target protein 502, wherein the coding sequence for an N-terminal portion of the target protein 502 comprises a splice junction at a 3 ’-end of the target protein coding sequence, SD 506, optional DISE 508, optional ISE 510, a first aptamer 512 instead of a first dimerization domain, and optional polyadenylation sequence.
  • molecule 500 is RNA, for example when transcribed from the DNA molecule, molecule 500 does not include a promoter (e.g., as shown in FIG.
  • molecule 600 of FIG. 7 A includes the same features disclosed above for molecule 150 of FIG. 6A, which when DNA includes a promoter operably linked to a sequence encoding an RNA molecule, the RNA molecule comprising from 5’ to 3’: r aptamer 602 instead of second dimerization domain 154, optional ISE 604, branch point 606, polypyrimidine tract 608, SA 610, DNA encoding a C-terminal portion of a target protein 614 with a splice junction at its 5 ’-end, and optional polyadenylation sequence 616.
  • molecule 600 is RNA
  • molecule 500 does not include a promoter (e.g., as shown in FIG.
  • Molecules 500 and 600 can include natural and/or non-natural nucleotides or ribonucleotides.
  • aptamer sequences 512, 602 recognize (e.g., specifically bind) the same target 700 (FIG. 7A), or can even recognize different targets (wherein a synthetic molecule is also administered with the system provided herein, which includes each molecule specifically recognized by each aptamer, or the part of the molecule recognized by the aptamer, such as a caffeine/dopamine hybrid molecule).
  • targets recognized by aptamers include cellular proteins, small molecules, exogenous proteins, or an RNA molecule.
  • FIG. 7B shows an example similar to FIG. 7A.
  • the dimerization domains (512, 602 FIG. 7A) recognize an RNA molecule.
  • each domain recognizes a different portion of an mRNA molecule only expressed in target cells (cells where target protein expression is desired), such as a cancer-specific transcript.
  • the coding sequences comprised by the RNAs (502, 614 of FIG. 7A) only recombine in the presence of the specific RNA molecule recognized by the dimerization domains.
  • the target protein would only be expressed in cancer cells, not normal cells.
  • Such a system allows for control of the target protein expression (e.g., a therapeutic protein for cancer, such as a toxin or a cytotoxic enzyme such as thymidine kinase with ganciclovir; thus in some examples the target protein is a toxin or thymidine kinase) in cancer cells, reducing undesirable side effects of expression the target protein in normal, non-cancer cells.
  • a therapeutic protein for cancer such as a toxin or a cytotoxic enzyme such as thymidine kinase with ganciclovir; thus in some examples the target protein is a toxin or thymidine kinase
  • FIG. 7C provides an exemplary “off-switch” example.
  • the hybridization/binding of dimerization domains 812, 902 (which are reverse complements of one another) of synthetic nucleic acid molecules 800, 900 can be reduced by providing an anti-binding domain oligonucleotide (e.g,
  • RNA or DNA 1000 (which can be two different anti -binding domain oligonucleotides 1000, one that is the reverse complement of 812, and one that is the reverse complement of 912) that competes for the binding/hybridization.
  • Anti -binding domain oligonucleotide 1000 can thus act as an “off-switch” for reconstitution of the protein encoded by N- and C-terminal coding portions 802 and 914, respectively.
  • Molecule 800 of FIG. 7C includes the same features disclosed above for a molecule 110 of FIG.
  • RNA molecule that is an RNA molecule (and thus lacks a promoter), which RNA molecule comprises from 5’ to 3’: a coding sequence for an N-terminal portion of the target protein 802, wherein the coding sequence for an N-terminal portion of the target protein 802 comprises a splice junction at a 3 ’-end of the target protein coding sequence, SD 806, optional DISE 808, optional ISE 810, dimerization domain 812, and optional polyadenylation sequence 814.
  • molecule 900 of FIG. 7C includes the same features disclosed above for a molecule 150 of FIG.
  • RNA molecule that is an RNA molecule (and thus lacks a promoter), which RNA molecule comprises from 5’ to 3’: anti-dimerization domain 902, optional ISE 904, branch point 906, polypyrimidine tract 908, SA 910, RNA encoding a C-terminal portion of a target protein 914, and optional polyadenylation sequence 916.
  • the two dimerization domains 812, 902 cannot interact/hybridize to each other in the presence of the anti -binding domain oligonucleotides 1000, and therefore prevents or reduces recombination of the N-terminal coding sequence 802 and C-terminal coding sequence 914.
  • Such an application can be used to reduce or eliminate expression of the protein encoded by the system.
  • Molecules 800 and 900 can include natural and/or non-natural nucleotides or ribonucleotides.
  • FIG. 9A provides an exemplary dimerization domain that uses kissing loop interactions instead of reverse complementary sequence hybridization for dimerization.
  • Kissing loop interactions are formed when the bases in the loops of two RNA hairpins form interacting pairs between two RNA molecules.
  • the molecule on the left hand side labelled with n-yfp represents an RNA molecule that encodes the n-terminal fragment of yfp, linked to a synthetic intron that contains a splice donor site, a downstream intronic splicing enhancer element, and two intronic splicing enhancer elements.
  • the dimerization domain this molecule contains three RNA hairpin loops that each are composed of a stem (where the RNA hybridizes onto itself) and a loop (in which the RNA is not hybridized to itself).
  • the dimerization domain contains three stem and loop elements (also referred to as hairpin loops) and is referred to as a trimodal kissing loop dimerization domain.
  • the molecule on the right hand side labelled with c-yfp represents an RNA molecule that encodes the c terminal portion of yfp. From 5’ to 3’ this molecule is composed of a trimodal kissing loop dimerization domain that contains a set of three hairpin loops.
  • the loop portions can form kissing loop interactions with the corresponding loops on the complementary n-yfp molecule.
  • the trimodal kissing loop dimerization domain is followed by a synthetic intron sequence that contains three intronic splicing enhancer sequences, a branch point sequence, a polypyrimidine tract, and a splice acceptor site.
  • the synthetic intron sequence is followed by the c-terminal yfp coding sequence, which is followed by a 3 ’ untranslated region that contains a poly adenylation signal.
  • a representative 3 -dimensional rendering of a kissing loop interaction is shown. This rendering illustrates how the kinked form of the hairpin loop exposes the loop residues towards the outside which renders them available for the kissing loop interaction.
  • FIGS. 6A-7C and 9A show embodiments where a system uses two synthetic nucleic acid molecules are used (i.e ., the target protein coding sequence is split between two synthetic nucleic acid molecules), one skilled in the art will appreciate that such embodiments can be used similarly with more than two synthetic nucleic acid molecules, such as three, four, five, six, seven, eight, nine, or 10 synthetic nucleic acid molecules using the teachings herein.
  • the system includes a nucleic acid molecule that suppresses expression of un-assembled/un-recombined fragments.
  • a nucleic acid molecule that suppresses expression of un-assembled/un-recombined fragments.
  • the nucleic acid molecule would suppress expression of each portion of a full-length coding sequence that was not recombined into a full-length protein.
  • such a suppressive nucleic acid molecule can destabilize the RNA once outside the nucleus, prevent translation, stimulate translation from a shifted start codon, contain microRNA target sites, or contain protein degron or destabilization domains that when translated suppress the protein activity or flag it for degradation.
  • destabilization of the un-recombined RNA molecule is achieved by including a self-cleaving RNA sequence (e.g., Hammerhead ribozyme or HDV ribozyme) into the synthetic intron, for example at any position within intronic sequence 130 of FIG. 6A or 6F.
  • a self-cleaving RNA sequence e.g., Hammerhead ribozyme or HDV ribozyme
  • cleaving the RNA molecule leads to a loss of the RNA stabilizing poly A tail, which can suppress expression of an un-recombined protein from open reading frame 114 of FIG. 6A or 6F.
  • a self cleaving RNA sequence is included at any position within s intronic sequence 170 of FIG.
  • RNA sequences are substituted with an RNA cleaving enzyme target site, such as a Csy4 target site.
  • a suppressive nucleic acid molecule includes a start codon (ATG) or a Kozak enhanced start codon (GCCGCCACCATG (SEQ ID NO: 154) or GCCACCATG or ACCATG) at any position within intronic sequence 170 of FIG. 6A or 6F that directs translation of an open reading frame that is shifted -1, -2, +1, or +2 nucleotides relative to the open reading frame sequence 164 of FIG. 6A or 6F.
  • un-assembled fragment expression is reduced or suppressed by using this decoy start codon strategy to direct translation away from the to be suppressed open reading frame of sequence 164 of FIG. 6A or 6F.
  • a suppressive nucleic acid molecule includes one or more micro RNA target sites at any position within intronic sequence 130 of FIG. 6A or 6F, and/or at any position within intronic sequence 170 of FIG. 6A or 6F. If a particular molecule (e.g., 110 or 150 in FIG. 6A or 6F) is exported from the nucleus, it becomes subject to micro RNA / small hairpin RNA dependent degradation which can suppress unintended un-joined fragment expression by degrading/suppressing un-joined RNA that was exported from the nucleus.
  • a micro RNA target sequence can be complementary to a micro RNA known to be expressed in the cell, or tissue, or animal into which the molecules 110 and 150 of FIG.
  • this micro RNA target sequence is complementary to a sequence that is introduced into the cell, or tissue, or animal.
  • a microRNA can be expressed from an RNA-polymerase III dependent promoter in the form of a small hairpin RNA.
  • a microRNA can be expressed from an RNA polymerase II dependent promoter and embedded in a micro RNA processing loop ( e.g mir30 scaffold).
  • destabilization of the un-recombined protein product from an open reading frame can be achieved by depleting stop codon occurrence in intronic sequence 130 of FIG. 6A or 6F and an additional inclusion of an RNA sequence coding for an in frame protein signal that can flag a protein for degradation (e.g., a degron sequence) that is placed at any position within intronic sequence 130 of FIG. 6A or 6F and which is in frame with the open reading frame that is extended out from sequence 114 of FIG. 6A or 6F.
  • a degron sequence can be that of a PEST sequence, or that of the CL1 degron sequence.
  • Degron sequences used can employ proteasome-dependent, proteasome-independent, ubiquitin-dependent, or ubiquitin-independent pathways.
  • un-recombined protein destabilization is enhanced by inclusion of several of the same or different degron sequences.
  • destabilization of the un-recombined protein product from open reading frame sequence 164 in FIG. 6A is achieved by introduction of a start codon (ATG) followed by a degron sequence at any position within intronic sequence 170 in FIG. 6A which is in frame with an open reading frame within sequence 164 in FIG. 6.
  • ATG start codon
  • the degron sequence will be N- terminally joined to the un-recombined protein fragment that will be suppressed by being flagged for degradation.
  • compositions and kits are provided that include two or more of the synthetic nucleic acid molecules provided herein, wherein the synthetic nucleic acid molecule encode a full-length protein when recombined.
  • the two or more of the synthetic nucleic acid molecules provided herein are DNA.
  • the two or more of the synthetic nucleic acid molecules provided herein are RNA, and do not include promoter sequences.
  • the composition or kit includes two of the synthetic nucleic acid molecules provided herein, wherein each of the two synthetic nucleic acid molecules encodes a different portion of a target protein (i.e., N- terminal and C-terminal, wherein the whole coding sequence is generated when recombination between the two molecules occurs), such as one listed in Table 1 (or a therapeutic protein, such as a toxin or thymidine kinase).
  • a target protein i.e., N- terminal and C-terminal, wherein the whole coding sequence is generated when recombination between the two molecules occurs
  • a therapeutic protein such as a toxin or thymidine kinase
  • the composition or kit includes three of the synthetic nucleic acid molecules provided herein, wherein each of the three synthetic nucleic acid molecules encodes a different portion of a target protein (i.e ., N- terminal, middle, and C-terminal, wherein the whole coding sequence is generated when recombination between the three molecules occurs), such as one listed in Table 1 (or a therapeutic protein, such as a toxin or thymidine kinase).
  • a target protein i.e ., N- terminal, middle, and C-terminal, wherein the whole coding sequence is generated when recombination between the three molecules occurs
  • a therapeutic protein such as a toxin or thymidine kinase
  • the composition or kit includes four or more of the synthetic nucleic acid molecules provided herein, wherein each of the four of more synthetic nucleic acid molecules encodes a different portion of a target protein (i.e., N- terminal, first middle, second middle (and optionally additional middle), and C-terminal, wherein the whole coding sequence is generated when recombination between the four or more synthetic nucleic acid molecules occurs), such as one listed in Table 1 (or a therapeutic protein, such as a toxin or thymidine kinase).
  • a target protein i.e., N- terminal, first middle, second middle (and optionally additional middle)
  • C-terminal wherein the whole coding sequence is generated when recombination between the four or more synthetic nucleic acid molecules occurs
  • a therapeutic protein such as a toxin or thymidine kinase
  • the composition or kit includes two or more sets of two or more of the synthetic nucleic acid molecules provided herein, wherein each set of synthetic nucleic acid molecules encodes a different target protein, such as two or more listed in Table 1 (and/or a therapeutic protein, such as a toxin or thymidine kinase).
  • each synthetic nucleic acid molecule in the composition or kit is part of a vector, such as AAV or other gene therapy vector.
  • the composition or kit includes a cell, such as a bacterial cell or eukaryotic cell, that includes two or more disclosed synthetic nucleic acid molecules, wherein the synthetic nucleic acid molecules encode a full-length target protein when recombined.
  • compositions can include a pharmaceutically acceptable carrier (e.g ., saline, water, glycerol, DMSO, or PBS).
  • a pharmaceutically acceptable carrier e.g ., saline, water, glycerol, DMSO, or PBS.
  • the composition is a liquid, lyophilized powder, or cryopreserved.
  • the kit includes a delivery system (e.g., liposome, a particle, an exosome, or a microvesicle) to direct cell type specific uptake/enhance endosomal escape/enable blood-brain barrier crossing etc.
  • the kits further include cell culture or growth media, such as media appropriate for growing bacterial, plant, insect, or mammalian cells.
  • cell culture or growth media such as media appropriate for growing bacterial, plant, insect, or mammalian cells.
  • such parts of a kit are in separate containers. Exemplary containers include plastic or glass vials or tubes.
  • each of two or more the synthetic nucleic acid molecules provided herein are in separate containers. In some examples, each of two or more sets of two or more of the synthetic nucleic acid molecules provided herein are in separate containers.
  • the disclosed methods and systems can be used to express any protein of interest, for example when a protein is too large to be expressed by a therapeutic virus (e.g., AAV) or when a complete gene sequence (e.g ., endogenous promoter + coding sequence) is too large to be expressed by a therapeutic virus (e.g., AAV).
  • a therapeutic virus e.g., AAV
  • a complete gene sequence e.g ., endogenous promoter + coding sequence
  • the coding sequence of the target protein may be divided into two or more portions using the disclosed systems, and recombined in the correct order, allowing for the protein to be expressed when and where desired.
  • the subject to be treated can be any mammal, such as one with a monogenetic disorder, such as one listed in Table 1.
  • the subject has cancer.
  • humans, cats, pigs, rats, mice, cows, goats, and dogs can be treated with the disclosed methods.
  • the subject is a human infant less than 6 months of age.
  • the subject is a human infant less than 1 year of age.
  • the subject is a human juvenile.
  • the subject is a human adult at least 18 years of age.
  • the subject is female.
  • the subject is male.
  • the two or more synthetic nucleic acid molecules provided herein used to treat a subject can be matched to the subject treated.
  • a dog coding sequence for the target protein can be used and the intronic sequence can be optimized for expression in dog cells
  • a human coding sequence for the target protein can be used and the intronic sequence can be optimized for expression in human cells.
  • the two or more synthetic nucleic acid molecules provided herein can be administered as part of a vector, such as an adeno-associated vector (AAV), for example AAV serotype rh.10.
  • a vector such as an adeno-associated vector (AAV), for example AAV serotype rh.10.
  • vectors e.g., AAV
  • AAV adeno-associated vector
  • vectors including one of the two or more synthetic nucleic acid molecules provided herein are administered systemically, such as intravenously.
  • a therapeutically effective amount of two or more synthetic nucleic acid molecules provided herein is administered, for example in AAVs.
  • the two or more synthetic nucleic acid molecules provided herein when part of a viral vector e.g., AAV
  • a viral vector e.g., AAV
  • the two or more synthetic nucleic acid molecules provided herein when part of a viral vector is administered at a dose of at least lxlO 11 genome copies (gc), at least lxlO 12 gc, at least 2xl0 12 gc, at least lxlO 13 gc, at least 2xl0 13 gc per subject, or at least 1 c 10 14 gc per subject, such as 2x 10 11 gc per subject, 2x 10 12 gc per subject,
  • the two or more synthetic nucleic acid molecules provided herein when part of a viral vector is administered at a dose of at least lxlO 11 gc/kg, at least 5xl0 n gc/kg, at least lxlO 12 gc/kg, at least 5xl0 12 gc/kg, at least lxlO 13 gc/kg, or at Ieast4xl0 13 gc/kg, such as 4xlO n gc/kg, 4xl0 12 gc/kg, or 4xl0 13 gc/kg.
  • a viral vector e.g., AAV
  • corticosteroids can be administered (e.g., see Nathwani et al., N Engl J Med. 365(25):2357-65, 2011).
  • Diseases that can be treated with the disclosed methods include any genetic disease of the blood (e.g. sickle cell disease, primary immunodeficiency diseases), HIV (such as HIV-1), and hematologic malignancies or cancers.
  • diseases e.g. sickle cell disease, primary immunodeficiency diseases
  • HIV such as HIV-1
  • hematologic malignancies or cancers examples include those listed in Al-Herz el al. (Frontiers in Immunology , volume 5, article 162, April 22, 2014, herein incorporated by reference in its entirety).
  • Hematologic malignancies or cancers are those tumors that affect blood, bone marrow, and lymph nodes.
  • leukemia e.g ., acute lymphoblastic leukemia, acute myelogenous leukemia, chronic lymphocytic leukemia, chronic myelogenous leukemia, acute monocytic leukemia
  • lymphoma e.g., Hodgkin’s lymphoma and non- Hodgkin’s lymphoma
  • myeloma myeloma.
  • the disease is a monogenetic disease.
  • Table 1 provides a list of exemplary disorders and genes that can be targeted by the disclosed systems and methods.
  • rarediseases.info.nih.gov/diseases/diseases-by- category /5/congenital-and-genetic-diseases list herein incorporated by reference.
