WO2021069417A1 - Human monocyte cell line and use of same as a cell model of phagocytosis - Google Patents

Human monocyte cell line and use of same as a cell model of phagocytosis Download PDF

Info

Publication number
WO2021069417A1
WO2021069417A1 PCT/EP2020/077961 EP2020077961W WO2021069417A1 WO 2021069417 A1 WO2021069417 A1 WO 2021069417A1 EP 2020077961 W EP2020077961 W EP 2020077961W WO 2021069417 A1 WO2021069417 A1 WO 2021069417A1
Authority
WO
WIPO (PCT)
Prior art keywords
cell line
human
monocyte cell
receptors
nucleic acid
Prior art date
Application number
PCT/EP2020/077961
Other languages
French (fr)
Inventor
Anaïs RAIA
Jean-Luc METERREAU
Original Assignee
Laboratoire Francais Du Fractionnement Et Des Biotechnologies
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Laboratoire Francais Du Fractionnement Et Des Biotechnologies filed Critical Laboratoire Francais Du Fractionnement Et Des Biotechnologies
Publication of WO2021069417A1 publication Critical patent/WO2021069417A1/en

Links

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5044—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics involving specific cell types
    • G01N33/5047—Cells of the immune system
    • G01N33/5055—Cells of the immune system involving macrophages
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0634—Cells from the blood or the immune system
    • C12N5/0645—Macrophages, e.g. Kuepfer cells in the liver; Monocytes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/50—Cell markers; Cell surface determinants
    • C12N2501/599—Cell markers; Cell surface determinants with CD designations not provided for elsewhere
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2502/00—Coculture with; Conditioned medium produced by
    • C12N2502/99—Coculture with; Conditioned medium produced by genetically modified cells

Definitions

  • the present invention relates to a novel human monocyte cell line, and its use as a cell model of phagocytosis.
  • Phagocytosis is the cellular process by which certain cells grouped under the general name of phagocytes can ingest solid foreign particles of micrometric scale. Phagocytosis is usually considered to be a particular form of endocytosis.
  • the phagocytosis target particle has a size greater than 0.5 ⁇ m.
  • phagocytosis has been observed experimentally in several cell types, it is generally strongly associated with certain categories of leukocytes, such as macrophages, dendritic cells or neutrophils. Its action is essential in the immune response. Whether innate or adaptive, phagocytosis is involved in the elimination of pathogens. Indeed, it constitutes the first line of defense against an infection. However, it also plays an important role in maintaining tissue homeostasis as well as tissue remodeling and repair.
  • the spleen is a soft organ of the lymphatic system. It plays a key role in immunity and the cell renewal process in the blood.
  • the spleen is made up of two main types of tissue, each with a different function: white pulp and red pulp.
  • the white pulp is a component of the infection defense system (immune system). It contains white blood cells called lymphocytes, which in turn produce antibodies (specialized proteins that fight against invasion by a foreign substance).
  • the red pulp filters the blood and removes unwanted elements. It contains other white blood cells, macrophages, which ingest microorganisms, such as bacteria, fungi and viruses. In addition, it also controls blood cells red, destroying those that are abnormal, too old or those that no longer function properly. Finally, it serves as a reservoir for various blood elements: primarily white blood cells and platelets (pseudo-cellular particles involved in coagulation). The removal of these elements, however, is only a minor function of the red pulp.
  • Macrophages residing in the red pulp of the spleen also play a major role in the clearance of blood cells opsonized by immunoglobulin G (IgG), such as in immunologic thrombocytopenic purpura (ITP) or in autoimmune hemolytic anemia (AHAI).
  • IgG immunoglobulin G
  • INP immunologic thrombocytopenic purpura
  • AHAI autoimmune hemolytic anemia
  • Blood cells are phagocytosed via Fc gamma receptors (FcyRs).
  • splenic macrophages are distinct in humans from splenic monocytes and circulating monocyte-derived macrophages in terms of expression of FcyRs and other surface markers. Indeed, the human macrophages of the red pulp predominantly express the low affinity receptors CD32a (or FcRylla) and CD16a (or FcyRIIIa). They do not express CD32b (or FcyRIIb) and very weakly express the high affinity CD64 receptor (FcyRI).
  • the phagocytosis process as defined today is characterized by three main stages;
  • Phagocytosis is also involved in numerous pathologies, and in particular in immune thrombocytopenia associated with purpura (ITP) and in autoimmune hemolytic anemia (AHAI); two autoimmune diseases for which the efficacy of immunoglobulin G concentrates as an immunotherapy treatment has been demonstrated in clinical trials. Phagocytosis may also represent the mechanism of action of certain drugs, such as anti-D and immunoglobulins G, in the case of immune deficiencies (replacement of antibacterial or antiviral antibodies).
  • the present invention relates to a human monocyte cell line which stably and functionally expresses the human CD16a, CD32 and CD64 Fc gamma receptors (FcyR) on their surface.
  • FcyR Fc gamma receptors
  • cell line is intended to mean a set of cells originating from the same mother cell and having the same genetic characteristics as this mother cell.
  • a cell line is further characterized by its ability to multiply in a culture medium stably in vitro over a large number of generations.
  • the term “stably expressing” means that the human monocyte cell line according to the invention is capable of expressing the human Fc gamma (FcyR) CD16a, CD32 and CD64 receptors on their surface after a large number of passages in cell culture, in particular after at least 20 passages, advantageously at least 25 passages, advantageously at least 30 passages.
  • the term “stably expressing” also means that the human monocyte cell line according to the invention is capable of expressing human Fc gamma (FcyR) CD16a, CD32 and CD64 receptors on their surface. without noticeable change in expression level over time.
  • the term “functionally expressing” is meant, within the meaning of the present invention, the capacity of the human Fc gamma receptors (FcyR) thus expressed as being capable of binding the Fc region, constant portion, of the immunoglobulins, in order to induce the phagocytosis.
  • the term “functionally expressing” also means that the human monocyte cell line according to the invention is capable of expressing sufficient human CD16a, CD32 and CD64 Fc gamma (FcR) receptors, in order to to obtain phagocytosis activity mediated by one or more combination of Fc gamma receptors (FcyR) CD16a, CD32 and CD64, during functional tests by blocking other receptors.
  • the human monocyte cell line according to the invention stably and functionally expresses the human CD16a, CD32 and CD64 Fc gamma receptors (FcyR).
  • the human monocyte cell line according to the invention is chosen from the group comprising a line derived from a histiocytic lymphoma, a line derived from the peripheral blood of a patient suffering from acute monocytic leukemia, a line derived from a pleural effusion from a patient with chronic myeloid leukemia in blast crisis, a line derived from the peripheral blood of a patient with acute myeloid leukemia, a line derived from the peripheral blood of a patient with a patient with acute lymphoblastic leukemia and a line derived from the peripheral blood of a patient with acute myelo-monocytic leukemia.
  • the human monocyte cell line is derived from the peripheral blood of a patient with acute myelo-monocytic leukemia.
  • the human monocyte cell line is derived from the peripheral blood of a one-year-old male patient suffering from acute myelo-monocytic leukemia.
  • the human monocyte cell line is derived from the THP1 cell line.
  • the human monocyte cell line is derived from the THP1 cell line, deposited with the ECACC under the number 88081201.
  • the human monocyte cell line is derived from histiocytic lymphoma.
  • the human monocyte cell line is derived from a histiocytic lymphoma of a 37-year-old male patient.
  • the human monocyte cell line is derived from the U-937 cell line.
  • the human monocyte cell line can be derived from the U-937 cell line, deposited with the ATCC under the number CLR-1593.2 TM.
  • the human monocyte cell line is derived from the peripheral blood of a patient with acute monocytic leukemia.
  • the human monocyte cell line is derived from the peripheral blood of a 64-year-old male patient suffering from acute monocytic leukemia.
  • the human monocyte cell line is derived from the Mono-Mac-6 cell line.
  • the human monocyte cell line is derived from the Mono-Mac-6 cell line, deposited with the DSMZ under the number ACC124.
  • the human monocyte cell line is derived from a pleural effusion from a patient with chronic myeloid leukemia in blast crisis.
  • the human monocyte cell line is derived from a pleural effusion from a 53-year-old female patient with chronic myeloid leukemia in blast crisis.
  • the human monocyte cell line is derived from the K-562 cell line.
  • the human monocyte cell line is derived from the K-562 cell line, deposited with the ATCC under the number CLR-243 TM.
  • the human monocyte cell line is derived from the K-562 cell line, deposited with the DSMZ under the number ACC10.
  • the human monocyte cell line is derived from the peripheral blood of a patient with acute myeloid leukemia.
  • the human monocyte cell line is derived from the peripheral blood of a 35-year-old female patient suffering from acute myeloid leukemia.
  • the human monocyte cell line is derived from the HL-60 cell line.
  • the human monocyte cell line is derived from the HL-60 cell line, deposited with the DSMZ under the number ACC3.
  • the human monocyte cell line is derived from the peripheral blood of a patient with acute lymphoblastic leukemia.
  • the human monocyte cell line is derived from the peripheral blood of a 19-year-old male patient with acute lymphoblastic leukemia.
  • the human monocyte cell line is derived from the Molt-4 cell line.
  • the human monocyte cell line is derived from the Molt-4 cell line, deposited with the DSMZ under the number ACC362.
  • the human monocyte cell line is derived from the peripheral blood of a patient with acute lymphoblastic leukemia.
  • the human monocyte cell line is derived from the peripheral blood of a 14-year-old male patient suffering from acute lymphoblastic leukemia.
  • the human monocyte cell line is derived from the Jurkat cell line.
  • the The human monocyte cell line is derived from the Jurkat cell line, deposited with the DSMZ under the number ACC282.
  • the human monocyte cell line is derived from a line of cells chosen from U-937 cells, Mono-Mac-6 cells, K-562 cells, HL-60, Jurkat cells and THP1 cells.
  • the human monocyte cell line is derived from the THP1 cell line.
  • the expression of CD32 and CD64 receptors is endogenous to the line before transfection.
  • the human monocyte cell line is derived from the U-937 cell line.
  • the expression of CD32 and CD64 receptors is endogenous to the line before transfection.
  • the human monocyte cell line is derived from the Mono-Mac-6 cell line.
  • the expression of CD32 and CD64 receptors is endogenous to the line prior to transfection.
  • the human monocyte cell line is derived from the K-562 cell line.
  • the expression of CD32 and CD64 receptors is endogenous to the line before transfection.
  • the human monocyte cell line is derived from the HL-60 cell line.
  • the expression of CD32 and CD64 receptors is endogenous to the line before transfection.
  • the human monocyte cell line is derived from the Jurkat cell line.
  • the expression of the CD32 and CD64 receptors is endogenous to the line before transfection.
  • the human monocyte cell line according to the invention is capable of stably and functionally expressing the human CD16a, CD32 and CD64 gamma Fc (FcR) receptors after at least 30 passages of cell culture.
  • the human monocyte cell line according to the invention stably and functionally expresses at least 50,000 CD16a receptors, advantageously at least 60,000 CD16a receptors, advantageously at least 70,000 CD16a receptors, advantageously at least 80,000 CD16a receptors, advantageously at least 90,000 CD16a receptors, advantageously at least 95,000 CD16a receptors, advantageously at least 96,000 CD16a receptors, advantageously at least 97,000 CD16a receptors, advantageously at least 98,000 CD16a receptors, advantageously at least 99,000 CD16a receptors, advantageously at least 100,000 CD16a receptors, advantageously at least 105,000 CD16a receptors after at least 30 passages of cell culture.
  • the human monocyte cell line according to the invention stably and functionally expresses at least 5,000 CD32 receptors, advantageously at least 6,000 CD32 receptors, advantageously at least 7,000 CD32 receptors, advantageously at least 8,000 CD32 receptors, advantageously at least 8,000 CD32 receptors. less 9,000 CD32 receptors, advantageously at least 10,000 CD32 receptors, advantageously at least 11,000 CD32 receptors, advantageously at least 12,000 CD32 receptors, advantageously at least 13,000 CD32 receptors, advantageously at least 14,000 CD32 receptors, advantageously at least 14 000 CD32 receptors, advantageously at least 16,000 CD32 receptors, advantageously at least 17,000 CD32 receptors after at least 30 passages of cell culture.
  • the human monocyte cell line according to the invention stably and functionally expresses at least 20,000 CD64 receptors, advantageously at least 21,000 CD64 receptors, advantageously at least 22,000 CD64 receptors, advantageously at least 23,000 CD64 receptors, advantageously at least 24,000 CD64 receptors, advantageously at least 25,000 CD64 receptors, advantageously at least 26,000 CD64 receptors, advantageously at least 27,000 CD64 receptors, advantageously at least 28,000 CD64 receptors, advantageously at least 29,000 CD64 receptors, advantageously at least 30,000 CD64 receivers, preferably at least 31,000 CD64 receptors, preferably at least 32,000 CD64 receptors after at least 30 passages of cell culture.
  • the human monocyte cell line according to the invention is capable of expressing in a stable and functional manner between 50,000 and 105,000 CD16a receptors, between 5,000 and 17,000 CD32 receptors and between 20,000 and 32,000. CD64 receptors on its surface after at least 30 passages of cell culture.
  • the human monocyte cell line according to the invention is capable of expressing in a stable and functional manner between 60,000 and 105,000 CD16a receptors between 6,000 and 17,000 CD32 receptors and between 21,000 and 32,000 CD64 receptors on its surface. after at least 30 passages of cell culture.
  • the human monocyte cell line according to the invention is capable of expressing in a stable and functional manner between 70,000 and 105,000 CD16a receptors, between 7,000 and 17,000 CD32 receptors and between 22,000 and 32,000 CD64 receptors at its. surface after at least 30 passages of cell culture.
  • the human monocyte cell line according to the invention is capable of expressing in a stable and functional manner between 80,000 and 105,000 CD16a receptors, between 8,000 and 17,000 CD32 receptors and between 22,000 and 32,000 CD64 receptors on its surface. after at least 30 passages of cell culture.
  • the human monocyte cell line according to the invention is capable of expressing in a stable and functional manner between 90,000 and 105,000 CD16a receptors, between 9,000 and 17,000 CD32 receptors and between 23,000 and 32,000 CD64 receptors on its surface. after at least 30 passages of cell culture.
  • the human monocyte cell line according to the invention is capable of expressing in a stable and functional manner between 95,000 and 105,000 CD16a receptors, between 10,000 and 17,000 CD32 receptors and between 24,000 and 32,000 CD64 receptors on its surface afterwards. at least 30 passages of cell culture.
  • the human monocyte cell line according to the invention is capable of stably and functionally expressing between 96,000 and 105,000 CD16a receptors, between 11,000 and 17,000 CD32 receptors and between 25,000 and 32,000 CD64 receptors at its. surface after at least 30 passages of cell culture.
  • the human monocyte cell line according to the invention is capable of stably and functionally expressing between 97,000 and 105,000 CD16a receptors, between 12,000 and 17,000 CD32 receptors and between 26,000 and 32,000 CD64 receptors on its surface. after at least 30 passages of cell culture.
  • the human monocyte cell line according to the invention is capable of expressing in a stable and functional manner between 98,000 and 105,000 CD16a receptors, between 13,000 and 17,000 CD32 receptors and between 27,000 and 32,000 CD64 receptors on its surface. after at least 30 passages of cell culture.
  • the human monocyte cell line according to the invention is capable of stably and functionally expressing between 99,000 and 105,000 CD16a receptors, between 14,000 and 17,000 CD32 receptors and between 27,000 and 32,000 CD64 receptors at its. surface after at least 30 passages of cell culture.
  • the human monocyte cell line according to the invention is capable of expressing in a stable and functional manner between 100,000 and 105,000 CD16a receptors, between 15,000 and 17,000 CD32 receptors and between 30,000 and 32,000 CD64 receptors at its. surface after at least 30 passages of cell culture.
  • the human monocyte cell line according to the invention stably and functionally expresses 102,000 CD16a receptors, 16,000 CD32 receptors and 31,000 CD64 receptors on its surface after at least 30 passages of cell culture.
  • the human monocyte cell line according to the invention was obtained by retroviral transduction with a lentiviral vector comprising at least one nucleic acid of sequence SEQ ID No.1 or a variant of nucleic acid of sequence SEQ ID No.1.
  • transfection or “transduction” is meant, within the meaning of the present invention, a process by which cells incorporate an exogenous nucleic acid and integrate this nucleic acid into their genome.
  • transfection is a stable transfection, allowing exogenous nucleic acid to be present continuously in the transfected cell.
  • the exogenous nucleic acid is transmitted to the progeny and the level of expression of the exogenous nucleic acid is constant over time.
  • the level of expression of the exogenous nucleic acid is stable after a large number of passages in cell culture, in particular after at least 20 passages, advantageously at least 25 passages, advantageously at least 30 passages.
  • a transfection is said to be transient, if the exogenous nucleic acid is present only transiently in the cell. In this case, the level of expression of the exogenous nucleic acid gradually decreases over time.
  • nucleic acid is meant, within the meaning of the present invention, an oligomer or a polymer, single or double stranded, of nucleotide bases read from the 5 'end to the 3' end.
  • nucleic acid can refer to a DNA or RNA molecule or to an RNA / DNA hybrid molecule, of natural or synthetic origin. In the nucleotide notation used in the present application, unless specifically mentioned, the left end of a single-stranded nucleotide sequence is the 5 'end.
  • the nucleic acid of SEQ ID No.1 codes for a protein corresponding to the extracellular domain of the human CD16 Fc gamma receptor (FCYRIII), in particular for a protein corresponding to the extracellular domain of the Fc gamma CD16a receptor (FCYRIII) human.
  • variant of the nucleic acid of sequence SEQ ID No.1 is meant, within the meaning of the present invention, a nucleic acid which differs by one or more bases relative to the nucleic acid of SEQ ID No.1 .
  • a variant nucleic acid may be of natural origin, such as an allelic variant found naturally, or may also be an unnatural variant obtained, for example, by mutagenesis techniques. In general, the differences between the reference nucleic acid and the variant nucleic acid are reduced such that the nucleotide sequences of the reference nucleic acid and the variant nucleic acid are very close and, in many regions , identical.
  • the modifications of nucleotides present in a variant nucleic acid can be silent, which means that they do not alter the amino acid sequences encoded by said variant nucleic acid.
  • variant nucleic acids of the nucleic acid of sequence SEQ ID No. 1 encode proteins which retain substantially the same function or biological activity as the proteins encoded by the reference nucleic acid or else the protein. ability to be recognized by antibodies directed against proteins encoded by the initial nucleic acid.
  • the variant nucleic acids of the nucleic acid of sequence SEQ ID No.1 according to the invention retain the same binding capacity of the human CD16 (FCYRIII) receptor, or exhibit an increased binding capacity of the human CD16 (FCYRIII) receptor. or diminished.
  • the variant nucleic acids of the nucleic acid of sequence SEQ ID No. 1 according to the invention retain the same binding capacity of the human CD16a (FCYRIII) receptor, or exhibit an increased binding capacity of the human CD16a (FCYRIII) receptor. or diminished.
  • nucleic acid of SEQ ID No.1 By way of example of a variant of the nucleic acid of SEQ ID No.1 according to the invention, mention may in particular be made of the nucleic acid of SEQ ID No.2.
  • Nucleic acid of SEQ ID No.2 atg cg g actg aag atctcccaaag g ctg tg g tg ttcctg g ag cctcaatg g tacag gg tg ctcg ag aag g acag tg tg actct g aag tg ccag gg ag cctactcccctg ag g acatg gccacttag ag cctcatctcaag ccag g g cctc g ag ctacttcattg acg ctg ccacag tcg acg ctacttcattg acg ctg ccacag tcg acg acag tg g ag ag tacag g tg
  • a variant of the nucleic acid of sequence SEQ ID No.1 is the nucleic acid of SEQ ID No.2.
  • nucleic acid of SEQ ID No.2 encodes a protein corresponding to the extracellular domain of the human CD16a (FCYRIII) receptor, in which the amino acid at position 158 has been replaced by valine.
  • vector is meant, within the meaning of the present invention, a nucleic acid-based transit vehicle, a nucleic acid molecule suitable for delivering nucleic acid or a DNA molecule capable of autonomous replication.
  • the monocyte for example a plasmid, a cosmid, a phagemid, a viral genome (chromosome), a phage genome (chromosome), and which allows the cloning of DNA molecules.
  • the vector used is a lentiviral vector.
  • the nucleic acid sequence used is placed under the control of signals allowing its expression in the human monocyte cell line.
  • the vector must contain a promoter, initiation and termination signals of the translation, as well as appropriate transcriptional regulatory regions. It must be able to be maintained in a stable manner in the monocyte and may possibly have particular signals specifying the secretion of the translated proteins.
  • the nucleic acid sequence can be inserted into autonomously replicating vectors within the human monocyte cell line, or integrative vectors of the human monocyte cell line.
  • Such vectors will be prepared according to the methods commonly used by a person skilled in the art, and the resulting clones can be introduced into the human monocyte cell line by standard methods such as, for example, transfection by calcium phosphate precipitation, lipofection. , electroporation, thermal shock.
  • Transduction into the human monocyte cell line of the vector can be accomplished in an equimolar amount by standard procedures such as calcium phosphate precipitation or lipofectin. Then, the transfected lines are selected in the appropriate culture media.
  • the lentiviral vector further comprises a nucleic acid of sequence SEQ ID No. 3.
  • nucleic acid of SEQ ID No.3 codes for a protein corresponding to the transmembrane and intracellular domains of the gamma chain of human FcsRI receptors.
  • the human monocyte cell line expressing in a stable and functional manner the human CD16a, CD32 and CD64 Fc gamma receptors (FcyR) at their surface according to the invention is obtained by retroviral transduction with a lentiviral vector comprising at least least a nucleic acid of sequence SEQ ID No.1 or a nucleic acid of sequence SEQ ID No.2 and a nucleic acid of sequence SEQ ID No.3.
  • the human monocyte cell line according to the invention was obtained by retroviral transduction with a lentiviral vector comprising at least one nucleic acid encoding a protein corresponding to the extracellular domain of the CD16a receptor and at least a nucleic acid encoding a protein corresponding to the transmembrane and intracellular domains of the gamma chain of human FcsRI receptors.
  • the inventors have surprisingly shown that the co-transfection of at least one nucleic acid encoding a protein corresponding to the extracellular domain of the CD16a receptor and at least one nucleic acid encoding a protein corresponding to the transmembrane and intracellular domains of the gamma chain human FcsRI receptors, makes it possible to obtain stable and functional expression of the CD16a receptor.
  • the inventors have shown that the transmembrane and intracellular domains of the gamma chain of human FcsRI receptors allow the anchoring in the monocyte membrane of the chimeric protein comprising the extracellular domain of the human CD16a receptor (FcyRIN) and the transmembrane domains and intracellular of the gamma chain of human FcsRI receptors, thus allowing the expression on the surface of the monocyte of the CD16a receptor and the transduction of phagocytosis signals.
  • FcyRIN human CD16a receptor
  • the lentiviral vector comprises a nucleic acid of sequence SED IQ No.4 consisting of the nucleic acid of sequence SEQ ID No.2 and of the nucleic acid of sequence SEQ ID No. 3.
  • the lentiviral vector comprises a nucleic acid of sequence SED IQ No.5 consisting of the nucleic acid of sequence SEQ ID No.1 and of the nucleic acid of sequence SEQ ID No. 3.
  • the human monocyte cell line according to the invention was obtained by retroviral transduction with a lentiviral vector comprising:
  • nucleic acid of sequence SED IQ No.4 consisting of nucleic acid of sequence SEQ ID No.2 and nucleic acid of sequence SEQ ID No. 3, or
  • nucleic acid of sequence SED IQ No.5 consisting of the nucleic acid of sequence SEQ ID No.1 and of the nucleic acid of sequence SEQ ID No. 3.
  • nucleic acids of sequences SEQ ID No.4 and SEQ ID No.5 code respectively for a chimeric protein comprising the extracellular domain of the human CD16a (FcyRI 11) receptor and the transmembrane and intracellular domains of the chain. gamma of human FcsRI receptors.
  • nucleic acid of sequence SEQ ID No.4 codes for a chimeric protein comprising the extracellular domain of the human CD16a (FcyRI 11) receptor in which the amino acid at position 158 has been replaced by valine and the transmembrane domains and intracellular gamma chain of human FcsRI receptors.
  • nucleic acid of sequence SEQ ID No.5 codes for a chimeric protein comprising the extracellular domain of the human CD16a (FcyRI 11) receptor in which the amino acid at position 158 is phenylalanine and the transmembrane and intracellular domains of the human.
  • human FcsRI receptor gamma chain codes for a chimeric protein comprising the extracellular domain of the human CD16a (FcyRI 11) receptor in which the amino acid at position 158 is phenylalanine and the transmembrane and intracellular domains of the human.
  • human FcsRI receptor gamma chain the extracellular domain of the human CD16a (FcyRI 11) receptor in which the amino acid at position 158 is phenylalanine and the transmembrane and intracellular domains of the human.
  • the human monocyte cell line according to the invention was obtained by retroviral transduction with a lentiviral vector comprising a nucleic acid of sequence SEQ ID No.6.
  • Nucleic acid of sequence SEQ ID No.6 atg tg g cag ctg ctg ctgccg accg cg ctg ctg ctgctg g tg ag cgcg gg catg cg caccg aag atctg ccg aaagcg g tg g tg tttctg g aaccg cag tg tg tg ctg c atag cg tg accctg aaatg ccag gg cg cg tatag cccg g aa g ataacag cacccag tg g ttttt
  • nucleic acid of SEQ ID No. 6 encodes a protein corresponding to the native human CD16a (FcyRIII) receptor.
  • the human monocyte cell line according to the invention constitutes a cell model of splenic phagocytosis. In another particular embodiment of the invention, the human monocyte cell line according to the invention constitutes a cell model of phagocytosis in the red pulp of the spleen.
  • Another aspect of the invention relates to a process for obtaining the line of human monocytes as described above, comprising the following steps: a) isolating the human monocytes from the peripheral blood of a patient suffering from acute myelogenous leukemia. monocytic, b) transduction of the human monocytes of step a) with a lentiviral vector comprising a nucleic acid of sequence chosen from sequence chosen from SEQ ID No.1, SEQ ID No.4, SEQ ID No.5, SEQ ID No .6 or a variant of the nucleic acid of sequence SEQ ID No.1, c) selecting the human monocytes from step b) expressing the CD16a, CD32 and CD64 receptors with a selection medium, and d) checking the levels of expression of the CD16a, CD32 and CD64 receptors in the human monocytes selected in step c).
  • Another aspect of the invention relates to a process for obtaining the line of human monocytes as described above, comprising the following steps: a) obtain an established human monocytic line b) transduction of the human monocytes of step a) with a lentiviral vector comprising a nucleic acid of sequence chosen from sequence chosen from SEQ ID No.1, SEQ ID No.4, SEQ ID No .5, SEQ ID No.6 or a variant of the nucleic acid of sequence SEQ ID No.1, c) select the human monocytes from step b) expressing the CD16a, CD32 and CD64 receptors with a medium of selection, and d) checking the levels of expression of CD16a, CD32 and CD64 receptors in the human monocytes selected in step c).
  • step c) of selection of human monocytes is carried out by flow cytometry using a combination of antibodies specific for FcyRs according to the following combination: CD16A-FITC, CD32-PE and CD64-PC7.
  • step d) of checking the levels of expression of CD16a, CD32 and CD64 receptors in the human monocytes selected in step c) is carried out by comparing the levels of expression of CD16CD16a, CD32 and CD64 receptors in the human monocytes selected in step c) relative to the levels of expression of these same receptors in the splenic monocytes and / or circulating macrophages derived from monocytes.
  • step d) of checking the levels of expression of CD16a, CD32 and CD64 receptors in the human monocytes selected in step c) is carried out by comparing the levels of expression of CD16a, CD32 and CD64 receptors in the human monocytes selected in step c) relative to the levels of expression of these same receptors in the untransfected human monocytes of step a).
  • step d) of checking the levels of expression of CD16a, CD32 and CD64 receptors in the human monocytes selected in step c) is carried out by comparing the levels of expression of CD16a, CD32 and CD64 receptors in the human monocytes selected in step c) relative to the levels of expression of these same receptors in the untransfected human monocytic line of step a).
  • Another aspect of the invention relates to the use of the monocyte cell line according to the invention as a cell model of phagocytosis, in particular for the phagocytosis of antibody / target entity complexes.
  • the term “target entities” is understood to mean organisms and particles having a surface antigen capable of binding an antibody.
  • the organisms can be living organisms or dead organisms, said living or dead organisms containing RNA or DNA.
  • the organisms are chosen from viruses, bacteria, fungi, mycoplasmas, virions, yeasts, living cells, in particular modified living cells and unmodified living cells, cell precursors. , and fragments thereof.
  • the particles having a surface antigen capable of binding an antibody can be synthetic chemical particles, in particular nanoparticles.
  • the monocyte cell line according to the invention can be used as a cell model of the phagocytosis of the anti-D / red blood cell complex.
  • the monocyte cell line according to the invention can be used as a cell model of platelet phagocytosis.
  • the monocyte cell line according to the invention can be used as a cell model for the phagocytosis of cancer cells.
  • Another aspect of the invention relates to a method for in vitro evaluation of the phagocytic activity of a human monocyte cell line comprising the following steps: a) labeling and sensitization of the target entities with antibodies directed against said target entities, b) bringing the target entities from step a) into contact with the human monocyte cell line as described above, c) measuring the phagocytic activity mediated by the antibodies directed against said target entities by flow cytometry, and d) determination of phagocytosis
  • Another aspect of the invention relates to a method for in vitro evaluation of the phagocytic activity of a human monocyte cell line comprising the following steps: a) labeling and sensitization of the target entities with antibodies directed against said target entities, b) pre-incubation of the human monocyte cell line as defined above in the presence of an agent blocking the Fc gamma receptors (FcyR) Human CD16a, CD32 and / or CD64 on the surface of the monocyte cell line, c) bringing the target entities from step a) into contact with the human monocyte cell line from step b), d) measurement of the phagocytic activity mediated by the antibodies directed against said target entities by flow cytometry, and e) determination of phagocytosis.
  • FcyR Fc gamma receptors
  • the phagocytosis is determined by means of any usual technique known to those skilled in the art.
  • the determination of the phagocytosis can be carried out, for example, by one or more different methods such as the determination of the percentage of phagocytosis, the measurement of the fluorescence intensity.
  • the determination of phagocytosis can be carried out by different methods allowing the entire phagocytosis process to be analyzed:
  • Ingestion For example, by analyzing the percentage of effector cells that have phagocytosed targets or the number of targets phagocytosed by cytometry, microscopy or any usual technique known to those skilled in the art. Release of cellular components. For example, by analyzing the compounds released into the medium by immunological assay in ELISA, cytometry or any usual technique known to those skilled in the art.
  • the method of in vitro evaluation of the phagocytic activity of a human monocyte cell line has the advantage of being reliable, precise, sensitive and reproducible.
  • the method according to the invention can be used as a cell model of phagocytosis.
  • the target entities are chosen from organisms and particles having a surface antigen capable of binding an antibody.
  • the organisms are chosen from living organisms and dead organisms, said living or dead organisms containing RNA or DNA.
  • the organisms are chosen from viruses, bacteria, fungi, mycoplasmas, virions, yeasts, living cells, in particular modified living cells and unmodified living cells, cell precursors, and fragments of these.
  • the particles having a surface antigen capable of binding an antibody can be synthetic chemical particles, in particular nanoparticles.
  • the living cells are chosen from platelets, erythrocytes and cancer cells.
  • the particles having a surface antigen capable of binding an antibody are nanoparticles.
  • the antibodies directed against said target entities are chosen from anti-D antibodies, in particular Roledumab, immunoglobulins G, anti-erythrocyte antibodies and anti-platelet antibodies, in particular L 'anti-CD41.
  • anti-D antibodies in particular Roledumab
  • immunoglobulins G anti-erythrocyte antibodies
  • anti-platelet antibodies in particular L 'anti-CD41.
  • the G immunoglobulins are polyvalent G immunoglobulins.
  • the target entities are pre-marked with PKH67.
  • the agent blocking the human CD16a, CD32 and / or CD64 gamma Fc receptors (FcyR) at the surface of the monocyte cell line is chosen from a polyvalent immunoglobulin G and / or a recombinant Fc fragment.