  • Any genetic disease caused by a lack of protein (e.g., recessive mutation) or an insufficiency of protein can benefit from the disclosed systems and methods.
  • the disclosed systems and methods are useful to add regulatory sequences, such as tissue specific promoters or specific non-coding RNA segments, to direct gene expression to the appropriate cell types at the appropriate levels.
  • Using the disclosed methods and systems can be used to treat any of the disorders listed in Table 1, or other known genetic disorder.
  • the disclosed methods can also be used to treat other disorders, such as a cancer that can benefit from expression of a therapeutic protein in a cancer cell, such as a toxin or thymidine kinase.
  • a cancer that can benefit from expression of a therapeutic protein in a cancer cell, such as a toxin or thymidine kinase.
  • the subject is administered two or more synthetic molecules provided herein that express a full-length thymidine kinase, the subject is also administered ganciclovir. Treatment does not require 100% removal of all characteristics of the disorder, but can be a reduction in such.
  • specific examples are provided below, based on this teaching one will understand that symptoms of other disorders can be similarly affected.
  • the disclosed methods can be used to increase expression of a protein that is not expressed or has reduced expression by the subject, or decrease expression of a protein that is undesirably expressed or has reduced expression by the subject.
  • the disclosed methods can be used to treat or reduce the undesirable effects of a genetic disease.
  • the disclosed methods and systems can treat or reduce the undesirable effects of sickle cell disease by expressing a full-length wild-type b-globin chain of hemoglobin.
  • the disclosed methods reduce the symptoms of sickle-cell disease in the recipient subject (such as one or more of, presence of sickle cells in the blood, pain, ischemia, necrosis, anemia, vaso -occlusive crisis, aplastic crisis, splenic sequestration crisis, and haemolytic crisis) for example a reduction of at least 10%, at least 20%, at least 50%, at least 70%, or at least 90% (as compared to no administration of the therapeutic nucleic acid molecule).
  • the disclosed methods decrease the number of sickle cells in the recipient subject, for example a decrease of at least 10%, at least 20%, at least 50%, at least 70%, at least 90%, or at least 95% (as compared to no administration of the therapeutic nucleic acid molecule).
  • the disclosed methods and systems can treat or reduce the undesirable effects of thrombophilia by expressing a full-length wild-type factor V Leiden or prothrombin gene.
  • the disclosed methods reduce the symptoms of thrombophilia in the recipie7nt subject (such as one or more of, thrombosis, such as deep vein thrombosis, pulmonary embolism, venous thromboembolism, swelling, chest pain, palpitations) for example a reduction of at least 10%, at least 20%, at least 50%, at least 70%, or at least 90% (as compared to no administration of the therapeutic nucleic acid molecule).
  • the disclosed methods decrease the activity of coagulation factors in the recipient subject, for example a decrease of at least 10%, at least 20%, at least 50%, at least 70%, at least 90%, or at least 95% (as compared to no administration of the therapeutic nucleic acid molecule).
  • the disclosed methods and systems can treat or reduce the undesirable effects of CD40 ligand deficiency by expressing a full-length wild-type CD40 ligand gene.
  • the disclosed methods reduce the symptoms of CD40 ligand deficiency in the recipient subject (such as one or more of, elevate serum IgM, low serum levels of other immunoglobulins, opportunistic infections, autoimmunity and malignancies) for example a reduction of at least 10%, at least 20%, at least 50%, at least 70%, or at least 90% (as compared to no administration of the therapeutic nucleic acid molecule s).
  • the disclosed methods increase the amount or activity of CD40 ligand deficiency in the recipient subject, for example an increase of at least 10%, at least 20%, at least 50%, at least 70%, at least 90%, at least 100%, at least 200% or at least 500% (as compared to no administration of the therapeutic nucleic acid molecule).
  • the disclosed methods can be used to treat or reduce the undesirable effects of a primary immunodeficiency disease resulting from a genetic defect.
  • the disclosed methods and systems (which can use two or more synthetic nucleic acid molecules to express a functional protein missing or defective in the subject, for example using AAV) can treat or reduce the undesirable effects of a primary immunodeficiency disease.
  • the disclosed methods reduce the symptoms of a primary immunodeficiency disease in the recipient subject (such as one or more of, a bacterial infection, fungal infection, viral infection, parasitic infection, lymph gland swelling, spleen enlargement, wounds, and weight loss) for example a reduction of at least 10%, at least 20%, at least 50%, at least 70%, or at least 90% (as compared to no administration of the therapeutic nucleic acid molecule).
  • a primary immunodeficiency disease in the recipient subject such as one or more of, a bacterial infection, fungal infection, viral infection, parasitic infection, lymph gland swelling, spleen enlargement, wounds, and weight loss
  • the disclosed methods increase the number of immune cells (such as T cells, such as CD8 cells) in the recipient subject with a primary immune deficiency disorder, for example an increase of at least 10%, at least 20%, at least 50%, at least 70%, at least 90%, at least 95%, at least 100%, at least 200%, at least 300%, at least 400%, or at least 500% (as compared to no administration of the therapeutic nucleic acid molecule).
  • immune cells such as T cells, such as CD8 cells
  • the disclosed methods reduce the number of infections ((such as bacterial, viral, fungal, or combinations thereof) in the recipient subject over a set period of time (such as over 1 year) with a primary immune deficiency disorder, for example a decrease of at least 10%, at least 20%, at least 50%, at least 70%, at least 90%, or at least 95%, (as compared to no administration of the therapeutic nucleic acid molecule).
  • infections such as bacterial, viral, fungal, or combinations thereof
  • a primary immune deficiency disorder for example a decrease of at least 10%, at least 20%, at least 50%, at least 70%, at least 90%, or at least 95%, (as compared to no administration of the therapeutic nucleic acid molecule).
  • the disclosed methods can be used to treat or reduce the undesirable effects of a monogenetic disorder.
  • the disclosed methods (which can use two or more synthetic nucleic acid molecules to express a functional protein missing or defective in the subject, for example using AAV) can treat or reduce the undesirable effects of a monogenetic disorder.
  • the disclosed methods reduce the symptoms of a monogenetic disorder in the recipient subject, for example a reduction of at least 10%, at least 20%, at least 50%, at least 70%, or at least 90% (as compared to no administration of the therapeutic nucleic acid molecule).
  • the disclosed methods increase the amount of normal protein not normally expressed by the recipient subject with a monogenetic disorder, for example an increase of at least 10%, at least 20%, at least 50%, at least 70%, at least 90%, at least 95%, at least 100%, at least 200%, at least 300%, at least 400%, or at least 500% (as compared to no administration of the therapeutic nucleic acid molecule).
  • the disclosed methods can be used to treat or reduce the undesirable effects of a hematological malignancy in the recipient subject.
  • the disclosed methods reduce the number of abnormal white blood cells (such as B cells) in the recipient subject (such as a subject with leukemia), for example a reduction of at least 10%, at least 20%, at least 50%, at least 70%, or at least 90% (as compared to no administration of the disclosed therapies).
  • administration of the disclosed therapies can be used to treat or reduce the undesirable effects of a lymphoma, such as reduce the size of the lymphoma, volume of the lymphoma, rate of growth of the lymphoma, metastasis of the lymphoma, for example a reduction of at least 10%, at least 20%, at least 50%, at least 70%, or at least 90% (as compared to no administration of the disclosed therapies).
  • administration of disclosed therapies can be used to treat or reduce the undesirable effects of multiple myeloma, such as reduce the number of abnormal plasma cells in the recipient subject, for example a reduction of at least 10%, at least 20%, at least 50%, at least 70%, or at least 90% (as compared to no administration of the disclosed therapies).
  • the disclosed methods can be used to treat or reduce the undesirable effects of a malignancy, such as one that results from a genetic defect in the recipient subject.
  • the disclosed methods reduce the number of cancer cells, the size of a tumor, the volume of a tumor, or the number of metastases, in the recipient subject (such as a subject with a cancer listed herein), for example a reduction of at least 10%, at least 20%, at least 50%, at least 70%, or at least 90% (as compared to no administration of the disclosed therapies).
  • administration of the disclosed therapies can be used to treat or reduce the undesirable effects of a lymphoma, such as reduce the size of the tumor, volume of the tumor, rate of growth of the cancer, metastasis of the cancer, for example a reduction of at least 10%, at least 20%, at least 50%, at least 70%, or at least 90% (as compared to no administration of the disclosed therapies).
  • a lymphoma such as reduce the size of the tumor, volume of the tumor, rate of growth of the cancer, metastasis of the cancer, for example a reduction of at least 10%, at least 20%, at least 50%, at least 70%, or at least 90% (as compared to no administration of the disclosed therapies).
  • the disclosed methods can be used to treat or reduce the undesirable effects of a neurological disease that results from a genetic defect in the recipient subject.
  • the disclosed methods increase neurological function in the recipient subject (such as a subject with a neurological disease listed above), for example an increase of at least 10%, at least 20%, at least 50%, at least 70%, at least 90%, at least 100%, at least 200%, at least 300%, at least 400%, or at least 500% (as compared to no administration of the disclosed therapies).
  • DMD Duchenne Muscular Dystrophy
  • DMD Duchenne muscular dystrophy
  • MIM Duchenne muscular dystrophy
  • the other three diseases that belong to this group are Becker Muscular dystrophy (BMD, a mild form of DMD); an intermediate clinical presentation between DMD and BMD; and DMD-associated dilated cardiomyopathy (heart-disease) with little or no clinical skeletal, or voluntary, muscle disease.
  • BMD Becker Muscular dystrophy
  • DMD-associated dilated cardiomyopathy heart-disease
  • a patient with DMD, BMD, an intermediate clinical presentation between DMD and BMD; or DMD-associated dilated cardiomyopathy (heart-disease) with little or no clinical skeletal, or voluntary, muscle disease is treated with the disclosed systems and methods.
  • the disclosed methods and systems can be used to treat the monogenic cause of DMD by expressing dystrophin.
  • Dystrophin has a long coding region, such as dystrophin.
  • Current methods of expressing dystrophin from a single AAV utilize shortened/truncated versions of dystrophin (micro dystrophin and mini- dystrophin).
  • micro dystrophin and mini- dystrophin shortened/truncated versions of dystrophin
  • truncated dystrophin delivery therapies are being tested in Phase MI clinical trials (NCT03362502, NCT00428935, NCT03368742, NCT03375164).
  • truncated versions of dystrophin may ameliorate the worst consequences of dystrophin deficiency in DMD, they are not expected to have full functionality when compared to full-length dystrophin as the truncated versions are missing key domains in the rod and hinge region of the full- length protein.
  • the disclosed methods and systems alleviate the size restriction of the transgenic payload of AAV by using “multiplexed” AAV combinations, because multiple AAV viruses can efficiently infect the same cell when introduced at high multiplicity of infection (MOI, i.e., high titer).
  • MOI multiplicity of infection
  • compositions that includes two or more AAVs, each containing one of a set of disclosed synthetic molecules is administered (e.g ., i.v.) to a DMD subject in a therapeutically effective amount, such as a set that includes two, three, four or five different synthetic RNA molecules (each in a different AAV), which when recombined, result in a full-length dystrophin coding sequence.
  • a therapeutically effective amount such as a set that includes two, three, four or five different synthetic RNA molecules (each in a different AAV), which when recombined, result in a full-length dystrophin coding sequence.
  • a system for expressing a target protein comprising (a) a first synthetic nucleic acid molecule comprising a first promoter operably linked to a sequence encoding an RNA molecule, the RNA molecule comprising from 5’ to 3’: a coding sequence for an N-terminal portion of the target protein; a splice donor; and a first dimerization domain; and (b) a second synthetic nucleic acid molecule comprising a second promoter operably linked to a sequence encoding an RNA molecule, the RNA molecule comprising from 5’ to 3’: a second dimerization domain, wherein the second dimerization domain binds to the first dimerization domain; a branch point sequence; a polypyrimidine tract; a splice acceptor; and a coding sequence for a C-terminal portion of the target protein.
  • a system for expressing a target protein comprising: (a) a first synthetic nucleic acid molecule comprising a first promoter operably linked to a sequence encoding an RNA molecule, the RNA molecule comprising from 5’ to 3’: a coding sequence for an N-terminal portion of the target protein; a splice donor; and a first dimerization domain; and (b) a second synthetic nucleic acid molecule comprising a second promoter operably linked to a sequence encoding an RNA molecule, the RNA molecule comprising from 5’ to 3’: a second dimerization domain, wherein the second dimerization domain binds to the first dimerization domain; a branch point sequence; a polypyrimidine tract; a splice acceptor; and a coding sequence for a middle portion of the target protein; a second splice donor; and a third dimerization domain; and (c) a third synthetic nucleic acid molecule comprising a third promoter oper
  • a system for expressing a target protein comprising (a) a first synthetic nucleic acid molecule comprising a first promoter operably linked to a sequence encoding an RNA molecule, the RNA molecule comprising from 5’ to 3’: a coding sequence for an N-terminal portion of the target protein, a splice donor, and a first dimerization domain; (b) a second synthetic nucleic acid molecule comprising a second promoter operably linked to a sequence encoding an RNA molecule, the RNA molecule comprising from 5’ to 3’: a second dimerization domain, wherein the second dimerization domain binds to the first dimerization domain; a branch point sequence; a polypyrimidine tract; a splice acceptor; and a coding sequence for a middle portion of the target protein; a second splice donor; and a third dimerization domain; and (c) a third synthetic nucleic acid molecule comprising a third promoter operably linked
  • first and second promoter are the same promoter; the first and second promoter are different promoters; the first, second, and third promoters are the same promoter; the first, second, and third promoters are different promoters; the first, second, third, and fourth promoters are the same promoter; or the first, second, third and fourth promoters are different promoters.
  • each of the first, second, third, and fourth promoter is independently selected from: a constitutive promoter; a tissue-specific promoter; and a promoter endogenous to the target protein.
  • composition of claim 7, wherein direct binding or indirect binding comprises basepairing interactions, non-canonical base pairing interactions, non-base pairing interactions, or a combination thereof.
  • composition of claim 7 or 8, wherein direct binding comprises base pairing interactions between kissing loops or hypodiverse regions.
  • composition of claim 7 or 8 wherein direct binding comprises non-canonical basepairing interactions, non-canonical base pairing interactions, non-base pairing interactions, or a combination thereof, between aptamer regions.
  • composition of claim 7 or 8, wherein indirect binding comprises basepairing interactions through a nucleic acid bridge.
  • composition of claim 7 or 8, wherein indirect binding comprises non -base pairing interactions between an aptamer and an aptamer target, or between two aptamers.
  • the first synthetic nucleic acid molecule further comprises one or both of a downstream intronic splice enhancer (DISE) 3’ to the splice donor and 5’ to the first dimerization domain, an intronic splice enhancer (ISE) 3’ to the splice donor and 5’ to the first dimerization domain; and/or the second synthetic nucleic acid molecule further comprises one or both of an ISE 3’ to the second dimerization domain and 5’ to the branch point sequence, and a DISE 3’ to the splice donor and 5 ’ to the dimerization domain; and any combination thereof.
  • DISE downstream intronic splice enhancer
  • ISE intronic splice enhancer
  • the first synthetic nucleic acid molecule further comprises a DISE 3’ to the first splice donor and 5’ to the first dimerization domain, an ISE 3’ to the first splice donor and 5’ to the first dimerization domain, or both a DISE and ISE;
  • the second synthetic nucleic acid molecule further comprises an ISE 3’ to the second dimerization domain and 5’ to the first branch point sequence, a DISE 3’ to the second splice donor and 5’ to the second dimerization domain, an ISE 3’ to the second splice donor and 5’ to the third dimerization domain, or combinations thereof;
  • the third synthetic nucleic acid molecule further comprises an ISE 3’ to the fourth dimerization domain and 5’ to the second branch point sequence; and any combination thereof.
  • the first synthetic nucleic acid molecule further comprises a DISE 3’ to the first splice donor and 5’ to the first dimerization domain, an ISE 3’ to the first splice donor and 5’ to the first dimerization domain, or both a DISE and ISE;
  • the second synthetic nucleic acid molecule further comprises an ISE 3’ to the second dimerization domain and 5’ to the first branch point sequence, a DISE 3’ to the second splice donor and 5’ to the second dimerization domain, an ISE 3’ to the second splice donor and 5’ to the third dimerization domain, or combinations thereof;
  • the third synthetic nucleic acid molecule further comprises ISE 3’ to the fourth dimerization domain and 5’ to the second branch point sequence; and/or the fourth synthetic nucleic acid molecule further comprises a ISE 3’ to the fifth dimerization domain and 5’ to the third branch point sequence, a DISE 3’ to the third splice donor and
  • each of the synthetic first, second, third and fourth nucleic acid molecules are part of a separate viral vector.
  • the first and/or third synthetic nucleic acid molecule further comprises a self-cleaving RNA sequence or an RNA-cleaving enzyme target sequence positioned anywhere 3 ’ to the splice donor such that it cleaves off the 3’ located polyadenylated tail to decrease or suppress protein fragment expression from a non-recombined RNA molecule;
  • the second and/or fourth synthetic nucleic acid molecule further comprises a self-cleaving RNA sequence or an RNA-cleaving enzyme target sequence positioned anywhere 5’ to the branch point sequence such that it cleaves off the 5’ located RNA cap to decrease or suppress protein fragment expression from a non-recombined RNA molecule;
  • the second and/or fourth synthetic nucleic acid molecule further comprises a start codon anywhere 5’ to the branch point sequence that is shifted relative to the open reading frame 3’ of the splice acceptor to decrease or suppress translation of a target protein fragment from a non-recombined RNA
  • any one, two, three, or four synthetic nucleic acid molecules of the system each has a size independently selected from: about 2500 nt to about 5000 nt, 2,500 nt to about 2,750 nt, about 2,500 nt to about 3,000 nt, about 2,500 nt to about 3,250 nt, about 2,500 nt to about 3,500 nt, about 2,500 nt to about 3,750 nt, about 2,500 nt to about 4,000 nt, about 2,500 nt to about 4,250 nt, about 2,500 nt to about 4,500 nt, about 2,500 nt to about 4,750 nt, about 2,500 nt to about 5,000 nt, about 2,750 nt to about 3,000 nt, about 2,750 nt to about
  • the synthetic nucleic acid molecules have a total size selected from about 5000 nt to about 10,000 nt, about 5,000 nt to about 5,500 nt, about 5,000 nt to about 6,000 nt, about 5,000 nt to about 6,500 nt, about 5,000 nt to about 7,000 nt, about 5,000 nt to about 7,500 nt, about 5,000 nt to about 8,000 nt, about 5,000 nt to about 8,500 nt, about 5,000 nt to about 9,000 nt, about 5,000 nt to about 9,500 nt, about 5,000 nt to about 10,000 nt, about 5,500 nt to about 6,000 nt, about 5,500 nt to about 6,500 nt, about 5,500 nt to about 7,000 nt, about 5,500 nt to about 7,500 nt, about 5,500 nt to about 8,000 nt, about
  • the total target protein coding sequence is about 2,000 nt, about 3,000 nt, about 3,500 nt, about 4,000 nt, about
  • RNA encoded by the two synthetic nucleic acid molecules has a total size selected from about 5,000 nt to about 9000 nt, about 5,000 nt to about 5,500 nt, about 5,000 nt to about 6,000 nt, about 5,000 nt to about 6,500 nt, about 5,000 nt to about 7,000 nt, about 5,000 nt to about 7,500 nt, about 5,000 nt to about 8,000 nt, about 5,000 nt to about 8,500 nt, about 5,000 nt to about 9,000 nt, about 5,500 nt to about 6,000 nt, about 5,500 nt to about 6,500 nt, about 5,500 nt to about 7,000 nt, about 5,500 nt to about 5,500 nt to about 7,000 nt, about 5,500 nt to about 5,500 nt to about 7,000 nt, about 5,500 nt to about 5,500 nt to about 7,000 nt, about 5,500
  • the RNA encoded by the two synthetic nucleic acid molecules has a total size of about 5,000 nt, about 5,500 nt, about 6,000 nt, about 6,500 nt, about 7,000 nt, about 7,500 nt, about 8,000 nt, about 8,500 nt, and about 9,000 nt.
  • the synthetic nucleic acid molecules have a total size selected from about 7500 nt to about 15,000 nt, about 7,500 nt to about 8,500 nt, about 7,500 nt to about 9,500 nt, about 7,500 nt to about 10,000 nt, about 7,500 nt to about 10,500 nt, about 7,500 nt to about 11,000 nt, about 7,500 nt to about
  • the synthetic nucleic acid molecules have a total size of about 7,500 nt, about 8,500 nt, about 9,500 nt, about 10,000 nt, about
  • the total target protein coding sequence is selected from about 3000 nt to about 12,000 nt, about 3,000 nt to about 4,000 nt, about 3,000 nt to about 5,000 nt, about 3,000 nt to about 6,000 nt, about
  • the total target protein coding sequence is about 3,000 nt, about 4,000 nt, about 5,000 nt, about 6,000 nt, about 7,000 nt, about 7,500 nt, about 8,000 nt, about 8,500 nt, about 9,000 nt, about 1,000 nt, about
  • the RNA encoded by the three synthetic nucleic acid molecules has a total size selected from about 7500 nt to about 13,500 nt, about 7,500 nt to about 8,500 nt, about 7,500 nt to about 9,000 nt, about 7,500 nt to about 9,500 nt, about 7,500 nt to about 10,000 nt, about 7,500 nt to about 10,500 nt, about 7,500 nt to about 11,000 nt, about 7,500 nt to about 11,500 nt, about 7,500 nt to about 12,000 nt, about 7,500 nt to about 12,500 nt, about 7,500 nt to about 13,000 nt, about 7,500 nt to about 13,500 nt, about 8,500 nt to about 9,000 nt, about 8,500 nt to about 9,500 nt, about 8,500 nt to about 10,000 nt, about 8,500 nt to about 13,500 nt to about 8,500 nt to about 9,000
  • the RNA encoded by the two synthetic nucleic acid molecules has a total size of about 7,500 nt, about 8,500 nt, about 9,000 nt, about 9,500 nt, about 10,000 nt, about 10,500 nt, about 11,000 nt, about 11,500 nt, about 12,000 nt, about 12,500 nt, about 13,000 nt, and about 13,500 nt.
  • the synthetic nucleic acid molecules have a total size selected from about 10,000 nt to about 20,000 nt, about 10,000 nt to about 11,000 nt, about 10,000 nt to about 12,000 nt, about 10,000 nt to about 13,000 nt, about 10,000 nt to about 14,000 nt, about 10,000 nt to about 15,000 nt, about 10,000 nt to about 16,000 nt, about 10,000 nt to about 17,000 nt, about 10,000 nt to about 18,000 nt, about 10,000 nt to about 19,000 nt, about 10,000 nt to about 20,000 nt, about 11,000 nt to about 12,000 nt, about 11,000 nt to about 13,000 nt, about 11,000 nt to about 14,000 nt, about 11,000 nt to about 15,000 nt, about 11,000 nt to about 16,000 nt, about 11,000 nt to about 17,000
  • the synthetic nucleic acid molecules have a total size of about 10,000 nt, about 11,000 nt, about 12,000 nt, about 13,000 nt, about 14,000 nt, about 15,000 nt, about 16,000 nt, about 17,000 nt, about 18,000 nt, about 19,000 nt, and about 20,000 nt; the total target protein coding sequence is selected from about 4000 nt to about 16,000 nt, about 5,000 nt to about 6,000 nt, about 5,000 nt to about 7,000 nt, about 5,000 nt to about 8,000 nt, about 5,000 nt to about 9,000 nt, about 5,000 nt to about 10,000 nt, about 5,000 nt to about 11,000 nt, about 5,000 nt to about 12,000 nt, about 5,000 nt to about 13,000 nt, about 5,000 nt to about 14,000 nt, about 5,000 nt to about 15,000 nt, about
  • the total target protein coding sequence is about 5,000 nt, about 6,000 nt, about 7,000 nt, about 8,000 nt, about 9,000 nt, about 10,000 nt, about 11,000 nt, about 12,000 nt, about 13,000 nt, about 14,000 nt, about 15,000 nt, or about 16,000 nt.
  • the total target protein coding sequence is at least about 5,000 nt, about 6,000 nt, about 7,000 nt, about 8,000 nt, about 9,000 nt, about 10,000 nt, about 11,000 nt, about 12,000 nt, about 13,000 nt, about 14,000 nt, and about 15,000 nt; and/or the RNA encoded by the two synthetic nucleic acid molecules has a total size selected from about 10,000 nt to about 18,000 nt, about 10,000 nt to about 11,000 nt, about 10,000 nt to about 12,000 nt, about 10,000 nt to about 13,000 nt, about 10,000 nt to about 14,000 nt, about 10,000 nt to about 15,000 nt, about 10,000 nt to about 16,000 nt, about 10,000 nt to about 17,000 nt, about 10,000 nt to about 18,000 nt, about 11,000 nt to about 12,000 nt, about 11,000 nt to about 13,000 n
  • the RNA encoded by the two synthetic nucleic acid molecules has a total size of about 10,000 nt, about 11,000 nt, about 12,000 nt, about 13,000 nt, about 14,000 nt, about 15,000 nt, about 16,000 nt, about 17,000 nt, and about 18,000 nt.
  • RNA recombination efficiency is about 10% to about 95%, about 10% to about 20%, about 10% to about 30%, about 10% to about 35%, about 10% to about 40%, about 10% to about 45%, about 10% to about 50%, about 10% to about 55%, about 10% to about 60%, about 10% to about 70%, about 10% to about 80%, about 10% to about 90%, about 20% to about 30%, about 20% to about 35%, about 20% to about 40%, about 20% to about 45%, about 20% to about 50%, about 20% to about 55%, about 20% to about 60%, about 20% to about 70%, about 20% to about 80%, about 20% to about 90%, about 30% to about 35%, about 30% to about 40%, about 30% to about 45%, about 30% to about 50%, about 30% to about 55%, about 30% to about 60%, about 30% to about 70%, about 30% to about 80%, about 30% to about 90%, about 35% to about 40%, about 35% to about 45%, about 35% to about 50%, about 30% to about 55%, about 30% to about 60%, about 30% to about 70%, about 30% to about
  • first dimerization domain and the second dimerization domain, the third dimerization domain and the fourth dimerization domain, and/or the fifth dimerization domain and the sixth dimerization domain are each no more than 1000 nt, such as at least 50 nt, at least 100 nt, at least 150 nt, at least 200 nt, at least 300 nt, at least 400 nt, at least 500 nt, 50 to 1000 nt, 50 to 500 nt, 50 to 150 nt, 50, 100, 150, 200, 250, 300, 400, or 500 nt; and the system has a recombination efficiency of at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least
  • each dimerization domain is no more than 1000 nt, such as at least 50 nt, at least 100 nt, at least 150 nt, at least 200 nt, at least 300 nt, at least 400 nt, at least 500 nt, 50 to 1000 nt, 50 to 500 nt, 50 to 150 nt, 50, 100, 150, 200, 250, 300, 400, or 500 nt; and the system has a recombination efficiency of at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, or at least 90%.
  • composition comprising the system of any one of embodiments 1 to 36.
  • composition comprising an RNA molecule as described in any one of embodiments 1 to 37.
  • composition comprising one, two, three, or four RNA molecules as described in any one of embodiments 1 to 37.
  • RNA molecule as described in any one of embodiments 1 to 36. 42.
  • a kit comprising the system of any one of embodiments 1 to 41, or composition of any one of embodiments 37 to 40, wherein any of the synthetic first, second, third and fourth nucleic acid molecules can be in separate containers, and optionally further comprising a buffer such as a pharmaceutically acceptable carrier.
  • a method of expressing a target protein in a cell comprising: introducing the system of any one of embodiments 1 to 36, or composition of any one of embodiments 35 to 37, into a cell, and expressing the synthetic first and second, first, second, and third, or first, second, third and fourth RNA molecules in the cell, wherein the target protein is produced in the cell.
  • the genetic disease is Duchenne muscular dystrophy and the target protein is dystrophin; the genetic disease is Hemophilia A and the target protein is F8; the genetic disease is Stargardt disease and the target protein is ABCA4; or the genetic disease is Usher syndrome and the target protein is MY07A.
  • a nucleic acid molecule comprising at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to a synthetic intron provided in any one of SEQ
  • nucleic acid molecule of embodiment 47 wherein the synthetic intron is nt 3703 to 3975 of SEQ ID NO: 20, nt 1 to 228 of SEQ ID NO: 21, nt 3703 to 3975 of SEQ ID NO: 22, nt 1 to 225 of SEQ ID NO: 23, nt 3560 to 3828 of SEQ ID NO: 24, or nt 1-225 of SEQ ID NO: 25.
  • the synthetic nucleic acid molecule of embodiment 49 wherein the portion of the protein coding sequence comprises an N-terminal half, an N-terminal third, a middle portion, a C-terminal half, or a C-terminal third of the protein coding sequence.
  • the synthetic nucleic acid is DNA that is produced by transcription of an RNA virus genome by reverse transcriptase.
  • a composition for expressing a target protein comprising (a) a first RNA molecule, the RNA molecule comprising from 5’ to 3’: (i) a coding sequence for an N-terminal portion of the target protein; (ii) a splice donor; and (iii) a first dimerization domain; and (b) a second RNA molecule, the RNA molecule comprising from 5’ to 3’: (i) a second dimerization domain, wherein the second dimerization domain binds to the first dimerization domain; (ii) a branch point sequence; (iii) a polypyrimidine tract; (iv) a splice acceptor; and (v) a coding sequence for a C-terminal portion of the target protein.
  • a composition for expressing a target protein comprising: (a) a first RNA molecule, the RNA molecule comprising from 5’ to 3’: (i) a coding sequence for an N-terminal portion of the target protein; (ii) a splice donor; and (iii) a first dimerization domain; and (b) a second RNA molecule, the RNA molecule comprising from 5’ to 3’: (i) a second dimerization domain, wherein the second dimerization domain binds to the first dimerization domain; (ii) a branch point sequence; (iii) a polypyrimidine tract; (iv) a splice acceptor; (v) a coding sequence for a middle portion of the target protein; (vi) a second splice donor; and (vii) a third dimerization domain; and (c) a third RNA molecule, the RNA molecule comprising from 5 ’ to 3 ’ : (i) a fourth dimer
  • a composition for expressing a target protein comprising (a) a first RNA molecule, the RNA molecule comprising from 5’ to 3’: (i) a coding sequence for an N-terminal portion of the target protein, (ii) a splice donor; and (iii) a first dimerization domain; (b) a second RNA molecule, the RNA molecule comprising from 5’ to 3’: (i) a second dimerization domain, wherein the second dimerization domain binds to the first dimerization domain; (ii) a branch point sequence; (iii) a polypyrimidine tract; (iv) a splice acceptor; (v) a coding sequence for a middle portion of the target protein; (vi) a second splice donor; and (vii) a third dimerization domain; and (c) a third RNA molecule, the RNA molecule comprising from 5’ to 3’: (i) a fourth dimerization domain, wherein
  • composition of claim 4, wherein direct binding or indirect binding comprises basepairing interactions, non-canonical base pairing interactions, non-base pairing interactions, or a combination thereof.
  • composition of claim 4 or 5, wherein direct binding comprises base pairing interactions between kissing loops or hypodiverse regions.
  • composition of claim 4 or 5, wherein direct binding comprises non-canonical basepairing interactions, non-canonical base pairing interactions, non-base pairing interactions, or a combination thereof, between aptamer regions.
  • composition of claim 4 or 5, wherein indirect binding comprises basepairing interactions through a nucleic acid bridge.
  • composition of claim 4 or 5 wherein indirect binding comprises non-base pairing interactions between an aptamer and an aptamer target agent, or between two aptamers.
  • composition of embodiment 13, wherein the disease is a monogenic disease.
  • composition of embodiment 14, wherein the therapeutic protein is a toxin.
  • composition of any one of embodiments 13 to 15, wherein the disease and the target protein are one listed in Table 1.
  • DISE downstream intronic splice enhancer
  • ISE intronic splice enhancer
  • the first RNA molecule further comprises a DISE 3’ to the first splice donor and 5’ to the first dimerization domain, an ISE 3’ to the first splice donor and 5’ to the first dimerization domain, or both; the RNA molecule further comprises an ISE 3’ to the second dimerization domain and 5’ to the first branch point sequence, a DISE 3’ to the second splice donor and 5’ to the second dimerization domain, an ISE 3’ to the second splice donor and 5’ to the third dimerization domain, or any combination thereof; and/or the third RNA molecule further comprises an ISE 3’ to the fourth dimerization domain and 5’ to the second branch point sequence; or any combination thereof.
  • the first RNA molecule further comprises a DISE 3’ to the first splice donor and 5’ to the first dimerization domain, an ISE 3’ to the first splice donor and 5’ to the first dimerization domain, or both;
  • the second RNA molecule further comprises an ISE 3’ to the second dimerization domain and 5’ to the first branch point sequence, a DISE 3’ to the second splice donor and 5’ to the second dimerization domain, an ISE 3’ to the second splice donor and 5’ to the third dimerization domain, or any combination thereof;
  • the third RNA molecule further comprises an ISE 3’ to the fourth dimerization domain and 5’ to the second branch point sequence; and/or the fourth RNA molecule further comprises an ISE 3’ to the fifth dimerization domain and 5’ to the third branch point sequence, a DISE 3’ to the third splice donor and 5’ to the fifth dimerization domain, an ISE 3’ to the third
  • a composition for expressing a target protein comprising: (a) a first synthetic DNA molecule that encodes the first RNA molecule of any one of embodiments 1 and 4 to 24, wherein the first synthetic DNA molecule comprises (i) a first promoter operably linked to a sequence encoding the first RNA molecule; and (b) a second synthetic DNA molecule that encodes the second RNA molecule of any one of embodiments 1 and 4 to 24, wherein the second synthetic DNA molecule comprises (i) a second promoter operably linked to a sequence encoding the second RNA molecule.
  • a composition for expressing a target protein comprising: (a) a first synthetic DNA molecule that encodes the first RNA molecule of any one of embodiments 2 and 4 to 24, wherein the first synthetic DNA molecule comprises (i) a first promoter operably linked to a sequence encoding the first RNA molecule; (b) a second synthetic DNA molecule that encodes the second RNA molecule of any one of embodiments 2 and 4 to 24, wherein the second synthetic DNA molecule comprises (i) a second promoter operably linked to a sequence encoding the second RNA molecule; and (c) a third synthetic DNA molecule that encodes the third RNA molecule of any one of embodiments 2 and 4 to 24, wherein the third synthetic DNA molecule comprises (i) a third promoter operably linked to a sequence encoding the third RNA molecule.
  • a composition for expressing a target protein comprising: (a) a first synthetic DNA molecule that encodes the first RNA molecule of any one of embodiments 3 and 4 to 24, wherein the first synthetic DNA molecule comprises (i) a first promoter operably linked to a sequence encoding the first RNA molecule; (b) a second synthetic DNA molecule that encodes the second RNA molecule of any one of embodiments 3 and 4 to 24, wherein the second synthetic DNA molecule comprises (i) a second promoter operably linked to a sequence encoding the second RNA molecule; (c) a third synthetic DNA molecule that encodes the third RNA molecule of any one of embodiments 3 and 4 to 24, wherein the third synthetic DNA molecule comprises (i) a third promoter operably linked to a sequence encoding the third RNA molecule; and (d) a fourth synthetic DNA molecule that encodes the fourth RNA molecule of any one of embodiments 3 and 4 to 24, wherein the fourth synthetic DNA molecule comprises (i) a fourth promoter operably
  • a system for expressing a target protein comprising a composition of any one of embodiments 25 to 30.
  • each of the first and second RNA molecules in a two-part system
  • each of the first, second and third RNA molecules in a three-part system
  • each of the first, second, third and fourth, RNA molecules in a four-part system
  • the total target protein coding sequence size is selected from about 2000 nt to about 8000 nt, about 2,000 nt to about 3,000 nt, about 2,000 nt to about 3,500 nt, about 2,000 nt to about 4,000 nt, about 2,000 nt to about 4,500 nt, about 2,000 nt to about 5,000 nt, about 2,000 nt to about 5,500 nt, about 2,000 nt to about 6,000 nt, about 2,000 nt to about 6,500 nt, about 2,000 nt to about 7,000 nt, about 2,000 nt to about 7,500
  • the total target protein coding sequence is about 2,000 nt, about 3,000 nt, about 3,500 nt, about 4,000 nt, about 4,500 nt, about 5,000 nt, about 5,500 nt, about 6,000 nt, about 6,500 nt, about 7,000 nt, about
  • RNA molecules encoded by the two synthetic DNA molecules is about 5,000 nt to about 9000 nt, about 5,000 nt to about 5,500 nt, about 5,000 nt to about 6,000 nt, about 5,000 nt to about 6,500 nt, about 5,000 nt to about 7,000 nt, about 5,000 nt to about 7,500 nt, about
  • nt to about 9,000 nt, about 5,000 nt, about 5,500 nt, about 6,000 nt, about 6,500 nt, about 7,000 nt, about 7,500 nt, about 8,000 nt, about 8,500 nt, or about 9,000 nt.
  • any one of embodiments 31 to 36 comprising a composition of any one of embodiments 26 and 28 to 30, wherein: the first, second, and third synthetic DNA molecules have a total size of about 7500 nt to about 15,000 nt, about 7,500 nt to about 8,500 nt, about 7,500 nt to about 9,500 nt, about 7,500 nt to about 10,000 nt, about 7,500 nt to about 10,500 nt, about 7,500 nt to about 11,000 nt, about 7,500 nt to about
  • RNA molecules encoded by the three synthetic DNA molecules is about 7500 nt to about 13,500 nt, about 7,500 nt to about 8,500 nt, about 7,500 nt to about 9,000 nt, about 7,500 nt to about 9,500 nt, about 7,500 nt to about 10,000 nt, about 7,500 nt to about 10,500 nt, about 7,500 nt to about 11,000 nt, about 7,500 nt to about 11,500 nt, about 7,500 nt to about 12,000 nt, about
  • any one of embodiments 31 to 36 comprising a composition of any one of embodiments 27 and 28 to 30, wherein: the first, second, third and fourth synthetic DNA molecules have a total size of about 10,000 nt to about 20,000 nt, about 10,000 nt to about 11,000 nt, about 10,000 nt to about 12,000 nt, about 10,000 nt to about 13,000 nt, about 10,000 nt to about 14,000 nt, about 10,000 nt to about 15,000 nt, about 10,000 nt to about 16,000 nt, about 10,000 nt to about 17,000 nt, about 10,000 nt to about 18,000 nt, about 10,000 nt to about 19,000 nt, about 10,000 nt to about 20,000 nt, about 11,000 nt to about 12,000 nt, about 11,000 nt to about 13,000 nt, about 11,000 nt to about 14,000 nt, about 11,000 nt to about 15,000 nt, about 11,000 nt to about 15,000