  • a polyvalent immunoglobulin G and / or a recombinant Fc fragment any concentrate of polyvalent immunoglobulins G currently on the market can be used.
  • the product Iqymune ® (LFB) can be used.
  • the method of in vitro evaluation of the phagocytic activity of a human monocyte cell line comprising the following steps: a) labeling with PKFI67 and sensitization of the erythrocytes with an anti- D, b) bringing the erythrocytes from step a) into contact with the human monocyte cell line in the presence of immunoglobulins G, c) measuring the phagocytic activity mediated by the anti-D antibody, by cytometry of flux, and d) determination of phagocytosis.
  • the method according to the invention using red blood cells as target organisms constitutes a precise, sensitive and reproducible reliable cellular model of the mechanism of action of Roledumab.
  • the method of in vitro evaluation of the phagocytic activity of a human monocyte cell line comprising the following steps: a) labeling with FITC and sensitization of at least one bacterium with a solution of immunoglobulins G, b) bringing the at least one bacterium resulting from step a) into contact with the human monocyte cell line, c) measurement of the phagocytic activity mediated by the immunoglobulins G, by cytometry flux, and d) determination of phagocytosis.
  • At least one bacterium can be chosen from Gram-positive bacteria or Gram-negative bacteria.
  • the Gram-positive bacteria can be chosen from bacteria of the genus Staphylococcus, bacteria of the genus Enterococcus, bacteria of the genus Micrococcus, bacteria of the genus Lactococcus, bacteria of the genus Lactobacillus, bacteria of the genus Clostridium, bacteria of the genus Bacillus, bacteria of the genus Streptococcus, bacteria of the genus Listeria and bacteria of the genus Enterococcus, the list not being exhaustive.
  • the Gram-negative bacteria can be chosen from bacteria of the genus Escherichia, in particular Escherichia coli, bacteria of the genus Pseudomonas, bacteria of the genus Acinetobacter, bacteria of the genus Bordetella, bacteria of the genus Salmonella. , bacteria of the genus Yersinia, bacteria of the genus Vibrio, bacteria of the genus Agrobacterium, bacteria of the genus Rhizobium, the list not being exhaustive.
  • at least one bacterium is Escherichia coli.
  • the method of in vitro evaluation of the phagocytic activity of a human monocyte cell line comprising the following steps: a) labeling with FITC and sensitization of Escherichia coli bacteria with a solution of immunoglobulins G, b) bringing the bacteria resulting from step a) into contact with the human monocyte cell line, c) measuring the phagocytic activity mediated by immunoglobulins G, by flow cytometry, and d) determining phagocytosis.
  • the G immunoglobulins are polyvalent G immunoglobulins.
  • the method according to the invention using the Escherichia.coli bacteria as target entities constitutes a precise, sensitive and reproducible reliable cellular model of the mechanism of action of immunoglobulins G as replacement therapy in the case of primary immunodeficiency and / or secondary.
  • the method of in vitro evaluation of the phagocytic activity of a human monocyte cell line comprising the following steps: a) labeling with PKH67 and sensitization of rabbit erythrocytes, possessing glycanic-type antigenic sites similar to certain bacteria, with immunoglobulins G, b) bringing the erythrocytes from step a) into contact with the human monocyte cell line, c) measuring the phagocytic activity mediated by the immunoglobulins G, by flow cytometry, and d) determination of phagocytosis.
  • the method according to the invention using rabbit erythrocytes as target entities constitutes a reliable, precise, sensitive and reproducible cell model of the mechanism of action of immunoglobulins G as replacement therapy in the case of primary and / or secondary immunodeficiency.
  • the method of in vitro evaluation of the phagocytic activity of a human monocyte cell line comprising the following steps: a) labeling with PKH67 and sensitization of the platelets with an anti-antibody. -CD41, b) pre-incubation of the human monocyte cell line as defined above in the presence of a polyvalent immunoglobulin G and / or an Fc fragment recombinant, c) bringing the platelets from step a) into contact with the human monocyte cell line from step b), d) measuring the phagocytic activity mediated by an anti-platelet antibody, in particular the anti-CD41 antibody, by flow cytometry, and e) determination of phagocytosis.
  • the method according to the invention using platelets as target organisms constitutes a reliable, precise, sensitive and reproducible cell model of immune thrombocytopenia associated with purpura (ITP).
  • the method of in vitro evaluation of the phagocytic activity of a human monocyte cell line comprising the following steps: a) labeling with PKH67 and sensitization of the erythrocytes with an anti-antibody.
  • erythrocytes b) pre-incubation of the human monocyte cell line as defined above in the presence of a polyvalent immunoglobulin G and / or a recombinant Fc fragment, c) bringing the erythrocytes from step a) into contact with the human monocyte cell line resulting from step b), d) measurement of phagocytic activity mediated by an anti-erythrocyte antibody, by flow cytometry, and e) determination of phagocytosis.
  • the anti-erythrocyte antibody is chosen from the anti-D antibody, the anti-A antibody and the anti-B antibody.
  • the anti-D antibody makes it possible to target rhesus + erythrocytes.
  • the anti-A antibody makes it possible to target erythrocytes belonging to blood groups A and / or AB.
  • the anti-B antibody makes it possible to target erythrocytes belonging to blood groups B and / or AB.
  • the method according to the invention using erythrocytes as target organisms constitutes a precise, sensitive and reproducible reliable cellular model of autoimmune hemolytic anemia (AHAI) and of the mechanism of action of immunoglobulins G as immunotherapy treatment.
  • Another aspect of the invention relates to a method of selecting antibodies with high ADCP activity mediated by the human CD16a, CD32 and / or CD64 gamma Fc receptors (FcyR).
  • ADCP Antibody-dependent cell phagocytosis
  • the term “antibody with strong ADCP activity” means an antibody exhibiting a strong capacity to induce phagocytosis of target entities by the human monocyte cell line according to the invention.
  • the method for selecting antibodies with high ADCP activity mediated by the human CD16a, CD32 and / or CD64 gamma Fc receptors comprising the following steps: a) pre-incubation of the human monocyte cell line according to the invention in the presence of an agent blocking the human CD16a, CD32 and / or CD64 gamma Fc receptors (FcyR) at the surface of the monocyte cell line, b) contacting the human monocyte cell line resulting from step a) with said antibodies to be selected, said antibodies being linked to their target entities, c) determination of phagocytosis, and d) selection of antibodies with high ADCP activity mediated by CD16a and / or CD32 and / or CD64.
  • the agent blocking human Fc gamma receptors (FcyR) at the surface of the monocyte cell line is chosen from a polyvalent immunoglobulin G and / or a recombinant Fc fragment.
  • any polyvalent immunoglobulin G currently on the market can be used.
  • the product Iqymune® (LFB) can be used.
  • Another aspect of the invention relates to a method of selecting an inhibitor of ADCP mediated by human Fc gamma receptors (FcyR) CD16a, CD32 and / or CD64.
  • FcyR human Fc gamma receptors
  • ADCP inhibitor means any molecule, in particular antibody, capable of inhibiting phagocytosis of target entities by the human monocyte cell line according to the invention.
  • the method for selecting an ADCP inhibitor mediated by the human CD16a, CD32 and / or CD64 Fc gamma receptors (FcyR) comprising the following steps: a) opsonization of the target entities with an antibody with high ADCP activity directed against said target entities, b) bringing the human monocyte cell line according to the invention into contact with the target entities opsonized during step a) and said inhibitors to be selected, c) determination of phagocytosis, and d) selection CD16a and / or CD32 and / or CD64-mediated ADCP inhibitors.
  • FIG. 1 represents the restriction map of the lentiviral vector comprising a nucleic acid of SEQ ID No.1.
  • FIG. 2 shows the expression profile of human Fc gamma receptors (FcyR) (CD16a, CD32 and CD64) of the human monocyte cell line of the invention.
  • the expression profile was obtained by flow cytometry using the following specific fluorescent antibodies: CD16-FITC, CD32-PE and CD64-PC7.
  • FIG. 3A represents the percentage of phagocytosis of the platelets, originating from a donor 1, sensitized with the anti-CD41 antibody by the monocyte cell line according to the invention, using increasing concentrations of IglV to 10% (Iqymune , LFB) or recombinant Fc fragments (LFBD192-DS AY, LFBD192-DS EY and LFBD191-DS AY) (Fc gamma receptor blocking agent (FcyR)), 6.66x10 5 M, 6.66x10 e M, 6 , 66x10 7 M, at 6.66x10 8 M. The results are obtained by flow cytometry.
  • IglV to 10% Iqymune , LFB
  • Fc fragments LFBD192-DS AY, LFBD192-DS EY and LFBD191-DS AY
  • FcyR Fc gamma receptor blocking agent
  • FIG. 3B represents the mean fluorescence intensity (MFI for Mean Fluorescence Intensity) associated with the quantity of platelets ingested by the monocyte cell line according to the invention using increasing concentrations of IglV at 10% (Iqymune, LFB) or recombinant Fc fragments (LFBD192-DS AY, LFBD192-DS EY and LFBD191-DS AY) (agent blocking gamma Fc receptors (FcyR)), 6.66x10-5 M, 6.66x10-6 M, 6, 66x10-7 M, at 6.66x10-8 M, said platelets coming from a donor 1, and having been sensitized with the anti-CD41 antibody. The results are obtained by flow cytometry.
  • MFI Mean Fluorescence Intensity
  • FIG. 3C represents the percentage of phagocytosis of the platelets, originating from a donor 2, sensitized with the anti-CD41 antibody by the cell line of monocytes according to the invention, using increasing concentrations of 10% IglV (Iqymune, LFB) or recombinant Fc fragments (LFBD192-DS AY, LFBD192-DS EY and LFBD191-DS AY) (agent blocking the Fc gamma receptors ( FcyR)) to 6,66x10 ® M, and M 6,66x10, 6,66x10 7 million to 8 6,66x10 M.
  • IglV Iqymune, LFB
  • Fc fragments LFBD192-DS AY, LFBD192-DS EY and LFBD191-DS AY
  • FcyR Fc gamma receptors
  • Figure 3D represents the mean fluorescence intensity (MFI) associated with the quantity of platelets ingested by the monocyte cell line according to the invention using increasing concentrations of 10% IglV (Iqymune, LFB) or Fc fragments recombinant (LFBD192-DS AY, LFBD192-DS EY and LFBD191-DS AY) (Fc gamma receptor blocker (FcyR)), 6.66x10-5 M, 6.66x10-6 M, 6.66x10-7 M , at 6.66x10-8 M, said platelets coming from a donor 2, and having been sensitized with the anti-CD41 antibody. The results are obtained by flow cytometry.
  • MFI mean fluorescence intensity
  • FIG. 3F represents the mean fluorescence intensity (MFI) associated with the quantity of platelets ingested by the monocyte cell line according to the invention using increasing concentrations of 10% IglV (Iqymune, LFB) or Fc fragments recombinant (LFBD192-DS AY, LFBD192-DS EY and LFBD191-DS AY) (Fc gamma receptor blocker (FcyR)), 6.66x10-5 M, 6.66x10-6 M, 6.66x10-7 M , at 6.66x10-8 M, said platelets coming from a donor 3, and having been sensitized with the anti-CD41 antibody. The results are obtained by flow cytometry.
  • MFI mean fluorescence intensity
  • FIG. 4A represents the percentage of phagocytosis of red blood cells sensitized with the anti-D antibody (Roledumab) by the monocyte cell line according to the invention, using increasing concentrations of anti-D antibodies (Roledumab), from 0, 04 at 5 pg / ml and in the presence of IglV at a concentration of 0.25 mg / ml. The results are obtained by flow cytometry.
  • FIG. 4B represents the mean fluorescence intensity (MFI) associated with the quantity of red blood cells ingested by the monocyte cell line according to the invention, using increasing concentrations of anti-D antibodies (Roledumab) ranging from 0, 04 to 5 ⁇ g / ml in the presence of 0.25 mg / ml of IglV, said red blood cells having been previously sensitized with the anti-D antibody (Roledumab). The results were obtained by flow cytometry.
  • MFI mean fluorescence intensity
  • 4C represents the percentage of phagocytosis of red blood cells sensitized with the anti-D antibody (Roledumab) by the monocyte cell line according to the invention, in the absence of anti-D antibody (Roledumab), in the presence of anti-D antibody (Roledumab) at a concentration of 5 ⁇ g / ml or in the presence of anti-D antibody (Roledumab) at a concentration of 5 ⁇ g / ml and 5 ⁇ g / ml of anti-CD16 antibody.
  • the results are obtained by flow cytometry.
  • FIG. 4D represents the mean fluorescence intensity (MFI) associated with the quantity of red blood cells ingested by the monocyte cell line according to the invention, in the absence of anti-D antibodies (Roledumab), in the presence of anti-D antibody (Roledumab) at a concentration of 5 ⁇ g / ml or in the presence of anti-D antibody (Roledumab) at a concentration of 5 ⁇ g / ml and 5 ⁇ g / ml of anti-CD16 antibody.
  • MFI mean fluorescence intensity
  • FIG. 5 represents the results of the phagocytosis test of red blood cells sensitized with an anti-D antibody (RhD + RBC) by the human monocyte cell line according to the invention (THP1 CD16 +) with increasing concentrations from 0.04 to 5 pg / ml of anti-D antibody (Roledumab) in the presence of 0.25 mg / ml of IVIg.
  • Graphs A and B were obtained with a range of 50% anti-D antibody and graphs C and D were obtained with a range of 150% anti-D antibody. Results are presented as percent phagocytosis (A and C) and average fluorescence intensity (B and D) and represent the average of a single experiment performed in duplicate.
  • FIG. 6 represents the results of the phagocytosis test of red blood cells sensitized with an anti-D antibody (RhD + RBC) by the human monocyte cell line according to the invention (THP1 CD16 +) with increasing concentrations from 0.04 to 5 pg / ml of anti-D antibody (Roledumab) in the presence of 0.25 mg / ml of IVIg.
  • Graphs A and D were obtained after applying heat stress at 40 ° C for 3 months
  • graphs B and E were obtained after applying heat stress at 50 ° C for 3 weeks
  • graphs C and F after application of heat stress at 50 ° C for 6 weeks.
  • Results are presented as percent phagocytosis (A, B, and C) and average fluorescence intensity (D, E, and F) and represent the average of a single experiment performed in duplicate.
  • FIG. 7 represents the results of the phagocytosis test of red blood cells sensitized with an anti-D antibody (RhD + RBC) by the human monocyte cell line according to the invention (THP1 CD16 +) with increasing concentrations from 0.04 to 5 pg / ml of anti-D antibody (Roledumab) in the presence of 0.25 mg / ml of IVIg.
  • Charts A and D were obtained after application of a chemical stress using H 2 0 2 at a concentration of 10 mM
  • graphs B and E were obtained after application of a chemical stress using H 2 0 2 at a concentration of 50 mM
  • graphs C and F after application of chemical stress using H 2 O 2 at a concentration of 10 mM.
  • the results are presented as percent phagocytosis (A, B and C) and average fluorescence intensity (D, E and F) and represent the average of a single experiment performed in duplicate.
  • FIG. 8 represents the results of the phagocytosis test of red blood cells sensitized with an anti-D antibody (RhD + RBC) by the human monocyte cell line according to the invention (THP1 CD16 +) with increasing concentrations from 0.04 to 5 pg / ml of anti-D antibody (Roledumab) in the presence of 0.25 mg / ml of IVIg.
  • Graphs A and D were obtained with DF5
  • graphs B and E were obtained with anti-D antibody (Roledumab) treated with EndoS2 for 2 hours at 37 ° C
  • graphs C and F were obtained with the heated anti-D antibody (Roledumab, batch CB04).
  • Results are presented as percent phagocytosis (A, B, and C) and average fluorescence intensity (D, E, and F) and represent the average of a single experiment performed in duplicate.
  • FIG. 9 represents the results of the phagocytosis test of red blood cells sensitized with an anti-D antibody (RhD + RBC) by the human monocyte cell line according to the invention (THP1 CD16 +) with increasing concentrations of 0.04 to 5 pg / ml of anti-D antibody (Roledumab) in the presence of 0.25 mg / ml of IglV after 3 passages or 29 passages of cell culture.
  • B and D represents the results of the phagocytosis test of red blood cells sensitized with an anti-D antibody (RhD + RBC) by the human monocyte cell line according to the invention (THP1 CD16A +) with increasing concentrations of 0 , 04 to 5 pg / ml of anti-D antibody (Roledumab, lot 304) having passed one or two F / T cycles in the presence of 0.25 mg / ml of IVIg. Results are presented as percent phagocytosis (A and B) and mean fluorescence intensity (C and D) and represent the average of a single experiment performed in duplicate.
  • Example 1 Preparation of a monocyte cell line (THP1 CD16 +)
  • THP1 human monocyte cells were transfected twice at MOI 100 with 4 ⁇ g / ml polybrene using lentiviral vectors expressing the nucleic acid of SEQ ID No.1 ( Figure 1). Cells were amplified and clone selection was performed by limiting dilution. The amplified clones were characterized beforehand.
  • IMDM Iscoves Modified Dulbecco's Medium
  • SVF Fetal Calf Serum
  • the cells were cultured in IMDM (Iscoves Modified Dulbecco's Medium) + 10% Fetal Calf Serum by subculturing them in the desired culture volume at 4x10 5 cells / ml for 3 days and at 3x10 5 cells / ml for 4 days.
  • IMDM Iscoves Modified Dulbecco's Medium
  • the cell cultures were incubated at 37 ° C in humidified incubators with an atmosphere of 5% CO 2 in air.
  • Total and viable cell densities were determined by automatic counting with the NC-200 system from Chemometec. A sample, optionally diluted, of 0.2 ml was analyzed by automated staining with DAPI and acridine orange, followed by a series of photographs. Analysis using the associated software (NucleoView) was performed to determine the concentrations of total and viable cells. Percent viability was calculated by multiplying by 100 the number of viable cells relative to the total number of cells (living and dead cells).
  • Cells in early or medium exponential growth phase and greater than 80% viability were used. Cells were collected by centrifugation and resuspended in freezing medium (95% Fetal Calf Serum - 5% DMSO), pre-cooled to 4 ° C. The cell suspension was then dispensed into the appropriate number of cryogenic tubes, along with 1 ml of suspension per cryogenic tube, containing 5 x 10 6 cells. Cryogenic tubes were immediately placed in a -80 ° C freezer. The next day, the cryotubes were transferred to a cryocontainer and stored in liquid nitrogen by immersion.
  • freezing medium 95% Fetal Calf Serum - 5% DMSO
  • the THP1 CD16 + human monocyte cell lines according to the invention were characterized by flow cytometry after an incubation of 15 minutes at room temperature, shielded from the light of 1 ⁇ 10 5 cells with different specific antibodies.
  • FcyRs according to the following combination: CD16-FITC (20 pL) / CD32-PE (20 pL) / CD64-PC7 (10 pL).
  • Isotypic controls (irrelevant antibodies of the same IgG isotype and labeled with the same fluorochrome) were carried out under the same experimental conditions.
  • Figure 2 shows the CD16, CD32 and CD64 receptor expression profile of the THP1 CD16 + human monocyte cell line.
  • the human monocyte cell line according to the invention therefore exhibits stable expression of CD16a, CD32 and CD64 membrane receptors.
  • the number of CD16a, CD32 and CD64 receptors expressed by the human monocyte cell line according to the invention was determined using the QIFIKIT kit from the company DAKO. By way of comparison, the presence of these CD16a, CD32 and CD64 receptors was also tested in untransfected THP 1 cells (THP1 WT) and conventional monocytes.
  • the samples are washed twice with 3 mL of PBS + 1% BSA by centrifugation at 270 x g for 5 minutes.
  • pellets are resuspended in 500 ⁇ L of PBS + 1% BSA before being analyzed by flow cytometry.
  • Figure 9 shows comparable phagocytosis activity between THP1CD16 + cells at passages P3 and P29. These results validate the use of THP1 CD16 + cells for approximately 30 cell culture passages. These results show that the human monocyte cell line according to the invention stably expresses CD16a, CD32 and CD64.
  • Example 2 Inhibition of phagocytosis of platelets mediated by anti-
  • the platelets were isolated from peripheral blood of human blood group O (EFS, Les Ulis) stored at 22 ° C ⁇ 2 ° C overnight then labeled with PKH67 (Sigma) at a final concentration of 2x10 6 M and sensitized. at 37 ° C for 30 min with stirring with 1 pg / ml of an anti-CD41 monoclonal antibody (absolute antibody) or dilution buffer (non-sensitized platelet control) for a platelet suspension of 2x10 7 platelets / m L
  • the THP1 human monocyte cell line according to the invention (THP1 CD16 + cell line) (1x10 6 cells) was pre-incubated for 30 min at 37 ° C with increasing concentrations ranging from 6.66x10 5 M, 6.66x10 e M, 6.66x10 7 M, at 6.66x10 8 M 10% IglV (Iqymune, LFB) or recombinant Fc fragments obtained according to the method described in international application WO 2019/115773 (rFc AY068, rFc EY069 and rFc AY070), corresponding to 10, 1, 0.1 and 0.01 mg / mL for 10% IglV (Iqymune, LFB) and 3.33; 0.33; 0.03 and 0.003 mg / mL for the recombinant Fc fragments (rFc AY068, rFc EY069 and rFc AY070).
  • the recombinant Fc fragment (rFc AY070) was produced in a transgenic goat line while the recombinant Fc fragments (rFc AY068 and rFc EY069) were produced in recombinant CHO cells.
  • the fragments were designed with several mutations in order to increase their affinities for the FcRn and CD16 receptors.
  • the rFc AY068 and rFc AY070 variants contain 5 mutations (K334N; P352S; A378V; V397N; N434Y and 1 -N glycosylation site (N297)).
  • the rFc variant EY069 contains 6 mutations (Y296W, K334N; P352S; A378V; V397N; N434Y, and 1 -N glycosylation site (N297)).
  • Platelets labeled and sensitized with anti-platelet antibody (2 ⁇ 10 7 platelets) were added to the human monocyte cell line THP1 CD16 + (ratio 1:20) and incubated for 1 hour at 37 ° C. After incubation, the THP1 cells were incubated with trypan blue to mask the fluorescence of the labeled platelets which would not be further internalized, the THP1 human monocyte cell line was labeled with an anti-CD45 fluorescent antibody (Beckman Coulter). The phagocytosis mediated by anti-platelet antibodies was measured by flow cytometry (Galios flow cytometer, Beckman Coulter). The results are shown in Figures 3A to 3F.
  • the cell line thus constitutes a reliable, precise, sensitive and reproducible cell model of immune thrombocytopenia associated with purpura (ITP), making it possible to distinguish the therapeutic efficacy in vitro of various products.
  • Papain commercial red blood cells were washed twice in 0.9% NaCl for 5 minutes at 1730g and the pellet was suspended in 400ml of 0.9% NaCl.
  • the suspension is first of all mixed with 2 ml of diluent C and then with 2 ml of 4 ⁇ 10 6 M PKH67 solution in diluent C (final concentration: 2 ⁇ 10 6 M). After rapid mixing, the suspension was incubated for 5 minutes in the dark. 4ml of fetal calf serum (FCS) was added, the supernatant was removed and the pellet washed three times in 0.9% NaCL. Labeling with PKH67 was checked by cytometry. All red blood cells fluoresce.
  • Red blood cells (RBC) labeled with PKH67 are washed twice in 0.9% NaCl for 5 minutes at 1730 g and 50 ⁇ L of a 1: 30 dilution of red blood cells in 0.9% NaCl have was mixed with 50 ml of a suspension of fluorescent microbeads (flowcount fluorospheres) and 2 ml of 0.9% NaCl.
  • red blood cells The concentration of red blood cells is determined by flow cytometry. The red blood cells were then resuspended in 0.9% NaCl at 2 ⁇ 10 8 red cells / ml ( ⁇ 15%).
  • THP1 CD16 + cells (monocyte cell line according to the invention) are counted and then resuspended in IMDM medium + 10% fetal calf serum (FCS) at 1 x 10 6 cells / ml ( ⁇ 15%).
  • FCS fetal calf serum
  • Red cells at a concentration of 2 ⁇ 10 8 red cells / mL in 0.9% NaCl are incubated with anti-D antibody preparations (Roledumab) at 0.04, 0.08, 0.16, 0.31, 0, 62, 1, 25, 2.5 and 5 pg / mL (v / v) or with 0.9% NaCl (non-sensitized red blood cells (NS-RBC)) for 30 minutes at 37 ° C.
  • the samples are washed twice in IMDM medium + 10% FCS and the pellets are suspended at 1x10 8 red blood cells / ml in IMDM medium + 10% FCS.
  • 100 ⁇ L of red cells at 1x10 8 red cells / mL are mixed with 100 ⁇ L of THP1 CD16 + cells at 1x10 6 cells / mL (i.e. a THP1 cell / red cell ratio of 1/100) in the presence of 0.25 mg / mL d human normal immunoglobulins (IVIG).
  • IVIG human normal immunoglobulins
  • a CD16a specificity control sample is performed with sensitized red blood cells using an anti-D concentration of 5 pg / mL and an anti-CD16 antibody concentration of 5 pg / mL.
  • Incubation is carried out at 37 ° C. for 1 hour.
  • the PKH67 labeling is quenched by adding 100 ⁇ L of trypan blue, in order to eliminate the signal from the red blood cells stuck to the THP1 CD16 + cells.
  • the THP1 CD16 + cells are labeled with a fluorescent anti-CD45 antibody for 15 minutes at room temperature and protected from light.
  • the samples are washed again and the red blood cells are lysed with 500 ⁇ L of Versalyse Lysing solution for 20 minutes at room temperature, protected from light, in order to eliminate the non-phagocytized red blood cells (the red blood cells phagocytosed by the cells targets are not sensitive to these treatments).
  • the samples are washed again and fixed with 500 ⁇ L of fixing solution diluted to 1/40 before analysis.
  • the percentage of CD45 + THP1 cells containing the PKFI67 red blood cells (percentage of phagocytosis) and their mean PKFI67 fluorescence intensity (MFI) are measured by flow cytometry with a Galios Flow cytometer from the company Beckman Coulter. The results are then analyzed with the Kaluza Analysis software. The results are shown in Figures 4A to 4D.
  • phagocytosis percentage ( Figure 4A) and MFI ( Figure 4B)
  • the activity of phagocytosis is proportional to the anti-D concentration with a maximum of 91% phagocytosis.
  • the negative control without anti-D (NS-RBC) and with the anti-CD16 antibody (S-RBC + Anti-CD16) shows 2% and 4% respectively (FIG. 4C) of phagocytosis.
  • Phagocytosis signals are specifically mediated by binding of anti-D coated red blood cells to the CD16a receptor.
  • the cell line according to the invention therefore expresses, in addition to CD32 and CD64, functional CD16s.
  • Example 4 Method for selecting antibodies with strong phagocytosis activity (ADCP)
  • the lot was supplied in pre-filled syringes at a protein concentration of 0.3 mg / mL in the following formulation: trisodium citrate dihydrate (8.82 g / L) at pH 6.5, sodium chloride (3, 25 g / L), mannitol (17 g / L) and Polysorbate 80 at 400 ppm.
  • Heat stress is used to accelerate the phenomena of chemical or physical degradation.
  • Roledumab (anti-D antibody - batch CB04) is known to be temperature sensitive; heat stress induces aggregation, structural modification (fragmentation, chemical modification, etc.) and loss of activity (CD16a activity). Rroledumab vials will be placed at + 40 ° C for 3 months, at + 50 ° C for 3 weeks and 6 weeks.
  • Figure 6 shows a significant but slight decrease in the percentage of phagocytosis after heating for 6 weeks at + 50 ° C (EC50: 77%, top: 86%).
  • EC50: 77%, top: 86%) a very significant decrease in MFI Top was observed after heating to reach 40%, after 6 weeks at + 50 ° C.
  • the thermal stress and the associated degradation seem to have a significant negative impact on the activity of phagocytosis, in particular on the quantity of red blood cells ingested.
  • oxidative degradation that occurs in biotherapeutic treatments is one of the chemical degradation pathways of recombinant monoclonal antibodies (MAbs).
  • Monoclonal antibodies are exposed to processing and storage conditions that can influence the rate and magnitude of these changes. Oxidation of methionine (primary), as well as cysteine, histidine, tryptophan and tyrosine can be induced by incubation with oxidizing agents such as Fl 2 0 2 .
  • Potential sources of oxidation include the use of excipients containing trace amounts of oxidizing species (for example, polysorbate 80) or contact of the drug substance with residues of disinfecting or depyrogenizing agents having some oxidative potential. .
  • the oxidation stress was carried out by adding 10 mM, 50 mM and 100 mM of Fl 2 0 2 with an incubation period of 24 hours at + 25 ° C. A negative control with the same volume as Fl 2 0 2 was made with water. The percentage of phagocytosis and MFI as a function of anti-D antibody concentration (Roledumab - batch CB04) were analyzed to compare the EC50 values and the maximum value of the oxidized sample. The results are shown in Figure 7.
  • Figure 7 shows no decrease in phagocytosis activity after treatment with 10 mM H 2 O 2. A slight decrease in the percentage of phagocytosis (EC50) after treatment at 50 mM and 100 mM was observed (87% and 79% respectively).
  • Oxidative stress and the associated degradation seem to have a significant negative impact on the activity of phagocytosis, in particular on the quantity of red blood cells ingested.
  • DF5 is an anti-D IgG1 monoclonal antibody produced by a human lymphoblastoid cell line. This highly fucosylated antibody exhibits low binding affinity for FcyRIIIa (CD16a).
  • the deglycosylation was carried out by adding 3 ⁇ g of EndoS2 to 150 ⁇ g of anti-D antibody (Roledumab, batch CB04, called “CB04”) with an incubation time of 2 hours at + 37 ° C.
  • a negative control with the same volume as Fl 2 0 2 is carried out with water.
  • Figure 8 shows that the highly fucosylated antibody DF5 exhibits low phagocytosis activity (A / D) and that the deglycosylated anti-D antibody (Roledumab, batch CB04) was not able to induce phagocytosis of red blood cells. (B / E). The negative control (C / F) is comparable to the untreated anti-D antibody (Roledumab, lot CB04).
  • the method therefore allows the selection of antibodies according to their ability to phagocytose (ADCP: Antibody-Dependent Cell Phagocytosis).
  • the EC50, the maximum phagocytosis and the mean fluorescence intensity (MFI) of each series (2 values / parameter / assay, i.e. 50 values / parameter) are used to calculate the standard deviation (SD), the coefficient of variation (CV) and confidence interval (CI) to determine the intermediate precision of the method (IP or CVR).
  • SD standard deviation
  • CV coefficient of variation
  • CI confidence interval
  • the intermediate precision is 14% for the EC50 parameter regardless of the signal read (% phagocytosis or MFI) and 4% for the maximum percentage of phagocytosis (% Top).
  • MFI Top this signal being directly dependent on the fluorescence of the red blood cells, this differs from one test to another, only the repeatability was calculated, it is 8%.
  • the phagocytosis test developed for red blood cells sensitized by anti-D antibody using the monocyte cell line according to the invention (THP1 CD16 + cells) is:
  • This procedure describes the steps to be carried out in order to assess the capacity of polyvalent immunoglobulins to induce phagocytosis of E. Coli bacteria by human THP1 monocytic cells expressing the Fc receptors (FcyRs) CD32, CD64 and transfected with the CD16a receptor.
  • FcyRs Fc receptors
  • Phagocytosis takes place in 2 phases:
  • Opsonization is a binding between the immunoglobulins specifically covering the antigens of the microorganism and their receptors on the surface of phagocytes (CD16a, CD32 and CD64) associated with binding with complement (C3b).
  • the microorganism is then ingested by membrane deformation of the phagocytic cell and is found in a cytoplasmic vesicle called a phagosome.
  • a phagosome a cytoplasmic vesicle
  • the fusion of the phagosome with the lysosomes leads to its digestion and destruction. The debris is thrown outside the cell.
  • E. Coli bacteria labeled with a fluorochrome and opsonized with polyvalent immunoglobulins are incubated with the THP1 CD16 + cells at + 37 ° C.