  • the total target protein coding sequence is about 5,000 nt, about 6,000 nt, about 7,000 nt, about 8,000 nt, about 9,000 nt, about 10,000 nt, about 11,000 nt, about 12,000 nt, about 13,000 nt, about 14,000 nt, about 15,000 nt, about 16,000 nt about 5,000 nt, about 6,000 nt, about 7,000 nt, about 8,000 nt, about 9,000 nt, about 10,000 nt, about 11,000 nt, about 12,000 nt, about 13,000 nt, about 14,000 nt, or about 15,000 nt; and/or the summed size of the RNA molecules encoded by the four synthetic DNA molecules is about 10,000 nt to about 18,000 nt, about 10,000 nt to about 11,000 nt, about 10,000 nt to about 12,000 nt, about 10,000 nt to about 13,000 nt, about 10,000 nt to about 14,000 nt,
  • first dimerization domain and the second dimerization domain, the third dimerization domain and the fourth dimerization domain, and/or the fifth dimerization domain and the sixth dimerization domain are each no more than 1000 nt, such as at least 50 nt, at least 100 nt, at least 150 nt, at least 200 nt, at least 300 nt, at least 400 nt, at least 500 nt, 50 to 1000 nt, 50 to 500 nt, 50 to 150 nt, 50, 100, 150, 200, 250, 300, 400, or 500 nt; and the system has a recombination efficiency of at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least
  • each dimerization domain is no more than 1000 nt, such as at least 50 nt, at least 100 nt, at least 150 nt, at least 200 nt, at least 300 nt, at least 400 nt, at least 500 nt, 50 to 1000 nt, 50 to 500 nt, 50 to 150 nt, 50, 100, 150, 200, 250, 300, 400, or 500 nt; and the system has a recombination efficiency of at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 90%, or about 100%.
  • RNA recombination efficiency is about 10% to about 100%, about 10% to about 20%, about 10% to about 30%, about 10% to about 35%, about 10% to about 40%, about 10% to about 45%, about 10% to about 50%, about 10% to about 55%, about 10% to about 60%, about 10% to about 70%, about 10% to about 80%, about 10% to about 90%, about 20% to about 30%, about 20% to about 35%, about 20% to about 40%, about 20% to about 45%, about 20% to about 50%, about 20% to about 55%, about 20% to about 60%, about 20% to about 70%, about 20% to about 80%, about 20% to about 90%, about 30% to about 35%, about 30% to about 40%, about 30% to about 45%, about 30% to about 50%, about 30% to about 55%, about 30% to about 60%, about 30% to about 70%, about 30% to about 80%, about 30% to about 90%, about 35% to about 40%, about 35% to about 45%, about 35% to about 50%, about 30% to about 55%, about 30% to about 60%, about 30% to about 70%, about 30% to about 80%
  • composition comprising a system of any one of embodiments 31 to 43.
  • composition of embodiment 44 wherein the composition comprises first, second, third and optionally fourth RNA molecules, each encoding at least a portion of dystrophin, factor 8, ABCA4, or MY07A.
  • kits comprising the system of any one of embodiments 31 to 43, or composition of any one of embodiments 44 and 45, wherein any of the synthetic first, second, third and fourth nucleic acid molecules can be in separate containers, and optionally further comprising a buffer such as a pharmaceutically acceptable carrier.
  • a method of expressing a target protein in a cell comprising: introducing the system of any one of embodiments 31 to 43, or composition of any one of embodiments 44 and 45, into a cell, and expressing the first and second, first, second, and third, or first, second, third and fourth RNA molecules in the cell, wherein the target protein is produced in the cell.
  • the genetic disease is Duchenne muscular dystrophy and the target protein is dystrophin; the genetic disease is Hemophilia A and the target protein is F8; the genetic disease is Stargardt disease and the target protein is ABCA4; or the genetic disease is Usher syndrome and the target protein is MY07A.
  • RNA molecules comprise a synthetic intron selected from: nt 3703 to 3975 of SEQ ID NO: 20, nt 1 to 228 of SEQ ID NO: 21, nt 3703 to 3975 of SEQ ID NO: 22, nt 1 to 225 of SEQ ID NO: 23, nt 3560 to 3828 of SEQ ID NO: 24, and nt 1-225 of SEQ ID NO: 25.
  • a system of any one of embodiments 31 to 43 and 51 to 54, a composition of any one of embodiments 1 to 24, 44 and 45, or a method of any one of embodiments 47 to 50 comprising: (a) a first RNA molecule, the RNA molecule comprising from 5’ to 3’: (i) a coding sequence for an N- terminal portion of the target protein; (ii) a splice donor; (ii-2) a DISE, an ISE, or both; and (iii) a first dimerization domain; and (b) a second RNA molecule, the RNA molecule comprising from 5’ to 3’: (i) a second dimerization domain, wherein the second dimerization domain binds to the first dimerization domain; (i-2) at least one ISE sequences; (ii) a branch point sequence; (iii) a polypyrimidine tract; (iv) a splice acceptor; and (v) a coding sequence for a C
  • the total target protein coding sequence is about 2000 nt to about 8000 nt, about 2,000 nt to about 3,000 nt, about 2,000 nt to about 3,500 nt, about 2,000 nt to about 4,000 nt, about 2,000 nt to about 4,500 nt, about 2,000 nt to about 5,000 nt, about 2,000 nt to about 5,500 nt, about 2,000 nt to about 6,000 nt, about 2,000 nt to about 6,500 nt, about 2,000 nt to about 7,000 nt, about 2,000 nt to about 7,500 nt, about 2,000 nt to about 8,000 nt, about 3,000 nt to about 3,500 nt, about 3,000 nt to about 4,000 nt, about 3,000 nt to about 4,500 nt, about 3,000 nt to about 5,000 nt, about 3,000 nt, wherein: the total target protein coding sequence is about 2000 nt
  • the total target protein coding sequence is about 2,000 nt, about 3,000 nt, about 3,500 nt, about 4,000 nt, about 4,500 nt, about 5,000 nt, about 5,500 nt, about 6,000 nt, about 6,500 nt, about 7,000 nt, about 7,500 nt, or about 8,000 nt; and/or the summed size of the two RNA molecules is about 5,000 nt to about 9000 nt, about 5,000 nt to about 5,500 nt, about 5,000 nt to about 6,000 nt, about 5,000 nt to about 6,500 nt, about 5,000 nt to about 7,000 nt, about 5,000 nt to about 7,500 nt, about 5,000 nt to about 8,000 nt, about 5,000 nt to about 8,500 nt, about 5,000 nt to about 9,000 nt, about 5,500 nt to about 6,000 nt, about 5,500 nt
  • the total target protein coding sequence size is about 3000 nt to about 12,000 nt, about 3,000 nt to about 4,000 nt, about 3,000 nt to about 5,000 nt, about 3,000 nt to about 6,000 nt, about 3,000 nt to about 7,000 nt, about 3,000 nt to about 7,500 nt, about 3,000 nt to about 8,000 nt, about 3,000 nt to about 8,500 nt, about 3,000 nt to about 9,000 nt, about 3,000 nt to about 1,000 nt, about 3,000 nt to about 11,000 nt, about 3,000 nt to about 12,000 nt, about 4,000 nt to about 5,000 nt, about 4,000 nt to about 6,000 nt, about 4,000 nt to about 7,000 nt, about 4,000 nt to about 7,500 nt, about 4,000 nt to about 5,000 nt, about 4,000 nt to about
  • nt, about 9,000 nt, about 1,000 nt, about 11,000 nt, or about 12,000 nt; and/or the summed size of the three RNA molecules is about 7500 nt to about 13,500 nt, about 7,500 nt to about 8,500 nt, about 7,500 nt to about 9,000 nt, about 7,500 nt to about 9,500 nt, about 7,500 nt to about 10,000 nt, about 7,500 nt to about 10,500 nt, about 7,500 nt to about 11,000 nt, about 7,500 nt to about 11,500 nt, about 7,500 nt to about 12,000 nt, about 7,500 nt to about 12,500 nt, about 7,500 nt to about 13,000 nt, about 7,500 nt to about 13,500 nt, about 8,500 nt to about 9,000 nt, about 8,500 nt to about 9,500 nt, about 8,500 nt to about 10,000 nt
  • the total target protein coding sequence size is about 4000 nt to about 16,000 nt, about 5,000 nt to about 6,000 nt, about 5,000 nt to about 7,000 nt, about 5,000 nt to about 8,000 nt, about 5,000 nt to about 9,000 nt, about 5,000 nt to about 10,000 nt, about 5,000 nt to about 11,000 nt, about 5,000 nt to about 12,000 nt, about 5,000 nt to about 13,000 nt, about 5,000 nt to about 14,000 nt, about 5,000 nt to about 15,000 nt, about 5,000 nt to about 16,000 nt, about 6,000 nt to about 7,000 nt, about 6,000 nt to about 8,000 nt, about 6,000 nt to about 9,000 nt, about 6,000 nt to about 10,000 nt, about 6,000 nt, wherein: the total target protein coding sequence size is about 4000
  • the total target protein coding sequence is about 5,000 nt, about 6,000 nt, about 7,000 nt, about 8,000 nt, about 9,000 nt, about 10,000 nt, about 11,000 nt, about 12,000 nt, about 13,000 nt, about 14,000 nt, about 15,000 nt, about 16,000 nt about 5,000 nt, about 6,000 nt, about 7,000 nt, about 8,000 nt, about 9,000 nt, about 10,000 nt, about 11,000 nt, about 12,000 nt, about 13,000 nt, about 14,000 nt, or about 15,000 nt; and/or the summed size of the RNA molecules encoded by the four synthetic DNA molecules is about 10,000 nt to about 18,000 nt, about 10,000 nt to about 11,000 nt, about 10,000 nt to about 12,000 nt, about 10,000 nt to about 13,000 nt, about 10,000 nt to about 14,000 nt,
  • any one of embodiments 1 to 24 and 57 to 60, wherein the first dimerization domain and the second dimerization domain, the third dimerization domain and the fourth dimerization domain, and/or the fifth dimerization domain and the sixth dimerization domain, are each no more than 1000 nt, such as at least 50 nt, at least 100 nt, at least 150 nt, at least 200 nt, at least 300 nt, at least 400 nt, at least 500 nt, 50 to 1000 nt, 50 to 500 nt, 50 to 150 nt, 50, 100, 150, 200, 250, 300, 400, or 500 nt; and the system has a recombination efficiency of at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least
  • each dimerization domain is no more than 1000 nt, such as at least 50 nt, at least 100 nt, at least 150 nt, at least 200 nt, at least 300 nt, at least 400 nt, at least 500 nt, 50 to 1000 nt, 50 to 500 nt, 50 to 150 nt, 50, 100, 150, 200, 250, 300, 400, or 500 nt; and the system has a recombination efficiency of at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, or at least 90%.
  • composition of any one of embodiments 1 to 24 and 57 to 62, wherein the RNA recombination efficiency is about 10% to about 100%, about 10% to about 20%, about 10% to about 30%, about 10% to about 35%, about 10% to about 40%, about 10% to about 45%, about 10% to about 50%, about 10% to about 55%, about 10% to about 60%, about 10% to about 70%, about 10% to about 80%, about 10% to about 90%, about 20% to about 30%, about 20% to about 35%, about 20% to about 40%, about 20% to about 45%, about 20% to about 50%, about 20% to about 55%, about 20% to about 60%, about 20% to about 70%, about 20% to about 80%, about 20% to about 90%, about 30% to about 35%, about 30% to about 40%, about 30% to about 45%, about 30% to about 50%, about 30% to about 55%, about 30% to about 60%, about 30% to about 70%, about 30% to about 80%, about 30% to about 90%, about 35% to about 40%, about 35% to about 45%, about 35% to about 40%, about 35% to about
  • FIG. 1 A depicts a schematic of vector designs (left) and RNA interactions and splicing (right). Left: 5’ trans-splice (trsp) DNA vector: Open arrows are two opposing promoters.
  • RFP coding domain and 3’UTR with poly adenylation elements are expressed opposite from the N-terminal portion of YFP (n-yfp), followed by a splice donor sequence (SD), a downstream intronic splicing enhancer (DISE), and two intronic splicing enhancers (2xISE), a binding domain (BD, also referred to as dimerization domain), and a stable stem loop BoxB element (boxB), a self-cleaving hammerhead ribozyme (HHrz), ending with a 3’ UTR containing poly adenylation elements.
  • SD splice donor sequence
  • DISE downstream intronic splicing enhancer
  • 2xISE two intronic splicing enhancers
  • BD binding domain
  • boxB stable stem loop BoxB element
  • HHrz self-cleaving hammerhead ribozyme
  • 3’ trsp DNA vector Open arrows are two opposing promoters. BFP coding domain and 3’UTR with poly adenylation elements are expressed opposite from complementary binding domain (anti-BD, also referred to as dimerization domain), followed by three intronic splicing enhancer sequences (3xISE), a branch point (BP), a polypyrimidine tract (PPT), a splice acceptor sequence (SA), the c-terminal proton of the YFP coding sequence, ending with a 3 ’ UTR containing poly adenylation elements.
  • 3xISE complementary binding domain
  • BP branch point
  • PPT polypyrimidine tract
  • SA splice acceptor sequence
  • FIG. IB depicts transfection of only the N-terminal expression plasmid does not lead to YFP fluorescence.
  • Flow cytometry displaying 20k RFP+ cells.
  • FIG. 1C depicts transfection of only the C-terminal expression plasmid does not lead to YFP fluorescence. Flow cytometry displaying 20k BFP+ cells.
  • FIG. ID depicts expression of N-terminal and C-terminal fragments without binding domains shows low levels of YFP induction.
  • Flow cytometry displaying red and green fluorescence values for 20k BFP+ cells.
  • FIG. IE depicts rationally designed dimerization/binding domain in a looped configuration. Segments of hypodiverse exclusively pyrimidine or exclusively purine containing sequences are interspaced with stable stem sequences. RNA folding predictions shows 6 stretches of open sequence (numbered 1-6) available for base pairing between the binding domain and its complementary sequence.
  • FIG. IF depicts 3D rendering of the “looped” dimerization domain configuration showing the 6 stretches of open sequence (numbered 1-6).
  • FIG. 1G depicts negative control with no binding domain on the C-terminal half.
  • Flow cytometry displaying red and green fluorescence values for 20k BFP+ cells.
  • FIG. 1H depicts negative control with no binding domain on the N-terminal half.
  • Flow cytometry displaying red and green fluorescence values for 20k BFP+ cells.
  • FIG. II depicts matching binding domains on both N- and C-terminal half shows strong YFP induction in 90% of the cells.
  • Flow cytometry displaying red and green fluorescence values for 20k BFP+ cells.
  • FIGS. 1 J-1N depict data equivalent to that in FIGS. IE- II for a configuration of a binding domain with a stretch of 150 hypodi verse exclusively pyrimidine or exclusively purine containing sequence resulting in a fully open configuration.
  • FIG. 10 depicts representative fluorescence images for cells shown in FIG. lG.
  • FIG. IP depicts representative fluorescence images for cells shown in FIG. 1L.
  • FIG. IQ depicts a comparison of conditions shown in FIG. ID, FIGS. 1G-1I, and FIGS. 1L-1N.
  • YFP induction coefficient is calculated: (#R+Y+ ⁇ #R+Y-) c 100 c med.Y-fluor(R+Y+).
  • a native intron intron I of the mouse parvalbumin gene
  • an optimized binding domain for that intron on the C-terminal fragment are shown (white bar). This illustrates the benefits of the optimized synthetic RNA dimerization and recombination domains.
  • FIG. 2A depicts an exemplary schematic of vector designs.
  • the protein coding sequence of a YFP is split into an N-terminal fragment, a middle fragment (m-yfp) and a C-terminal fragment.
  • the junction of the n and m fragments is joined by a looped design binding domain (BD1) and the junction between m and c fragments is joined by a looped binding domain (BD2).
  • the pyrimidine (Y) and purine (R) sequences are arranged to avoid self-circularization of the m-fragment and avoid direct recombination of the N- and C-fragment.
  • the N-terminal fragment is co-expressed with red fluorescent protein as a transfection control
  • the C-terminal fragment is coexpressed with blue fluorescent protein as a transfection control.
  • FIG. 2B depicts matching binding domains on all three fragments shows strong YFP induction in 80% of the cells.
  • Flow cytometry displaying red and green fluorescence values for 20k BFP+ cells.
  • FIG. 2C depicts representative fluorescent image of expression of the n and m fragment only shows no YFP fluorescence (negative control).
  • FIG. 2D depicts representative fluorescent image of expression of the m and c fragment only shows no YFP fluorescence (negative control).
  • FIG. 2E depicts representative fluorescent image showing that strong YFP fluorescence is induced by co -transfection of all three fragments.
  • Reconstitution of a YFP coding sequence from two fragments is achieved by using two synthetic RNA sequences, wherein one included the n-terminal coding half fragment of YFP, and one included the c-terminal coding half fragment (FIG. 3A) (SEQ ID NOS 1 and 2).
  • Each fragment was expressed from AAV2/8 after systemic (iv) administration in newborn (P3) mouse pups.
  • a total of 1.88E11 viral genomes for each of the two fragments were administered per mouse.
  • Expression of YFP was detected 3 weeks later in the liver, heart muscle, and skeletal muscle using fluorescence microscopy.
  • the disclosed systems can be used to express full-length proteins in vivo, from two or more separate synthetic RNA molecules.
  • Reconstitution of a YFP coding sequence from three fragments is achieved by using three synthetic RNA sequences, wherein one included the n-terminal fragment of YFP, one included a middle fragment of YFP, and one included the c-terminal fragment (FIG. 4A) (SEQ ID NOS: 145, 146 and 2 respectively).
  • Each fragment was expressed from AAV2/8 after intramuscular injection into the e tibialis anterior muscle of newborn (P3) mouse pups. A total of 1E11 viral genomes for each of the fragments was administered intramuscularly. Expression of YFP was detected 3 weeks later in the skeletal muscle using fluorescence microscopy.
  • the disclosed systems can be used to express full-length proteins in vivo, from three or more separate synthetic RNA molecules.
  • FIGS. 5A-5F depict efficient reconstitution of YFP from two and from three fragments in adult mouse tibialis anterior muscle.
  • FIG. 5 A depicts N-terminal and C-terminal halves of YFP coding sequences are equipped with synthetic RNA-dimerization and recombination domains.
  • FIG. 5B depicts two AAV transfer plasmids expressing these two fragments were electroporated transcutaneously into adult mouse tibialis anterior (TA) muscle and strong fluorescence was detected at 5 days post electroporation.
  • FIG. 5C shows no fluorescence was detectable in contralateral non-injected TA.
  • FIG. 5D depicts N-terminal, middle, and C-terminal YFP coding sequence are equipped with synthetic RNA- dimerization and recombination domains linking each fragment to its adjacent fragment(s).
  • FIG. 5E depicts transcutaneous electroporation of three AAV transfer plasmids expressing these three fragments. Strong YFP fluorescence is detected indicating efficient reconstitution of YFP from three fragments.
  • FIG. 5F depicts fluorescence in contralateral non-injected TA. Fluorescent channel is overlaid onto grey scale photographs for context.
  • Two or three vectors were used to successfully express YFP in liver, cardiac muscle and skeletal muscle (two AAV vectors), and in skeletal muscle (three AAV vectors).
  • the synthetic RNA-dimerization and recombination system provided herein can be deployed in the muscle. Based on these results, one can substitute the YFP coding sequence with a dystrophin (or other gene) coding sequence to achieve therapeutic full-length dystrophin (or other gene) expression from AAVs into a desired subject and/or tissue.
  • Adeno-associated viruses are a common and the preferred method of gene delivery in gene replacement therapy. AAVs are non-toxic, well tolerated, and lead to long term expression of the replacement gene without random integration into the genome. However, the dystrophin gene is too large to be delivered by a single virus. If broken down into fragments, full-length dystrophin can only be delivered using a minimum of three viruses.
  • dystrophin Smaller versions of dystrophin called “micro-Dystrophin” or “mini-Dystrophin” are currently being tested for dystrophin gene replacement therapy, but these truncated versions of dystrophin are not expected to have full functionality as they are missing key domains in the rod and hinge section of the protein. To date, past attempts to overcome this limitation have not yielded the efficiency required for treating DMD.