  • the presence of fluorescent bacteria internalized by the phagocytic cells is sought by flow cytometry. 1 / Opsonization step
  • Two negative control tubes are prepared by adding 100 ⁇ l of physiological water to 20 ⁇ l of non-opsonized E. Coli bacteria labeled FITC.
  • IMDM medium Iscoves Modified Dulbecco's Medium + 10% Fetal calf serum
  • 20 ml of opsonized FITC-bacteria are mixed with 100 ⁇ l of THP1 CD16 + cells at 1x10 6 cells / m, with increasing concentrations of polyvalent immunoglobulins G. The tests were carried out in duplicate.
  • a negative control sample is produced with 20 ml of non-opsonized FITC bacteria to which 100 ml of THP1 CD16 + cells at 1x10 6 cells / ml are added. Incubation is carried out at 37 ° C. for 1 hour. At the end of the incubation, the FITC labeling is quenched by adding 100 ⁇ L of trypan blue diluted to 1/20 and maintained at 4 ° C., in order to eliminate the signal from the bacteria stuck to the THP1 CD16 + cells. Washing is then carried out by adding 3 ml of physiological water and by centrifuging the tubes for 3 minutes at + 4 ° C. and at 600 g.
  • the THP1 CD16 + cells are labeled with a fluorescent anti-CD45 antibody for 15 minutes at room temperature and protected from light.
  • the samples are washed again by adding 3 ml of physiological water and centrifuging the tubes for 3 minutes at + 4 ° C and at 600 g.
  • THP1 CD45 + cells containing FITC bacteria percentage of phagocytosis
  • MFI fluorescence intensity FITC mean
  • This procedure describes the steps to be carried out in order to evaluate the capacity of polyvalent immunoglobulins to induce phagocytosis of rabbit red blood cells, possessing antigenic sites of the glycanic type similar to certain bacteria, by THP1 human monocytic cells expressing the Fc receptors (FcyRs ) CD32, CD64 and transfected with the CD16a receptor.
  • FcyRs Fc receptors
  • Phagocytosis takes place in 2 phases:
  • Opsonization is a binding between the immunoglobulins specifically covering the antigens of the microorganism and their receptors present on the surface of phagocytes (CD16, CD32 and CD64) associated with binding with complement (C3b).
  • the microorganism is then ingested by membrane deformation of the phagocytic cell and is found in a cytoplasmic vesicle called a phagosome.
  • a phagosome a cytoplasmic vesicle
  • the fusion of the phagosome with the lysosomes leads to its digestion and destruction. The debris is thrown outside the cell.
  • Rabbit red blood cells labeled with a fluorochrome and opsonized with polyvalent immunoglobulins are incubated with the THP1 CD16 + cells at + 37 ° C.
  • the presence of fluorescent red blood cells internalized by the phagocytic cells is sought by flow cytometry.
  • the rabbit red blood cells (2mpl) are freshly taken on the day of the test using a sterile syringe containing an anticoagulant (citrate).
  • the red blood cells are then washed three times with 10 ml of physiological water by centrifugation at 1730 g for 5 minutes. After 3 successive washes, the red blood cells are taken up in 400 ⁇ L of physiological water.
  • the suspension is first of all mixed with 2 ml of diluent C and then with 2 ml of PKH67 solution at 4x10 ® M diluted to 1/250 in diluent C (final concentration: 2x10 ® M). After rapid mixing, the suspension was incubated for 5 minutes in the dark. 4 ml of fetal calf serum (FCS) were added, the supernatant was removed by centrifugation for 5 min at 1730 g and the pellet washed three times in 15 ml of physiological water. Labeling with PKH67 was checked by cytometry. All red blood cells fluoresce. Readjust the suspension of rabbit red blood cells to 200 x 10 ® cells / mL by adding physiological water.
  • FCS fetal calf serum
  • Two negative control tubes are prepared by adding 150 ⁇ L of physiological water to 150 ⁇ L of globular suspensions at 200 ⁇ 10 6 rabbit red cells / mL labeled with PKH67.
  • the tubes are washed twice by adding 3 ml of IMDM + 10% FCS medium per tube and centrifuged for 5 minutes at 1730 g. The supernatants are then removed and the pellets taken up in 300 ⁇ L of IMDM + 10% FCS medium (100 ⁇ 10 6 red blood cells / m L)
  • Phagocytosis was studied with red blood cells sensitized with known amounts of immunoglobulins G and THP1 CD16 + cells.
  • the rabbit red blood cells labeled with PKH67 are mixed with 100 ⁇ L of THP1 CD16 + cells at 1x10 6 cells / ml, with increasing concentrations of polyvalent immunoglobulins G. The tests were carried out in duplicate.
  • a negative control sample is produced with 10OmI of rabbit red blood cells labeled with PKH67 to which are added 100mI of THP1 CD16 + cells at 1x10 6 cells / mL. Incubation is carried out at 37 ° C. for 1 hour.
  • the PKH67 labeling is quenched by adding 100 ⁇ L of trypan blue diluted to 1/20 and maintained at 4 ° C., in order to eliminate the signal from the rabbit red blood cells stuck to the THP1 CD16 + cells. Washing is then carried out by adding 3 ml of physiological water and by centrifuging the tubes for 3 minutes at + 4 ° C. and at 600 g.
  • the THP1 CD16 + cells are labeled with 5 ⁇ l fluorescent anti-CD45 antibody in 500 ⁇ l of PBS per tube for 15 minutes at room temperature and protected from light.
  • the samples are washed again by adding 3 ml of physiological water and centrifuging the tubes for 3 minutes at + 4 ° C and at 600 g.
  • the samples are washed again and the red blood cells are lysed with 500 ⁇ L of Versalyse Lysing solution for 20 minutes at room temperature, protected from light, in order to eliminate the non-phagocytized red blood cells (the red blood cells phagocytosed by the cells targets are not sensitive to these treatments).
  • the samples are washed again and fixed with 500 ⁇ L of fixing solution diluted to 1/40 before analysis.
  • the percentage of CD45 + THP1 cells containing the PKH67 red blood cells (percentage of phagocytosis) and their mean PKH67 fluorescence intensity (MFI) are measured by flow cytometry with a Galios Flow cytometer from the company Beckman Coulter. The results are then analyzed with the Kaluza Analysis software. Reading the tubes on the Gallios cytometer (Beckman Coulter) (Store in the dark before reading): expression of PKH-67 in FL1 with a window on CD45 + cells.
  • Example 7 Inhibition by polyvalent immunoglobulins G of the phagocytosis of opsonized red blood cells
  • This procedure describes the steps to be carried out in order to evaluate the capacity of polyvalent immunoglobulins to inhibit phagocytosis of human red blood cells opsonized by anti-red blood cells (Autoimmune Hemolytic Anemia model), by human THP1 monocyte cells expressing the Fc receptors (FcyRs) CD32, CD64 and transfected with the CD16 receptor.
  • Autoimmune Hemolytic Anemia AHAI
  • AHAI Autoimmune Hemolytic Anemia
  • the major mechanism of action involved in the clearance of opsonized red blood cells is phagocytosis by macrophages of the red pulp of the spleen of the CD16 + / CD32 + / CD64 + phenotype.
  • RhD-i- human red blood cells labeled with a fluorochrome and opsonized with an anti-D antibody, playing the role of autoantibodies, are incubated with the THP1 CD16 + cells at + 37 ° C in the presence of increasing concentrations of polyvalent immunoglobulins. .
  • the presence of fluorescent red blood cells internalized by the phagocytic cells is sought by flow cytometry.
  • the 4000 ml of pellet are mixed with 2 ml of diluent C and then with 2 ml of PKH67 solution at 4x10 6 M diluted to 1/250 in diluent C (final concentration: 2x10 6 M). After rapid mixing, the suspension was incubated for 5 minutes in the dark. 4 ml of fetal calf serum (FCS) were added, the supernatant was removed by centrifugation for 5 min at 1730 g and the pellet washed three times in 15 ml of physiological water. Labeling with PKH67 was checked by cytometry. All red blood cells fluoresce. Readjust the suspension of rabbit red blood cells to 200 x 10 6 cells / mL by adding physiological water.
  • FCS fetal calf serum
  • the red blood cell suspension is incubated for one hour at + 37 ° C in a water bath, protected from light, 500 ⁇ L of red blood cell suspensions at 200 x 10 6 red cells / mL labeled with PKH-67 with 500 ⁇ L of solution of immunoglobulins to be tested in a cytometry tube.
  • a negative control tube non-opsonized red blood cells is prepared by adding 500 ml of physiological water to 500 ml of red blood cells at 200 ⁇ 10 6 rabbit red cells / ml labeled with PKH67.
  • the tubes are washed twice by adding 3 ml of IMDM + 10% FCS medium per tube and centrifuged for 5 minutes at 1730 g. The supernatants are then removed and the pellets taken up in 1 mL of IMDM + 10% FCS medium (100 ⁇ 10 6 red blood cells / mL)
  • Different concentrations of immunoglobulin G solutions are tested: 5 mg / mL in physiological water, 2.5 mg / mL in physiological water, 1.25 mg / mL in physiological water, 0.625 mg / mL in physiological water, 0.31 mg / mL in physiological water, 5 mg / mL in physiological water, 0.15 mg / mL in physiological water and 0 mg / mL in physiological water.
  • 100 ⁇ L of THP1 CD16 + cells at 1x10 6 cells / mL are pre-incubated with 50 ⁇ L of increasing concentrations of immunoglobulins to be tested for 30 minutes at + 37 ° C.
  • the red blood cells labeled with PKFI67 are mixed with 100 ⁇ L of THP1 CD16 + cells at 1x10 6 cells / ml, and sensitized with a saturating concentration of anti-D antibodies. The tests were carried out in duplicate.
  • a negative control sample is produced with 100 ml of non-opsonized PKH67 red blood cells to which are added 100 ml of CD16 + THP1 cells at 1 x10 6 cells / ml.
  • Incubation is carried out at 37 ° C. for 1 hour.
  • the PKH67 labeling is quenched by adding 100 ⁇ L of trypan blue diluted to 1/20 and maintained at 4 ° C, in order to eliminate the signal from the rabbit red blood cells stuck to the THP1 CD16 + cells. Washing is then carried out by adding 3 ml of physiological water and centrifuging the tubes for 3 minutes at + 4 ° C and at 600 g.
  • the THP1 CD16 + cells are labeled with 5 ⁇ l fluorescent anti-CD45 antibody in 500 ⁇ l of PBS per tube for 15 minutes at room temperature and protected from light.
  • the samples are washed again by adding 3 ml of physiological water and centrifuging the tubes for 3 minutes at + 4 ° C and at 600 g.
  • the samples are washed again and the red blood cells are lysed with 500 ⁇ L of Versalyse Lysing solution for 20 minutes at room temperature, protected from light, in order to eliminate the non-phagocytized red blood cells (the red blood cells phagocytosed by the cells targets are not sensitive to these treatments).
  • the samples are washed again and fixed with 500 ⁇ L of fixing solution diluted to 1/40 before analysis.
  • the percentage of THP1 CD45 + cells containing PKFI67 red blood cells (percentage of phagocytosis) and their mean fluorescence intensity PKH67 (MFI) are measured by flow cytometry with a Galios Flow cytometer from the company Beckman Coulter. The results are then analyzed with the Kaluza Analysis software. Reading of the tubes on the Gallios cytometer (Beckman Coulter) (Store away from light before reading): expression of PKFI-67 in FL1 with a window on the CD45 + cells.

Landscapes

  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Immunology (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Cell Biology (AREA)
  • Biotechnology (AREA)
  • Hematology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Urology & Nephrology (AREA)
  • Microbiology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Analytical Chemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Physics & Mathematics (AREA)
  • Medicinal Chemistry (AREA)
  • Food Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Toxicology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Peptides Or Proteins (AREA)

Abstract

The present invention concerns a human monocyte cell line expressing, in a stable and functional manner, human Fc gamma receptors (FcyR) CD16a, CD32 and CD64 on the surface, and a method for the in vitro evaluation of the phagocytic activity of the line. The present invention also concerns a method for the selection of antibodies having a high ADCP activity mediated by the human Fc gamma receptors (FcyR) CD16a, CD32 and/or CD64 and a method for the selection of an inhibitor of ADCP mediated by the human Fc gamma receptors (FcyR) CD16a, CD32 and/or CD64.

Description

Titre : Lignée cellulaire de monocytes humains et son utilisation en tant que modèle cellulaire de la phagocytose. Title: Human monocyte cell line and its use as a cell model of phagocytosis.
La présente invention concerne une nouvelle lignée cellulaire de monocytes humains, et son utilisation en tant que modèle cellulaire de la phagocytose. The present invention relates to a novel human monocyte cell line, and its use as a cell model of phagocytosis.
La phagocytose est le processus cellulaire par lequel certaines cellules regroupées sous la dénomination générale de phagocytes peuvent ingérer des particules étrangères solides d'échelle micrométrique. On considère habituellement que la phagocytose est une forme particulière d'endocytose. Phagocytosis is the cellular process by which certain cells grouped under the general name of phagocytes can ingest solid foreign particles of micrometric scale. Phagocytosis is usually considered to be a particular form of endocytosis.
Elle se distingue d'autres processus d'internalisation cellulaire (endocytose, pinocytose) par au moins deux critères généraux : It differs from other cellular internalization processes (endocytosis, pinocytosis) by at least two general criteria:
- la phagocytose est induite par le contact physique avec la particule-cible ; - phagocytosis is induced by physical contact with the target particle;
- la particule-cible de la phagocytose a une taille supérieure à 0,5 pm. - the phagocytosis target particle has a size greater than 0.5 μm.
Bien que la phagocytose ait été observée expérimentalement dans plusieurs types cellulaires, elle est généralement fortement associée avec certaines catégories de leucocytes, tels les macrophages, les cellules dendritiques ou les neutrophiles. Son action est essentielle dans la réponse immunitaire. Qu’elle soit innée ou adaptative, la phagocytose est impliquée dans l’élimination des pathogènes. En effet, elle constitue la première ligne de défense face à une infection. Cependant, elle joue également un rôle important dans le maintien de l’homéostasie des tissus ainsi que dans le remodelage et la réparation de ces derniers. Although phagocytosis has been observed experimentally in several cell types, it is generally strongly associated with certain categories of leukocytes, such as macrophages, dendritic cells or neutrophils. Its action is essential in the immune response. Whether innate or adaptive, phagocytosis is involved in the elimination of pathogens. Indeed, it constitutes the first line of defense against an infection. However, it also plays an important role in maintaining tissue homeostasis as well as tissue remodeling and repair.
La rate est un organe mou du système lymphatique. Il joue un rôle déterminant dans l’immunité et le processus de renouvellement cellulaire du sang. La rate est composée de deux principaux types de tissu, chacun ayant une fonction différente : la pulpe blanche et la pulpe rouge. The spleen is a soft organ of the lymphatic system. It plays a key role in immunity and the cell renewal process in the blood. The spleen is made up of two main types of tissue, each with a different function: white pulp and red pulp.
La pulpe blanche est une composante du système de défense contre les infections (système immunitaire). Elle contient des globules blancs appelés lymphocytes, qui à leur tour produisent des anticorps (protéines spécialisées qui luttent contre l’envahissement par une substance étrangère). The white pulp is a component of the infection defense system (immune system). It contains white blood cells called lymphocytes, which in turn produce antibodies (specialized proteins that fight against invasion by a foreign substance).
La pulpe rouge filtre le sang et élimine les éléments indésirables. Elle contient d’autres globules blancs, les macrophages, qui ingèrent les micro-organismes, comme les bactéries, les champignons et les virus. De plus, elle contrôle également les globules rouges, en détruisant ceux qui sont anormaux, trop vieux ou ceux qui ne fonctionnent plus correctement. Enfin, elle sert de réservoir pour différents éléments sanguins : essentiellement les globules blancs et les plaquettes (particules pseudo-cellulaires impliquées dans la coagulation). L’élimination de ces éléments n’est cependant qu’une fonction mineure de la pulpe rouge. The red pulp filters the blood and removes unwanted elements. It contains other white blood cells, macrophages, which ingest microorganisms, such as bacteria, fungi and viruses. In addition, it also controls blood cells red, destroying those that are abnormal, too old or those that no longer function properly. Finally, it serves as a reservoir for various blood elements: primarily white blood cells and platelets (pseudo-cellular particles involved in coagulation). The removal of these elements, however, is only a minor function of the red pulp.
Les macrophages résidant de la pulpe rouge de la rate jouent également un rôle majeur dans la clairance des cellules sanguines opsonisées par des immunoglobulines G (IgG), comme dans le purpura thrombopénique immunologique (PTI) ou dans l’anémie hémolytique autoimmune (AHAI). Les cellules sanguines sont phagocytées via les récepteurs Fc gamma (FcyRs). Macrophages residing in the red pulp of the spleen also play a major role in the clearance of blood cells opsonized by immunoglobulin G (IgG), such as in immunologic thrombocytopenic purpura (ITP) or in autoimmune hemolytic anemia (AHAI). Blood cells are phagocytosed via Fc gamma receptors (FcyRs).
Ces macrophages spléniques sont distincts chez l’homme des monocytes spléniques et des macrophages circulants dérivés de monocytes en termes d’expression des FcyRs et d’autres marqueurs de surface. En effet, les macrophages humains de la pulpe rouge expriment de manière prédominante les récepteurs de faibles affinité CD32a (ou FcRylla) et CD16a (ou FcyRIIIa). Ils n’expriment pas le CD32b (ou FcyRIIb) et expriment très faiblement le récepteur de haute affinité CD64 (FcyRI). These splenic macrophages are distinct in humans from splenic monocytes and circulating monocyte-derived macrophages in terms of expression of FcyRs and other surface markers. Indeed, the human macrophages of the red pulp predominantly express the low affinity receptors CD32a (or FcRylla) and CD16a (or FcyRIIIa). They do not express CD32b (or FcyRIIb) and very weakly express the high affinity CD64 receptor (FcyRI).
Le processus de phagocytose tel que définit aujourd’hui est caractérisé par trois étapes principales ; The phagocytosis process as defined today is characterized by three main stages;
- la phase d’adhésion qui s’effectue grâce à des récepteurs des micro-organismes étrangers ou de cellules sénescentes présents à la surface du macrophage, ou par l’intermédiaire des récepteurs aux opsonines, - the adhesion phase which takes place through receptors of foreign microorganisms or senescent cells present on the surface of the macrophage, or through opsonin receptors,
- la phase d’internalisation ou ingestion qui aboutit à la formation du phagosome et- the internalization or ingestion phase which results in the formation of the phagosome and
- la phase de dégradation par divers enzymes qui s’accumulent dans le phagosome suite à sa fusion avec les lysosomes. - the phase of degradation by various enzymes that accumulate in the phagosome following its fusion with the lysosomes.
C’est la reconnaissance de la particule qui permet d’enclencher la cascade de signaux qui aboutissent à la polymérisation de l’actine, la production de divers produits toxiques et la synthèse de cytokines et de chimiokines anti-inflammatoires. It is the recognition of the particle that sets in motion the cascade of signals that lead to the polymerization of actin, the production of various toxic products and the synthesis of anti-inflammatory cytokines and chemokines.
La phagocytose est également impliquée dans de nombreuses pathologies, et notamment dans la thrombocytopénie immunitaire associée au purpura (ITP) et dans l’anémie hémolytique autoimmune (AHAI) ; deux maladies autoimmunes pour lesquelles l’efficacité des concentrés d’immunoglobulines G comme traitement d’immunothérapie a été démontré lors d’essais cliniques. La phagocytose peut également représenter le mécanisme d’action de certains médicaments, tels que l’anti-D et les immunoglobulines G, dans le cas de déficiences immunes (remplacement des anticorps antibactériens ou antiviraux). Phagocytosis is also involved in numerous pathologies, and in particular in immune thrombocytopenia associated with purpura (ITP) and in autoimmune hemolytic anemia (AHAI); two autoimmune diseases for which the efficacy of immunoglobulin G concentrates as an immunotherapy treatment has been demonstrated in clinical trials. Phagocytosis may also represent the mechanism of action of certain drugs, such as anti-D and immunoglobulins G, in the case of immune deficiencies (replacement of antibacterial or antiviral antibodies).
Actuellement, il n'existe pas de modèle cellulaire stable et établi de phagocytose médiée par les récepteurs Fcy notamment par le CD16 (FcyRIII), en particulier par le CD16a, permettant d’obtenir un résultat fiable et reproductible. C’est pourquoi, les inventeurs ont mis au point une nouvelle lignée cellulaire de monocytes destinée à être utilisée comme modèle cellulaire de phagocytose, notamment pour la phagocytose de complexes anticorps/entité cible, par exemple anti-D/hématies, anticorps/ plaquettes et immunoglobulines G/bactéries. Currently, there is no stable and established cell model of phagocytosis mediated by Fcy receptors, in particular by CD16 (FcyRIII), in particular by CD16a, making it possible to obtain a reliable and reproducible result. This is why the inventors have developed a new monocyte cell line intended to be used as a cell model of phagocytosis, in particular for the phagocytosis of antibody / target entity complexes, for example anti-D / red blood cells, antibody / platelets and immunoglobulins G / bacteria.
Ainsi, la présente invention porte sur une lignée cellulaire de monocytes humains exprimant de manière stable et fonctionnelle les récepteurs Fc gamma (FcyR) CD16a, CD32 et CD64 humains à leur surface. Thus, the present invention relates to a human monocyte cell line which stably and functionally expresses the human CD16a, CD32 and CD64 Fc gamma receptors (FcyR) on their surface.
Par «lignée cellulaire», on entend, au sens de la présente invention, un ensemble de cellules provenant d'une même cellule mère et possédant les mêmes caractéristiques génétiques que cette cellule mère. Une lignée cellulaire se caractérise en outre par sa capacité à se multiplier dans un milieu de culture de façon stable in vitro pendant un grand nombre de générations. For the purposes of the present invention, the term “cell line” is intended to mean a set of cells originating from the same mother cell and having the same genetic characteristics as this mother cell. A cell line is further characterized by its ability to multiply in a culture medium stably in vitro over a large number of generations.
Par « exprimant de manière stable», on entend au sens de la présente invention, que la lignée cellulaire de monocytes humains selon l’invention est capable d’exprimer les récepteurs Fc gamma (FcyR) CD16a, CD32 et CD64 humains à leur surface après un nombre important de passages en culture cellulaire, en particulier après au moins 20 passages, avantageusement au moins 25 passage, avantageusement au moins 30 passages. Par « exprimant de manière stable», on entend également au sens de la présente invention, que la lignée cellulaire de monocytes humains selon l’invention est capable d’exprimer les récepteurs Fc gamma (FcyR) CD16a, CD32 et CD64 humains à leur surface sans évolution notable du niveau d’expression au cours du temps. For the purposes of the present invention, the term “stably expressing” means that the human monocyte cell line according to the invention is capable of expressing the human Fc gamma (FcyR) CD16a, CD32 and CD64 receptors on their surface after a large number of passages in cell culture, in particular after at least 20 passages, advantageously at least 25 passages, advantageously at least 30 passages. For the purposes of the present invention, the term “stably expressing” also means that the human monocyte cell line according to the invention is capable of expressing human Fc gamma (FcyR) CD16a, CD32 and CD64 receptors on their surface. without noticeable change in expression level over time.
Par « exprimant de manière fonctionnelle », on entend, au sens de la présente invention, la capacité des récepteurs Fc gamma (FcyR) humains ainsi exprimés comme étant capables de fixer la région Fc, portion constante, des immunoglobulines, afin d’induire la phagocytose. Par « exprimant de manière fonctionnelle», on entend également au sens de la présente invention, que la lignée cellulaire de monocytes humains selon l’invention est capable d’exprimer suffisamment de récepteurs Fc gamma (FcyR) CD16a, CD32 et CD64 humains, afin d’obtenir une activité de phagocytose médiée par l’un ou la combinaison des récepteurs Fc gamma (FcyR) CD16a, CD32 et CD64, lors des tests fonctionnels en bloquant les autres récepteurs. By “functionally expressing” is meant, within the meaning of the present invention, the capacity of the human Fc gamma receptors (FcyR) thus expressed as being capable of binding the Fc region, constant portion, of the immunoglobulins, in order to induce the phagocytosis. For the purposes of the present invention, the term “functionally expressing” also means that the human monocyte cell line according to the invention is capable of expressing sufficient human CD16a, CD32 and CD64 Fc gamma (FcR) receptors, in order to to obtain phagocytosis activity mediated by one or more combination of Fc gamma receptors (FcyR) CD16a, CD32 and CD64, during functional tests by blocking other receptors.
La lignée cellulaire de monocytes humains selon l’invention exprime de manière stable et fonctionnelle les récepteurs Fc gamma (FcyR) CD16a, CD32 et CD64 humains. The human monocyte cell line according to the invention stably and functionally expresses the human CD16a, CD32 and CD64 Fc gamma receptors (FcyR).
Avantageusement, la lignée cellulaire de monocytes humains selon l’invention est choisie parmi le groupe comprenant une lignée dérivée d’un lymphome histiocytaire, une lignée dérivée du sang périphérique d’un patient atteint d’une leucémie aigüe monocytaire, une lignée dérivée d’un épanchement pleural d’un patient atteint d’une leucémie myéloïde chronique en crise blastique, une lignée dérivée du sang périphérique d’un patient atteint d’une leucémie myéloïde aigüe, une lignée dérivée du sang périphérique d’un patient atteint d’une leucémie lymphoblastique aigüe et une lignée dérivée du sang périphérique d’un patient atteint d’une leucémie aigüe myélo-monocytaire. Advantageously, the human monocyte cell line according to the invention is chosen from the group comprising a line derived from a histiocytic lymphoma, a line derived from the peripheral blood of a patient suffering from acute monocytic leukemia, a line derived from a pleural effusion from a patient with chronic myeloid leukemia in blast crisis, a line derived from the peripheral blood of a patient with acute myeloid leukemia, a line derived from the peripheral blood of a patient with a patient with acute lymphoblastic leukemia and a line derived from the peripheral blood of a patient with acute myelo-monocytic leukemia.
Dans un mode de réalisation particulièrement avantageux, la lignée cellulaire de monocytes humains est dérivée du sang périphérique d’un patient atteint d’une leucémie aigüe myélo-monocytaire. Avantageusement, la lignée cellulaire de monocytes humains est dérivée du sang périphérique d’un patient masculin âgé d’un an atteint d’une leucémie aigüe myélo-monocytaire. Dans un mode de réalisation particulièrement avantageux, la lignée cellulaire de monocytes humains est dérivée de la lignée de cellules THP1. Avantageusement, la lignée cellulaire de monocytes humains est dérivée de la lignée de cellules THP1 , déposée auprès de l’ECACC sous le numéro 88081201 . In a particularly advantageous embodiment, the human monocyte cell line is derived from the peripheral blood of a patient with acute myelo-monocytic leukemia. Advantageously, the human monocyte cell line is derived from the peripheral blood of a one-year-old male patient suffering from acute myelo-monocytic leukemia. In a particularly advantageous embodiment, the human monocyte cell line is derived from the THP1 cell line. Advantageously, the human monocyte cell line is derived from the THP1 cell line, deposited with the ECACC under the number 88081201.
Dans un autre mode de réalisation, la lignée cellulaire de monocytes humains est dérivée d’un lymphome histiocytaire. Avantageusement, la lignée cellulaire de monocytes humains est dérivée d’un lymphome histiocytaire d’un patient masculin âgé de 37 ans. Dans un mode de réalisation particulièrement avantageux, la lignée cellulaire de monocytes humains est dérivée de la lignée de cellules U-937. Avantageusement, la lignée cellulaire de monocytes humains peut être dérivée de la lignée de cellules U-937, déposée auprès de l’ATCC sous le numéro CLR-1593.2™. In another embodiment, the human monocyte cell line is derived from histiocytic lymphoma. Advantageously, the human monocyte cell line is derived from a histiocytic lymphoma of a 37-year-old male patient. In a particularly advantageous embodiment, the human monocyte cell line is derived from the U-937 cell line. Advantageously, the human monocyte cell line can be derived from the U-937 cell line, deposited with the ATCC under the number CLR-1593.2 ™.
Dans un autre mode de réalisation, la lignée cellulaire de monocytes humains est dérivée du sang périphérique d’un patient atteint d’une leucémie aigüe monocytaire. Avantageusement, la lignée cellulaire de monocytes humains est dérivée du sang périphérique d’un patient masculin âgé de 64 ans atteint de leucémie aigüe monocytaire. Dans un mode de réalisation particulièrement avantageux, la lignée cellulaire de monocytes humains est dérivée de la lignée de cellules Mono-Mac-6. Avantageusement, la lignée cellulaire de monocytes humains est dérivée de la lignée de cellules Mono-Mac- 6, déposée auprès de la DSMZ sous le numéro ACC124. In another embodiment, the human monocyte cell line is derived from the peripheral blood of a patient with acute monocytic leukemia. Advantageously, the human monocyte cell line is derived from the peripheral blood of a 64-year-old male patient suffering from acute monocytic leukemia. In a particularly advantageous embodiment, the human monocyte cell line is derived from the Mono-Mac-6 cell line. Advantageously, the human monocyte cell line is derived from the Mono-Mac-6 cell line, deposited with the DSMZ under the number ACC124.
Dans un autre mode de réalisation, la lignée cellulaire de monocytes humains est dérivée d’un épanchement pleural d’un patient atteint d’une leucémie myéloïde chronique en crise blastique. Avantageusement, la lignée cellulaire de monocytes humains est dérivée d’un épanchement pleural d’un patient féminin âgé de 53 ans atteint d’une leucémie myéloïde chronique en crise blastique. Dans un mode de réalisation particulièrement avantageux, la lignée cellulaire de monocytes humains est dérivée de la lignée de cellules K-562. Avantageusement, la lignée cellulaire de monocytes humains est dérivée de la lignée de cellules K-562, déposée auprès de l’ATCC sous le numéro CLR-243™. Avantageusement, la lignée cellulaire de monocytes humains est dérivée de la lignée de cellules K-562, déposée auprès de la DSMZ sous le numéro ACC10. In another embodiment, the human monocyte cell line is derived from a pleural effusion from a patient with chronic myeloid leukemia in blast crisis. Advantageously, the human monocyte cell line is derived from a pleural effusion from a 53-year-old female patient with chronic myeloid leukemia in blast crisis. In a particularly advantageous embodiment, the human monocyte cell line is derived from the K-562 cell line. Advantageously, the human monocyte cell line is derived from the K-562 cell line, deposited with the ATCC under the number CLR-243 ™. Advantageously, the human monocyte cell line is derived from the K-562 cell line, deposited with the DSMZ under the number ACC10.
Dans un autre mode de réalisation particulièrement avantageux, la lignée cellulaire de monocytes humains est dérivée du sang périphérique d’un patient atteint d’une leucémie myéloïde aigüe. Avantageusement, la lignée cellulaire de monocytes humains est dérivée du sang périphérique d’un patient féminin âgé de 35 ans atteint d’une leucémie myéloïde aigüe. Dans un mode de réalisation particulièrement avantageux, la lignée cellulaire de monocytes humains est dérivée de la lignée de cellules HL-60. Avantageusement, la lignée cellulaire de monocytes humains est dérivée de la lignée de cellules HL-60, déposée auprès de la DSMZ sous le numéro ACC3. In another particularly advantageous embodiment, the human monocyte cell line is derived from the peripheral blood of a patient with acute myeloid leukemia. Advantageously, the human monocyte cell line is derived from the peripheral blood of a 35-year-old female patient suffering from acute myeloid leukemia. In a particularly advantageous embodiment, the human monocyte cell line is derived from the HL-60 cell line. Advantageously, the human monocyte cell line is derived from the HL-60 cell line, deposited with the DSMZ under the number ACC3.
Dans un autre mode de réalisation, la lignée cellulaire de monocytes humains est dérivée du sang périphérique d’un patient atteint d’une leucémie lymphoblastique aigüe. Avantageusement, la lignée cellulaire de monocytes humains est dérivée du sang périphérique d’un patient masculin âgé de 19 ans atteint de leucémie lymphoblastique aigüe. Dans un mode de réalisation particulièrement avantageux, la lignée cellulaire de monocytes humains est dérivée de la lignée de cellules Molt-4. Avantageusement, la lignée cellulaire de monocytes humains est dérivée de la lignée de cellules Molt-4, déposée auprès de la DSMZ sous le numéro ACC362. In another embodiment, the human monocyte cell line is derived from the peripheral blood of a patient with acute lymphoblastic leukemia. Advantageously, the human monocyte cell line is derived from the peripheral blood of a 19-year-old male patient with acute lymphoblastic leukemia. In a particularly advantageous embodiment, the human monocyte cell line is derived from the Molt-4 cell line. Advantageously, the human monocyte cell line is derived from the Molt-4 cell line, deposited with the DSMZ under the number ACC362.
Dans un autre mode de réalisation, la lignée cellulaire de monocytes humains est dérivée du sang périphérique d’un patient atteint d’une leucémie lymphoblastique aigüe. Avantageusement, la lignée cellulaire de monocytes humains est dérivée du sang périphérique d’un patient masculin âgé de 14 ans atteint de leucémie lymphoblastique aigüe. Dans un mode de réalisation particulièrement avantageux, la lignée cellulaire de monocytes humains est dérivée de la lignée de cellules Jurkat. Avantageusement, la lignée cellulaire de monocytes humains est dérivée de la lignée de cellules Jurkat, déposée auprès de la DSMZ sous le numéro ACC282. In another embodiment, the human monocyte cell line is derived from the peripheral blood of a patient with acute lymphoblastic leukemia. Advantageously, the human monocyte cell line is derived from the peripheral blood of a 14-year-old male patient suffering from acute lymphoblastic leukemia. In a particularly advantageous embodiment, the human monocyte cell line is derived from the Jurkat cell line. Advantageously, the The human monocyte cell line is derived from the Jurkat cell line, deposited with the DSMZ under the number ACC282.
Dans un mode de réalisation particulièrement avantageux de l’invention, la lignée cellulaire de monocytes humains est dérivée d’une lignée de cellules choisies parmi les cellules U-937, les cellules Mono-Mac-6, les cellules K-562, les cellules HL-60, les cellules Jurkat et les cellules THP1. In a particularly advantageous embodiment of the invention, the human monocyte cell line is derived from a line of cells chosen from U-937 cells, Mono-Mac-6 cells, K-562 cells, HL-60, Jurkat cells and THP1 cells.
Dans un mode de réalisation encore plus avantageux de l’invention, la lignée cellulaire de monocytes humains est dérivée de la lignée de cellules THP1. Dans un mode de réalisation particulier, lorsque la lignée cellulaire de monocytes humains est dérivée de la lignée de cellules THP1 , l’expression des récepteurs CD32 et CD64 est endogène à la lignée avant transfection. In an even more advantageous embodiment of the invention, the human monocyte cell line is derived from the THP1 cell line. In a particular embodiment, when the human monocyte cell line is derived from the THP1 cell line, the expression of CD32 and CD64 receptors is endogenous to the line before transfection.
Dans un mode de réalisation encore plus avantageux de l’invention, la lignée cellulaire de monocytes humains est dérivée de la lignée de cellules U-937. Dans un mode de réalisation particulier, lorsque la lignée cellulaire de monocytes humains est dérivée de la lignée de cellules U-937, l’expression des récepteurs CD32 et CD64 est endogène à la lignée avant transfection. In an even more advantageous embodiment of the invention, the human monocyte cell line is derived from the U-937 cell line. In a particular embodiment, when the human monocyte cell line is derived from the U-937 cell line, the expression of CD32 and CD64 receptors is endogenous to the line before transfection.
Dans un mode de réalisation encore plus avantageux de l’invention, la lignée cellulaire de monocytes humains est dérivée de la lignée de cellules Mono-Mac-6. Dans un mode de réalisation particulier, lorsque la lignée cellulaire de monocytes humains est dérivée de la lignée de cellules Mono-Mac-6, l’expression des récepteurs CD32 et CD64 est endogène à la lignée avant transfection. In an even more advantageous embodiment of the invention, the human monocyte cell line is derived from the Mono-Mac-6 cell line. In a particular embodiment, when the human monocyte cell line is derived from the Mono-Mac-6 cell line, the expression of CD32 and CD64 receptors is endogenous to the line prior to transfection.
Dans un mode de réalisation encore plus avantageux de l’invention, la lignée cellulaire de monocytes humains est dérivée de la lignée de cellules K-562. Dans un mode de réalisation particulier, lorsque la lignée cellulaire de monocytes humains est dérivée de la lignée de cellules K-562, l’expression des récepteurs CD32 et CD64 est endogène à la lignée avant transfection. In an even more advantageous embodiment of the invention, the human monocyte cell line is derived from the K-562 cell line. In a particular embodiment, when the human monocyte cell line is derived from the K-562 cell line, the expression of CD32 and CD64 receptors is endogenous to the line before transfection.
Dans un mode de réalisation encore plus avantageux de l’invention, la lignée cellulaire de monocytes humains est dérivée de la lignée de cellules HL-60. Dans un mode de réalisation particulier, lorsque la lignée cellulaire de monocytes humains est dérivée de la lignée de cellules HL-60, l’expression des récepteurs CD32 et CD64 est endogène à la lignée avant transfection. In an even more advantageous embodiment of the invention, the human monocyte cell line is derived from the HL-60 cell line. In a particular embodiment, when the human monocyte cell line is derived from the HL-60 cell line, the expression of CD32 and CD64 receptors is endogenous to the line before transfection.
Dans un mode de réalisation encore plus avantageux de l’invention, la lignée cellulaire de monocytes humains est dérivée de la lignée de cellules Jurkat. Dans un mode de réalisation particulier, lorsque la lignée cellulaire de monocytes humains est dérivée de la lignée de cellules Jurkat, l’expression des récepteurs CD32 et CD64 est endogène à la lignée avant transfection. In an even more advantageous embodiment of the invention, the human monocyte cell line is derived from the Jurkat cell line. In a mode of In particular, when the human monocyte cell line is derived from the Jurkat cell line, the expression of the CD32 and CD64 receptors is endogenous to the line before transfection.
Dans un mode de réalisation particulier, la lignée cellulaire de monocytes humains selon l’invention est capable d’exprimer de manière stable et fonctionnelle les récepteurs Fc gamma (FcyR) CD16a, CD32 et CD64 humains après au moins 30 passages de culture cellulaire. Avantageusement, la lignée cellulaire de monocytes humains selon l’invention exprime de manière stable et fonctionnelle au moins 50 000 récepteurs CD16a, avantageusement au moins 60 000 récepteurs CD16a, avantageusement au moins 70 000 récepteurs CD16a, avantageusement au moins 80 000 récepteurs CD16a, avantageusement au moins 90 000 récepteurs CD16a, avantageusement au moins 95 000 récepteurs CD16a, avantageusement au moins 96 000 récepteurs CD16a, avantageusement au moins 97 000 récepteurs CD16a, avantageusement au moins 98 000 récepteurs CD16a, avantageusement au moins 99 000 récepteurs CD16a, avantageusement au moins 100 000 récepteurs CD16a, avantageusement au moins 105000 récepteurs CD16a après au moins 30 passages de culture cellulaire. Avantageusement, la lignée cellulaire de monocytes humains selon l’invention exprime de manière stable et fonctionnelle au moins 5 000 récepteurs CD32, avantageusement au moins 6000 récepteurs CD32, avantageusement au moins 7 000 récepteurs CD32, avantageusement au moins 8 000 récepteurs CD32, avantageusement au moins 9 000 récepteurs CD32, avantageusement au moins 10 000 récepteurs CD32, avantageusement au moins 11 000 récepteurs CD32, avantageusement au moins 12 000 récepteurs CD32, avantageusement au moins 13 000 récepteurs CD32, avantageusement au moins 14 000 récepteurs CD32, avantageusement au moins 14 000 récepteurs CD32, avantageusement au moins 16 000 récepteurs CD32, avantageusement au moins 17 000 récepteurs CD32 après au moins 30 passages de culture cellulaire. Avantageusement, la lignée cellulaire de monocytes humains selon l’invention exprime de manière stable et fonctionnelle au moins 20 000 récepteurs CD64, avantageusement au moins 21 000 récepteurs CD64, avantageusement au moins 22 000 récepteurs CD64, avantageusement au moins 23 000 récepteurs CD64, avantageusement au moins 24 000 récepteurs CD64, avantageusement au moins 25 000 récepteurs CD64, avantageusement au moins 26 000 récepteurs CD64, avantageusement au moins 27 000 récepteurs CD64, avantageusement au moins 28 000 récepteurs CD64, avantageusement au moins 29 000 récepteurs CD64, avantageusement au moins 30 000 récepteurs CD64, avantageusement au moins 31 000 récepteurs CD64, avantageusement au moins 32 000 récepteurs CD64 après au moins 30 passages de culture cellulaire. In a particular embodiment, the human monocyte cell line according to the invention is capable of stably and functionally expressing the human CD16a, CD32 and CD64 gamma Fc (FcR) receptors after at least 30 passages of cell culture. Advantageously, the human monocyte cell line according to the invention stably and functionally expresses at least 50,000 CD16a receptors, advantageously at least 60,000 CD16a receptors, advantageously at least 70,000 CD16a receptors, advantageously at least 80,000 CD16a receptors, advantageously at least 90,000 CD16a receptors, advantageously at least 95,000 CD16a receptors, advantageously at least 96,000 CD16a receptors, advantageously at least 97,000 CD16a receptors, advantageously at least 98,000 CD16a receptors, advantageously at least 99,000 CD16a receptors, advantageously at least 100,000 CD16a receptors, advantageously at least 105,000 CD16a receptors after at least 30 passages of cell culture. Advantageously, the human monocyte cell line according to the invention stably and functionally expresses at least 5,000 CD32 receptors, advantageously at least 6,000 CD32 receptors, advantageously at least 7,000 CD32 receptors, advantageously at least 8,000 CD32 receptors, advantageously at least 8,000 CD32 receptors. less 9,000 CD32 receptors, advantageously at least 10,000 CD32 receptors, advantageously at least 11,000 CD32 receptors, advantageously at least 12,000 CD32 receptors, advantageously at least 13,000 CD32 receptors, advantageously at least 14,000 CD32 receptors, advantageously at least 14 000 CD32 receptors, advantageously at least 16,000 CD32 receptors, advantageously at least 17,000 CD32 receptors after at least 30 passages of cell culture. Advantageously, the human monocyte cell line according to the invention stably and functionally expresses at least 20,000 CD64 receptors, advantageously at least 21,000 CD64 receptors, advantageously at least 22,000 CD64 receptors, advantageously at least 23,000 CD64 receptors, advantageously at least 24,000 CD64 receptors, advantageously at least 25,000 CD64 receptors, advantageously at least 26,000 CD64 receptors, advantageously at least 27,000 CD64 receptors, advantageously at least 28,000 CD64 receptors, advantageously at least 29,000 CD64 receptors, advantageously at least 30,000 CD64 receivers, preferably at least 31,000 CD64 receptors, preferably at least 32,000 CD64 receptors after at least 30 passages of cell culture.
Dans un mode de réalisation particulier, la lignée cellulaire de monocytes humains selon l’invention est capable d’exprimer de manière stable et fonctionnelle entre 50 000 et 105000 récepteurs CD16a, entre 5 000 et 17 000 récepteurs CD32 et entre 20 000 et 32 000 récepteurs CD64 à sa surface après au moins 30 passages de culture cellulaire. Avantageusement, la lignée cellulaire de monocytes humains selon l’invention est capable d’exprimer de manière stable et fonctionnelle entre 60 000 et 105 000 récepteurs CD16a entre 6 000 et 17 000 récepteurs CD32 et entre 21 000 et 32 000 récepteurs CD64 à sa surface après au moins 30 passages de culture cellulaire. Avantageusement, la lignée cellulaire de monocytes humains selon l’invention est capable d’exprimer de manière stable et fonctionnelle entre 70 000 et 105 000 récepteurs CD16a, entre 7 000 et 17 000 récepteurs CD32 et entre 22 000 et 32 000 récepteurs CD64 à sa surface après au moins 30 passages de culture cellulaire. Avantageusement, la lignée cellulaire de monocytes humains selon l’invention est capable d’exprimer de manière stable et fonctionnelle entre 80 000 et 105000 récepteurs CD16a, entre 8 000 et 17 000 récepteurs CD32 et entre 22 000 et 32 000 récepteurs CD64 à sa surface après au moins 30 passages de culture cellulaire. Avantageusement, la lignée cellulaire de monocytes humains selon l’invention est capable d’exprimer de manière stable et fonctionnelle entre 90 000 et 105 000 récepteurs CD16a, entre 9 000 et 17000 récepteurs CD32 et entre 23 000 et 32 000 récepteurs CD64 à sa surface après au moins 30 passages de culture cellulaire. Avantageusement, la lignée cellulaire de monocytes humains selon l’invention est capable d’exprimer de manière stable et fonctionnelle entre 95 000 et 105000 récepteurs CD16a, entre 10 000 et 17000 récepteurs CD32 et entre 24 000 et 32 000 récepteurs CD64 à sa surface après au moins 30 passages de culture cellulaire. Avantageusement, la lignée cellulaire de monocytes humains selon l’invention est capable d’exprimer de manière stable et fonctionnelle entre 96 000 et 105 000 récepteurs CD16a, entre 11 000 et 17 000 récepteurs CD32 et entre 25 000 et 32 000 récepteurs CD64 à sa surface après au moins 30 passages de culture cellulaire. Avantageusement, la lignée cellulaire de monocytes humains selon l’invention est capable d’exprimer de manière stable et fonctionnelle entre 97 000 et 105000 récepteurs CD16a, entre 12 000 et 17 000 récepteurs CD32 et entre 26 000 et 32 000 récepteurs CD64 à sa surface après au moins 30 passages de culture cellulaire. Avantageusement, la lignée cellulaire de monocytes humains selon l’invention est capable d’exprimer de manière stable et fonctionnelle entre 98 000 et 105 000 récepteurs CD16a, entre 13 000 et 17000 récepteurs CD32 et entre 27 000 et 32 000 récepteurs CD64 à sa surface après au moins 30 passages de culture cellulaire. Avantageusement, la lignée cellulaire de monocytes humains selon l’invention est capable d’exprimer de manière stable et fonctionnelle entre 99 000 et 105 000 récepteurs CD16a, entre 14 000 et 17 000 récepteurs CD32 et entre 27 000 et 32 000 récepteurs CD64 à sa surface après au moins 30 passages de culture cellulaire. Avantageusement, la lignée cellulaire de monocytes humains selon l’invention est capable d’exprimer de manière stable et fonctionnelle entre 100 000 et 105 000 récepteurs CD16a, entre 15 000 et 17 000 récepteurs CD32 et entre 30 000 et 32 000 récepteurs CD64 à sa surface après au moins 30 passages de culture cellulaire. In a particular embodiment, the human monocyte cell line according to the invention is capable of expressing in a stable and functional manner between 50,000 and 105,000 CD16a receptors, between 5,000 and 17,000 CD32 receptors and between 20,000 and 32,000. CD64 receptors on its surface after at least 30 passages of cell culture. Advantageously, the human monocyte cell line according to the invention is capable of expressing in a stable and functional manner between 60,000 and 105,000 CD16a receptors between 6,000 and 17,000 CD32 receptors and between 21,000 and 32,000 CD64 receptors on its surface. after at least 30 passages of cell culture. Advantageously, the human monocyte cell line according to the invention is capable of expressing in a stable and functional manner between 70,000 and 105,000 CD16a receptors, between 7,000 and 17,000 CD32 receptors and between 22,000 and 32,000 CD64 receptors at its. surface after at least 30 passages of cell culture. Advantageously, the human monocyte cell line according to the invention is capable of expressing in a stable and functional manner between 80,000 and 105,000 CD16a receptors, between 8,000 and 17,000 CD32 receptors and between 22,000 and 32,000 CD64 receptors on its surface. after at least 30 passages of cell culture. Advantageously, the human monocyte cell line according to the invention is capable of expressing in a stable and functional manner between 90,000 and 105,000 CD16a receptors, between 9,000 and 17,000 CD32 receptors and between 23,000 and 32,000 CD64 receptors on its surface. after at least 30 passages of cell culture. Advantageously, the human monocyte cell line according to the invention is capable of expressing in a stable and functional manner between 95,000 and 105,000 CD16a receptors, between 10,000 and 17,000 CD32 receptors and between 24,000 and 32,000 CD64 receptors on its surface afterwards. at least 30 passages of cell culture. Advantageously, the human monocyte cell line according to the invention is capable of stably and functionally expressing between 96,000 and 105,000 CD16a receptors, between 11,000 and 17,000 CD32 receptors and between 25,000 and 32,000 CD64 receptors at its. surface after at least 30 passages of cell culture. Advantageously, the human monocyte cell line according to the invention is capable of stably and functionally expressing between 97,000 and 105,000 CD16a receptors, between 12,000 and 17,000 CD32 receptors and between 26,000 and 32,000 CD64 receptors on its surface. after at least 30 passages of cell culture. Advantageously, the human monocyte cell line according to the invention is capable of expressing in a stable and functional manner between 98,000 and 105,000 CD16a receptors, between 13,000 and 17,000 CD32 receptors and between 27,000 and 32,000 CD64 receptors on its surface. after at least 30 passages of cell culture. Advantageously, the human monocyte cell line according to the invention is capable of stably and functionally expressing between 99,000 and 105,000 CD16a receptors, between 14,000 and 17,000 CD32 receptors and between 27,000 and 32,000 CD64 receptors at its. surface after at least 30 passages of cell culture. Advantageously, the human monocyte cell line according to the invention is capable of expressing in a stable and functional manner between 100,000 and 105,000 CD16a receptors, between 15,000 and 17,000 CD32 receptors and between 30,000 and 32,000 CD64 receptors at its. surface after at least 30 passages of cell culture.
Dans un mode de réalisation particulier, la lignée cellulaire de monocytes humains selon l’invention exprime de manière stable et fonctionnelle 102 000 récepteurs CD16a, 16000 récepteurs CD32 et 31 000 récepteurs CD64 à sa surface après au moins 30 passages de culture cellulaire. In a particular embodiment, the human monocyte cell line according to the invention stably and functionally expresses 102,000 CD16a receptors, 16,000 CD32 receptors and 31,000 CD64 receptors on its surface after at least 30 passages of cell culture.
Dans un mode de réalisation particulier de l’invention, la lignée cellulaire de monocytes humains selon l’invention a été obtenue par transduction rétrovirale avec un vecteur lentiviral comprenant au moins un acide nucléique de séquence SEQ ID No.1 ou un variant de l’acide nucléique de séquence SEQ ID No.1. In a particular embodiment of the invention, the human monocyte cell line according to the invention was obtained by retroviral transduction with a lentiviral vector comprising at least one nucleic acid of sequence SEQ ID No.1 or a variant of nucleic acid of sequence SEQ ID No.1.
Par « transfection » ou « transduction », on entend, au sens de la présente invention, un procédé par lequel des cellules incorporent un acide nucléique exogène et intègrent cet acide nucléique dans leur génome. Au sens de la présente invention, la transfection est une transfection stable, permettant à l’acide nucléique exogène d’être présent continuellement dans la cellule transfectée. Dans le cas d’une transfection stable, l’acide nucléique exogène est transmis à la descendance et le niveau d’expression de l’acide nucléique exogène est constant dans le temps. Avantageusement, le niveau d’expression de l’acide nucléique exogène est stable après un nombre important de passages en culture cellulaire, en particulier après au moins 20 passages, avantageusement au moins 25 passage, avantageusement au moins 30 passages. By “transfection” or “transduction” is meant, within the meaning of the present invention, a process by which cells incorporate an exogenous nucleic acid and integrate this nucleic acid into their genome. For the purposes of the present invention, transfection is a stable transfection, allowing exogenous nucleic acid to be present continuously in the transfected cell. In the case of stable transfection, the exogenous nucleic acid is transmitted to the progeny and the level of expression of the exogenous nucleic acid is constant over time. Advantageously, the level of expression of the exogenous nucleic acid is stable after a large number of passages in cell culture, in particular after at least 20 passages, advantageously at least 25 passages, advantageously at least 30 passages.
Au contraire, une transfection est dite transitoire, si l’acide nucléique exogène n’est présent que de manière transitoire dans la cellule. De ce cas, le niveau d’expression de l’acide nucléique exogène diminue progressivement dans le temps. On the contrary, a transfection is said to be transient, if the exogenous nucleic acid is present only transiently in the cell. In this case, the level of expression of the exogenous nucleic acid gradually decreases over time.
Par « acide nucléique », on entend, au sens de la présente invention, un oligomère ou un polymère, simple ou double brin, de bases nucléotidiques lues à partir de l'extrémité 5' vers l'extrémité 3'. Le terme «acide nucléique » peut se référer à une molécule d'ADN, d'ARN ou à une molécule hybride ARN/ADN, d'origine naturelle ou synthétique. Dans la notation nucléotidique utilisée dans la présente demande, sauf mention particulière, l'extrémité gauche d'une séquence nucléotidique simple brin est l'extrémité 5'. By “nucleic acid” is meant, within the meaning of the present invention, an oligomer or a polymer, single or double stranded, of nucleotide bases read from the 5 'end to the 3' end. The term "nucleic acid" can refer to a DNA or RNA molecule or to an RNA / DNA hybrid molecule, of natural or synthetic origin. In the nucleotide notation used in the present application, unless specifically mentioned, the left end of a single-stranded nucleotide sequence is the 5 'end.
Dans un mode de réalisation particulièrement avantageux, l’acide nucléique de SEQ ID No.1 code pour une protéine correspondant au domaine extracellulaire du récepteur Fc gamma CD16 (FCYRIII) humain, en particulier pour une protéine correspondant au domaine extracellulaire du récepteur Fc gamma CD16a (FCYRIII) humain. In a particularly advantageous embodiment, the nucleic acid of SEQ ID No.1 codes for a protein corresponding to the extracellular domain of the human CD16 Fc gamma receptor (FCYRIII), in particular for a protein corresponding to the extracellular domain of the Fc gamma CD16a receptor (FCYRIII) human.
Acide nucléique de SEQ ID No.1 : atg cg g actg aag atctcccaaag g ctg tg g tg ttcctg g ag cctcaatg g tacag g g tg ctcg ag aag g acag tg tg actct g aag tg ccag g g ag cctactcccctg ag g acaattccacacag tg g tttcacaatg ag ag cctcatctcaag ccag g cctc g ag ctacttcattg acg ctg ccacag tcg acg acag tg g ag ag tacag g tg ccag acaaacctctccaccctcag tg accc g g tg cag ctag aag tccatatcg g ctg g ctg ttg ctccag g cccctcg g tg g g tg ttcaag g ag g aag accctattcacctg a g g tg tcacag ctg g aag aacactg ctctg cataag g tcacatatttacag aatg g caaag g cag g aag tattttcatcataatt ctg acttctacattccaaaag ccacactcaaag acag cg gctcctacttctg cag g g g g ctttttg g g ag taaaaatg tg tcttc ag ag actg tg aacatcaccatcactcaag g tttg g cag tg tcaaccatctcatcattctttccacctg g g . Nucleic acid of SEQ ID No.1: atg cg g actg aag atctcccaaag g ctg tg g tg ttcctg g ag cctcaatg g tacag gg tg ctcg ag aag g acag tg tg actct g aag tg ccag gg ag cctactcccctg ag g acatg gccacttag ag cctcatctcaag ccag g cctc g ag ctacttcattg acg ctg ccacag tcg acg acag tg g ag ag tacag g tg ccag acaaacctctccaccctcag tg accc gg tg cag ctag aag tccatatcg g ctg g ctg acag tag gtc gtccatt tg tcacag ctg aag g aacactg ctctg cataag g tcacatatttacag AATG caaag g g g cag aag ctg tattttcatcataatt acttctacattccaaaag ccacactcaaag ACAG cg gctcctacttctg cag gg gggg ctttttg ag ag ag taaaaatg tg tcttc ACTG aacatcaccatcactcaag tg g tg tcaaccatctcatcattctttccacctg TTTG g cag gg.
Par " variant de l’acide nucléique de séquence SEQ ID No.1", on entend au sens de la présente invention, un acide nucléique qui diffère d'une ou plusieurs bases par rapport à l'acide nucléique de SEQ ID No.1. Un acide nucléique variant peut être d'origine naturel, tel qu'un variant allélique retrouvé naturellement, ou peut être aussi un variant non naturel obtenu par exemple par des techniques de mutagénèse. En général, les différences entre l'acide nucléique de référence et l'acide nucléique variant sont réduites de telle sorte que les séquences nucléotidiques de l'acide nucléique de référence et de l'acide nucléique variant sont très proches et, dans de nombreuses régions, identiques. Les modifications de nucléotides présentes dans un acide nucléique variant peuvent être silencieuses, ce qui signifie qu'elles n'altèrent pas les séquences d'acides aminés codées par ledit acide nucléique variant. By “variant of the nucleic acid of sequence SEQ ID No.1” is meant, within the meaning of the present invention, a nucleic acid which differs by one or more bases relative to the nucleic acid of SEQ ID No.1 . A variant nucleic acid may be of natural origin, such as an allelic variant found naturally, or may also be an unnatural variant obtained, for example, by mutagenesis techniques. In general, the differences between the reference nucleic acid and the variant nucleic acid are reduced such that the nucleotide sequences of the reference nucleic acid and the variant nucleic acid are very close and, in many regions , identical. The modifications of nucleotides present in a variant nucleic acid can be silent, which means that they do not alter the amino acid sequences encoded by said variant nucleic acid.
Cependant, les changements de nucléotides dans un acide nucléique variant peuvent aussi résulter dans des substitutions, additions, délétions dans le polypeptide codé par l'acide nucléique variant par rapport à la protéine codée par l'acide nucléique de SEQ ID No.1. En outre, des modifications de nucléotides dans les régions codantes peuvent produire des substitutions, conservatives ou non conservatives dans la séquence d'acides aminés. De préférence, les acides nucléiques variants de l’acide nucléique de séquence SEQ ID No.1 selon l'invention codent pour des protéines qui conservent sensiblement la même fonction ou activité biologique que les protéines codées par l'acide nucléique de référence ou encore la capacité à être reconnus par des anticorps dirigés contre les protéines codées par l'acide nucléique initial. Avantageusement, les acides nucléiques variants de l’acide nucléique de séquence SEQ ID No.1 selon l’invention conservent la même capacité de fixation du récepteur CD16 (FCYRIII) humain, ou présente une capacité de fixation du récepteur CD16 (FCYRIII) humain augmentée ou diminuée. Avantageusement, les acides nucléiques variants de l’acide nucléique de séquence SEQ ID No.1 selon l’invention conservent la même capacité de fixation du récepteur CD16a (FCYRIII) humain, ou présente une capacité de fixation du récepteur CD16a (FCYRIII) humain augmentée ou diminuée. However, changes of nucleotides in a variant nucleic acid can also result in substitutions, additions, deletions in the polypeptide encoded by the variant nucleic acid relative to the protein encoded by the nucleic acid of SEQ ID No.1. In addition, modifications of nucleotides in the coding regions can produce substitutions, conservative or non-conservative in the amino acid sequence. Preferably, the variant nucleic acids of the nucleic acid of sequence SEQ ID No. 1 according to the invention encode proteins which retain substantially the same function or biological activity as the proteins encoded by the reference nucleic acid or else the protein. ability to be recognized by antibodies directed against proteins encoded by the initial nucleic acid. Advantageously, the variant nucleic acids of the nucleic acid of sequence SEQ ID No.1 according to the invention retain the same binding capacity of the human CD16 (FCYRIII) receptor, or exhibit an increased binding capacity of the human CD16 (FCYRIII) receptor. or diminished. Advantageously, the variant nucleic acids of the nucleic acid of sequence SEQ ID No. 1 according to the invention retain the same binding capacity of the human CD16a (FCYRIII) receptor, or exhibit an increased binding capacity of the human CD16a (FCYRIII) receptor. or diminished.
À titre d’exemple de variant de l’acide nucléique de SEQ ID No.1 selon l’invention, on peut notamment citer l’acide nucléique de SEQ ID No.2. By way of example of a variant of the nucleic acid of SEQ ID No.1 according to the invention, mention may in particular be made of the nucleic acid of SEQ ID No.2.
Acide nucléique de SEQ ID No.2 : atg cg g actg aag atctcccaaag g ctg tg g tg ttcctg g ag cctcaatg g tacag g g tg ctcg ag aag g acag tg tg actct g aag tg ccag g g ag cctactcccctg ag g acaattccacacag tg g tttcacaatg ag ag cctcatctcaag ccag g cctc g ag ctacttcattg acg ctg ccacag tcg acg acag tg g ag ag tacag g tg ccag acaaacctctccaccctcag tg accc g g tg cag ctag aag tccatatcg g ctg g ctg ttg ctccag g cccctcg g tg g g tg ttcaag g ag g aag accctattcacctg a g g tg tcacag ctg g aag aacactg ctctg cataag g tcacatatttacag aatg g caaag g cag g aag tattttcatcataatt ctg acttctacattccaaaag ccacactcaaag acag cg gctcctacttctg cag g g g g cttg ttg g g ag taaaaatg tg tcttc ag ag actg tg aacatcaccatcactcaag g tttg g cag tg tcaaccatctcatcattctttccacctg g g . Nucleic acid of SEQ ID No.2: atg cg g actg aag atctcccaaag g ctg tg g tg ttcctg g ag cctcaatg g tacag gg tg ctcg ag aag g acag tg tg actct g aag tg ccag gg ag cctactcccctg ag g acatg gccacttag ag cctcatctcaag ccag g cctc g ag ctacttcattg acg ctg ccacag tcg acg acag tg g ag ag tacag g tg ccag acaaacctctccaccctcag tg accc gg tg cag ctag aag tccatatcg g ctg g ctg acag tag gtc gtccatt tg tcacag ctg aag g aacactg ctctg cataag g tcacatatttacag AATG caaag g g g cag aag ctg tattttcatcataatt acttctacattccaaaag ccacactcaaag ACAG cg gctcctacttctg cag gg gggg CTTG ttg ag ag ag taaaaatg tg tcttc ACTG aacatcaccatcactcaag tg g tg tcaaccatctcatcattctttccacctg TTTG g cag gg.
Dans un mode de réalisation particulier de l’invention, un variant de l’acide nucléique de séquence SEQ ID No.1 est l’acide nucléique de SEQ ID No.2. In a particular embodiment of the invention, a variant of the nucleic acid of sequence SEQ ID No.1 is the nucleic acid of SEQ ID No.2.
Avantageusement, l’acide nucléique de SEQ ID No.2 code pour une protéine correspondant au domaine extracellulaire du récepteur CD16a (FCYRIII) humain, dans lequel l’acide aminé en position 158 a été remplacé par la valine. Advantageously, the nucleic acid of SEQ ID No.2 encodes a protein corresponding to the extracellular domain of the human CD16a (FCYRIII) receptor, in which the amino acid at position 158 has been replaced by valine.
Par «vecteur», on entend, au sens de la présente invention, un véhicule de transit à base d'acides nucléiques, une molécule d'acide nucléique adaptée pour livrer de l'acide nucléique ou une molécule d'ADN capable de réplication autonome dans le monocyte, par exemple un plasmide, un cosmide, un phagemide, un génome (chromosome) viral, un génome (chromosome) phagique, et qui permet le clonage de molécules d'ADN. Dans un mode de réalisation particulièrement avantageux, le vecteur utilisé est un vecteur lentiviral. By “vector” is meant, within the meaning of the present invention, a nucleic acid-based transit vehicle, a nucleic acid molecule suitable for delivering nucleic acid or a DNA molecule capable of autonomous replication. in the monocyte, for example a plasmid, a cosmid, a phagemid, a viral genome (chromosome), a phage genome (chromosome), and which allows the cloning of DNA molecules. In a particularly advantageous embodiment, the vector used is a lentiviral vector.