  • a novel technology that can be used to efficiently reconstitute the coding sequence of large genes, including dystrophin, from multiple serial fragments. Using this technology in combination with AAV as a delivery vector, full-length dystrophin will be expressed in a murine model (as well as pig and canine models) for DMD.
  • the subject is a human adult, juvenile, or infant with DMD.
  • the disclosed methods and systems can be used to deliver synthetic RNA-dimerization and recombination domains encoding full-length dystrophin over two or three AAVs ( e.g . , each AAV delivering a half or a third of the full-length coding sequence).
  • the AAVs are myotropic AAVs (e.g., those that preferentially infect muscles). This approach can be used to ameliorate or prevent the onset of dystrophy symptoms in a mouse or canine model for DMD, as well as human subjects.
  • Part 1 Construct efficiently reconstituted three-way split dystrophin expression cassettes. Three expression cassettes are constructed that efficiently reconstitute the full-length dystrophin coding sequence in vitro while each individual expression cassette is within the packaging limit of conventional AAV vectors. To achieve therapeutically effective levels of dystrophin, the expression system can be optimized to achieve roughly physiological levels of dystrophin or moderately supraphysiological levels. Up to 50-fold overexpression of dystrophin is tolerated without adverse effects.
  • the dystrophin coding sequence can be split at a number of different points along its length. Efficiency of reconstitution, however, is affected by the local RNA microenvironment and maximization of reconstitution efficiency is done empirically by comparing efficiency of several possible split points.
  • the natural dystrophin coding sequence can be codon optimized for optimal expression and modified to accommodate maximal reconstitution efficiency. It is expected that the full- length dystrophin coding sequence can be reconstituted from a three-way split precursor using the synthetic RNA-dimerization and recombination approach herein disclosed. In screening different configurations, the set of three expression cassettes that lead to the most efficient reconstitution of dystrophin (e.g., approximately physiological or moderately supraphysiological levels) are selected. Experiments can be performed in HEK293T or Human Skeletal Muscle Cells (HSkMC, either primary or trans-differentiated). Using endogenous vs. exogenous specific quantitative RT-PCR probes, and by epitope tag detection in the exogenous dystrophin protein and Western blot analysis, reconstitution efficiencies will be determined different configurations of the split/reconstituted dystrophin.
  • HSkMC Human Skeletal Muscle Cells
  • Part 2 Maximize full-length dystrophin expression over non-reconstituted fragments. Suppression of fragmented background expression of non-reconstituted dystrophin can be achieved by modification of the synthetic RNA-dimerization and recombination domains. Non-reconstituted fragment expression caused by inefficiencies in RNA-recombination may lead to background expression of dystrophin fragments. Further, suppression of this fragmented background expression may be achieved by modification of the synthetic RNA-dimerization and recombination domains. With the disclosed approach, each fragment of dystrophin is transcribed separately. Reconstitution occurs on the RNA level. Each individual fragment can therefore potentially be translated without being reconstituted.
  • RNA- dimerization and recombination domains can be optimized to avoid non-reconstituted fragment expression and favor full length expression of dystrophin. This can for example be achieved by strategically placing degron sequences, disrupting RNA nuclear export of non-recombined fragments, and introducing decoy translation initiation points. Experiments are carried out in HEK293T and HSkMC.
  • the dystrophin coding sequence can be bookended with epitope tags that allow for identification and quantification of not fully reconstituted fragments of dystrophin using western blot analysis. Cellular distribution of these dystrophin fragments will be assessed using immunohistochemistry in skeletal human muscle cells. Additionally, quantitative assessment of fragment suppression will be done using conventional molecular biology techniques, including quantitative RT PCR across the recombination junctions will be used to determine how efficient the reconstitution on an RNA level occurs. It is expected that low levels of fragmented dystrophin expression will be observed. By modifying the synthetic RNA-dimerization and recombination domains, these fragments can be suppressed.
  • dystrophin form three separate viruses repeated administration of the virus may be performed.
  • the analysis will focus on: (1) skeletal muscles (major forelimb, hindlimb, shoulder, abdominal and, face muscles) and differential infectivity of fast vs. slow twitch muscles, will be assessed by comparing tibialis anterior and soleus muscles, (2) cardiac muscle expression, and (3) liver expression. This cohort of animals will be monitored for possible adverse effects of the high -titer AAV injections.
  • Dytrophin e.g., normal heart function with only about 50% of cardiomyocytes being dystrophin deficient under non-stress conditions. Both, physiological and supraphysiological levels of dystrophin are of therapeutic value. Quantitative assessment will be performed as outlined in Part 1 & 2. In vivo intramuscular and systemic virus application will be performed in neonatal or juvenile mice under aseptic condition.
  • FLD-AAV FLD-AAV is delivered according to parameters established as described under Part 4. Animals are injected in the first postnatal week, in a time window before onset of myonecrosis in mdx mice. Wild-type, treated-mdx and vehicle/sham-treated-mdx mice are e assessed for behavioral and anatomical signs of skeletal and cardiac myopathy.
  • kinematic and electromyographic testing equipment performance of these mice in a variety of motor tasks is assessed, such as balance beam, grip strength, horizontal ladder, treadmill speed challenge, over ground locomotor kinematic assessment, and swimming kinematic assessment (ambient temperature and cold water challenge). It will be determined whether FLD-AAV therapy can prevent the presentation of cardiomyopathy in mdx mice following chemical challenge.
  • a first half of the MY07A coding sequence is appended with a synthetic RNA dimerization and recombination domain and expressed from a first vector/plasmid.
  • the second half of MY07A is appended to the complementary RNA dimerization and recombination domain and expressed from a second vector/plasmid. If expressed together in the same cell the two halves of MY07A are recombined to form the full-length MY07A transcript which is then translated into protein.
  • Breaking a target gene into two nonfunctional halves that get expressed from either two different promoters or using two different delivery vehicles can result in an intersectional expression pattern.
  • promoter 1 of a first synthetic nucleic acid molecule provided herein can drive expression of the N-terminal half of the coding sequence in for example cell types A, B, and C, while promoter 2 of a second synthetic nucleic acid molecule provided herein drives expression of the C- terminal half in a subset of cells A, D, E, and F.
  • the effector gene encoding the target protein is only expressed in the overlapping area (in this example in cell population A).
  • intersectionality can be used by making the two halves conditionally expressed, for example, under the condition of the presence of a recombinase.
  • Another level at which intersectionality can be achieved is by delivering the two halves with two viruses that have different tropisms.
  • Example 9 Complementation The disclosed methods and systems can be used to make any gene (and corresponding target protein) into complementation parts (similar to the principle of alpha complementation of LacZ), by encoding two non-functional halves on separate plasmids that only become active when both plasmids are present.
  • the disclosed systems and methods can be configured such that reconstitution of the two or more portions of the coding sequences of the target protein depends on the presence of a specific “trigger” RNA molecule.
  • a specific “trigger” RNA molecule As shown in FIG. 7B, in this example, the dimerization domains of each synthetic nucleic acid molecule are not reverse complements of one another, but instead specifically hybridize to adjacent regions of a third RNA molecule, a “trigger RNA”, which serves as a bridge to bring two synthetic nucleic acid molecules together.
  • the system can “report” the presence of a specific RNA molecule which allows for “cell type specific triggering” of a reporter/effector protein.
  • This example describes methods used to evaluate recombination of split coding sequences in the presence of a sequence in the 3’-UTR that stabilizes RNA.
  • Woodchuck hepatitis posttranscriptional regulatory element 3 (WPRE3) was used as an exemplary stabilizing sequence.
  • WPRE3 Woodchuck hepatitis posttranscriptional regulatory element 3
  • RNA sequence stabilizers can be used in place of WPRE3.
  • Median YFP fluorescence was measured by flow-cytometry for a two-way split YFP that is reconstituted using the disclosed synthetic RNA dimerization and recombination approach.
  • the C- terminal YFP coding fragment is followed by a poly adenylation signal only (w/o WPRE3) or by a truncated version of the woodchuck hepatitis posttranscriptional regulatory element, WPRE3 followed by a poly adenylation signal (labelled w/WPRE3).
  • the N-terminal YFP coding fragment is coexpressed with a red fluorescent protein from a bidirectional promoter for transfection control.
  • the C -terminal fragment is co-expressed with a blue fluorescent protein from a bidirectional promoter as transfection control. Cells with equal red and blue fluorescent control values between conditions are compared.
  • inclusion of a stabilizing element in the 3’-UTR increased expression efficiency of the recombined full-length YFP by about 50-60%. This enhancement is observed even though WPRE sequences stimulate nuclear export of the RNA molecule they are contained in, which may have negatively impacted the RNA joining reaction (and thus gene expression) by shuttling molecule 150 of FIG. 6A outside the nucleus before the spliceosome mediated RNA joining can occur and thus rendering it non-functional.
  • 160, 161, 162, 163, 164, 165, and 166) can be modified to further include a RNA sequence stabilizer.
  • Binding domain length was assessed as follows. YFP was split into two non-fluorescent halves (SEQ ID NOS: 1 and 2, but with different length binding domains). Reconstitution efficiency for different length binding domains (ranging from 50 to 500 nucleotides) was assessed in cultured HEK 293t cells. N-terminal YFP is expressed from a bidirectional CMV promoter with a Red Fluorescent Protein (RFP) as a transfection control. C-terminal YFP is expressed from a bidirectional CMV promoter with a Blue Fluorescent Protein (BFP) as a transfection control. For the different binding domain lengths, YFP median fluorescence intensity was compared. Cells with matching RFP and BFP transfection levels are compared between conditions.
  • RFP Red Fluorescent Protein
  • This example describes methods used to assess the effect of including one or more intronic splicing enhancer sequences (e.g., 118, 120, 156 in FIG. 6A) in the disclosed synthetic introns.
  • intronic splicing enhancer sequences e.g., 118, 120, 156 in FIG. 6A
  • YFP was split into two non-fluorescent halves (FIG. 12A). Reconstitution efficiency for different intron configurations was assessed in cultured HEK 293t cells. N-terminal YFP was expressed from a bidirectional CMV promoter with a Red Fluorescent Protein (RFP) as a transfection control. C- terminal YFP was expressed from a bidirectional CMV promoter with a Blue Fluorescent Protein (BFP) as a transfection control. For the different intron configurations, YFP median fluorescence intensity is compared. Cells with matching RFP and BFP transfection levels are compared between conditions.
  • RFP Red Fluorescent Protein
  • BFP Blue Fluorescent Protein
  • the 5’ molecule (SEQ ID NO: 1) includes the coding region of the N- terminal portion of YFP (n-yfp), followed by a splice donor sequence (SD), a downstream intronic splicing enhancer (DISE), and two intronic splicing enhancers (2xISE), a binding domain (BD), a self cleaving hammerhead ribozyme (HHrz), ending with a poly adenylation signal (pA).
  • SD splice donor sequence
  • DISE downstream intronic splicing enhancer
  • 2xISE two intronic splicing enhancers
  • BD binding domain
  • HHrz self cleaving hammerhead ribozyme
  • pA poly adenylation signal
  • the 3’ molecule includes the complementary binding domain (anti-BD), followed by three intronic splicing enhancer sequences (3xISE), a branch point (BP), a polypyrimidine tract (PPT), a splice acceptor sequence (SA), the c-terminal proton of the YFP coding sequence, ending with a poly adenylation signal (pA).
  • anti-BD complementary binding domain
  • 3xISE three intronic splicing enhancer sequences
  • BP branch point
  • PPT polypyrimidine tract
  • SA splice acceptor sequence
  • pA poly adenylation signal
  • splice enhancers As shown in FIG. 12B, inclusion of splice enhancers to both the 5’ and the 3’ molecules increases reconstitution efficiency of the full-length YFP. Removal of the splice enhancers reduces the reconstitution efficiency of the two coding sequences by about 50-90%.
  • YFP is reconstituted using the reference configuration (SEQ ID NOS: 1 and 2)
  • the second column shows the reconstitution efficiency with deletion of the ISE elements in the 5’ fragment
  • the third column shows reconstitution efficiency after deletion of the ISE and the DISE in the 5’ fragment.
  • the fourth column shows the reconstitution efficiency after deletion of the HHrz in the 5’ fragment.
  • the fifth column shows reconstitution efficiency using the reference configuration.
  • the sixth column shows reconstitution efficiency after deletion of the ISE elements in the 3’ fragment.
  • the seventh shows reconstitution efficiency after deletion of the ISE in both 5’ and 3’ fragment and the DISE in the 5’ fragment.
  • This example describes methods used to perform dual projection tracing by reconstitution of full-length flp recombinase (Flpo) from two fragments (SEQ ID NOS: 147 and 148).
  • Flpo full-length flp recombinase
  • FIG. 13 A the Flp recombinase gene was split into two non-functional halves.
  • the N-terminal half of the Flpo gene was joined at its 3’ end with a synthetic intron sequence followed by a dimerization domain sequence (RNA end joining module, REJ).
  • the C-terminal half of the Flpo gene was joined at its 5’ end with a synthetic intron and a dimerization domain (REJ-module).
  • FIG. 13B shows a schematic of a flp activity reporter mouse carrying a flpo dependent red fluorescent protein (tdTomato) (Rosa-CAG-frt- STOP-frt-tdTomato).
  • the two synthetic nucleic acid (DNA) constructs were packaged into separate adeno-associated viruses (retrogradely transported serotype AAV2/retro).
  • AAV2/retro-n-flpo virus carrying the first construct
  • AAV2/retro- c-flpo virus carrying the second construct
  • FIGS. 13C-13D primary motor cortex cells with axons that cross the midline are labeled with the red fluorescent protein (and appear white in FIGS. 13C and 13D). Hoechst staining (nuclei) is shown for context.
  • This example describes methods used to achieve efficient expression of oversized cargo in cell culture and in vivo in the mouse primary motor cortex.
  • a split YFP coding sequence was embedded inside a large uninterrupted open reading frame. N-terminally (i.e., on the 5’ side) the first part of the YFP coding sequence is flanked with long stuffer sequences (i.e., an uninterrupted open reading frame) followed by a sequence encoding a 2A self-cleaving peptide.
  • the second part of the YFP coding sequence is followed by a 2A self-cleaving peptide coding sequence and then followed by a long stuffer sequence (i.e., and uninterrupted open reading frame)
  • FIG. 14A The first and second synthetic DNA molecules encoding pre-mRNA molecules are shown in SEQ ID NOS: 22 and 23, excluding promoter sequences.
  • the resulting RNA molecules expressed are each about 4000nt between the transcriptional start site at position 1 of SEQ ID NO: 22 and the transcriptional start site at position 1 of SEQ ID NO: 23 and the polyA tail.
  • the resulting transcribed pre-mRNA molecule (5’ fragment; transcribed from SEQ ID NO: 22) contains a stuffer open reading frame which is followed by a self-cleaving 2A peptide encoding sequence, followed by a sequence encoding the N-terminal portion of YFP, followed by a synthetic intron and a dimerization domain (having kissing loop architecture), and a polyA tail.
  • the C-terminal pre-mRNA molecule (3’ fragment; transcribed from SEQ ID NO: 23) is composed of a complementary kissing loop dimerization domain, a synthetic intron sequence, followed by the C-terminal YFP coding sequence, followed by a self cleaving 2A peptide coding sequence, followed by a stuffer open reading frame, followed by a polyA tail.
  • the dimerization domains bind, and splicing joins the pre-mRNAs to produce a full-length mRNA.
  • the 2A cleavage sequences flanking the YFP result in the cleaving off of the N and C-terminal stuffer sequences and the production of functional YFP protein.
  • RNA level To determine reconstitution efficiency on an RNA level, two probe based (5 ’-hydrolysis) quantitative real-time PCR assays are used.
  • the first assay spans a sequence fully contained in the 3’ exonic YFP sequence (labelled 3’ probe).
  • the second assay spans the junction between the 5’ and the 3’ exonic YFP sequence (labelled junction probe). Reconstitution efficiency is calculated as the ratio of (junction probe count)/(3’ probe count).
  • Reconstituted YFP protein expression from full-length oversized YFP expression and split-REJ expression is assessed by flow cytometry of transiently transfected HEK 293t cells.
  • the split REJ system achieved about a 45% joining efficiency, even with the large cargo.
  • in vivo analysis of reconstitution of the large YFP protein was performed as follows. 60nl of adeno-associated virus 2/8, containing 3E9 vg/inj ection/fragment, was injected into the primary motor cortex of the mouse. Tissue was harvested 10 days post injection. As shown in FIG.
  • the disclosed system can be used to express large proteins in vivo.
  • This example describes methods used to achieve efficient reconstitution of full-length human coagulation factor VIII (FVIII).
  • FIG. 15A A schematic of the 5’ and 3’ nucleic acid molecules used for the experiment is shown in FIG. 15A (DNA encoding the pre-RNA molecules are set forth in SEQ ID NOS: 24 and 25, respectively). Each half includes about 3.8 kb of FVIII coding sequence.
  • the resulting RNA 5 ’-sequence containing the N-terminal half ( e.g ., as shown schematically in 110 of FIG. 6A) of the FVIII coding sequence is followed by an efficient synthetic intron and a dimerization domain (kissing loop architecture), and a poly A tail.
  • the 3 ’-sequence containing the C-terminal half e.g., 150 of FIG.
  • the FVIII coding sequence is preceded by the complementary kissing loop dimerization domain, and an efficient synthetic intron sequence.
  • two probe based (5 ’-hydrolysis) quantitative real-time PCR assays are used. The first assay spans a sequence fully contained in the 3’ exonic FVIII sequence (labelled 3’ probe). The second assay spans the junction between the 5’ and the 3’ exonic FVIII sequence (labelled junction probe). Reconstitution efficiency is calculated as the ratio of (junction probe count)/(3’ probe count). PCR quantification of reconstitution efficiency after two days of expression in HEK 293t cells was performed. Full-length FVIII is used as reference. Full-length FVIII ratio is set to one.
  • Reconstituted FVIII assay ratios are expressed as fraction of full-length (labelled split-REJ). As shown in FIG. 15B, a reconstitution efficiency of about 40-60% was achieved (that is about 40-60% of the two RNAs joined in the split-REJ system).
  • FVIII FVIII in vitro
  • Western blotting was used.
  • FVIII was tagged with an HA-tag at the N-terminus. Constructs are expressed in HEK 293t cells for 2 days.