Dans ce cas, la séquence d'acide nucléique utilisée est placée sous le contrôle de signaux permettant son expression dans la lignée cellulaire de monocytes humains. Le vecteur doit comporter un promoteur, des signaux d'initiation et de terminaison de la traduction, ainsi que des régions appropriées de régulation de la transcription. Il doit pouvoir être maintenu de façon stable dans le monocyte et peut éventuellement posséder des signaux particuliers spécifiant la sécrétion des protéines traduites. À cet effet, la séquence d'acide nucléique peut être insérée dans des vecteurs à réplication autonome au sein de la lignée cellulaire de monocytes humains, ou des vecteurs intégratifs de la lignée cellulaire de monocytes humains. In this case, the nucleic acid sequence used is placed under the control of signals allowing its expression in the human monocyte cell line. The vector must contain a promoter, initiation and termination signals of the translation, as well as appropriate transcriptional regulatory regions. It must be able to be maintained in a stable manner in the monocyte and may possibly have particular signals specifying the secretion of the translated proteins. For this purpose, the nucleic acid sequence can be inserted into autonomously replicating vectors within the human monocyte cell line, or integrative vectors of the human monocyte cell line.
De tels vecteurs seront préparés selon les méthodes couramment utilisées par l'homme du métier, et les clones en résultant peuvent être introduits dans la lignée cellulaire de monocytes humains par des méthodes standards telles par exemple la transfection par précipitation au phosphate de calcium, la lipofection, l'électroporation, le choc thermique.Such vectors will be prepared according to the methods commonly used by a person skilled in the art, and the resulting clones can be introduced into the human monocyte cell line by standard methods such as, for example, transfection by calcium phosphate precipitation, lipofection. , electroporation, thermal shock.
La transduction dans la lignée cellulaire de monocytes humains du vecteur peut être réalisée au moyen de quantité équimolaire par les procédures standard du type précipitation au phosphate de calcium ou par la lipofectine. Ensuite, les lignées transfectées sont sélectionnées dans les milieux de culture adéquats. Transduction into the human monocyte cell line of the vector can be accomplished in an equimolar amount by standard procedures such as calcium phosphate precipitation or lipofectin. Then, the transfected lines are selected in the appropriate culture media.
Dans un mode de réalisation particulier de l’invention, le vecteur lentiviral comprend en outre un acide nucléique de séquence SEQ ID No. 3. In a particular embodiment of the invention, the lentiviral vector further comprises a nucleic acid of sequence SEQ ID No. 3.
Acide nucléique de séquence SEQ ID No.3 : cctcag ctctgctatatcctg g atg ccatcctg tttctg tatg g aattg tcctcaccctcctctactg tcg actg aag g taatccaag t g cg aaag g cag ctataaccagctatg ag aaatcag atg g tg tttacacg g g cctg ag caccag g aaccag g ag acttacg ag actctg aagcatg ag aaaccaccacag . Nucleic acid of sequence SEQ ID No.3: cctcag ctctgctatatcctg g atg ccatcctg tttctg tatg g aattg tcctcaccctcctctactg tcg actg aag g taatccaag tg cg aaag g cag ctataaccagctatg agaccatcag actg agacg g tg agaccatcag agacatg g tg aaaccaccacag.
Avantageusement, l’acide nucléique de SEQ ID No.3 code pour une protéine correspondant aux domaines transmembranaire et intracellulaire de la chaîne gamma des récepteurs FcsRI humain. Advantageously, the nucleic acid of SEQ ID No.3 codes for a protein corresponding to the transmembrane and intracellular domains of the gamma chain of human FcsRI receptors.
Dans un mode de réalisation particulier, la lignée cellulaire de monocytes humains exprimant de manière stable et fonctionnelle les récepteurs Fc gamma (FcyR) CD16a, CD32 et CD64 humains à leur surface selon l’invention est obtenue par transduction rétrovirale avec un vecteur lentiviral comprenant au moins un acide nucléique de séquence SEQ ID No.1 ou un acide nucléique de séquence SEQ ID No.2 et un acide nucléique de séquence SEQ ID No.3. In a particular embodiment, the human monocyte cell line expressing in a stable and functional manner the human CD16a, CD32 and CD64 Fc gamma receptors (FcyR) at their surface according to the invention is obtained by retroviral transduction with a lentiviral vector comprising at least least a nucleic acid of sequence SEQ ID No.1 or a nucleic acid of sequence SEQ ID No.2 and a nucleic acid of sequence SEQ ID No.3.
Dans un mode de réalisation particulièrement avantageux de l’invention, la lignée cellulaire de monocytes humains selon l’invention a été obtenue par transduction rétrovirale avec un vecteur lentiviral comprenant au moins un acide nucléique codant pour une protéine correspondant au domaine extracellulaire du récepteur CD16a et au moins un acide nucléique codant pour une protéine correspondant aux domaines transmembranaire et intracellulaire de la chaîne gamma des récepteurs FcsRI humain.In a particularly advantageous embodiment of the invention, the human monocyte cell line according to the invention was obtained by retroviral transduction with a lentiviral vector comprising at least one nucleic acid encoding a protein corresponding to the extracellular domain of the CD16a receptor and at least a nucleic acid encoding a protein corresponding to the transmembrane and intracellular domains of the gamma chain of human FcsRI receptors.
Les inventeurs ont montré de manière surprenante que la co-transfection d’au moins un acide nucléique codant pour une protéine correspondant au domaine extracellulaire du récepteur CD16a et au moins un acide nucléique codant pour une protéine correspondant aux domaines transmembranaire et intracellulaire de la chaîne gamma des récepteurs FcsRI humain, permet d’obtenir une expression stable et fonctionnelle du récepteur CD16a. Plus particulièrement, les inventeurs ont montré que les domaines transmembranaire et intracellulaire de la chaîne gamma des récepteurs FcsRI humain permet l’ancrage dans la membrane du monocyte de la protéine chimérique comprenant le domaine extracellulaire du récepteur CD16a (FcyRIN) humain et les domaines transmembranaire et intracellulaire de la chaîne gamma des récepteurs FcsRI humain, permettant ainsi l’expression à la surface du monocyte du récepteur CD16a et la transduction des signaux de phagocytose. The inventors have surprisingly shown that the co-transfection of at least one nucleic acid encoding a protein corresponding to the extracellular domain of the CD16a receptor and at least one nucleic acid encoding a protein corresponding to the transmembrane and intracellular domains of the gamma chain human FcsRI receptors, makes it possible to obtain stable and functional expression of the CD16a receptor. More particularly, the inventors have shown that the transmembrane and intracellular domains of the gamma chain of human FcsRI receptors allow the anchoring in the monocyte membrane of the chimeric protein comprising the extracellular domain of the human CD16a receptor (FcyRIN) and the transmembrane domains and intracellular of the gamma chain of human FcsRI receptors, thus allowing the expression on the surface of the monocyte of the CD16a receptor and the transduction of phagocytosis signals.
Dans un autre mode de réalisation particulièrement avantageux de l’invention, le vecteur lentiviral comprend un acide nucléique de séquence SED IQ No.4 constitué de l’acide nucléique de séquence SEQ ID No.2 et de l’acide nucléique de séquence SEQ ID No. 3.In another particularly advantageous embodiment of the invention, the lentiviral vector comprises a nucleic acid of sequence SED IQ No.4 consisting of the nucleic acid of sequence SEQ ID No.2 and of the nucleic acid of sequence SEQ ID No. 3.
Acide nucléique de séquence SEQ ID No.4 : atg cg g actg aag atctcccaaag g ctg tg g tg ttcctg g ag cctcaatg g tacag g g tg ctcg ag aag g acag tg tg actct g aag tg ccag g g ag cctactcccctg ag g acaattccacacag tg g tttcacaatg ag ag cctcatctcaag ccag g cctc g ag ctacttcattg acg ctg ccacag tcg acg acag tg g ag ag tacag g tg ccag acaaacctctccaccctcag tg accc g g tg cag ctag aag tccatatcg g ctg g ctg ttg ctccag g cccctcg g tg g g tg ttcaag g ag g aag accctattcacctg a g g tg tcacag ctg g aag aacactg ctctg cataag g tcacatatttacag aatg g caaag g cag g aag tattttcatcataatt ctg acttctacattccaaaag ccacactcaaag acag cg gctcctacttctg cag g g g g cttg ttg g g ag taaaaatg tg tcttc ag ag actg tg aacatcaccatcactcaag g tttg g cag tg tcaaccatctcatcattctttccacctg g gcctcag ctctg ctata tcctg g atg ccatcctg tttctg tatg g aattg tcctcaccctcctctactg tcg actg aag g taatccaag tg cg aaag g cagct ataaccag ctatg ag aaatcag atg g tg tttacacg g g cctg ag caccag g aaccag g ag acttacg ag actctg aag cat gagaaaccaccacag Nucleic acid of sequence SEQ ID No.4: atg cg g actg aag atctcccaaag g ctg tg g tg ttcctg g ag cctcaatg g tacag gg tg ctcg ag aag g acag tg tg actct g aag tg ccag gg ag cctactcccctg ag gcat tag gccactt ag ag cctcatctcaag ccag g cctc g ag ctacttcattg acg ctg ccacag tcg acg acag tg g ag ag tacag g tg ccag acaaacctctccaccctcag tg accc gg tg cag ctag aag tccatatcg g ctg g ctccg tag gtc gctg ctatt agg tg tcacag ctg g aag aacactg ctctg cataag g tcacatatttacag AATG g caaag g cag g aag tattttcatcataatt ctg acttctacattccaaaag ccacactcaaag ACAG cg gctcctacttctg cag gggg CTTG ttg gg ag taaaaatg tg tcttc ag ag ACTG tg aacatcaccatcactcaag g TTTG g cag tg tcaaccatctcatcattctttccacctg g gcctcag ctctg ctata tcctg g atg ccatcctg tttctg tatg g aattg tcctcaccctcctctactg tcg actg aag g taatccaag tg cg aaag g cagct ataaccag ctatg ag aaatcag atg g tg tttacacg gg cctg ag caccag g aaccag g actaccg aag aag catg ag
Dans un autre mode de réalisation particulièrement avantageux de l’invention, le vecteur lentiviral comprend un acide nucléique de séquence SED IQ No.5 constitué de l’acide nucléique de séquence SEQ ID No.1 et de l’acide nucléique de séquence SEQ ID No. 3.In another particularly advantageous embodiment of the invention, the lentiviral vector comprises a nucleic acid of sequence SED IQ No.5 consisting of the nucleic acid of sequence SEQ ID No.1 and of the nucleic acid of sequence SEQ ID No. 3.
Acide nucléique de séquence SEQ ID No.5 : atg cg g actg aag atctcccaaag g ctg tg g tg ttcctg g ag cctcaatg g tacag g g tg ctcg ag aag g acag tg tg actct g aag tg ccag g g ag cctactcccctg ag g acaattccacacag tg g tttcacaatg ag ag cctcatctcaag ccag g cctc g ag ctacttcattg acg ctg ccacag tcg acg acag tg g ag ag tacag g tg ccag acaaacctctccaccctcag tg accc g g tg cag ctag aag tccatatcg g ctg g ctg ttg ctccag g cccctcg g tg g g tg ttcaag g ag g aag accctattcacctg a g g tg tcacag ctg g aag aacactg ctctg cataag g tcacatatttacag aatg g caaag g cag g aag tattttcatcataatt ctg acttctacattccaaaag ccacactcaaag acag cg gctcctacttctg cag g g g g ctttttg g g ag taaaaatg tg tcttc ag ag actg tg aacatcaccatcactcaag g tttg g cag tg tcaaccatctcatcattctttccacctg g gcctcag ctctgctata tcctg g atg ccatcctg tttctg tatg g aattg tcctcaccctcctctactg tcg actg aag g taatccaag tg cg aaag g cagct ataaccag ctatg ag aaatcag atg g tg tttacacg g g cctg ag caccag g aaccag g ag acttacg ag actctg aag cat gagaaaccaccacag Nucleic acid of sequence SEQ ID No.5: atg cg g actg aag atctcccaaag g ctg tg g tg ttcctg g ag cctcaatg g tacag gg tg ctcg ag aag g acag tg tg actct g aag tg ccag gg ag cctactcccctg ag g acaattccacacag tg g ag tacag gg tg ctcatt ag ctg ccacag tcg acg acag tg g ag ag tacag g tg ccag acaaacctctccaccctcag tg accc gg tg cag ctag aag tccatatcg g ctg g ctg ttg ctccag g cccctcg g tg gg tg ttcaag tg cg tg gg aag accatt tcacatatttacag AATG g caaag g cag g aag tattttcatcataatt ctg acttctacattccaaaag ccacactcaaag ACAG cg gctcctacttctg cag gggg ctttttg gg ag taaaaatg tg tcttc ag ag ACTG tg aacatcaccatcactcaag g TTTG g cag tg tcaaccatctcatcattctttccacctg g gcctcag ctctgctata tcctg g atg ccatcctg tttctg tatg g aattg tcctcaccctcctctactg tcg ACTG aag g taatccaag tg cg aaag g cagct ataaccag ctatg ag aaatcag atg g tg tttacacg gg cctg ag caccag g aaccag g ag acttacg ag actctg aag cat gagaaaccaccacag
Dans un mode de réalisation particulièrement avantageux de l’invention, la lignée cellulaire de monocytes humains selon l’invention a été obtenue par transduction rétrovirale avec un vecteur lentiviral comprenant :In a particularly advantageous embodiment of the invention, the human monocyte cell line according to the invention was obtained by retroviral transduction with a lentiviral vector comprising:
- un acide nucléique de séquence SED IQ No.4 constitué de l’acide nucléique de séquence SEQ ID No.2 et de l’acide nucléique de séquence SEQ ID No. 3, ou- a nucleic acid of sequence SED IQ No.4 consisting of nucleic acid of sequence SEQ ID No.2 and nucleic acid of sequence SEQ ID No. 3, or
- un acide nucléique de séquence SED IQ No.5 constitué de l’acide nucléique de séquence SEQ ID No.1 et de l’acide nucléique de séquence SEQ ID No. 3. - a nucleic acid of sequence SED IQ No.5 consisting of the nucleic acid of sequence SEQ ID No.1 and of the nucleic acid of sequence SEQ ID No. 3.
Dans un mode de réalisation particulier, les acides nucléiques de séquences SEQ ID No.4 et SEQ ID No.5 code respectivement pour une protéine chimérique comprenant le domaine extracellulaire du récepteur CD16a (FcyRI 11) humain et les domaines transmembranaire et intracellulaire de la chaîne gamma des récepteurs FcsRI humain.In a particular embodiment, the nucleic acids of sequences SEQ ID No.4 and SEQ ID No.5 code respectively for a chimeric protein comprising the extracellular domain of the human CD16a (FcyRI 11) receptor and the transmembrane and intracellular domains of the chain. gamma of human FcsRI receptors.
Avantageusement, l’acide nucléique de séquence SEQ ID No.4 code pour une protéine chimérique comprenant le domaine extracellulaire du récepteur CD16a (FcyRI 11) humain dans lequel l’acide aminé en position 158 a été remplacé par la valine et les domaines transmembranaire et intracellulaire de la chaîne gamma des récepteurs FcsRI humain.Advantageously, the nucleic acid of sequence SEQ ID No.4 codes for a chimeric protein comprising the extracellular domain of the human CD16a (FcyRI 11) receptor in which the amino acid at position 158 has been replaced by valine and the transmembrane domains and intracellular gamma chain of human FcsRI receptors.
Avantageusement, l’acide nucléique de séquence SEQ ID No.5 code pour une protéine chimérique comprenant le domaine extracellulaire du récepteur CD16a (FcyRI 11) humain dans lequel l’acide aminé en position 158 est la phénylalanine et les domaines transmembranaire et intracellulaire de la chaîne gamma des récepteurs FcsRI humain.Advantageously, the nucleic acid of sequence SEQ ID No.5 codes for a chimeric protein comprising the extracellular domain of the human CD16a (FcyRI 11) receptor in which the amino acid at position 158 is phenylalanine and the transmembrane and intracellular domains of the human. human FcsRI receptor gamma chain.
Dans un autre mode de réalisation particulier de l’invention, la lignée cellulaire de monocytes humains selon l’invention a été obtenue par transduction rétrovirale avec un vecteur lentiviral comprenant un acide nucléique de séquence SEQ ID No.6. Acide nucléique de séquence SEQ ID No.6 : atg tg g cag ctg ctg ctgccg accg cg ctg ctg ctgctg g tg ag cgcg g g catg cg caccg aag atctg ccg aaagcg g tg g tg tttctg g aaccg cag tg g tatcg cg tg ctg g aaaaag atag cg tg accctg aaatg ccag g g cg cg tatag cccg g aa g ataacag cacccag tg g tttcataacg aaag cctg attag cag ccag g cg agcag ctattttattg atg cg g cg accg tg g atg atag cg g cg aatatcg ctgccag accaacctg agcaccctg ag cg atccg g tg cag ctg g aag tg catattg gctg g et g ctg ctg cag g cg ccg egetg g g tg tttaaag aag aag atccg atteatetg cg ctg ccatag ctg g aaaaacaccg cg ctg cataaag tg acctatctgcag aaeg g caaag gccg caaatattttcatcataacag cg atttttatattccg aaag cg accctg aaag atag cg g cag ctatttttg ccgcg g cctg tttg g cag caaaaacg tg ag cag cg aaaccg tg aacattaccattaccc ag g g cctg g cg g tg ag caccattag cag cttttttccg ccg g g ctatcag g tg ag cttttg cctg g tg atg g tg ctg ctg tttg cg g tg g ataccg geetg tattttag cg tg aaaaccaacattcgcag cag cacccg cg attg g aaag atcataaatttaaatg g cg caaag atccg cag g ataaa In another particular embodiment of the invention, the human monocyte cell line according to the invention was obtained by retroviral transduction with a lentiviral vector comprising a nucleic acid of sequence SEQ ID No.6. Nucleic acid of sequence SEQ ID No.6: atg tg g cag ctg ctg ctgccg accg cg ctg ctg ctgctg g tg ag cgcg gg catg cg caccg aag atctg ccg aaagcg g tg g tg tttctg g aaccg cag tg tg tg ctg c atag cg tg accctg aaatg ccag gg cg cg tatag cccg g aa g ataacag cacccag tg g tttcataacg aaag cctg attag cag ccag g cg agcag ctattttattg atg cg g cg accg tg g atg atag cg g cg aatcc ag catag atg ctg ct ctg g aag tg catattg gctg g and g ctg ctg cag g cg ccg egetg gg tg tttaaag aag aag atccg atteatetg cg ctg ccatag ctg g aaaaacaccg cg ctg cataaag tg acctatctgcagcctat aac cattag cttg attg aacag cttag cttg attg aacag cttag cttg attg aacag cttag cttg attg aacag cttag cttg cttg aac cttag cttg atg ccgcg g cctg tttg g cag caaaaacg tg ag cag cg aaaccg tg aacattaccattaccc ag gg cctg g cg g tg ag caccattag cag cttttttccg ccg gg ctatcag g tg ag cttttg cctg g tg atg g tg tg t gttg ctg ct aaaaccaacattcgcag cag cacccg cg attg g aaag atcataaatttaaatg g cg caaag atccg cag g ataaa
Avantageusement, l’acide nucléique de SEQ ID No.6 code pour une protéine correspondant au récepteur CD16a (FcyRIII) humain natif. Advantageously, the nucleic acid of SEQ ID No. 6 encodes a protein corresponding to the native human CD16a (FcyRIII) receptor.
Dans un autre mode de réalisation particulier de l’invention, la lignée cellulaire de monocytes humains selon l’invention constitue un modèle cellulaire de phagocytose splénique. Dans un autre mode de réalisation particulier de l’invention, la lignée cellulaire de monocytes humains selon l’invention constitue un modèle cellulaire de phagocytose dans la pulpe rouge de la rate. In another particular embodiment of the invention, the human monocyte cell line according to the invention constitutes a cell model of splenic phagocytosis. In another particular embodiment of the invention, the human monocyte cell line according to the invention constitutes a cell model of phagocytosis in the red pulp of the spleen.
Un autre aspect de l’invention concerne un procédé d’obtention de la lignée de monocytes humains telle que décrite précédent, comprenant les étapes suivantes : a) isoler les monocytes humains du sang périphérique d’un patient atteint d’une leucémie aigüe myélo-monocytaire, b) transduction des monocytes humains de l’étape a) avec un vecteur lentiviral comprenant un acide nucléique de séquence choisie parmi séquence choisie parmi SEQ ID No.1 , SEQ ID No.4, SEQ ID No.5, SEQ ID No.6 ou un variant de l’acide nucléique de séquence SEQ ID No.1 , c) sélectionner les monocytes humains issus de l’étape b) exprimant les récepteurs au CD16a, CD32 et CD64 avec un milieu de sélection, et d) vérifier les niveaux d’expression des récepteurs au CD16a, CD32 et CD64 dans les monocytes humains sélectionnés à l’étape c). Another aspect of the invention relates to a process for obtaining the line of human monocytes as described above, comprising the following steps: a) isolating the human monocytes from the peripheral blood of a patient suffering from acute myelogenous leukemia. monocytic, b) transduction of the human monocytes of step a) with a lentiviral vector comprising a nucleic acid of sequence chosen from sequence chosen from SEQ ID No.1, SEQ ID No.4, SEQ ID No.5, SEQ ID No .6 or a variant of the nucleic acid of sequence SEQ ID No.1, c) selecting the human monocytes from step b) expressing the CD16a, CD32 and CD64 receptors with a selection medium, and d) checking the levels of expression of the CD16a, CD32 and CD64 receptors in the human monocytes selected in step c).
Un autre aspect de l’invention concerne un procédé d’obtention de la lignée de monocytes humains telle que décrite précédent, comprenant les étapes suivantes : a) obtenir une lignée monocytaire humaine établie b) transduction des monocytes humains de l’étape a) avec un vecteur lentiviral comprenant un acide nucléique de séquence choisie parmi séquence choisie parmi SEQ ID No.1 , SEQ ID No.4, SEQ ID No.5, SEQ ID No.6 ou un variant de l’acide nucléique de séquence SEQ ID No.1 , c) sélectionner les monocytes humains issus de l’étape b) exprimant les récepteurs au CD16a, CD32 et CD64 avec un milieu de sélection, et d) vérifier les niveaux d’expression des récepteurs au CD16a, CD32 et CD64 dans les monocytes humains sélectionnés à l’étape c). Another aspect of the invention relates to a process for obtaining the line of human monocytes as described above, comprising the following steps: a) obtain an established human monocytic line b) transduction of the human monocytes of step a) with a lentiviral vector comprising a nucleic acid of sequence chosen from sequence chosen from SEQ ID No.1, SEQ ID No.4, SEQ ID No .5, SEQ ID No.6 or a variant of the nucleic acid of sequence SEQ ID No.1, c) select the human monocytes from step b) expressing the CD16a, CD32 and CD64 receptors with a medium of selection, and d) checking the levels of expression of CD16a, CD32 and CD64 receptors in the human monocytes selected in step c).
Avantageusement, l’étape c) de sélection des monocytes humains est réalisée par cytométrie de flux en utilisant une combinaison d’anticorps spécifiques des FcyRs selon la combinaison suivante : CD16A-FITC, CD32-PE et CD64-PC7. Advantageously, step c) of selection of human monocytes is carried out by flow cytometry using a combination of antibodies specific for FcyRs according to the following combination: CD16A-FITC, CD32-PE and CD64-PC7.
Dans un mode de réalisation de l’invention, l’étape d) de vérification des niveaux d’expression des récepteurs CD16a, CD32 et CD64 dans les monocytes humains sélectionnés à l’étape c) est réalisée en comparant les niveaux d’expression des récepteurs au CD16CD16a, CD32 et CD64 dans les monocytes humains sélectionnés à l’étape c) par rapport aux niveaux d’expression de ces mêmes récepteurs dans les monocytes spléniques et/ou des macrophages circulants dérivés de monocytes. Dans un mode de réalisation de l’invention, l’étape d) de vérification des niveaux d’expression des récepteurs CD16a, CD32 et CD64 dans les monocytes humains sélectionnés à l’étape c) est réalisée en comparant les niveaux d’expression des récepteurs au CD16a, CD32 et CD64 dans les monocytes humains sélectionnés à l’étape c) par rapport aux niveaux d’expression de ces mêmes récepteurs dans les monocytes humains non transfectés de l’étape a). Dans un mode de réalisation de l’invention, l’étape d) de vérification des niveaux d’expression des récepteurs CD16a, CD32 et CD64 dans les monocytes humains sélectionnés à l’étape c) est réalisée en comparant les niveaux d’expression des récepteurs au CD16a, CD32 et CD64 dans les monocytes humains sélectionnés à l’étape c) par rapport aux niveaux d’expression de ces mêmes récepteurs dans la lignée monocytaire humaine non transfectée de l’étape a).. In one embodiment of the invention, step d) of checking the levels of expression of CD16a, CD32 and CD64 receptors in the human monocytes selected in step c) is carried out by comparing the levels of expression of CD16CD16a, CD32 and CD64 receptors in the human monocytes selected in step c) relative to the levels of expression of these same receptors in the splenic monocytes and / or circulating macrophages derived from monocytes. In one embodiment of the invention, step d) of checking the levels of expression of CD16a, CD32 and CD64 receptors in the human monocytes selected in step c) is carried out by comparing the levels of expression of CD16a, CD32 and CD64 receptors in the human monocytes selected in step c) relative to the levels of expression of these same receptors in the untransfected human monocytes of step a). In one embodiment of the invention, step d) of checking the levels of expression of CD16a, CD32 and CD64 receptors in the human monocytes selected in step c) is carried out by comparing the levels of expression of CD16a, CD32 and CD64 receptors in the human monocytes selected in step c) relative to the levels of expression of these same receptors in the untransfected human monocytic line of step a).
Un autre aspect de l’invention concerne l’utilisation de la lignée cellulaire de monocytes selon l’invention comme modèle cellulaire de la phagocytose notamment pour la phagocytose de complexes anticorps/entités cibles. Another aspect of the invention relates to the use of the monocyte cell line according to the invention as a cell model of phagocytosis, in particular for the phagocytosis of antibody / target entity complexes.
Par « entités cibles », on entend au sens de la présente invention, des organismes et des particules disposant d’un antigène de surface susceptible de fixer un anticorps. Avantageusement, les organismes peuvent être des organismes vivants ou des organismes morts, lesdits organismes vivants ou morts contenant de l’ARN ou de l’ADN. Dans un mode de réalisation particulier, les organismes sont choisis parmi les virus, les bactéries, les champignons, les mycoplasmes, les virions, les levures, les cellules vivantes, en particulier les cellules vivantes modifiées et les cellules vivantes non modifiées, les précurseurs cellulaires, et les fragments de ceux-ci. Dans un autre mode de réalisation particulier, les particules disposant d’un antigène de surface susceptible de fixer un anticorps peuvent être des particules chimiques synthétiques, en particulier les nanoparticules. For the purposes of the present invention, the term “target entities” is understood to mean organisms and particles having a surface antigen capable of binding an antibody. Advantageously, the organisms can be living organisms or dead organisms, said living or dead organisms containing RNA or DNA. In a particular embodiment, the organisms are chosen from viruses, bacteria, fungi, mycoplasmas, virions, yeasts, living cells, in particular modified living cells and unmodified living cells, cell precursors. , and fragments thereof. In another particular embodiment, the particles having a surface antigen capable of binding an antibody can be synthetic chemical particles, in particular nanoparticles.
Dans un mode de réalisation particulier, la lignée cellulaire de monocytes selon l’invention peut être utilisée comme modèle cellulaire de la phagocytose du complexe anti- D/hématies. Dans un autre mode de réalisation particulier, la lignée cellulaire de monocytes selon l’invention peut être utilisée comme modèle cellulaire de la phagocytose des plaquettes. Dans un autre mode de réalisation particulier, la lignée cellulaire de monocytes selon l’invention peut être utilisée comme modèle cellulaire de la phagocytose de cellules cancéreuses. In a particular embodiment, the monocyte cell line according to the invention can be used as a cell model of the phagocytosis of the anti-D / red blood cell complex. In another particular embodiment, the monocyte cell line according to the invention can be used as a cell model of platelet phagocytosis. In another particular embodiment, the monocyte cell line according to the invention can be used as a cell model for the phagocytosis of cancer cells.
Un autre aspect de l’invention concerne un procédé d’évaluation in vitro de l’activité phagocytaire d’une lignée cellulaire de monocytes humains comprenant les étapes suivantes : a) marquage et sensibilisation des entités cibles avec des anticorps dirigés contre lesdites entités cibles, b) mise en contact des entités cibles issues de l’étape a) avec la lignée cellulaire de monocytes humains telle que décrite précédemment, c) mesure de l’activité phagocytaire médiée par les anticorps dirigés contre lesdites entités cibles par cytométrie de flux, et d) détermination de la phagocytose Another aspect of the invention relates to a method for in vitro evaluation of the phagocytic activity of a human monocyte cell line comprising the following steps: a) labeling and sensitization of the target entities with antibodies directed against said target entities, b) bringing the target entities from step a) into contact with the human monocyte cell line as described above, c) measuring the phagocytic activity mediated by the antibodies directed against said target entities by flow cytometry, and d) determination of phagocytosis
Un autre aspect de l’invention concerne un procédé d’évaluation in vitro de l’activité phagocytaire d’une lignée cellulaire de monocytes humains comprenant les étapes suivantes : a) marquage et sensibilisation des entités cibles avec des anticorps dirigés contre lesdits entités cibles, b) pré-incubation de la lignée cellulaire de monocytes humains telle que définie précédemment en présence d’un agent bloquant les récepteurs Fc gamma (FcyR) CD16a, CD32 et/ou CD64 humains à la surface de la lignée cellulaire de monocytes, c) mise en contact des entités cibles issus de l’étape a) avec la lignée cellulaire de monocytes humains issue de l’étape b), d) mesure de l’activité phagocytaire médiée par les anticorps dirigés contre lesdits entités cibles par cytométrie de flux, et e) détermination de la phagocytose. Another aspect of the invention relates to a method for in vitro evaluation of the phagocytic activity of a human monocyte cell line comprising the following steps: a) labeling and sensitization of the target entities with antibodies directed against said target entities, b) pre-incubation of the human monocyte cell line as defined above in the presence of an agent blocking the Fc gamma receptors (FcyR) Human CD16a, CD32 and / or CD64 on the surface of the monocyte cell line, c) bringing the target entities from step a) into contact with the human monocyte cell line from step b), d) measurement of the phagocytic activity mediated by the antibodies directed against said target entities by flow cytometry, and e) determination of phagocytosis.
La détermination de la phagocytose se fait au moyen de toute technique habituelle connue de l’homme du métier. En particulier, la détermination de la phagocytose peut être effectuée par exemple par une ou plusieurs méthodes différentes telles que la détermination du pourcentage de phagocytose, la mesure de l’intensité de fluorescence. En particulier, la détermination de la phagocytose peut être effectuée par différentes méthodes permettant d’analyser le processus de phagocytose dans son entièreté : The phagocytosis is determined by means of any usual technique known to those skilled in the art. In particular, the determination of the phagocytosis can be carried out, for example, by one or more different methods such as the determination of the percentage of phagocytosis, the measurement of the fluorescence intensity. In particular, the determination of phagocytosis can be carried out by different methods allowing the entire phagocytosis process to be analyzed:
Reconnaissance et d’adhésion de l’organisme, entité ou particule cible. Par exemple, par l’analyse de la formation de rosette visible au microscope ou par toute technique habituelle connue de l’homme du métier, Recognition and adhesion of the target organism, entity or particle. For example, by analyzing the formation of a rosette visible under a microscope or by any usual technique known to those skilled in the art,
- Activation de la voie de signalisation. Par exemple, par l’analyse de l’état de phosphorylation de protéines impliquées dans la voie de signalisation de la phagocytose par cytométrie, western blot ou toute technique habituelle connue de l’homme du métier - Activation of the signaling channel. For example, by analyzing the state of phosphorylation of proteins involved in the phagocytosis signaling pathway by cytometry, western blot or any usual technique known to those skilled in the art
Ingestion. Par exemple, par l’analyse du pourcentage de cellules effectrices ayant phagocytées des cibles ou du nombre de cibles phagocytées par cytométrie, microscopie ou toute technique habituelle connue de l’homme du métier Relargage des composants cellulaire. Par exemple, par l’analyse des composés relargués dans le milieu par dosage immunologique en ELISA, cytométrie ou toute technique habituelle connue de l’homme du métier. Ingestion. For example, by analyzing the percentage of effector cells that have phagocytosed targets or the number of targets phagocytosed by cytometry, microscopy or any usual technique known to those skilled in the art. Release of cellular components. For example, by analyzing the compounds released into the medium by immunological assay in ELISA, cytometry or any usual technique known to those skilled in the art.