  • FIG. 15C the disclosed split-REJ system successfully expressed full-length FVIII in vitro.
  • a full-length FVIII protein in vivo can be achieved, for example to treat hemophilia A.
  • a first half of a FVIII coding sequence is appended with a synthetic RNA dimerization and recombination domain and expressed from a first vector/plasmid.
  • the second half of FVIII is appended to the complementary RNA dimerization and recombination domain and expressed from a second vector/plasmid. If expressed together in the same cell the two halves of FVIII are recombined to form the full-length FVIII transcript which is then translated into protein.
  • a sequence having at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO: 24, which includes an N-terminal FVIII coding sequence, and SEQ ID NO: 25 which includes a C-terminal FVIII coding sequence, can be utilized for in vivo expression.
  • This example describes methods used to achieve efficient reconstitution of full-length human ATP binding cassette subfamily A member 4 (Abca4).
  • FIG. 16A A schematic of the 5’ and 3’ molecules used are shown in FIG. 16A (DNA encoding the pre- RNA molecules are set forth in SEQ ID NOS: 20 and 21, respectively).
  • the 5’ half includes about 3.6kb of Abca4 coding sequence, and the 3’ half about 3.2kb of the Abca4 coding region plus a C- terminal 3xFFAGtag.
  • the 5 ’-sequence contains the N-terminal half of the coding sequence followed by the an efficient synthetic intron sequence and the first dimerization domain (kissing loop).
  • the 3’- sequence containing the C-terminal half of the coding sequence is preceded by the complementary (kissing loop) dimerization domain and an efficient synthetic intron sequence.
  • a Sanger sequencing trace across the junction is shown.
  • PCR amplification of the junction demonstrates faithful joining of the two coding sequences.
  • two probe based (5’- hydrolysis) quantitative real-time PCR assays are used (FIG. 16C).
  • the first assay spans a sequence fully contained in the 3’ exonic Abca4 sequence (labelled 3’ probe).
  • the second assay spans the junction between the 5’ and the 3’ exonic Abca4 sequence (labelled junction probe).
  • Reconstitution efficiency is calculated as the ratio of (junction probe count)/(3’ probe count).
  • FIG. 16D Full- length Abca4 is used as reference.
  • Average full-length Abca4 ratio is set to one.
  • Reconstituted Abca4 assay ratios are expressed as fraction of full-length (labelled split-REJ).
  • split-REJ fraction of full-length
  • a reconstitution efficiency of about 35% was achieved (that is about 30-40% of the two RNAs joined in the split-REJ system).
  • Abca4 is tagged with a 3xFFAG-tag at the C-terminus. Constructs are expressed in HEK 293t cells for 2 days. As shown in FIG. 16E, the disclosed split-REJ system successfully expressed full-length Abca4 in vitro.
  • Fig. 16F Quantification of the western blot is shown in Fig. 16F.
  • the full-length plasmid and the C-terminal plasmid co express a Blue Fluorescent Protein for transfection control.
  • BFP concentration in each sample was determined by dot blot and used to normalize between conditions.
  • Abca4 is expressed at approximately 40% of the levels when compared with direct full-length expression.
  • the protein levels as determined by western blot track well with the RNA reconstitution efficiency determined by qPCR.
  • expression of a full-length ABCA4 protein in vivo can be achieved, for example to treat Stargardt’s Disease.
  • a first half of the ABCA4 coding sequence is appended with a synthetic RNA dimerization and recombination domain and expressed from a first vector/plasmid.
  • the second half of ABCA4 is appended to the complementary RNA dimerization and recombination domain and expressed from a second vector/plasmid. If expressed together in the same cell the two halves of ABCA4 are recombined to form the full-length ABCA4 transcript which is then translated into protein.
  • a sequence having at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO: 20 (FIGS. 10R-10U), which includes an N-terminal Abca4 coding sequence
  • SEQ ID NO: 21 which includes a C-terminal Abca4 coding sequence
  • This example describes methods used to achieve efficient reconstitution of full-length murine Otoferlin (Otof).
  • the sequences of the 5’ and 3’ DNA molecules used are shown in SEQ ID NOS: 155 and 156, respectively.
  • the 5’ half includes about 3.5kb of Otof coding sequence, the 3’ half about 2.5kb of the Otof coding region plus a C-terminal 3xFLAGtag.
  • the 3 ’-sequence containing the C-terminal half e.g ., 150 of FIG. 6A is preceded by the complementary binding domain and an efficient synthetic intron sequence.
  • a human OTOF coding sequence e.g., GenBank Accession No. NM_001287489.2 or NM_194248.3 can be substituted for the mouse coding sequence in SEQ ID NOS: 155 and 156.
  • Otof is tagged with a 3xFLAG-tag at the C-terminus for Western blot detection. Constructs are expressed in HEK 293t cells for 2 days. As shown in FIG. 18A, the disclosed split-REJ system successfully expressed full-length Otof in vitro.
  • FIGS. 18B-C Quantification of the western blot is shown in FIGS. 18B-C.
  • Raw quantification is shown in the left bar plot (FIG. 18B) as fraction of full-length control.
  • the full-length plasmid and the C-terminal plasmid co-express a Blue Fluorescent Protein for transfection control.
  • BFP concentration in each sample was determined by confocal fluorescence microscopy prior to harvesting the cells and used to normalize between conditions.
  • Normalized quantification is shown in the right bar plot (FIG 18C) as normalized fraction of the full-length control. As shown in FIG. 18C reconstituted Otof is expressed at approximately 30% of the levels when compared with direct full-length expression.
  • a full-length OTOF protein in vivo can be achieved, for example to treat autosomal recessive deafness 9.
  • a first half of the OTOF coding sequence is appended with a synthetic RNA dimerization and recombination domain (that is an intron and binding domain) and expressed from a first vector/plasmid.
  • the second half of OTOF is appended to the complementary RNA dimerization and recombination domain and expressed from a second vector/plasmid. If expressed together in the same cell the two RNA molecules are expressed in a target cell and the two halves of OTOF coding transcript are recombined to form the full-length OTOF transcript which is then translated into protein.
  • a sequence having at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO: 155, which includes an N-terminal Otof coding sequence, and SEQ ID NO: 156 which includes a C-terminal Otof coding sequence, can be utilized for in vivo expression, for example to treat hearing loss.
  • This example describes methods used to achieve efficient reconstitution of full-length human MYOSIN VIIA (Myo7a).
  • the sequences of the 5’ and 3’ DNA molecules used are shown in SEQ ID NOS: 157 and 158, respectively.
  • the 5’ half includes about 3.6kb of Myo7a coding sequence, the 3’ half about 3.1 kb of the Myo7a coding region plus a C-terminal 3xFLAGtag.
  • the 3 ’-sequence containing the C-terminal half e.g ., 150 of FIG. 6A is preceded by the complementary binding domain and an efficient synthetic intron sequence.
  • Myo7a is tagged with a 3xFLAG-tag at the C-terminus for Western blot detection. Constructs are expressed in HEK 293t cells for 2 days. As shown in FIG. 19A, the disclosed split-REJ system successfully expressed full-length Myo7a in vitro.
  • FIGS. 19B-19C Quantification of the western blot is shown in FIGS. 19B-19C.
  • Raw quantification is shown in the left bar plot (FIG. 19B) as fraction of full-length control.
  • the full-length plasmid and the C-terminal plasmid co-express a Blue Fluorescent Protein for transfection control.
  • BFP concentration in each sample was determined by confocal fluorescence microscopy prior to harvesting the cells and used to normalize between conditions.
  • Normalized quantification is shown in the right bar plot (FIG. 19C) as normalized fraction of the full-length control.
  • FIG. 19C reconstituted Myo7a is expressed at approximately 60% of the levels when compared with direct full-length expression.
  • a full-length MY07A protein in vivo can be achieved, for example to treat Usher syndrome, type IB.
  • a first half of the MY07A coding sequence is appended with a synthetic RNA dimerization and recombination domain (that is an intron and binding domain) and expressed from a first vector/plasmid.
  • the second half of MY07A is appended to the complementary RNA dimerization and recombination domain and expressed from a second vector/plasmid. If expressed together in the same cell the two RNA molecules are expressed in a target cell and the two halves of MY07A coding transcript are recombined to form the full-length MY07A transcript which is then translated into protein.
  • a sequence having at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO: 157, which includes an N-terminal Myo7a coding sequence, and SEQ ID NO: 158 which includes a C-terminal Myo7a coding sequence, can be utilized for in vivo expression.
  • This example describes methods used to achieve efficient reconstitution of full-length enzymatically dead Cas9 fused to a VPR transcriptional activator domain (dCas9-VPR).
  • the sequences of the 5’ and 3’ DNA molecules used are shown in SEQ ID NOS: 159 and 160, respectively.
  • the 5’ half includes about 3.3kb of DCas9-VPR coding sequence, the 3’ half about 2.5kb of the DCas9-VPR coding region.
  • the 3’-sequence containing the C-terminal half e.g., 150 of FIG.
  • FIGS. 20B-20C Quantification of the western blot is shown in FIGS. 20B-20C.
  • Raw quantification is shown in the left bar plot (FIG. 20B) as fraction of full-length control.
  • the full-length plasmid and the C-terminal plasmid co-express a Blue Fluorescent Protein for transfection control.
  • BFP concentration in each sample was determined by confocal fluorescence microscopy prior to harvesting the cells and used to normalize between conditions.
  • Normalized quantification is shown in the right bar plot (FIG. 20C) as normalized fraction of the full-length control.
  • FIG. 20C reconstituted DCas9-VPR is expressed at approximately 35% of the levels when compared with direct full-length expression.
  • both full-length and two-way split reconstituted dCas9-VPR When expressed together with a UAS targeting guide RNA in HEK 293t cells (FIG. 20D), both full-length and two-way split reconstituted dCas9-VPR induce yellow fluorescent protein expression from a UAS-YFP plasmid, demonstrating functionality of the reconstituted dCas9-VPR.
  • a full-length DCAS9-VPR protein in vivo can be achieved, for example to activate or overexpress genes.
  • a first half of the DCAS9-VPR coding sequence is appended with a synthetic RNA dimerization and recombination domain (that is an intron and binding domain) and expressed from a first vector/plasmid.
  • the second half of DCAS9-VPR is appended to the complementary RNA dimerization and recombination domain and expressed from a second vector/plasmid.
  • RNA molecules are expressed in a target cell and the two halves of DCAS9-VPR coding transcript are recombined to form the full- length DCAS9-VPR transcript which is then translated into protein.
  • a sequence having at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO: 159, which includes an N-terminal DCas9-VPR coding sequence, and SEQ ID NO: 160 which includes a C-terminal DCas9-VPR coding sequence can be utilized for in vivo expression.
  • This example describes methods used to achieve efficient reconstitution of full-length humanized Cas9 Prime Editor (Prime Editor).
  • the sequences of the 5’ and 3’ DNA molecules used are shown in SEQ ID NOS: 161 and 162, respectively.
  • the 5’ half includes about 3.3kb of Prime Editor coding sequence, the 3’ half about 3.0kb of the Prime Editor coding region.
  • the 3’-sequence containing the C-terminal half (e.g., 150 of FIG. 6A) is preceded by the complementary binding domain and an efficient synthetic intron sequence.
  • FIGS. 21B-21C Quantification of the western blot is shown in FIGS. 21B-21C.
  • Raw quantification is shown in the left bar plot (FIG. 21B) as fraction of full-length control.
  • the full-length plasmid and the C-terminal plasmid co-express a Blue Fluorescent Protein for transfection control.
  • BFP concentration in each sample was determined by confocal fluorescence microscopy prior to harvesting the cells and used to normalize between conditions.
  • Normalized quantification is shown in the right bar plot (FIG. 21C) as normalized fraction of the full-length control.
  • FIG. 21C reconstituted Prime Editor is expressed at approximately 60% of the levels when compared with direct full-length expression.
  • FIG. 2 ID shows that targeted G to T transversion mutations could be introduced using the full-length and the two-way split prime editors, demonstrating functionality of the two-way split prime editor constructs.
  • a full-length PRIME EDITOR protein in vivo can be achieved, for example to treat genomic point mutations.
  • a first half of the PRIME EDITOR coding sequence is appended with a synthetic RNA dimerization and recombination domain (that is an intron and binding domain) and expressed from a first vector/plasmid.
  • the second half of PRIME EDITOR is appended to the complementary RNA dimerization and recombination domain and expressed from a second vector/plasmid. If expressed together in the same cell the two RNA molecules are expressed in a target cell and the two halves of PRIME EDITOR coding transcript are recombined to form the full-length PRIME EDITOR transcript which is then translated into protein.
  • a sequence having at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO: 161, which includes an N-terminal Prime Editor coding sequence, and SEQ ID NO: 162 which includes a C-terminal Prime Editor coding sequence, can be utilized for in vivo expression.
  • This example describes methods used to achieve efficient reconstitution of full-length humanized Cas9 Cytosine Base Editor (AncBE4).
  • the sequences of the 5’ and 3’ DNA molecules used are shown in SEQ ID NOS: 163 and 164, respectively.
  • the 5’ half includes about 2.4kb of AncBE4 coding sequence, the 3’ half about 3.2kb of the AncBE4 coding region.
  • the 3’-sequence containing the C-terminal half (e.g., 150 of FIG. 6A) is preceded by the complementary binding domain and an efficient synthetic intron sequence.
  • FIG. 22B Quantification of the western blot is shown in FIG. 22B.
  • Raw quantification is shown in the left bar plot (FIG. 22B) as fraction of full-length control.
  • FIG. 22B reconstituted AncBE4 is expressed at approximately 40-50% of the levels when compared with direct full-length expression.
  • FIG. 22C shows that targeted C to T transition mutations could be introduced using the full-length and the two-way split AncBE4s, demonstrating functionality of the two-way split AncBE4 constructs.
  • a full-length ANCBE4 protein in vivo can be achieved, for example to treat genomic point mutations.
  • a first half of the ANCBE4 coding sequence is appended with a synthetic RNA dimerization and recombination domain (that is an intron and binding domain) and expressed from a first vector/plasmid.
  • the second half of ANCBE4 is appended to the complementary RNA dimerization and recombination domain and expressed from a second vector/plasmid. If expressed together in the same cell the two RNA molecules are expressed in a target cell and the two halves of ANCBE4 coding transcript are recombined to form the full-length ANCBE4 transcript which is then translated into protein.
  • a sequence having at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO: 163, which includes an N-terminal AncBE4 coding sequence, and SEQ ID NO: 164 which includes a C-terminal AncBE4 coding sequence, can be utilized for in vivo expression.
  • This example describes methods used to achieve efficient reconstitution of full-length humanized Cas9 Adenosine Base Editor (Abe8e).
  • the sequences of the 5’ and 3’ DNA molecules used are shown in SEQ ID NOS: 165 and 166, respectively.
  • the 5’ half includes about 2.4kb of Abe8e coding sequence, the 3’ half about 3.2kb of the Abe8e coding region.
  • the 3’-sequence containing the C-terminal half (e.g., 150 of FIG. 6A) is preceded by the complementary binding domain and an efficient synthetic intron sequence.
  • FIG. 23B Quantification of the western blot is shown in FIG. 23B.
  • Raw quantification is shown in the left bar plot (FIG. 23B) as fraction of full-length control.
  • FIG. 23B reconstituted Abe8e is expressed at approximately 70% of the levels when compared with direct full-length expression.
  • a full-length ABE8E protein in vivo can be achieved, for example to treat genomic point mutations.
  • a first half of the ABE8E coding sequence is appended with a synthetic RNA dimerization and recombination domain (that is an intron and binding domain) and expressed from a first vector/plasmid.
  • the second half of ABE8E is appended to the complementary RNA dimerization and recombination domain and expressed from a second vector/plasmid. If expressed together in the same cell the two RNA molecules are expressed in a target cell and the two halves of ABE8E coding transcript are recombined to form the full-length ABE8E transcript which is then translated into protein.
  • a sequence having at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO: 165, which includes an N-terminal Abe8e coding sequence, and SEQ ID NO: 166 which includes a C-terminal Abe8e coding sequence, can be utilized for in vivo expression.
  • the yellow fluorescent protein (yfp) coding sequence was split into two fragments. To extend the RNA encoding molecules, stuffer open reading frames were installed at the 5’ end of the 5’ fragment and the 3’ end of the 3’ fragment, respectively. The 5’ yfp coding sequence was fused to an extended stuffer open reading frame via a self-cleaving 2A sequence. The 3’ yfp coding sequence of yfp was linked via a self-cleaving 2A sequence to an extended stuffer open reading frame. At the split point of the 5’ fragment of yfp and the 3’ fragment of yfp an RNA end joining module (synthetic intron plus binding domain) was installed.
  • RNA end joining module synthetic intron plus binding domain
  • the self-cleaving 2A sequences allow for the YFP protein to separate from the respective stuffer open reading frames after translation.
  • four 5’ fragment encoding constructs and four 3’ fragment encoding constructs were assembled.
  • the length of the RNA (protein coding sequence plus synthetic intron and binding domain) transcribed from these constructs were: lOOOnt, 2000nt, 3000nt, and 4000nt for the 5’ fragment and lOOOnt, 2000nt, 3000nt, and 4000nt for the 3’ fragment.
  • This example describes methods used to achieve efficient joining of two RNA molecules by incorporation of specific splicing enhancer sequences.
  • FIG. 24B Quantification of the flow cytometry is shown in FIG. 24B.
  • Incorporation of intronic sequences to stimulate recruitment of the 5’ splice site selection promoting splicing factor TIA-1 (T-Cell- Restricted Intracellular Antigen- 1) can increase RNA end joining.
  • sequences containing W GGG motifs enhance RNA end j oining.
  • RNA end joining modules expression of a full-length split proteins in vivo can be enhanced by incorporating specific intronic splicing enhancer sequences into the intronic portion of the RNA end joining modules.
  • sequences such as 1, 2, or 3 sequences
  • one or more sequences having at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to any one of SEQ NOS: 173 to 180, 182-196, or 199 to 203, can be utilized for in vivo expression of RNA end joining reaction products (for example can be use as the ISE for any embodiment provided herein).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Wood Science & Technology (AREA)
  • Organic Chemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Virology (AREA)
  • Cell Biology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Peptides Or Proteins (AREA)
  • Saccharide Compounds (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
PCT/US2020/053643 2019-11-11 2020-09-30 Compositions and methods for high-efficiency recombination of rna molecules Ceased WO2021096605A1 (en)