Le procédé d’évaluation in vitro de l’activité phagocytaire d’une lignée cellulaire de monocytes humains présente l’avantage d’être fiable, précis, sensible et reproductible. Ainsi, le procédé selon l’invention peut être utilisé comme modèle cellulaire de phagocytose. The method of in vitro evaluation of the phagocytic activity of a human monocyte cell line has the advantage of being reliable, precise, sensitive and reproducible. Thus, the method according to the invention can be used as a cell model of phagocytosis.
Dans un mode de réalisation particulier de l’invention, les entités cibles sont choisies parmi les organismes et les particules disposant d’un antigène de surface susceptible de fixer un anticorps. Dans un autre mode de réalisation particulier de l’invention, les organismes sont choisis parmi les organismes vivants et les organismes morts, lesdits organismes vivants ou morts contenant de l’ARN ou de l’ADN. Dans un mode de réalisation particulier, les organismes sont choisis parmi les virus, les bactéries, les champignons, les mycoplasmes, les virions, les levures, les cellules vivantes, en particulier les cellules vivantes modifiées et les cellules vivantes non modifiées, les précurseurs cellulaires, et les fragments de ceux-ci. Dans un autre mode de réalisation particulier, les particules disposant d’un antigène de surface susceptible de fixer un anticorps peuvent être des particules chimiques synthétiques, en particulier des nanoparticules. In a particular embodiment of the invention, the target entities are chosen from organisms and particles having a surface antigen capable of binding an antibody. In another particular embodiment of the invention, the organisms are chosen from living organisms and dead organisms, said living or dead organisms containing RNA or DNA. In a mode of particular embodiment, the organisms are chosen from viruses, bacteria, fungi, mycoplasmas, virions, yeasts, living cells, in particular modified living cells and unmodified living cells, cell precursors, and fragments of these. In another particular embodiment, the particles having a surface antigen capable of binding an antibody can be synthetic chemical particles, in particular nanoparticles.
Dans un mode de réalisation particulier de l’invention, les cellules vivantes sont choisies parmi les plaquettes, les érythrocytes et les cellules cancéreuses. In a particular embodiment of the invention, the living cells are chosen from platelets, erythrocytes and cancer cells.
Dans un mode de réalisation particulier de l’invention, les particules disposant d’un antigène de surface susceptible de fixer un anticorps sont des nanoparticules. In a particular embodiment of the invention, the particles having a surface antigen capable of binding an antibody are nanoparticles.
Dans un mode de réalisation particulier de l’invention, les anticorps dirigés contre lesdites entités cibles sont choisis parmi les anticorps anti-D, en particulier Roledumab, les immunoglobulines G, les anticorps anti-érythrocytes et les anticorps anti-plaquettes, en particulier l’anti-CD41. Avantageusement, les immunoglobulines G sont des immunoglobulines G polyvalentes. In a particular embodiment of the invention, the antibodies directed against said target entities are chosen from anti-D antibodies, in particular Roledumab, immunoglobulins G, anti-erythrocyte antibodies and anti-platelet antibodies, in particular L 'anti-CD41. Advantageously, the G immunoglobulins are polyvalent G immunoglobulins.
Dans un mode de réalisation particulier de l’invention, les entités cibles sont préalablement marquées au PKH67. In a particular embodiment of the invention, the target entities are pre-marked with PKH67.
Dans un mode de réalisation particulier de l’invention, l’agent bloquant les récepteurs Fc gamma (FcyR) CD16a, CD32 et/ou CD64 humains à la surface de la lignée cellulaire de monocytes est choisi parmi une immunoglobuline G polyvalente et/ou un fragment Fc recombinant. Avantageusement, tout concentré d’immunoglobulines G polyvalentes actuellement sur le marché peut être utilisé. À titre d’exemple, le produit Iqymune® (LFB) peut être utilisé. In a particular embodiment of the invention, the agent blocking the human CD16a, CD32 and / or CD64 gamma Fc receptors (FcyR) at the surface of the monocyte cell line is chosen from a polyvalent immunoglobulin G and / or a recombinant Fc fragment. Advantageously, any concentrate of polyvalent immunoglobulins G currently on the market can be used. As an example, the product Iqymune ® (LFB) can be used.
Dans un mode de réalisation particulier, le procédé d’évaluation in vitro de l’activité phagocytaire d’une lignée cellulaire de monocytes humains selon l’invention comprenant les étapes suivantes : a) marquage au PKFI67 et sensibilisation des érythrocytes avec un anticorps anti-D, b) mise en contact des érythrocytes issus de l’étape a) avec la lignée cellulaire de monocytes humains en présence d’immunoglobulines G, c) mesure de l’activité phagocytaire médiée par l’anticorps anti-D, par cytométrie de flux, et d) détermination de la phagocytose. Le procédé selon l’invention utilisant les hématies comme organismes cibles constitue un modèle cellulaire fiable précis, sensible et reproductible du mécanisme d’action de Roledumab. In a particular embodiment, the method of in vitro evaluation of the phagocytic activity of a human monocyte cell line according to the invention comprising the following steps: a) labeling with PKFI67 and sensitization of the erythrocytes with an anti- D, b) bringing the erythrocytes from step a) into contact with the human monocyte cell line in the presence of immunoglobulins G, c) measuring the phagocytic activity mediated by the anti-D antibody, by cytometry of flux, and d) determination of phagocytosis. The method according to the invention using red blood cells as target organisms constitutes a precise, sensitive and reproducible reliable cellular model of the mechanism of action of Roledumab.
Dans un mode de réalisation particulier, le procédé d’évaluation in vitro de l’activité phagocytaire d’une lignée cellulaire de monocytes humains selon l’invention comprenant les étapes suivantes : a) marquage au FITC et sensibilisation d’au moins une bactérie avec une solution d’mmunoglobulines G, b) mise en contact de l’au moins une bactérie issue de l’étape a) avec la lignée cellulaire de monocytes humains, c) mesure de l’activité phagocytaire médiée par les immunoglobulines G, par cytométrie de flux, et d) détermination de la phagocytose. In a particular embodiment, the method of in vitro evaluation of the phagocytic activity of a human monocyte cell line according to the invention comprising the following steps: a) labeling with FITC and sensitization of at least one bacterium with a solution of immunoglobulins G, b) bringing the at least one bacterium resulting from step a) into contact with the human monocyte cell line, c) measurement of the phagocytic activity mediated by the immunoglobulins G, by cytometry flux, and d) determination of phagocytosis.
Avantageusement, l’au moins une bactérie peut être choisie parmi les bactéries à Gram positif ou les bactéries à Gram négatif. Selon un mode de réalisation particulier, les bactéries à Gram positif peuvent être choisies parmi les bactéries de genre Staphylococcus, les bactéries de genre Enterococcus, les bactéries de genre Micrococcus, les bactéries de genre Lactococcus, les bactéries de genre Lactobacillus, les bactéries de genre Clostridium, les bactéries de genre Bacillus, les bactéries de genre Streptococcus, les bactéries de genre Listeria et les bactéries de genre Enterococcus, la liste n’étant pas limitative. Advantageously, at least one bacterium can be chosen from Gram-positive bacteria or Gram-negative bacteria. According to a particular embodiment, the Gram-positive bacteria can be chosen from bacteria of the genus Staphylococcus, bacteria of the genus Enterococcus, bacteria of the genus Micrococcus, bacteria of the genus Lactococcus, bacteria of the genus Lactobacillus, bacteria of the genus Clostridium, bacteria of the genus Bacillus, bacteria of the genus Streptococcus, bacteria of the genus Listeria and bacteria of the genus Enterococcus, the list not being exhaustive.
Selon un mode de réalisation particulier, les bactéries à Gram négatif peuvent être choisies parmi les bactéries de genre Escherichia, en particulier Escherichia coli, les bactéries de genre Pseudomonas, les bactéries de genre Acinetobacter, les bactéries de genre Bordetella, les bactéries de genre Salmonella, les bactéries de genre Yersinia, les bactéries de genre Vibrio, les bactéries de genre Agrobacterium, les bactéries de genre Rhizobium, la liste n’étant pas limitative. Dans un mode de réalisation particulièrement avantageux, l’au moins une bactérie est Escherichia coli. According to a particular embodiment, the Gram-negative bacteria can be chosen from bacteria of the genus Escherichia, in particular Escherichia coli, bacteria of the genus Pseudomonas, bacteria of the genus Acinetobacter, bacteria of the genus Bordetella, bacteria of the genus Salmonella. , bacteria of the genus Yersinia, bacteria of the genus Vibrio, bacteria of the genus Agrobacterium, bacteria of the genus Rhizobium, the list not being exhaustive. In a particularly advantageous embodiment, at least one bacterium is Escherichia coli.
Dans un mode de réalisation particulier, le procédé d’évaluation in vitro de l’activité phagocytaire d’une lignée cellulaire de monocytes humains selon l’invention comprenant les étapes suivantes : a) marquage au FITC et sensibilisation de bactéries Escherichia coli avec une solution d’mmunoglobulines G, b) mise en contact des bactéries issus de l’étape a) avec la lignée cellulaire de monocytes humains, c) mesure de l’activité phagocytaire médiée par les immunoglobulines G, par cytométrie de flux, et d) détermination de la phagocytose. In a particular embodiment, the method of in vitro evaluation of the phagocytic activity of a human monocyte cell line according to the invention comprising the following steps: a) labeling with FITC and sensitization of Escherichia coli bacteria with a solution of immunoglobulins G, b) bringing the bacteria resulting from step a) into contact with the human monocyte cell line, c) measuring the phagocytic activity mediated by immunoglobulins G, by flow cytometry, and d) determining phagocytosis.
Avantageusement, les immunoglobulines G sont des immunoglobulines G polyvalentes.Advantageously, the G immunoglobulins are polyvalent G immunoglobulins.
Le procédé selon l’invention utilisant les bactéries Escherichia.coli comme entités cibles constitue un modèle cellulaire fiable précis, sensible et reproductible du mécanisme d’action des immunoglobulines G en tant que thérapie de substitution dans le cas d’une immunodéficience primaire et/ou secondaire. The method according to the invention using the Escherichia.coli bacteria as target entities constitutes a precise, sensitive and reproducible reliable cellular model of the mechanism of action of immunoglobulins G as replacement therapy in the case of primary immunodeficiency and / or secondary.
Dans un mode de réalisation particulier, le procédé d’évaluation in vitro de l’activité phagocytaire d’une lignée cellulaire de monocytes humains selon l’invention comprenant les étapes suivantes : a) marquage au PKH67 et sensibilisation d’érythrocytes de lapin, possédant des sites antigéniques de type glycanique similaires à certaines bactéries, avec des immunoglobulines G, b) mise en contact des érythrocytes issus de l’étape a) avec la lignée cellulaire de monocytes humains, c) mesure de l’activité phagocytaire médiée par les immunoglobulines G, par cytométrie de flux, et d) détermination de la phagocytose. In a particular embodiment, the method of in vitro evaluation of the phagocytic activity of a human monocyte cell line according to the invention comprising the following steps: a) labeling with PKH67 and sensitization of rabbit erythrocytes, possessing glycanic-type antigenic sites similar to certain bacteria, with immunoglobulins G, b) bringing the erythrocytes from step a) into contact with the human monocyte cell line, c) measuring the phagocytic activity mediated by the immunoglobulins G, by flow cytometry, and d) determination of phagocytosis.
Le procédé selon l’invention utilisant les érythrocytes de lapin comme entités cibles constitue un modèle cellulaire fiable précis, sensible et reproductible du mécanisme d’action des immunoglobulines G en tant que thérapie de substitution dans le cas d’immunodéficience primaire et/ou secondaire. The method according to the invention using rabbit erythrocytes as target entities constitutes a reliable, precise, sensitive and reproducible cell model of the mechanism of action of immunoglobulins G as replacement therapy in the case of primary and / or secondary immunodeficiency.
Dans un autre mode de réalisation particulier, le procédé d’évaluation in vitro de l’activité phagocytaire d’une lignée cellulaire de monocytes humains selon l’invention comprenant les étapes suivantes : a) marquage au PKH67 et sensibilisation des plaquettes avec un anticorps anti-CD41 , b) pré-incubation de la lignée cellulaire de monocytes humains telle que définie précédemment en présence d’une immunoglobuline G polyvalente et /ou un fragment Fc recombinant, c) mise en contact des plaquettes issus de l’étape a) avec la lignée cellulaire de monocytes humains issue de l’étape b), d) mesure de l’activité phagocytaire médiée par un anticorps anti-plaquettes, en particulier l’anticorps anti-CD41 , par cytométrie de flux, et e) détermination de la phagocytose. In another particular embodiment, the method of in vitro evaluation of the phagocytic activity of a human monocyte cell line according to the invention comprising the following steps: a) labeling with PKH67 and sensitization of the platelets with an anti-antibody. -CD41, b) pre-incubation of the human monocyte cell line as defined above in the presence of a polyvalent immunoglobulin G and / or an Fc fragment recombinant, c) bringing the platelets from step a) into contact with the human monocyte cell line from step b), d) measuring the phagocytic activity mediated by an anti-platelet antibody, in particular the anti-CD41 antibody, by flow cytometry, and e) determination of phagocytosis.
Le procédé selon l’invention utilisant les plaquettes comme organismes cibles constitue un modèle cellulaire fiable précis, sensible et reproductible de la thrombocytopénie immunitaire associée au purpura (ITP). The method according to the invention using platelets as target organisms constitutes a reliable, precise, sensitive and reproducible cell model of immune thrombocytopenia associated with purpura (ITP).
Dans un autre mode de réalisation particulier, le procédé d’évaluation in vitro de l’activité phagocytaire d’une lignée cellulaire de monocytes humains selon l’invention comprenant les étapes suivantes : a) marquage au PKH67 et sensibilisation des érythrocytes avec un anticorps anti érythrocytes, b) pré-incubation de la lignée cellulaire de monocytes humains telle que définie précédemment en présence d’une immunoglobuline G polyvalente et /ou un fragment Fc recombinant, c) mise en contact des érythrocytes issus de l’étape a) avec la lignée cellulaire de monocytes humains issue de l’étape b), d) mesure de l’activité phagocytaire médiée par un anticorps anti-érythrocytes, par cytométrie de flux, et e) détermination de la phagocytose. In another particular embodiment, the method of in vitro evaluation of the phagocytic activity of a human monocyte cell line according to the invention comprising the following steps: a) labeling with PKH67 and sensitization of the erythrocytes with an anti-antibody. erythrocytes, b) pre-incubation of the human monocyte cell line as defined above in the presence of a polyvalent immunoglobulin G and / or a recombinant Fc fragment, c) bringing the erythrocytes from step a) into contact with the human monocyte cell line resulting from step b), d) measurement of phagocytic activity mediated by an anti-erythrocyte antibody, by flow cytometry, and e) determination of phagocytosis.
Avantageusement, l’anticorps anti-érythrocytes est choisi parmi l’anticorps anti-D, l’anticorps anti-A et l’anticorps anti-B. Avantageusement, l’anticorps anti-D permet de cibler les érythrocytes rhésus +. Avantageusement, l’anticorps anti-A permet de cibler les érythrocytes appartenant aux groupes sanguins A et/ou AB. Avantageusement, l’anticorps anti-B permet de cibler les érythrocytes appartenant aux groupes sanguins B et/ou AB.Advantageously, the anti-erythrocyte antibody is chosen from the anti-D antibody, the anti-A antibody and the anti-B antibody. Advantageously, the anti-D antibody makes it possible to target rhesus + erythrocytes. Advantageously, the anti-A antibody makes it possible to target erythrocytes belonging to blood groups A and / or AB. Advantageously, the anti-B antibody makes it possible to target erythrocytes belonging to blood groups B and / or AB.
Le procédé selon l’invention utilisant les érythrocytes comme organismes cibles constitue un modèle cellulaire fiable précis, sensible et reproductible de l’anémie hémolytique autoimmune (AHAI) et du mécanisme d’action des immunoglobulines G comme traitement d’immunothérapie. Un autre aspect de l’invention concerne un procédé de sélection d'anticorps à forte activité ADCP médiée par les récepteurs Fc gamma (FcyR) CD16a, CD32 et/ou CD64 humains. The method according to the invention using erythrocytes as target organisms constitutes a precise, sensitive and reproducible reliable cellular model of autoimmune hemolytic anemia (AHAI) and of the mechanism of action of immunoglobulins G as immunotherapy treatment. Another aspect of the invention relates to a method of selecting antibodies with high ADCP activity mediated by the human CD16a, CD32 and / or CD64 gamma Fc receptors (FcyR).
La phagocytose cellulaire dépendante des anticorps (ADCP) est le mécanisme par lequel les anticorps (par leur fragment Fc) vont agir en tant qu'opsonines pour favoriser l'ingestion des entités cibles par la lignée cellulaire de monocytes humains selon l’invention. Antibody-dependent cell phagocytosis (ADCP) is the mechanism by which antibodies (through their Fc fragment) will act as opsonins to promote ingestion of the target entities by the human monocyte cell line according to the invention.
Par « anticorps à forte activité ADCP », on entend au sens de la présente invention, un anticorps présentant une forte capacité à induire la phagocytose des entités cibles par la lignée cellulaire de monocytes humains selon l’invention. For the purposes of the present invention, the term “antibody with strong ADCP activity” means an antibody exhibiting a strong capacity to induce phagocytosis of target entities by the human monocyte cell line according to the invention.
Avantageusement, le procédé de sélection d'anticorps à forte activité ADCP médiée par les récepteurs Fc gamma (FcyR) CD16a, CD32 et/ou CD64 humains comprenant les étapes suivantes : a) pré-incubation de la lignée cellulaire de monocytes humains selon l’invention en présence d’un agent bloquant les récepteurs Fc gamma (FcyR) CD16a, CD32 et/ou CD64 humains à la surface de la lignée cellulaire de monocytes, b) mise en contact de la lignée cellulaire de monocytes humains issue de l’étape a) avec lesdits anticorps à sélectionner, lesdits anticorps étant liés à leurs entités cibles, c) détermination de la phagocytose, et d) sélection des anticorps à forte activité ADCP médiée par le CD16a et/ou CD32 et/ou CD64. Advantageously, the method for selecting antibodies with high ADCP activity mediated by the human CD16a, CD32 and / or CD64 gamma Fc receptors (FcyR) comprising the following steps: a) pre-incubation of the human monocyte cell line according to the invention in the presence of an agent blocking the human CD16a, CD32 and / or CD64 gamma Fc receptors (FcyR) at the surface of the monocyte cell line, b) contacting the human monocyte cell line resulting from step a) with said antibodies to be selected, said antibodies being linked to their target entities, c) determination of phagocytosis, and d) selection of antibodies with high ADCP activity mediated by CD16a and / or CD32 and / or CD64.
Dans un mode de réalisation particulier, l’agent bloquant les récepteurs Fc gamma (FcyR) humains à la surface de la lignée cellulaire de monocytes est choisi parmi une immunoglobuline G polyvalente et/ou un fragment Fc recombinant. Avantageusement, toute immunoglobuline G polyvalente actuellement sur le marché peut être utilisée. À titre d’exemple, le produit Iqymune® (LFB) peut être utilisé. In a particular embodiment, the agent blocking human Fc gamma receptors (FcyR) at the surface of the monocyte cell line is chosen from a polyvalent immunoglobulin G and / or a recombinant Fc fragment. Advantageously, any polyvalent immunoglobulin G currently on the market can be used. For example, the product Iqymune® (LFB) can be used.
Un autre aspect de l’invention concerne un procédé de sélection d’un inhibiteur de l’ADCP médiée par les récepteurs Fc gamma (FcyR) CD16a, CD32 et/ou CD64 humains. Another aspect of the invention relates to a method of selecting an inhibitor of ADCP mediated by human Fc gamma receptors (FcyR) CD16a, CD32 and / or CD64.
Par « inhibiteur de l’ADCP », on entend au sens de la présente invention, toute molécule, en particulier anticorps, capable d’inhiber la phagocytose des entités cibles par la lignée cellulaire de monocytes humains selon l’invention. Avantageusement, le procédé de sélection d’un inhibiteur de l’ADCP médiée par les récepteurs Fc gamma (FcyR) CD16a, CD32 et/ou CD64 humains comprenant les étapes suivantes : a) opsonisation des entités cibles avec un anticorps à forte activité ADCP dirigés contre lesdites entités cibles, b) mise en contact de la lignée cellulaire de monocytes humains selon l’invention avec les entités cibles opsonisées lors de l’étape a) et lesdits inhibiteurs à sélectionner, c) détermination de la phagocytose, et d) sélection des inhibiteurs de l’ADCP médiée par le CD16a et/ou CD32 et/ou CD64. For the purposes of the present invention, the term “ADCP inhibitor” means any molecule, in particular antibody, capable of inhibiting phagocytosis of target entities by the human monocyte cell line according to the invention. Advantageously, the method for selecting an ADCP inhibitor mediated by the human CD16a, CD32 and / or CD64 Fc gamma receptors (FcyR) comprising the following steps: a) opsonization of the target entities with an antibody with high ADCP activity directed against said target entities, b) bringing the human monocyte cell line according to the invention into contact with the target entities opsonized during step a) and said inhibitors to be selected, c) determination of phagocytosis, and d) selection CD16a and / or CD32 and / or CD64-mediated ADCP inhibitors.
FIGURES FIGURES
La figure 1 représente la carte de restriction du vecteur lentiviral comprenant un acide nucléique de SEQ ID No.1. FIG. 1 represents the restriction map of the lentiviral vector comprising a nucleic acid of SEQ ID No.1.
La figure 2 représente le profil d’expression des récepteurs Fc gamma (FcyR) humains (CD16a, CD32 et CD64) de la lignée cellulaire de monocytes humains de l’invention. Le profil d’expression a été obtenu par cytométrie de flux en utilisant les anticorps fluorescents spécifiques suivants : CD16-FITC, CD32-PE et CD64-PC7. Figure 2 shows the expression profile of human Fc gamma receptors (FcyR) (CD16a, CD32 and CD64) of the human monocyte cell line of the invention. The expression profile was obtained by flow cytometry using the following specific fluorescent antibodies: CD16-FITC, CD32-PE and CD64-PC7.
La figure 3A représente le pourcentage de phagocytose des plaquettes, provenant d’un donneur 1 , sensibilisées avec l’anticorps anti-CD41 par la lignée cellulaire de monocytes selon l’invention, en utilisant des concentrations croissantes d’IglV à 10% (Iqymune, LFB) ou des fragments Fc recombinant (LFBD192-DS AY, LFBD192-DS EY et LFBD191-DS AY) (agent bloquant les récepteurs Fc gamma (FcyR)), de 6,66x105 M, 6,66x10 e M, 6,66x107 M, à 6,66x108 M. Les résultats sont obtenus par cytométrie de flux. FIG. 3A represents the percentage of phagocytosis of the platelets, originating from a donor 1, sensitized with the anti-CD41 antibody by the monocyte cell line according to the invention, using increasing concentrations of IglV to 10% (Iqymune , LFB) or recombinant Fc fragments (LFBD192-DS AY, LFBD192-DS EY and LFBD191-DS AY) (Fc gamma receptor blocking agent (FcyR)), 6.66x10 5 M, 6.66x10 e M, 6 , 66x10 7 M, at 6.66x10 8 M. The results are obtained by flow cytometry.
La figure 3B représente l’intensité de fluorescence moyenne (MFI pour Mean Fluorescence Intensity) associée à la quantité de plaquettes ingérées par la lignée cellulaire de monocytes selon l’invention en utilisant des concentrations croissantes d’IglV à 10% (Iqymune, LFB) ou des fragments Fc recombinant (LFBD192-DS AY, LFBD192-DS EY et LFBD191-DS AY) (agent bloquant les récepteurs Fc gamma (FcyR)), de 6,66x10-5 M, 6,66x10-6 M, 6,66x10-7 M, à 6,66x10-8 M, lesdites plaquettes provenant d’un donneur 1 , et ayant été sensibilisées avec l’anticorps anti-CD41. Les résultats sont obtenus par cytométrie de flux. FIG. 3B represents the mean fluorescence intensity (MFI for Mean Fluorescence Intensity) associated with the quantity of platelets ingested by the monocyte cell line according to the invention using increasing concentrations of IglV at 10% (Iqymune, LFB) or recombinant Fc fragments (LFBD192-DS AY, LFBD192-DS EY and LFBD191-DS AY) (agent blocking gamma Fc receptors (FcyR)), 6.66x10-5 M, 6.66x10-6 M, 6, 66x10-7 M, at 6.66x10-8 M, said platelets coming from a donor 1, and having been sensitized with the anti-CD41 antibody. The results are obtained by flow cytometry.
La figure 3C représente le pourcentage de phagocytose des plaquettes, provenant d’un donneur 2, sensibilisées avec l’anticorps anti-CD41 par la lignée cellulaire de monocytes selon l’invention, en utilisant des concentrations croissantes d’IglV à 10% (Iqymune, LFB) ou des fragments Fc recombinant (LFBD192-DS AY, LFBD192-DS EY et LFBD191-DS AY) (agent bloquant les récepteurs Fc gamma (FcyR)), de 6,66x10 ® M, 6,66x10 e M, 6,66x107 M, à 6,66x108 M. Les résultats sont obtenus par cytométrie de flux. FIG. 3C represents the percentage of phagocytosis of the platelets, originating from a donor 2, sensitized with the anti-CD41 antibody by the cell line of monocytes according to the invention, using increasing concentrations of 10% IglV (Iqymune, LFB) or recombinant Fc fragments (LFBD192-DS AY, LFBD192-DS EY and LFBD191-DS AY) (agent blocking the Fc gamma receptors ( FcyR)) to 6,66x10 ® M, and M 6,66x10, 6,66x10 7 million to 8 6,66x10 M. The results are obtained by flow cytometry.
La figure 3D représente l’intensité de fluorescence moyenne (MFI) associée à la quantité de plaquettes ingérées par la lignée cellulaire de monocytes selon l’invention en utilisant des concentrations croissantes d’IglV à 10% (Iqymune, LFB) ou des fragments Fc recombinant (LFBD192-DS AY, LFBD192-DS EY et LFBD191-DS AY) (agent bloquant les récepteurs Fc gamma (FcyR)), de 6,66x10-5 M, 6,66x10-6 M, 6,66x10-7 M, à 6,66x10-8 M, lesdites plaquettes provenant d’un donneur 2, et ayant été sensibilisées avec l’anticorps anti-CD41. Les résultats sont obtenus par cytométrie de flux. Figure 3D represents the mean fluorescence intensity (MFI) associated with the quantity of platelets ingested by the monocyte cell line according to the invention using increasing concentrations of 10% IglV (Iqymune, LFB) or Fc fragments recombinant (LFBD192-DS AY, LFBD192-DS EY and LFBD191-DS AY) (Fc gamma receptor blocker (FcyR)), 6.66x10-5 M, 6.66x10-6 M, 6.66x10-7 M , at 6.66x10-8 M, said platelets coming from a donor 2, and having been sensitized with the anti-CD41 antibody. The results are obtained by flow cytometry.
La figure 3E représente le pourcentage de phagocytose des plaquettes, provenant d’un donneur 3, sensibilisées avec l’anticorps anti-CD41 par la lignée cellulaire de monocytes selon l’invention, en utilisant des concentrations croissantes d’IglV à 10% (Iqymune, LFB) ou des fragments Fc recombinant (LFBD192-DS AY, LFBD192-DS EY et LFBD191-DS AY) (agent bloquant les récepteurs Fc gamma (FcyR)), de 6,66x10 ® M, 6,66x10 e M, 6,66x107 M, à 6,66x10 ® M. Les résultats sont obtenus par cytométrie de flux. FIG. 3E represents the percentage of phagocytosis of the platelets, originating from a donor 3, sensitized with the anti-CD41 antibody by the monocyte cell line according to the invention, using increasing concentrations of IglV to 10% (Iqymune , LFB) or recombinant Fc fragments (LFBD192-DS AY, LFBD192-DS EY and LFBD191-DS AY) (agent blocking gamma Fc receptors (FcyR)), 6.66x10 ® M, 6.66x10 e M, 6 , 66x10 7 M, at 6.66x10 ® M. The results are obtained by flow cytometry.
La figure 3F représente l’intensité de fluorescence moyenne (MFI) associée à la quantité de plaquettes ingérées par la lignée cellulaire de monocytes selon l’invention en utilisant des concentrations croissantes d’IglV à 10% (Iqymune, LFB) ou des fragments Fc recombinant (LFBD192-DS AY, LFBD192-DS EY et LFBD191-DS AY) (agent bloquant les récepteurs Fc gamma (FcyR)), de 6,66x10-5 M, 6,66x10-6 M, 6,66x10-7 M, à 6,66x10-8 M, lesdites plaquettes provenant d’un donneur 3, et ayant été sensibilisées avec l’anticorps anti-CD41. Les résultats sont obtenus par cytométrie de flux. FIG. 3F represents the mean fluorescence intensity (MFI) associated with the quantity of platelets ingested by the monocyte cell line according to the invention using increasing concentrations of 10% IglV (Iqymune, LFB) or Fc fragments recombinant (LFBD192-DS AY, LFBD192-DS EY and LFBD191-DS AY) (Fc gamma receptor blocker (FcyR)), 6.66x10-5 M, 6.66x10-6 M, 6.66x10-7 M , at 6.66x10-8 M, said platelets coming from a donor 3, and having been sensitized with the anti-CD41 antibody. The results are obtained by flow cytometry.
La figure 4A représente le pourcentage de phagocytose des hématies sensibilisées avec l’anticorps anti-D (Roledumab) par la lignée cellulaire de monocytes selon l’invention, en utilisant des concentrations croissantes d’anticorps anti-D (Roledumab), de 0,04 à 5 pg/ml et en présence d’IglV à une concentration de 0,25 mg/ml. Les résultats sont obtenus par cytométrie de flux. FIG. 4A represents the percentage of phagocytosis of red blood cells sensitized with the anti-D antibody (Roledumab) by the monocyte cell line according to the invention, using increasing concentrations of anti-D antibodies (Roledumab), from 0, 04 at 5 pg / ml and in the presence of IglV at a concentration of 0.25 mg / ml. The results are obtained by flow cytometry.
La figure 4B représente l’intensité de fluorescence moyenne (MFI) associée à la quantité d’hématies ingérées par la lignée cellulaire de monocytes selon l’invention, en utilisant des concentrations croissantes d’anticorps anti-D (Roledumab) allant de 0,04 à 5pg/ml en présence de 0,25 mg/ml d’IglV, lesdites hématies ayant été préalablement sensibilisées avec l’anticorps anti-D (Roledumab). Les résultats ont été obtenus par cytométrie de flux. La figure 4C représente le pourcentage de phagocytose des hématies sensibilisées avec l’anticorps anti-D (Roledumab) par la lignée cellulaire de monocytes selon l’invention, en l’absence d’anticorps anti-D (Roledumab), en présence d’anticorps anti-D (Roledumab ) à une concentration de 5 pg/ml ou en présence d’anticorps anti-D (Roledumab ) à une concentration de 5 pg/ml et de 5 pg/ml d’anticorps anti-CD16. Les résultats sont obtenus par cytométrie de flux. FIG. 4B represents the mean fluorescence intensity (MFI) associated with the quantity of red blood cells ingested by the monocyte cell line according to the invention, using increasing concentrations of anti-D antibodies (Roledumab) ranging from 0, 04 to 5 μg / ml in the presence of 0.25 mg / ml of IglV, said red blood cells having been previously sensitized with the anti-D antibody (Roledumab). The results were obtained by flow cytometry. FIG. 4C represents the percentage of phagocytosis of red blood cells sensitized with the anti-D antibody (Roledumab) by the monocyte cell line according to the invention, in the absence of anti-D antibody (Roledumab), in the presence of anti-D antibody (Roledumab) at a concentration of 5 μg / ml or in the presence of anti-D antibody (Roledumab) at a concentration of 5 μg / ml and 5 μg / ml of anti-CD16 antibody. The results are obtained by flow cytometry.