Priority Applications (11)

Application Number Priority Date Filing Date Title
BR112022009006A BR112022009006A2 (pt) 2019-11-11 2020-09-30 Composições e métodos para recombinação de alta eficiência de moléculas de rna
IL292904A IL292904A (en) 2019-11-11 2020-09-30 Compositions and methods for high-efficiency recombination of rna molecules
KR1020227019191A KR20220113940A (ko) 2019-11-11 2020-09-30 Rna 분자의 고-효율 재조합을 위한 조성물 및 방법
AU2020384996A AU2020384996A1 (en) 2019-11-11 2020-09-30 Compositions and methods for high-efficiency recombination of RNA molecules
CN202080092659.8A CN114945666A (zh) 2019-11-11 2020-09-30 用于rna分子高效重组的组合物和方法
MX2022005670A MX2022005670A (es) 2019-11-11 2020-09-30 Composiciones y metodos para recombinacion de alta eficiencia de moleculas de arn.
EP20793875.4A EP4058571A1 (en) 2019-11-11 2020-09-30 Compositions and methods for high-efficiency recombination of rna molecules
CA3157799A CA3157799A1 (en) 2019-11-11 2020-09-30 Compositions and methods for high-efficiency recombination of rna molecules
JP2022526727A JP7759106B2 (ja) 2019-11-11 2020-09-30 Ｒｎａ分子の高効率の組換えのための組成物および方法
US17/741,311 US20220265855A1 (en) 2019-11-11 2022-05-10 Compositions and methods for high-efficiency recombination of rna molecules
JP2025079571A JP2025118824A (ja) 2019-11-11 2025-05-12 Ｒｎａ分子の高効率の組換えのための組成物および方法

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US201962933714P 2019-11-11 2019-11-11
US62/933,714 2019-11-11
USPCT/US2020/025430 2020-03-27
PCT/US2020/025430 WO2020205604A1 (en) 2019-03-29 2020-03-27 High-efficiency reconstitution of rna molecules

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2020/025430 Continuation-In-Part WO2020205604A1 (en) 2019-03-29 2020-03-27 High-efficiency reconstitution of rna molecules

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US17/741,311 Continuation US20220265855A1 (en) 2019-11-11 2022-05-10 Compositions and methods for high-efficiency recombination of rna molecules

Publications (1)

Publication Number Publication Date
WO2021096605A1 true WO2021096605A1 (en) 2021-05-20

Family

ID=75911442

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2020/053643 Ceased WO2021096605A1 (en) 2019-11-11 2020-09-30 Compositions and methods for high-efficiency recombination of rna molecules

Country Status (11)

Country Link
US (1) US20220265855A1 (https=)
EP (1) EP4058571A1 (https=)
JP (2) JP7759106B2 (https=)
KR (1) KR20220113940A (https=)
CN (1) CN114945666A (https=)
AU (1) AU2020384996A1 (https=)
BR (1) BR112022009006A2 (https=)
CA (1) CA3157799A1 (https=)
IL (1) IL292904A (https=)
MX (1) MX2022005670A (https=)
WO (1) WO2021096605A1 (https=)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2023250325A1 (en) * 2022-06-21 2023-12-28 The Regents Of The University Of California Compositions and methods for treating huntington's disease
WO2023250324A3 (en) * 2022-06-21 2024-10-10 The Regents Of The University Of California Compositions and methods for reducing rna levels
US12448636B2 (en) 2019-03-29 2025-10-21 Salk Institute For Biological Studies High-efficiency reconstitution of RNA molecules
EP4396350A4 (en) * 2021-09-03 2026-01-14 Tacit Therapeutics Inc RNA EDITING BY RECRUITMENT OF SPLICING COMPLEX COMPONENTS
EP4437117A4 (en) * 2021-12-10 2026-02-25 Aavantibio Inc COMPOSITIONS INCLUDING SELECTED KOZAK SEQUENCES TO PRODUCE ENHANCED EXPRESSION

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20220157944A (ko) 2020-02-21 2022-11-29 아카우오스, 인크. 인간 대상체에서 비-연령-연관 청각 장애를 치료하기 위한 조성물 및 방법

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6110743A (en) 1995-02-10 2000-08-29 The Regents Of The University Of California Development and use of human pancreatic cell lines
US20060134658A1 (en) * 2004-08-09 2006-06-22 Garcia-Blanco Mariano A Use of RNA trans-splicing for generation of interfering RNA molecules

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
ES2763526T3 (es) * 2014-07-03 2020-05-29 Hoffmann La Roche Sistemas de expresión de polipéptidos

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6110743A (en) 1995-02-10 2000-08-29 The Regents Of The University Of California Development and use of human pancreatic cell lines
US20060134658A1 (en) * 2004-08-09 2006-06-22 Garcia-Blanco Mariano A Use of RNA trans-splicing for generation of interfering RNA molecules

Non-Patent Citations (46)

* Cited by examiner, † Cited by third party
Title
"GenBank", Database accession no. NM_001287489.2
"Gene Therapeutics", 1994, BIRKHAUSER
AL-HERZ ET AL., FRONTIERS IN IMMUNOLOGY, vol. 5, 22 April 2014 (2014-04-22)
ALTSCHUL ET AL., J. MOL. BIOL., vol. 215, 1990, pages 403
ALTSCHUL ET AL., NATURE GENET, vol. 6, 1994, pages 119
BIROCCIO ET AL., . VIROL., vol. 76, 2002, pages 3688 - 96
BITTER ET AL., METHODS IN ENZYMOLOGY, vol. 153, 1987, pages 516 - 544
BRUNOKIEL, BIOSENSORS & BIOELECTRONICS, vol. 14, 1999, pages 457 - 464
BRUNOKIEL, BIOTECHNIQUES, vol. 32, 2002, pages 178 - 180,182-183
CHALOIN ET AL., NUCLEIC ACIDS RES., vol. 30, 2002, pages 4001 - 8
CIESIOLKA ET AL., RNA, vol. 1, 1995, pages 538 - 550
CORPET ET AL., NUCLEIC ACIDS RESEARCH, vol. 16, 1988, pages 10881
E. W. MARTIN: "Remington's Pharmaceutical Sciences", 1975, MACK PUBLISHING CO.
ELLINGTON ET AL., NATURE, vol. 346, 1990, pages 818 - 822
FAMULOK ET AL., ACC. CHEM. RES., vol. 33, 2000, pages 591 - 599
FAMULOK ET AL., CHEM. REV., vol. 107, 2007, pages 3715 - 3743
GREEN ET AL., BIOCHEMISTRY, vol. 35, 1996, pages 14413 - 14424
HESSELBERTH ET AL., REV. MOL. BIOTECH., vol. 74, 2000, pages 15 - 25
HIGGINSSHARP, CABIOS, vol. 5, 1989, pages 151
HIGGINSSHARP, GENE, vol. 73, 1988, pages 237
HOFMANN ET AL., RNA, vol. 3, 1997, pages 1289 - 1300
HUIZENGASZOSTAK, BIOCHEMISTRY, vol. 34, 1995, pages 656 - 665
KIGA ET AL., NUCLEIC ACIDS RES, vol. 26, 1998, pages 1755 - 60
LAUHONSZOSTAK, J. AM. CHEM. SOC., vol. 117, 1995, pages 1246 - 57
LEE ET AL., NUCLEIC ACIDS RES, vol. 32, 2004, pages D95 - D100
LIU ET AL., CHEM. REV., vol. 109, 2009, pages 1948 - 1998
LORAIN STEPHANIE ET AL.: "Exon exchange approach to repair Duchenne Dystrophin transcripts", PLOS ONE, PUBLIC LIBRARY OF SCIENCE, vol. 5, no. 5, 28 May 2010 (2010-05-28), pages E10894 - 1, XP002613584, ISSN: 1932-6203, DOI: 10.1371/JOURNAL.PONE.0010894 *
MANIMALA ET AL., RECENT DEV. NUCLEIC ACIDS RES., vol. 1, 2004, pages 207 - 231
MORRIS ET AL., PROC. NATL. ACAD. SCI. U.S.A., vol. 95, 1998, pages 2902 - 2907
NATHWANI ET AL., N ENGL J MED, vol. 365, no. 25, 2011, pages 2357 - 65
NAVANILI, URR. OPIN. CHEM. BIOL., vol. 10, 2006, pages 272 - 281
NEEDLEMANWUNSCH, J. MOL. BIOL., vol. 48, 1970, pages 443
PEARSONLIPMAN, PROC. NATL. ACAD. SCI. U.S.A., vol. 85, 1988, pages 2444
PERGOLIZZI R.G. ET AL.: "Genetic medicine at the RNA level: modifications of the genetic repertoire for therapeutic purposes by pre-mRNA trans-splicing", COMPTES RENDUS BIOLOGIES, ELSEVIER, PARIS, FR, vol. 327, no. 8, 1 August 2004 (2004-08-01), pages 695 - 709, XP004561828, ISSN: 1631-0691, DOI: 10.1016/J.CRVI.2004.05.008 *
S. GARY MANSFIELD ET AL.: "RNA repair using spliceosome-mediated RNA trans-splicing", TRENDS IN MOLECULAR MEDICINE, vol. 10, no. 6, 1 June 2004 (2004-06-01), GB, pages 263 - 268, XP055755915, ISSN: 1471-4914, DOI: 10.1016/j.molmed.2004.04.007 *
SAMBROOK ET AL.: "Molecular Cloning: A Laboratory Manual", 2001, COLD SPRING HARBOR LABORATORY PRESS
SHAMAH ET AL., ACC. CHEM. RES., vol. 41, 2008, pages 130 - 138
SMITHWATERMAN, ADV. APPL. MATH., vol. 2, 1981, pages 482
SONG ET AL., TRAC, TRENDS ANAL. CHEM., vol. 27, 2008, pages 108 - 117
TIJSSEN: "Laboratory Techniques in Biochemistry and Molecular Biology-Hybridization with Nucleic Acid Probes Part I", 1993, ELSEVIER
TUERKGOLD, SCIENCE, vol. 249, 1990, pages 505 - 510
WALLACESCHROEDER, RNA, vol. 4, 1998, pages 112 - 123
WALLIS ET AL., CHEM. BIOL., vol. 4, 1997, pages 357 - 366
WALSH C.E.: "New paradigms for gene transfer: RNA trans-splicing and small interfering RNA as therapeutic strategy", SEMINARS IN HEMATOLOGY, W.B. SAUNDERS CO, US, vol. 41, no. 4, 1 October 2004 (2004-10-01), pages 297 - 302, XP009070446, ISSN: 0037-1963 *
WILSON ET AL., ANNU. REV. BIOCHEM., vol. 68, 1999, pages 611 - 647
YANPING YANG ET AL.: "Spliceosome-mediated RNA trans-splicing", MOLECULAR THERAPY, vol. 12, no. 6, 1 December 2005 (2005-12-01), US, pages 1006 - 1012, XP055755905, ISSN: 1525-0016, DOI: 10.1016/j.ymthe.2005.09.006 *

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US12448636B2 (en) 2019-03-29 2025-10-21 Salk Institute For Biological Studies High-efficiency reconstitution of RNA molecules
EP4396350A4 (en) * 2021-09-03 2026-01-14 Tacit Therapeutics Inc RNA EDITING BY RECRUITMENT OF SPLICING COMPLEX COMPONENTS
EP4437117A4 (en) * 2021-12-10 2026-02-25 Aavantibio Inc COMPOSITIONS INCLUDING SELECTED KOZAK SEQUENCES TO PRODUCE ENHANCED EXPRESSION
WO2023250325A1 (en) * 2022-06-21 2023-12-28 The Regents Of The University Of California Compositions and methods for treating huntington's disease
WO2023250324A3 (en) * 2022-06-21 2024-10-10 The Regents Of The University Of California Compositions and methods for reducing rna levels

Also Published As

Publication number Publication date
JP2025118824A (ja) 2025-08-13
JP2023500957A (ja) 2023-01-11
CN114945666A (zh) 2022-08-26
MX2022005670A (es) 2022-07-19
US20220265855A1 (en) 2022-08-25
IL292904A (en) 2022-07-01
EP4058571A1 (en) 2022-09-21
KR20220113940A (ko) 2022-08-17
JP7759106B2 (ja) 2025-10-23
AU2020384996A1 (en) 2022-06-23
BR112022009006A2 (pt) 2022-10-11
CA3157799A1 (en) 2021-05-20

Similar Documents

Publication Publication Date Title
US20260015642A1 (en) High-efficiency reconstitution of rna molecules
US20220265855A1 (en) Compositions and methods for high-efficiency recombination of rna molecules
AU2017407272B2 (en) Method for inducing exon skipping by genome editing
KR102808368B1 (ko) 선택적 유전자 조절을 위한 조성물 및 방법
JP7416451B2 (ja) ＣＲＩＳＰＲ－Ｃａｓによる標的化された核内ＲＮＡ切断及びポリアデニル化
JP2024115555A (ja) 標的化された核酸編集のためのシステム、方法、及び組成物
KR20240095525A (ko) 조작된 casx 억제 시스템
JP2022000041A (ja) 標的化核酸編集のための系、方法、及び組成物
TW202027799A (zh) 用於表現因子ix的組成物及方法
KR20210053898A (ko) 신규 crispr 효소 및 시스템
KR20200006054A (ko) 신규 타입 vi crispr 오르소로그 및 시스템
IL286865B2 (en) Methods and compositions for insertion of antibody coding sequences into a safe harbor locus
US20240309368A1 (en) Targeted rna editing by leveraging endogenous adar using engineered rnas
US20240100185A1 (en) Compositions and methods for the targeting of ptbp1
WO2022232442A2 (en) Multiplex crispr/cas9-mediated target gene activation system
JP2024518413A (ja) 修飾ヌクレアーゼ
US20230081547A1 (en) Non-human animals comprising a humanized klkb1 locus and methods of use
US20240216544A1 (en) Methods and compositions for expression of editing proteins
WO2023279106A1 (en) Compositions and methods for myosin heavy chain base editing
KR20260046119A (ko) 단방향 유전자 삽입 동안 도입유전자 발현을 증진시키는 bGH-SV40L 직렬 PolyA의 용도
WO2023212677A2 (en) Identification of tissue-specific extragenic safe harbors for gene therapy approaches

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20793875

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 3157799

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2022526727

Country of ref document: JP

Kind code of ref document: A

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112022009006

Country of ref document: BR

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2020793875

Country of ref document: EP

Effective date: 20220613

ENP Entry into the national phase

Ref document number: 2020384996

Country of ref document: AU

Date of ref document: 20200930

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 112022009006

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20220509