La figure 4D représente l’intensité de fluorescence moyenne (MFI) associée à la quantité d’hématies ingérées par la lignée cellulaire de monocytes selon l’invention, en l’absence d’anticorps anti-D (Roledumab), en présence d’anticorps anti-D (Roledumab ) à une concentration de 5 pg/ml ou en présence d’anticorps anti-D (Roledumab) à une concentration de 5 pg/ml et de 5 pg/ml d’anticorps anti-CD16. Les résultats sont obtenus par cytométrie de flux. FIG. 4D represents the mean fluorescence intensity (MFI) associated with the quantity of red blood cells ingested by the monocyte cell line according to the invention, in the absence of anti-D antibodies (Roledumab), in the presence of anti-D antibody (Roledumab) at a concentration of 5 μg / ml or in the presence of anti-D antibody (Roledumab) at a concentration of 5 μg / ml and 5 μg / ml of anti-CD16 antibody. The results are obtained by flow cytometry.
La figure 5 représente les résultats du test de phagocytose des hématies sensibilisées avec un anticorps anti-D (RhD+RBC) par la lignée cellulaire de monocytes humains selon l’invention (THP1 CD16+) avec des concentrations croissantes de 0,04 à 5 pg/ml d’anticorps anti-D (Roledumab) en présence de 0,25 mg/ml d’IgIV. Les graphiques A et B ont été obtenus avec une gamme de 50% d’anticorps anti-D et les graphiques C et D ont été obtenus avec une gamme de 150% d’anticorps anti-D. Les résultats sont présentés en pourcentage de phagocytose (A et C) et en intensité de fluorescence moyenne (B et D) et représente la moyenne d’une seule expérience réalisée en double. FIG. 5 represents the results of the phagocytosis test of red blood cells sensitized with an anti-D antibody (RhD + RBC) by the human monocyte cell line according to the invention (THP1 CD16 +) with increasing concentrations from 0.04 to 5 pg / ml of anti-D antibody (Roledumab) in the presence of 0.25 mg / ml of IVIg. Graphs A and B were obtained with a range of 50% anti-D antibody and graphs C and D were obtained with a range of 150% anti-D antibody. Results are presented as percent phagocytosis (A and C) and average fluorescence intensity (B and D) and represent the average of a single experiment performed in duplicate.
La figure 6 représente les résultats du test de phagocytose des hématies sensibilisées avec un anticorps anti-D (RhD+RBC) par la lignée cellulaire de monocytes humains selon l’invention (THP1 CD16+) avec des concentrations croissantes de 0,04 à 5 pg/ml d’anticorps anti-D (Roledumab) en présence de 0,25 mg/ml d’IgIV. Les graphiques A et D ont été obtenus après application d’un stress thermique à 40°C pendant 3 mois, les graphiques B et E ont été obtenus après application d’un stress thermique à 50°C pendant 3 semaines, et les graphiques C et F après application d’un stress thermique à 50°C pendant 6 semaines. Les résultats sont présentés en pourcentage de phagocytose (A, B et C) et en intensité de fluorescence moyenne (D, E et F) et représente la moyenne d’une seule expérience réalisée en double. FIG. 6 represents the results of the phagocytosis test of red blood cells sensitized with an anti-D antibody (RhD + RBC) by the human monocyte cell line according to the invention (THP1 CD16 +) with increasing concentrations from 0.04 to 5 pg / ml of anti-D antibody (Roledumab) in the presence of 0.25 mg / ml of IVIg. Graphs A and D were obtained after applying heat stress at 40 ° C for 3 months, graphs B and E were obtained after applying heat stress at 50 ° C for 3 weeks, and graphs C and F after application of heat stress at 50 ° C for 6 weeks. Results are presented as percent phagocytosis (A, B, and C) and average fluorescence intensity (D, E, and F) and represent the average of a single experiment performed in duplicate.
La figure 7 représente les résultats du test de phagocytose des hématies sensibilisées avec un anticorps anti-D (RhD+RBC) par la lignée cellulaire de monocytes humains selon l’invention (THP1 CD16+) avec des concentrations croissantes de 0,04 à 5 pg/ml d’anticorps anti-D (Roledumab) en présence de 0,25 mg/ml d’IgIV. Les graphiques A et D ont été obtenus après application d’un stress chimique utilisant du H202 à une concentration de 10 mM, les graphiques B et E ont été obtenus après application d’un stress chimique utilisant du H202 à une concentration de 50 mM, et les graphiques C et F après application d’un stress chimique utilisant du H202 à une concentration de 10 mM. Les résultats sont présentés en pourcentage de phagocytose (A, B et C) et en intensité de fluorescence moyenne (D, E et F) et représente la moyenne d’une seule expérience réalisée en double. FIG. 7 represents the results of the phagocytosis test of red blood cells sensitized with an anti-D antibody (RhD + RBC) by the human monocyte cell line according to the invention (THP1 CD16 +) with increasing concentrations from 0.04 to 5 pg / ml of anti-D antibody (Roledumab) in the presence of 0.25 mg / ml of IVIg. Charts A and D were obtained after application of a chemical stress using H 2 0 2 at a concentration of 10 mM, graphs B and E were obtained after application of a chemical stress using H 2 0 2 at a concentration of 50 mM , and graphs C and F after application of chemical stress using H 2 O 2 at a concentration of 10 mM. The results are presented as percent phagocytosis (A, B and C) and average fluorescence intensity (D, E and F) and represent the average of a single experiment performed in duplicate.
La figure 8 représente les résultats du test de phagocytose des hématies sensibilisées avec un anticorps anti-D (RhD+RBC) par la lignée cellulaire de monocytes humains selon l’invention (THP1 CD16+) avec des concentrations croissantes de 0,04 à 5 pg/ml d’anticorps anti-D (Roledumab) en présence de 0,25 mg/ml d’IgIV. Les graphiques A et D ont été obtenus avec le DF5, les graphiques B et E ont été obtenus avec l’anticorps anti-D (Roledumab) traité avec l’EndoS2 pendant 2 heures à 37°C, et les graphiques C et F ont été obtenus avec l’anticorps anti-D (Roledumab, lot CB04) chauffé. Les résultats sont présentés en pourcentage de phagocytose (A, B et C) et en intensité de fluorescence moyenne (D, E et F) et représente la moyenne d’une seule expérience réalisée en double.FIG. 8 represents the results of the phagocytosis test of red blood cells sensitized with an anti-D antibody (RhD + RBC) by the human monocyte cell line according to the invention (THP1 CD16 +) with increasing concentrations from 0.04 to 5 pg / ml of anti-D antibody (Roledumab) in the presence of 0.25 mg / ml of IVIg. Graphs A and D were obtained with DF5, graphs B and E were obtained with anti-D antibody (Roledumab) treated with EndoS2 for 2 hours at 37 ° C, and graphs C and F were were obtained with the heated anti-D antibody (Roledumab, batch CB04). Results are presented as percent phagocytosis (A, B, and C) and average fluorescence intensity (D, E, and F) and represent the average of a single experiment performed in duplicate.
La figure 9 (graphiques A et C) représente les résultats du test de phagocytose des hématies sensibilisées avec un anticorps anti-D (RhD+RBC) par la lignée cellulaire de monocytes humains selon l’invention (THP1 CD16+) avec des concentrations croissantes de 0,04 à 5 pg/ml d’anticorps anti-D (Roledumab) en présence de 0,25mg/ml d’IglV après 3 passages ou 29 passages de culture cellulaire. La figure 9 ( B et D) représente les résultats du test de phagocytose des hématies sensibilisées avec un anticorps anti-D (RhD+RBC) par la lignée cellulaire de monocytes humains selon l’invention (THP1 CD16A+) avec des concentrations croissantes de 0,04 à 5 pg/ml d’anticorps anti-D (Roledumab, lot 304) ayant réussi un ou deux cycles F/T en présence de 0,25 mg/ml d’IgIV. Les résultats sont présentés en pourcentage de phagocytose (A et B) et en intensité de fluorescence moyenne (C et D) et représente la moyenne d’une seule expérience réalisée en double. FIG. 9 (graphs A and C) represents the results of the phagocytosis test of red blood cells sensitized with an anti-D antibody (RhD + RBC) by the human monocyte cell line according to the invention (THP1 CD16 +) with increasing concentrations of 0.04 to 5 pg / ml of anti-D antibody (Roledumab) in the presence of 0.25 mg / ml of IglV after 3 passages or 29 passages of cell culture. FIG. 9 (B and D) represents the results of the phagocytosis test of red blood cells sensitized with an anti-D antibody (RhD + RBC) by the human monocyte cell line according to the invention (THP1 CD16A +) with increasing concentrations of 0 , 04 to 5 pg / ml of anti-D antibody (Roledumab, lot 304) having passed one or two F / T cycles in the presence of 0.25 mg / ml of IVIg. Results are presented as percent phagocytosis (A and B) and mean fluorescence intensity (C and D) and represent the average of a single experiment performed in duplicate.
EXEMPLES EXAMPLES
Exemple 1 : Préparation d’une lignée cellulaire de monocytes (THP1 CD16+)Example 1: Preparation of a monocyte cell line (THP1 CD16 +)
Les cellules de monocytes humains THP1 ont été transfectée deux fois à MOI 100 avec 4pg/ml de polybrène en utilisant les vecteurs lentiviraux exprimant l’acide nucléique de SEQ ID No.1 (Figure 1).Les cellules ont été amplifiées et une sélection de clone a été réalisée par dilution limite. Les clones amplifiés ont été préalablement caractérisés. THP1 human monocyte cells were transfected twice at MOI 100 with 4 µg / ml polybrene using lentiviral vectors expressing the nucleic acid of SEQ ID No.1 (Figure 1). Cells were amplified and clone selection was performed by limiting dilution. The amplified clones were characterized beforehand.
1. Décongélation et début de la culture cellulaire 1. Thawing and start of cell culture
Les cellules en culture ont été obtenues à partir d'une banque de cryotubes en décongelant rapidement à 37°C et en les diluant dans 10 ml de milieu de croissance préchauffé IMDM (Iscoves Modified Dulbecco's Medium) + 20% de Sérum de Veau Foetal (SVF) à 37°C. Le DMSO a été éliminé par centrifugation des cellules à 270 g pendant 5 minutes à température ambiante et le surnageant a été jeté. Les cellules ont ensuite été remises en suspension dans un milieu de culture frais à 0,5x106 cellules/ml et incubées à 37°C dans des incubateurs humidifiés avec une atmosphère de 5% de C02 dans l'air. Cells in culture were obtained from a cryotube bank by rapidly thawing at 37 ° C and diluting them in 10 ml of preheated IMDM (Iscoves Modified Dulbecco's Medium) growth medium + 20% Fetal Calf Serum ( SVF) at 37 ° C. DMSO was removed by centrifuging the cells at 270g for 5 minutes at room temperature and the supernatant was discarded. The cells were then resuspended in fresh culture medium at 0.5x10 6 cells / ml and incubated at 37 ° C in humidified incubators with an atmosphere of 5% CO 2 in air.
2. Maintien et expansion des cellules 2. Maintenance and expansion of cells
Pour amplifier la lignée cellulaire THP1 , les cellules ont été cultivées dans du milieu IMDM (Iscoves Modified Dulbecco's Medium) + 10% de Sérum de Veau foetal en les repiquant dans le volume de culture souhaité à 4x105 cellules/ml pendant 3 jours et à 3x105 cellules/ml pendant 4 jours. To amplify the THP1 cell line, the cells were cultured in IMDM (Iscoves Modified Dulbecco's Medium) + 10% Fetal Calf Serum by subculturing them in the desired culture volume at 4x10 5 cells / ml for 3 days and at 3x10 5 cells / ml for 4 days.
Les cultures de cellules ont été incubées à 37°C dans des incubateurs humidifiés avec une atmosphère de 5% de C02 dans l'air. The cell cultures were incubated at 37 ° C in humidified incubators with an atmosphere of 5% CO 2 in air.
3. Concentration cellulaire et viabilité cellulaire 3. Cell concentration and cell viability
Les densités cellulaires totales et viables ont été déterminées par comptage automatique avec le système NC-200 de Chemometec. Un échantillon, éventuellement dilué, de 0,2 ml a été analysé par coloration automatisée au DAPI et à l'acridine orange, suivie d'une série de photographies. Une analyse au moyen du logiciel associé (NucleoView) a été réalisée permettant de déterminer les concentrations de cellules totales et viables. Le pourcentage de viabilité a été calculé en multipliant par 100 le nombre de cellules viables par rapport au nombre total de cellules (cellules vivantes et mortes). Total and viable cell densities were determined by automatic counting with the NC-200 system from Chemometec. A sample, optionally diluted, of 0.2 ml was analyzed by automated staining with DAPI and acridine orange, followed by a series of photographs. Analysis using the associated software (NucleoView) was performed to determine the concentrations of total and viable cells. Percent viability was calculated by multiplying by 100 the number of viable cells relative to the total number of cells (living and dead cells).
4. Cryoconservation 4. Cryopreservation
Des cellules en phase de croissance exponentielle précoce ou moyenne et une viabilité supérieure à 80% ont été utilisées. Les cellules ont été recueillies par centrifugation et remises en suspension dans un milieu de congélation (95% de Sérum de veau foetal - 5% de DMSO), pré-refroidies à 4 °C. La suspension cellulaire a ensuite été distribuée dans le nombre approprié de tubes cryogéniques, avec 1 ml de suspension par tubes cryogéniques, contenant 5 x 106 cellules. Les tubes cryogéniques ont été immédiatement placés dans un congélateur à -80°C. Le lendemain, les cryotubes ont été transférés dans un cryoconteneur et stockées enazote liquide par immersion. Cells in early or medium exponential growth phase and greater than 80% viability were used. Cells were collected by centrifugation and resuspended in freezing medium (95% Fetal Calf Serum - 5% DMSO), pre-cooled to 4 ° C. The cell suspension was then dispensed into the appropriate number of cryogenic tubes, along with 1 ml of suspension per cryogenic tube, containing 5 x 10 6 cells. Cryogenic tubes were immediately placed in a -80 ° C freezer. The next day, the cryotubes were transferred to a cryocontainer and stored in liquid nitrogen by immersion.
5. Immunophénotypaae 5. Immunophenotypaae
Les lignées cellulaires de monocytes humains THP1 CD16+ selon l’invention (durant 30 passages) ont été caractérisées par cytométrie de flux après une incubation de 15 minutes à la température ambiante, à l'abri de la lumière de 1x105 cellules avec différents anticorps spécifiques des FcyRs selon la combinaison suivante: CD16-FITC (20 pL) / CD32-PE (20 pL) / CD64-PC7 (10 pL). The THP1 CD16 + human monocyte cell lines according to the invention (during 30 passages) were characterized by flow cytometry after an incubation of 15 minutes at room temperature, shielded from the light of 1 × 10 5 cells with different specific antibodies. FcyRs according to the following combination: CD16-FITC (20 pL) / CD32-PE (20 pL) / CD64-PC7 (10 pL).
Des contrôles isotypiques (anticorps non pertinents du même isotype IgG et marqués du même fluorochrome) ont été réalisés dans les mêmes conditions expérimentales. Isotypic controls (irrelevant antibodies of the same IgG isotype and labeled with the same fluorochrome) were carried out under the same experimental conditions.
La Figure 2 présente le profil d’expression des récepteurs CD16, CD32 et CD64 de la lignée cellulaire de monocytes humains THP1 CD16+. Figure 2 shows the CD16, CD32 and CD64 receptor expression profile of the THP1 CD16 + human monocyte cell line.
La lignée cellulaire de monocytes humains selon l’invention présente donc une expression stable des récepteurs membranaires CD16a, CD32 et CD64. The human monocyte cell line according to the invention therefore exhibits stable expression of CD16a, CD32 and CD64 membrane receptors.
6. Détermination du nombre de récepteurs CD 16a, CD32 et CD64 dans la lignée cellulaire de monocytes humains selon l’invention. 6. Determination of the number of CD 16a, CD32 and CD64 receptors in the human monocyte cell line according to the invention.
Le nombre de récepteurs CD16a, CD32 et CD64 exprimés par la lignée cellulaire de monocytes humains selon l’invention a été déterminé en utilisant le kit QIFIKIT de la société DAKO. A titre de comparaison, la présence de ces récepteurs CD16a, CD32 et CD64 a également été testée dans les cellules THP 1 non transfectées (THP1 WT) et les monocytes classiques. The number of CD16a, CD32 and CD64 receptors expressed by the human monocyte cell line according to the invention was determined using the QIFIKIT kit from the company DAKO. By way of comparison, the presence of these CD16a, CD32 and CD64 receptors was also tested in untransfected THP 1 cells (THP1 WT) and conventional monocytes.
Plus particulièrement, 100 pL d’une suspension de cellules à une concentration de 2x106 cellules/mL dans du PBS + 1%BSA ont été incubées à une température de 4°C pendant 30 à 60 minutes avec 1 pg of trois anticorps monoclonaux de souris primaires non- conjugués anti-CD16a, anti-CD32 et anti-CD64 ou avec un anticorps monoclonal de souris non pertinent du même isotype et ajusté à la même concentration utilisé comme contrôle négatif. Les échantillons ont ensuite été lavés deux fois avec 3 mL de PBS + 1%BSA par centrifugation à 270 x g pendant 5 minutes. Dans le même temps, 100 mI_ de billes de montage et de calibration remises en suspension (vortex), respectivement, ont été placées dans deux tubes à essai séparés et lavées avec 3 ml_ de PBS + 1% de BSA par centrifugation à 270 x g pendant 5 minutes.More specifically, 100 µL of a cell suspension at a concentration of 2x10 6 cells / mL in PBS + 1% BSA was incubated at a temperature of 4 ° C for 30-60 minutes with 1 µg of three monoclonal antibodies of primary mice unconjugated anti-CD16a, anti-CD32 and anti-CD64 or with an irrelevant mouse monoclonal antibody of the same isotype and adjusted to the same concentration used as negative control. The samples were then washed twice with 3 mL of PBS + 1% BSA by centrifugation at 270 xg for 5 minutes. At the same time, 100 ml of resuspended (vortex) mounting and calibration beads, respectively, were placed in two separate test tubes and washed with 3 ml of PBS + 1% BSA by centrifugation at 270 xg for 5 minutes.
Les culots de cellules et de billes ont été incubés dans l’obscurité à 4°C pendant 45 minutes avec 100 pL de conjugué FITC, dilués à 1/50 dans du PBS. Cell pellets and beads were incubated in the dark at 4 ° C for 45 minutes with 100 µL of FITC conjugate, diluted 1/50 in PBS.
Les échantillons sont lavés deux fois avec 3 mL de PBS + 1% de BSA par centrifugation à 270 x g pendant 5 minutes. The samples are washed twice with 3 mL of PBS + 1% BSA by centrifugation at 270 x g for 5 minutes.
Les culots sont resuspendus dans 500 pL of PBS + 1%BSA avant d’être analysés par cytométrie de flux. The pellets are resuspended in 500 µL of PBS + 1% BSA before being analyzed by flow cytometry.
Les résultats sont présentés dans le tableau 1 ci-dessous.
Figure imgf000031_0001
The results are shown in Table 1 below.
Figure imgf000031_0001
Tableau 1 : Détermination du nombre de récepteurs CD16a CD32 et CD64 4/ Stabilité de la lignée Table 1: Determination of the number of CD16a CD32 and CD64 receptors 4 / Stability of the line
Afin de valider l'utilisation de la lignée cellulaire selon l’invention (THP1 CD16+) pour environ 30 passages de culture cellulaire, correspondant à 3 mois de culture cellulaire, un test a été réalisé pour comparer les cellules THP1 aux passages 3 (P3) et 29 (P29) (Figure 9 A/C). Le pourcentage de phagocytose et le MFI en fonction de la concentration en CB04 ont été analysés pour comparer les valeurs EC50 et Top. Les résultats sont présentés à la figure 9. In order to validate the use of the cell line according to the invention (THP1 CD16 +) for approximately 30 passages of cell culture, corresponding to 3 months of cell culture, a test was carried out to compare the THP1 cells to passages 3 (P3) and 29 (P29) (Figure 9 A / C). Percent phagocytosis and MFI as a function of CB04 concentration were analyzed to compare EC50 and Top values. The results are shown in Figure 9.
La figure 9 montre une activité de phagocytose comparable entre les cellules THP1CD16+ aux passages P3 et P29. Ces résultats valident l'utilisation de cellules THP1 CD16+ pour environ 30 passages de culture cellulaire Ces résultats montrent que la lignée cellulaire de monocytes humains selon l’invention exprime de manière stable les CD16a, CD32 et CD64. Figure 9 shows comparable phagocytosis activity between THP1CD16 + cells at passages P3 and P29. These results validate the use of THP1 CD16 + cells for approximately 30 cell culture passages. These results show that the human monocyte cell line according to the invention stably expresses CD16a, CD32 and CD64.
Exemple 2 : Inhibition de la phagocytose des plaquettes médiée par l’anticorps anti-Example 2: Inhibition of phagocytosis of platelets mediated by anti-
CD41 CD41
1/ Préparation des plaquettes 1 / Preparation of platelets
Les plaquettes ont été isolées à partir de sang périphérique de groupe sanguin O humain (EFS, Les Ulis) stocké à 22°C ±2°C toute la nuit puis marquées au PKH67 (Sigma) à une concentration finale de 2x106M et sensibilisées à 37 °C pendant 30 min sous agitation avec 1 pg/ml d'un anticorps monoclonal anti-CD41 (anticorps absolu) ou tampon de dilution (contrôle plaquettaire non sensibilisé) pour une suspension de plaquettes de 2x107 plaquettes/m L The platelets were isolated from peripheral blood of human blood group O (EFS, Les Ulis) stored at 22 ° C ± 2 ° C overnight then labeled with PKH67 (Sigma) at a final concentration of 2x10 6 M and sensitized. at 37 ° C for 30 min with stirring with 1 pg / ml of an anti-CD41 monoclonal antibody (absolute antibody) or dilution buffer (non-sensitized platelet control) for a platelet suspension of 2x10 7 platelets / m L
La lignée cellulaire de monocytes humains THP1 selon l’invention (lignée cellulaire THP1 CD16+) (1x106 cellules) a été pré-incubée pendant 30 min à 37°C avec des concentrations croissantes allant de 6,66x105 M, 6,66x10 e M, 6,66x107 M, à 6,66x108 M d’IglV à 10% (Iqymune, LFB) ou des fragments Fc recombinant obtenus selon la méthode décrite dans la demande internationale WO 2019/115773 (rFc AY068, rFc EY069 et rFc AY070), correspondant à 10, 1 , 0,1 et 0,01 mg/mL pour d’IglV à 10% (Iqymune, LFB) et 3,33 ; 0,33 ; 0,03 et 0,003 mg/mL pour les fragments Fc recombinant (rFc AY068, rFc EY069 et rFc AY070). The THP1 human monocyte cell line according to the invention (THP1 CD16 + cell line) (1x10 6 cells) was pre-incubated for 30 min at 37 ° C with increasing concentrations ranging from 6.66x10 5 M, 6.66x10 e M, 6.66x10 7 M, at 6.66x10 8 M 10% IglV (Iqymune, LFB) or recombinant Fc fragments obtained according to the method described in international application WO 2019/115773 (rFc AY068, rFc EY069 and rFc AY070), corresponding to 10, 1, 0.1 and 0.01 mg / mL for 10% IglV (Iqymune, LFB) and 3.33; 0.33; 0.03 and 0.003 mg / mL for the recombinant Fc fragments (rFc AY068, rFc EY069 and rFc AY070).
Le fragment Fc recombinant (rFc AY070) a été produit dans une lignée de chèvre transgénique alors que les fragments Fc recombinants (rFc AY068 et rFc EY069) ont été produit dans des cellules CHO recombinantes. Les fragments ont été conçus avec plusieurs mutations afin d’augmenter leurs affinités pour les récepteurs FcRn et CD16.The recombinant Fc fragment (rFc AY070) was produced in a transgenic goat line while the recombinant Fc fragments (rFc AY068 and rFc EY069) were produced in recombinant CHO cells. The fragments were designed with several mutations in order to increase their affinities for the FcRn and CD16 receptors.
Les variant rFc AY068 et rFc AY070 contiennent 5 mutations (K334N; P352S; A378V; V397N; N434Y et 1 -N glycosylation site (N297)). The rFc AY068 and rFc AY070 variants contain 5 mutations (K334N; P352S; A378V; V397N; N434Y and 1 -N glycosylation site (N297)).
Le variant rFc EY069 contient 6 mutations (Y296W, K334N; P352S; A378V; V397N; N434Y, et 1 -N glycosylation site (N297)). The rFc variant EY069 contains 6 mutations (Y296W, K334N; P352S; A378V; V397N; N434Y, and 1 -N glycosylation site (N297)).
2/ Phagocytose 2 / Phagocytosis
Les plaquettes marquées et sensibilisées avec un anticorps anti-plaquettes (2x107 plaquettes) ont été ajoutées à la lignée cellulaire de monocytes humains THP1 CD16+ (ratio 1 :20) et incubées pendant 1 heure à 37°C. Après incubation, les cellules THP1 ont été incubées avec du bleu trypan pour masquer la fluorescence des plaquettes marquées qui ne seraient pas internalisées de plus, la lignée cellulaire de monocytes humains THP1 a été marquée avec un anticorps fluorescent anti- CD45 (Beckman Coulter). La phagocytose médiée par des anticorps anti-plaquettes a été mesurée par cytométrie de flux (cytomètre de flux Galios, Beckman Coulter). Les résultats sont présentés aux Figures 3A à 3F. Platelets labeled and sensitized with anti-platelet antibody (2 × 10 7 platelets) were added to the human monocyte cell line THP1 CD16 + (ratio 1:20) and incubated for 1 hour at 37 ° C. After incubation, the THP1 cells were incubated with trypan blue to mask the fluorescence of the labeled platelets which would not be further internalized, the THP1 human monocyte cell line was labeled with an anti-CD45 fluorescent antibody (Beckman Coulter). The phagocytosis mediated by anti-platelet antibodies was measured by flow cytometry (Galios flow cytometer, Beckman Coulter). The results are shown in Figures 3A to 3F.
Lors de l'analyse du pourcentage de phagocytose, une moyenne de 20% de phagocytose des plaquettes non sensibilisées a été obtenue (données non présentées) et a été déduite des résultats de la phagocytose des plaquettes sensibilisées. When analyzing the percentage of phagocytosis, an average of 20% phagocytosis of nonsensitized platelets was obtained (data not shown) and was deduced from the results of phagocytosis of sensitized platelets.
Lorsque les plaquettes sont incubées avec 1 pg/mL d'anti-CD41 , on observe en moyenne 55% de phagocytose spécifique. Les résultats ont été normalisés sur des graphiques afin de comparer l'efficacité du produit sur les trois donneurs indépendamment de la phagocytose initiale sans produit. When the platelets are incubated with 1 µg / mL of anti-CD41, an average of 55% specific phagocytosis is observed. The results were normalized on graphs in order to compare the efficacy of the product on the three donors regardless of the initial phagocytosis without product.
Une inhibition dose-dépendante de la phagocytose a été observée de manière reproductible avec les produits testés. A dose-dependent inhibition of phagocytosis was observed reproducibly with the products tested.
Ainsi la lignée cellulaire constitue un modèle cellulaire fiable précis, sensible et reproductible de la thrombocytopénie immunitaire associée au purpura (ITP) permettant de discréminer l’efficacité thérapeutique in vitro de différents produits. The cell line thus constitutes a reliable, precise, sensitive and reproducible cell model of immune thrombocytopenia associated with purpura (ITP), making it possible to distinguish the therapeutic efficacy in vitro of various products.
Exemple 3 : Phagocytose des hématies médiée par l’anticorps anti-D Example 3: Phagocytosis of red blood cells mediated by anti-D antibody
1/ Préparation des hématies 1 / Preparation of red blood cells
Des hématies commerciales papainées (RBC) ont été lavés deux fois dans du NaCI à 0,9% pendant 5 minutes à 1730g et le culot a été mis en suspension dans 400mI_ de NaCI à 0,9%. La suspension est tout d’abord mélangé avec 2ml de diluent C et ensuite avec 2ml de solution de PKH67 à 4x106M dans le diluent C (concentration finale : 2x106M). Après un rapide mélange, la suspension a été incubée pendant 5 minutes dans l’obscurité. 4ml de sérum de veau foetal (SVF) ont été ajoutés, le surnageant a été éliminé et le culot lavé trois fois dans du NaCL à 0,9%. Le marquage par PKH67 a été contrôlé par cytométrie. Toutes les hématies présentent une fluorescence. Papain commercial red blood cells (RBC) were washed twice in 0.9% NaCl for 5 minutes at 1730g and the pellet was suspended in 400ml of 0.9% NaCl. The suspension is first of all mixed with 2 ml of diluent C and then with 2 ml of 4 × 10 6 M PKH67 solution in diluent C (final concentration: 2 × 10 6 M). After rapid mixing, the suspension was incubated for 5 minutes in the dark. 4ml of fetal calf serum (FCS) was added, the supernatant was removed and the pellet washed three times in 0.9% NaCL. Labeling with PKH67 was checked by cytometry. All red blood cells fluoresce.
2/ Phagocytose 2 / Phagocytosis
La phagocytose a été étudiée avec des hématies sensibilisées avec des quantités connues d’anticorps anti-D et des cellules THP1 CD16+. Les hématies (RBC) marquées avec le PKH67 sont lavées deux fois dans NaCI à 0,9% pendant 5 minutes à 1730 g et 50 pL d'une dilution 1 :30 de culots d’hématies dans du NaCI à 0,9% ont été mélangés avec 50 mI d’une suspension de microbilles fluorescentes (flowcount fluorospheres) et 2 ml de NaCI 0,9%. Phagocytosis was studied with red blood cells sensitized with known amounts of anti-D antibodies and THP1 CD16 + cells. Red blood cells (RBC) labeled with PKH67 are washed twice in 0.9% NaCl for 5 minutes at 1730 g and 50 µL of a 1: 30 dilution of red blood cells in 0.9% NaCl have was mixed with 50 ml of a suspension of fluorescent microbeads (flowcount fluorospheres) and 2 ml of 0.9% NaCl.
La concentration d’hématies est déterminée par cytométrie de flux. Les hématies ont ensuite été remises en suspension dans du NaCI 0,9% à 2x108 hématies/ml (± 15%).The concentration of red blood cells is determined by flow cytometry. The red blood cells were then resuspended in 0.9% NaCl at 2 × 10 8 red cells / ml (± 15%).
Les cellules THP1 CD16+ (lignée cellulaire de monocytes selon l’invention) sont comptées puis remises en suspension dans un milieu IMDM + 10% de sérum de veau foetal (SVF) à 1 x 106 cellules/ml (± 15%). The THP1 CD16 + cells (monocyte cell line according to the invention) are counted and then resuspended in IMDM medium + 10% fetal calf serum (FCS) at 1 x 10 6 cells / ml (± 15%).
Les hématies à une concentration de 2x108 hématies/mL dans NaCI 0,9% sont incubées avec des préparations d'anticorps anti-D (Roledumab) à 0,04, 0,08, 0,16, 0,31 , 0,62, 1 ,25, 2,5 et 5 pg/mL (v/v) ou avec du NaCI à 0,9% (hématies non sensibilisées (NS-RBC)) pendant 30 minutes à 37°C. Les échantillons sont lavés deux fois dans du milieu IMDM + 10% de FCS et les culots sont suspendus à 1x108 hématies/mL dans du milieu IMDM + 10% de SVF. Red cells at a concentration of 2 × 10 8 red cells / mL in 0.9% NaCl are incubated with anti-D antibody preparations (Roledumab) at 0.04, 0.08, 0.16, 0.31, 0, 62, 1, 25, 2.5 and 5 pg / mL (v / v) or with 0.9% NaCl (non-sensitized red blood cells (NS-RBC)) for 30 minutes at 37 ° C. The samples are washed twice in IMDM medium + 10% FCS and the pellets are suspended at 1x10 8 red blood cells / ml in IMDM medium + 10% FCS.
100 pL d’hématies à 1x108 hématies/mL sont mélangées à 100 pL de cellules THP1 CD16 + à 1x106 cellules/mL (soit un ratio cellule THP1/hématies de 1/100) en présence de 0,25 mg/mL d'immunoglobulines humaines normales (IVIG). Les essais ont été réalisés avec 10 échantillons, chacun en double exemplaire. Un échantillon de contrôle de la spécificité CD16a est réalisé avec des hématies sensibilisées en utilisant une concentration d’anti-D à 5 pg/mL et une concentration d'anticorps anti-CD16 à 5 pg/mL. L'incubation est effectuée à 37°C pendant 1 heure. À la fin de l'incubation, le marquage PKH67 est éteint en ajoutant 100 pL de bleu trypan, afin d’éliminer le signal des hématies collées aux cellules THP1 CD16+. 100 μL of red cells at 1x10 8 red cells / mL are mixed with 100 μL of THP1 CD16 + cells at 1x10 6 cells / mL (i.e. a THP1 cell / red cell ratio of 1/100) in the presence of 0.25 mg / mL d human normal immunoglobulins (IVIG). The tests were carried out with 10 samples, each in duplicate. A CD16a specificity control sample is performed with sensitized red blood cells using an anti-D concentration of 5 pg / mL and an anti-CD16 antibody concentration of 5 pg / mL. Incubation is carried out at 37 ° C. for 1 hour. At the end of the incubation, the PKH67 labeling is quenched by adding 100 μL of trypan blue, in order to eliminate the signal from the red blood cells stuck to the THP1 CD16 + cells.
Après une étape de lavage dans du NaCI 0,9%, les cellules THP1 CD16 + sont marquées avec un anticorps anti-CD45 fluorescent pendant 15 minutes à température ambiante et à l'abri de la lumière. Les échantillons sont lavés à nouveau et les hématies sont lysées avec 500 pL de solution de Versalyse Lysing pendant 20 minutes à la température ambiante, à l'abri de la lumière, afin d'éliminer les hématies non phagocytées (les hématies phagocytées par les cellules cibles ne sont pas sensibles à ces traitements). Les échantillons sont lavés à nouveau et fixés avec 500 pL de solution de fixation diluée au 1/40 avant analyse. Le pourcentage de cellules THP1 CD45+ contenant les hématies PKFI67 (pourcentage de phagocytose) et leur intensité de fluorescence moyenne PKFI67 (MFI) sont mesurés par cytométrie de flux avec un cytomètre Galios Flow de la société Beckman Coulter. Les résultats sont ensuite analysés avec le logiciel Kaluza Analysis. Les résultats sont présentés aux Figures 4A à 4D. After a step of washing in 0.9% NaCl, the THP1 CD16 + cells are labeled with a fluorescent anti-CD45 antibody for 15 minutes at room temperature and protected from light. The samples are washed again and the red blood cells are lysed with 500 μL of Versalyse Lysing solution for 20 minutes at room temperature, protected from light, in order to eliminate the non-phagocytized red blood cells (the red blood cells phagocytosed by the cells targets are not sensitive to these treatments). The samples are washed again and fixed with 500 μL of fixing solution diluted to 1/40 before analysis. The percentage of CD45 + THP1 cells containing the PKFI67 red blood cells (percentage of phagocytosis) and their mean PKFI67 fluorescence intensity (MFI) are measured by flow cytometry with a Galios Flow cytometer from the company Beckman Coulter. The results are then analyzed with the Kaluza Analysis software. The results are shown in Figures 4A to 4D.
Conclusions : Conclusions:
L'activité de la phagocytose (pourcentage (Figure 4A) et MFI (Figure 4B)) est proportionnelle à la concentration en anti-D avec un maximum de 91% de phagocytose. Le contrôle négatif sans anti-D (NS-RBC) et avec l'anticorps anti-CD16 (S-RBC + Anti- CD16) présente respectivement 2% et 4% (Figure 4C) de phagocytose. Les signaux de phagocytose sont spécifiquement médiés par la liaison des hématies revêtus d' anti-D au récepteur CD16a. The activity of phagocytosis (percentage (Figure 4A) and MFI (Figure 4B)) is proportional to the anti-D concentration with a maximum of 91% phagocytosis. The negative control without anti-D (NS-RBC) and with the anti-CD16 antibody (S-RBC + Anti-CD16) shows 2% and 4% respectively (FIG. 4C) of phagocytosis. Phagocytosis signals are specifically mediated by binding of anti-D coated red blood cells to the CD16a receptor.
La lignée cellulaire selon l’invention exprime donc, en plus des CD32 et CD64, des CD16 fonctionnels. The cell line according to the invention therefore expresses, in addition to CD32 and CD64, functional CD16s.
Exemple 4 : Méthode de sélection d’anticorps à forte activité de phagocytose (ADCP) Example 4: Method for selecting antibodies with strong phagocytosis activity (ADCP)
1/ Sensibilité 1 / Sensitivity
Une dégradation forcée a été effectuée sur l’anticorps anti-D (Roledumab, lot CB04), afin d'examiner la sensibilité de la méthode et de déterminer si elle indique la stabilité. Forced degradation was performed on the anti-D antibody (Roledumab, lot CB04), in order to examine the sensitivity of the method and to determine if it indicates stability.
Le lot a été fourni dans des seringues pré remplies à une concentration en protéines de 0,3 mg/mL dans la formulation suivante : citrate trisodique dihydraté (8,82 g / L) à pH 6,5, chlorure de sodium (3,25 g / L), mannitol (17 g / L) et Polysorbate 80 à 400 ppm. The lot was supplied in pre-filled syringes at a protein concentration of 0.3 mg / mL in the following formulation: trisodium citrate dihydrate (8.82 g / L) at pH 6.5, sodium chloride (3, 25 g / L), mannitol (17 g / L) and Polysorbate 80 at 400 ppm.
Les contraintes de dégradation se concentreront sur le stress thermique, l'oxydation et la déglycosylation. Les échantillons préparés sont décrits dans le tableau 2 ci-dessous.
Figure imgf000035_0002
Degradation stresses will focus on heat stress, oxidation and deglycosylation. The samples prepared are described in Table 2 below.
Figure imgf000035_0002
Tableau
Figure imgf000035_0001
lot CB04). 1.1/ Sensibilité au stress thermique Board
Figure imgf000035_0001
lot CB04). 1.1 / Sensitivity to thermal stress
Le stress thermique est utilisé pour accélérer les phénomènes de dégradation chimique ou physique. Heat stress is used to accelerate the phenomena of chemical or physical degradation.
Roledumab (anticorps anti-D - lot CB04) est connu pour être sensible à la température; un stress thermique induit une agrégation, une modification structurelle (fragmentation, modification chimique...) et une perte d'activité (activité de CD16a). Les flacons de Rroledumab seront placés à + 40 ° C pendant 3 mois, à + 50 ° C pendant 3 semaines et 6 semaines. Roledumab (anti-D antibody - batch CB04) is known to be temperature sensitive; heat stress induces aggregation, structural modification (fragmentation, chemical modification, etc.) and loss of activity (CD16a activity). Rroledumab vials will be placed at + 40 ° C for 3 months, at + 50 ° C for 3 weeks and 6 weeks.
Le pourcentage de phagocytose et le MFI en fonction de la concentration en anticorps anti-D (Roledumab - lot CB04) ont été analysés pour comparer les valeurs EC50 et la valeur maximale de l'échantillon chauffé. Les résultats sont présentés à la figure 6. The percentage of phagocytosis and MFI as a function of anti-D antibody concentration (Roledumab - batch CB04) were analyzed to compare the EC50 values and the maximum value of the heated sample. The results are shown in Figure 6.
La figure 6 montre une diminution significative mais légère du pourcentage de phagocytose après chauffage pendant 6 semaines à + 50 ° C (EC50: 77%, en haut: 86%). En revanche, une diminution très importante du MFI Top a été observée après chauffage pour atteindre 40%, après 6 semaines à + 50 ° C. Le stress thermique et la dégradation associée semblent avoir un impact négatif significatif sur l'activité de la phagocytose, en particulier sur la quantité d’hématies ingérées. Figure 6 shows a significant but slight decrease in the percentage of phagocytosis after heating for 6 weeks at + 50 ° C (EC50: 77%, top: 86%). On the other hand, a very significant decrease in MFI Top was observed after heating to reach 40%, after 6 weeks at + 50 ° C. The thermal stress and the associated degradation seem to have a significant negative impact on the activity of phagocytosis, in particular on the quantity of red blood cells ingested.
1.2/ Sensibilité chimique : oxydation par Fl?0? 1.2 / Chemical sensitivity: oxidation by Fl ? 0 ?
La dégradation oxydative qui se produit dans les traitements biothérapeutiques est l’une des voies de dégradation chimiques des anticorps monoclonaux recombinants (AcM). Les anticorps monoclonaux sont exposés à des conditions de traitement et de stockage susceptibles d’influencer le taux et l’ampleur de ces modifications. L'oxydation de la méthionine (primaire), ainsi que de la cystéine, de l'histidine, du tryptophane et de la tyrosine peut être induite par une incubation avec des agents oxydants tels que Fl202.The oxidative degradation that occurs in biotherapeutic treatments is one of the chemical degradation pathways of recombinant monoclonal antibodies (MAbs). Monoclonal antibodies are exposed to processing and storage conditions that can influence the rate and magnitude of these changes. Oxidation of methionine (primary), as well as cysteine, histidine, tryptophan and tyrosine can be induced by incubation with oxidizing agents such as Fl 2 0 2 .
Les sources potentielles d'oxydation comprennent l'utilisation d'excipients contenant des quantités infimes d'espèces oxydantes (par exemple, le polysorbate 80) ou le contact de la substance médicamenteuse avec des résidus d'agents désinfectants ou dépyrogénisants possédant un certain potentiel oxydant. Potential sources of oxidation include the use of excipients containing trace amounts of oxidizing species (for example, polysorbate 80) or contact of the drug substance with residues of disinfecting or depyrogenizing agents having some oxidative potential. .
La contrainte d'oxydation a été réalisée en ajoutant 10 mM, 50 mM et 100 mM de Fl202 avec une durée d'incubation de 24 heures à + 25 ° C. Un contrôle négatif avec le même volume que Fl202 a été réalisé avec de l'eau. Le pourcentage de phagocytose et le MFI en fonction de la concentration en anticorps anti-D (Roledumab - lot CB04) ont été analysés pour comparer les valeurs EC50 et la valeur maximale de l'échantillon oxydé. Les résultats sont présentés à la figure 7. The oxidation stress was carried out by adding 10 mM, 50 mM and 100 mM of Fl 2 0 2 with an incubation period of 24 hours at + 25 ° C. A negative control with the same volume as Fl 2 0 2 was made with water. The percentage of phagocytosis and MFI as a function of anti-D antibody concentration (Roledumab - batch CB04) were analyzed to compare the EC50 values and the maximum value of the oxidized sample. The results are shown in Figure 7.
La figure 7 ne montre aucune diminution de l'activité de la phagocytose après un traitement avec H202 10 mM. Une légère diminution du pourcentage de phagocytose (EC50) après un traitement à 50 mM et à 100 mM a été observée (respectivement 87% et 79%). Figure 7 shows no decrease in phagocytosis activity after treatment with 10 mM H 2 O 2. A slight decrease in the percentage of phagocytosis (EC50) after treatment at 50 mM and 100 mM was observed (87% and 79% respectively).
En revanche, comme pour le stress thermique, une diminution plus importante et comparable du sommet MFI a été observée après traitement avec 50 mM et 100 mM de H202: 75% et 77% respectivement. On the other hand, as for heat stress, a more significant and comparable decrease in the MFI top was observed after treatment with 50 mM and 100 mM of H 2 0 2 : 75% and 77% respectively.
Le stress d'oxydation et la dégradation associée (fragmentation, oxydation...) semblent avoir un impact négatif significatif sur l'activité de la phagocytose, en particulier sur la quantité de globules rouges ingérée. Oxidative stress and the associated degradation (fragmentation, oxidation, etc.) seem to have a significant negative impact on the activity of phagocytosis, in particular on the quantity of red blood cells ingested.
1.3/ Déalvcosylation 1.3 / Dealvcosylation
DF5 est un anticorps monoclonal anti-D lgG1 produit par une lignée de cellules lymphoblastoïdes humaines. Cet anticorps hautement fucosylé présente une faible affinité de liaison pour FcyRIIIa (CD16a). DF5 is an anti-D IgG1 monoclonal antibody produced by a human lymphoblastoid cell line. This highly fucosylated antibody exhibits low binding affinity for FcyRIIIa (CD16a).
La déglycosylation a été effectuée en ajoutant 3 pg d'EndoS2 à 150 pg d’anticorps anti-D (Roledumab, lot CB04, appelé « CB04 ») avec un temps d'incubation de 2 heures à + 37 ° C. Un contrôle négatif avec le même volume que Fl202 est réalisé avec de l'eau. The deglycosylation was carried out by adding 3 μg of EndoS2 to 150 μg of anti-D antibody (Roledumab, batch CB04, called “CB04”) with an incubation time of 2 hours at + 37 ° C. A negative control with the same volume as Fl 2 0 2 is carried out with water.
Le pourcentage de phagocytose et le MFI en fonction de la concentration en Aanti-D ont été analysés pour comparer les valeurs EC50 et Top de DF5 et de l’anticorps anti-D (Roledumab, lot CB04). Les résultats sont présentés à la figure 8. Percent phagocytosis and MFI as a function of Aanti-D concentration were analyzed to compare the EC50 and Top values of DF5 and anti-D antibody (Roledumab, lot CB04). The results are shown in Figure 8.
La figure 8 montre que l'anticorps hautement fucosylé DF5 présente une faible activité en phagocytose (A / D) et que l’anticorps anti-D (Roledumab, lot CB04) déglycosylé n'a pas été capable d’induire la phagocytose des hématies (B / E). Le contrôle négatif (C / F) est comparable à l’anticorps anti-D (Roledumab, lot CB04) non traité. Figure 8 shows that the highly fucosylated antibody DF5 exhibits low phagocytosis activity (A / D) and that the deglycosylated anti-D antibody (Roledumab, batch CB04) was not able to induce phagocytosis of red blood cells. (B / E). The negative control (C / F) is comparable to the untreated anti-D antibody (Roledumab, lot CB04).
La méthode permet donc la sélection d’anticorps selon leur capacité à phagocyter (ADCP : Antibody-Dependent Cell Phagocytosis). The method therefore allows the selection of antibodies according to their ability to phagocytose (ADCP: Antibody-Dependent Cell Phagocytosis).
2/ Précision 2 / Precision
La précision est l'étroite concordance entre les mesures d'échantillons multiples d'un échantillon homogène dans les conditions recommandées. La précision a été étudiée à l'aide de l’anticorps anti-D (Roledumab) lot CB04. Precision is the close agreement between measurements of multiple samples of a homogeneous sample under recommended conditions. The precision was studied using the anti-D antibody (Roledumab) lot CB04.
Vingt-cinq dosages de deux séries indépendantes de 8 déterminations de l’anticorps anti- D (Roledumab) lot CB04 ont été effectués. Twenty-five assays of two independent series of 8 determinations of anti-D antibody (Roledumab) lot CB04 were performed.
L’EC50, le maximum de phagocytose et l’intensité de fluorescence moyenne (MFI) de chaque série (2 valeurs / paramètre / dosage, soit 50 valeurs / paramètre) sont utilisés pour calculer l'écart type (DS), le coefficient de variation (C V) et l'intervalle de confiance (IC) afin de déterminer la précision intermédiaire de la méthode (IP ou CVR). The EC50, the maximum phagocytosis and the mean fluorescence intensity (MFI) of each series (2 values / parameter / assay, i.e. 50 values / parameter) are used to calculate the standard deviation (SD), the coefficient of variation (CV) and confidence interval (CI) to determine the intermediate precision of the method (IP or CVR).
Pour cette étude, 3 cryotubes de lignée cellulaire THP1 CD16 +, 9 préparations de hématies (marquage PKH67) et différents lots de réactifs, dont 3 lots de kit PKH67, ont été utilisés. L'analyse statistique est présentée dans le tableau 3 ci-dessous. For this study, 3 cryotubes of the THP1 CD16 + cell line, 9 red blood cell preparations (PKH67 labeling) and different lots of reagents, including 3 lots of PKH67 kit, were used. The statistical analysis is presented in Table 3 below.
Tableau 3 : Précision intermédiaire de la méthode
Figure imgf000038_0001
Table 3: Intermediate precision of the method
Figure imgf000038_0001
Légende: * Variance IP= S2 R = S2 r + S2 g CVR = SR/p x 100 Legend: * Variance IP = S 2 R = S 2 r + S 2 g CV R = S R / px 100
Cl = résultat ± t x SR Cl = result ± tx S R
La précision intermédiaire est de 14% pour le paramètre EC50 quel que soit le signal lu (% de phagocytose ou MFI) et de 4% pour le pourcentage maximum de phagocytose (%Top). Pour le MFI Top, ce signal étant directement dépendant de la fluorescence des hématies, cela diffère d’un test à l’autre, seule la répétabilité a été calculée, elle est de 8%. The intermediate precision is 14% for the EC50 parameter regardless of the signal read (% phagocytosis or MFI) and 4% for the maximum percentage of phagocytosis (% Top). For the MFI Top, this signal being directly dependent on the fluorescence of the red blood cells, this differs from one test to another, only the repeatability was calculated, it is 8%.
La méthode est donc suffisamment précise pour permettre de sélectionner des anticorps selon leur capacité ADCP. Conclusions : The method is therefore sufficiently precise to make it possible to select antibodies according to their ADCP capacity. Conclusions:
Le test de phagocytose développé pour les hématies sensibilisées par l’anticorps anti-D utilisant la lignée cellulaire de monocytes selon l’invention (cellules THP1 CD16 +) est:The phagocytosis test developed for red blood cells sensitized by anti-D antibody using the monocyte cell line according to the invention (THP1 CD16 + cells) is:
- Précis et reproductible : la variation maximale de 14% a été obtenue lors de l'analyse statistique de 25 analyses indépendantes.- Accurate and reproducible: the maximum variation of 14% was obtained during the statistical analysis of 25 independent analyzes.
- Sensible, car une évolution de l’EC50 et du Top en fonction du type de la dégradation et proportionnelle à l'intensité de la dégradation a été observée, avec le paramètre Top de fluorescence, qui semble être le plus pertinent pour l'étude d'échantillons stressés/modifiés structurellement. - Sensitive, because an evolution of the EC50 and the Top depending on the type of degradation and proportional to the intensity of the degradation was observed, with the Top parameter of fluorescence, which seems to be the most relevant for the study of structurally stressed / altered samples.
Exemple 5 : Phagocytose de bactérie Escherichia coli (E. Coli) médiée par les immunoglobulines polyvalentes G Example 5 Phagocytosis of Escherichia coli (E. Coli) bacteria mediated by polyvalent immunoglobulins G
Ce mode opératoire décrit les étapes à réaliser pour évaluer la capacité d’immunoglobulines polyvalentes à induire la phagocytose de bactéries E. Coli par des cellules monocytaires humaines THP1 exprimant les récepteurs Fc (FcyRs) CD32, CD64 et transfectées avec le récepteur CD16a. This procedure describes the steps to be carried out in order to assess the capacity of polyvalent immunoglobulins to induce phagocytosis of E. Coli bacteria by human THP1 monocytic cells expressing the Fc receptors (FcyRs) CD32, CD64 and transfected with the CD16a receptor.
In vivo, le phénomène de phagocytose a pour but la destruction d’agents pathogènes ayant pénétrés dans l’organisme. La phagocytose se déroule en 2 phases : In vivo, the phagocytosis phenomenon aims to destroy pathogens that have entered the body. Phagocytosis takes place in 2 phases:
- phase de reconnaissance entre les cellules phagocytaires et les antigènes du microorganisme par l’intermédiaire d’opsonines. L’opsonisation est une liaison entre les immunoglobulines recouvrant spécifiquement les antigènes du microorganisme et leurs récepteurs présents à la surface des phagocytes (CD16a, CD32 et CD64) associée à une liaison avec le complément (C3b).- phase of recognition between phagocytic cells and antigens of the microorganism via opsonins. Opsonization is a binding between the immunoglobulins specifically covering the antigens of the microorganism and their receptors on the surface of phagocytes (CD16a, CD32 and CD64) associated with binding with complement (C3b).
- phase d’endocytose : le microorganisme est ensuite ingéré par déformation membranaire de la cellule phagocytaire et se retrouve dans une vésicule cytoplasmique appelée phagosome. La fusion du phagosome avec les lysosomes entraîne sa digestion et sa destruction. Les débris sont rejetés à l’extérieur de la cellule. - endocytosis phase: the microorganism is then ingested by membrane deformation of the phagocytic cell and is found in a cytoplasmic vesicle called a phagosome. The fusion of the phagosome with the lysosomes leads to its digestion and destruction. The debris is thrown outside the cell.
Des bactéries E. Coli marquées par un fluorochrome et opsonisées avec des immunoglobulines polyvalentes, sont incubées avec les cellules THP1 CD16+ à +37°C. La présence de bactéries fluorescentes internalisées par les cellules phagocytaires est recherchée par cytométrie en flux. 1/ Etape d’opsonisation E. Coli bacteria labeled with a fluorochrome and opsonized with polyvalent immunoglobulins are incubated with the THP1 CD16 + cells at + 37 ° C. The presence of fluorescent bacteria internalized by the phagocytic cells is sought by flow cytometry. 1 / Opsonization step
Différentes concentration de solutions d’immunoglobulines sont testées : 5 mg/mL en eau physiologique, 2,5 mg/mL en eau physiologique, 1 ,25 mg/mL en eau physiologique, 0,625 mg/mL en eau physiologique, 0,31 mg/mL en eau physiologique, 5 mg/mL en eau physiologique, 0,15 mg/mL en eau physiologique et 0 mg/mL en eau physiologique. Different concentrations of immunoglobulin solutions are tested: 5 mg / mL in physiological water, 2.5 mg / mL in physiological water, 1.25 mg / mL in physiological water, 0.625 mg / mL in physiological water, 0.31 mg / mL in physiological water, 5 mg / mL in physiological water, 0.15 mg / mL in physiological water and 0 mg / mL in physiological water.
20 pl de bactéries E. Coli marquées FITC non opsonisées sont incubées pendant une heure à +37°C au bain-marie, à l’abri de la lumière, avec 100 pl de solution d’immunoglobulines polyvalentes G à tester dans un tube de cytométrie. 20 μl of non-opsonized FITC-labeled E. Coli bacteria are incubated for one hour at + 37 ° C in a water bath, protected from light, with 100 μl of solution of polyvalent immunoglobulins G to be tested in a tube of cytometry.
Deux tubes témoin négatif (bactéries non opsonisées) sont préparés par addition de 100 pl d’eau physiologique à 20 pl de bactéries E. Coli non opsonisées marquées FITC. Two negative control tubes (non-opsonized bacteria) are prepared by adding 100 μl of physiological water to 20 μl of non-opsonized E. Coli bacteria labeled FITC.
Après l’incubation, les tubes sont lavés deux fois en ajoutant 3 ml d’eau physiologique/tube et centrifugé pendant 5 minutes à +4°C et à 250 g. Les surnageant sont ensuite éliminés et les culots repris dans 20 pL de milieu IMDM (Iscoves Modified Dulbecco's Medium) + 10% Sérum de veau foetal After incubation, the tubes are washed twice by adding 3 ml of physiological water / tube and centrifuged for 5 minutes at + 4 ° C and 250 g. The supernatants are then removed and the pellets taken up in 20 μL of IMDM medium (Iscoves Modified Dulbecco's Medium) + 10% Fetal calf serum
2/ Etape de phagocytose : 2 / Phagocytosis step:
20 mI_ de bactéries-FITC opsonisées sont mélangées à 100 pL de cellules THP1 CD16 + à 1x106 cellules/m, avec des concentrations croissantes d'immunoglobulines G polyvalentes. Les essais ont été réalisés en double exemplaire. Un échantillon de contrôle négatif est réalisé avec 20mI bactéries non opsonisées-FITC auxquelles sont ajoutées 100 mI de cellules THP1 CD16+ à 1x106 cellules/mL. L'incubation est effectuée à 37°C pendant 1 heure. À la fin de l'incubation, le marquage FITC est éteint en ajoutant 100 pL de bleu trypan dilué au 1/20 et maintenu à 4°C, afin d’éliminer le signal des bactéries collées aux cellules THP1 CD16+. Un lavage est ensuite effectué en ajoutant 3 ml d’eau physiologique et en centrifugeant les tubes pendant 3 minutes à +4°C et à 600 g. 20 ml of opsonized FITC-bacteria are mixed with 100 μl of THP1 CD16 + cells at 1x10 6 cells / m, with increasing concentrations of polyvalent immunoglobulins G. The tests were carried out in duplicate. A negative control sample is produced with 20 ml of non-opsonized FITC bacteria to which 100 ml of THP1 CD16 + cells at 1x10 6 cells / ml are added. Incubation is carried out at 37 ° C. for 1 hour. At the end of the incubation, the FITC labeling is quenched by adding 100 μL of trypan blue diluted to 1/20 and maintained at 4 ° C., in order to eliminate the signal from the bacteria stuck to the THP1 CD16 + cells. Washing is then carried out by adding 3 ml of physiological water and by centrifuging the tubes for 3 minutes at + 4 ° C. and at 600 g.
Après une étape de lavage, les cellules THP1 CD16 + sont marquées avec un anticorps anti-CD45 fluorescent pendant 15 minutes à température ambiante et à l'abri de la lumière. Les échantillons sont lavés à nouveau par ajout de 3 ml d’eau physiologique et en centrifugeant les tubes pendant 3 minutes à +4°C et à 600 g. After a washing step, the THP1 CD16 + cells are labeled with a fluorescent anti-CD45 antibody for 15 minutes at room temperature and protected from light. The samples are washed again by adding 3 ml of physiological water and centrifuging the tubes for 3 minutes at + 4 ° C and at 600 g.
Les échantillons sont lavés à nouveau et fixés avec 500 pL de solution de fixation diluée au 1/40 dans le PBS avant analyse. Le pourcentage de cellules THP1 CD45+ contenant lesbactéries FITC (pourcentage de phagocytose) et leur intensité de fluorescence moyenne FITC (MFI) sont mesurés par cytométrie de flux avec un cytomètre Galios Flow de la société Beckman Coulter. Les résultats sont ensuite analysés avec le logiciel Kaluza Analysis. The samples are washed again and fixed with 500 μL of fixing solution diluted 1/40 in PBS before analysis. The percentage of THP1 CD45 + cells containing FITC bacteria (percentage of phagocytosis) and their fluorescence intensity FITC mean (MFI) are measured by flow cytometry with a Galios Flow cytometer from the company Beckman Coulter. The results are then analyzed with the Kaluza Analysis software.
Exemple 6 : Phagocytose des hématies de lapin médiées par les immunoglobulines polyvalentes G Example 6 Phagocytosis of rabbit red blood cells mediated by polyvalent immunoglobulins G
Ce mode opératoire décrit les étapes à réaliser pour évaluer la capacité d’immunoglobulines polyvalentes à induire la phagocytose d’hématies de lapin, possédant des sites antigéniques de type glycanique similaire à certaines bactéries, par des cellules monocytaires humaines THP1 exprimant les récepteurs Fc (FcyRs) CD32, CD64 et transfectées avec le récepteur CD16a. This procedure describes the steps to be carried out in order to evaluate the capacity of polyvalent immunoglobulins to induce phagocytosis of rabbit red blood cells, possessing antigenic sites of the glycanic type similar to certain bacteria, by THP1 human monocytic cells expressing the Fc receptors (FcyRs ) CD32, CD64 and transfected with the CD16a receptor.
In vivo, le phénomène de phagocytose a pour but la destruction d’agents pathogènes ayant pénétrés dans l’organisme. La phagocytose se déroule en 2 phases : In vivo, the phagocytosis phenomenon aims to destroy pathogens that have entered the body. Phagocytosis takes place in 2 phases:
- phase de reconnaissance entre les cellules phagocytaires et les antigènes du microorganisme par l’intermédiaire d’opsonines. L’opsonisation est une liaison entre les immunoglobulines recouvrant spécifiquement les antigènes du microorganisme et leurs récepteurs présents à la surface des phagocytes (CD16, CD32 et CD64) associée à une liaison avec le complément (C3b). - phase of recognition between phagocytic cells and antigens of the microorganism via opsonins. Opsonization is a binding between the immunoglobulins specifically covering the antigens of the microorganism and their receptors present on the surface of phagocytes (CD16, CD32 and CD64) associated with binding with complement (C3b).
- phase d’endocytose : le microorganisme est ensuite ingéré par déformation membranaire de la cellule phagocytaire et se retrouve dans une vésicule cytoplasmique appelée phagosome. La fusion du phagosome avec les lysosomes entraîne sa digestion et sa destruction. Les débris sont rejetés à l’extérieur de la cellule. - endocytosis phase: the microorganism is then ingested by membrane deformation of the phagocytic cell and is found in a cytoplasmic vesicle called a phagosome. The fusion of the phagosome with the lysosomes leads to its digestion and destruction. The debris is thrown outside the cell.
Des hématies de lapin marquées par un fluorochrome et opsonisées avec des immunoglobulines polyvalentes, sont incubées avec les cellules THP1 CD16+ à +37°C. La présence d’hématies fluorescentes internalisées par les cellules phagocytaires est recherchée par cytométrie en flux. Rabbit red blood cells labeled with a fluorochrome and opsonized with polyvalent immunoglobulins are incubated with the THP1 CD16 + cells at + 37 ° C. The presence of fluorescent red blood cells internalized by the phagocytic cells is sought by flow cytometry.
1/ Lavage des hématies de lapin 1 / Washing of rabbit red blood cells
Les hématies de lapin (2mpl) sont fraîchement prélevées le jour du test à l’aide d’une seringue stérile contenant un anticoagulant (citrate). Les hématies sont ensuite laver trois fois avec 10 mL d’eau physiologique par centrifugation à 1730 g pendant 5 minutes. Après 3 lavages successifs, les culots globulaires sont repris avec 400 pL d’eau physiologique. The rabbit red blood cells (2mpl) are freshly taken on the day of the test using a sterile syringe containing an anticoagulant (citrate). The red blood cells are then washed three times with 10 ml of physiological water by centrifugation at 1730 g for 5 minutes. After 3 successive washes, the red blood cells are taken up in 400 μL of physiological water.
2/ Marquage des hématies de lapin au PKH67 2 / Labeling of rabbit red blood cells with PKH67
La suspension est tout d’abord mélangé avec 2ml de diluent C et ensuite avec 2ml de solution de PKH67 à 4x10 ®M diluée au 1/250 en diluent C (concentration finale : 2x10 ®M). Après un rapide mélange, la suspension a été incubée pendant 5 minutes dans l’obscurité. 4ml de sérum de veau foetal (SVF) ont été ajoutés, le surnageant a été éliminé par centrifugation pendant 5 min à 1730g et le culot lavé trois fois dans de 15 ml eau physiologique. Le marquage par PKH67 a été contrôlé par cytométrie. Toutes les hématies présentent une fluorescence. Réajuster la suspension d’hématies de lapin à 200 x 10® cellules/mL par ajout d’eau physiologique. The suspension is first of all mixed with 2 ml of diluent C and then with 2 ml of PKH67 solution at 4x10 ® M diluted to 1/250 in diluent C (final concentration: 2x10 ® M). After rapid mixing, the suspension was incubated for 5 minutes in the dark. 4 ml of fetal calf serum (FCS) were added, the supernatant was removed by centrifugation for 5 min at 1730 g and the pellet washed three times in 15 ml of physiological water. Labeling with PKH67 was checked by cytometry. All red blood cells fluoresce. Readjust the suspension of rabbit red blood cells to 200 x 10 ® cells / mL by adding physiological water.
3/ Sensibilisation des hématies de lapin : 3 / Sensitization of rabbit red blood cells:
Différentes concentration de solutions d’immunoglobulines G sont testées : 5 mg/mL en eau physiologique, 2,5 mg/mL en eau physiologique, 1 ,25 mg/mL en eau physiologique, 0,625 mg/mL en eau physiologique, 0,31 mg/mL en eau physiologique, 5 mg/mL en eau physiologique, 0,15 mg/mL en eau physiologique et 0 mg/mL en eau physiologique. Incuber pendant une heure à +37°C au bain-marie, à l’abri de la lumière, 150 pL de suspensions globulaires à 200 x 106 hématies de lapin/mL marquées au PKH-67 avec 150 pL de solution d’immunoglobulines à tester dans un tube de cytométrie. Different concentrations of immunoglobulin G solutions are tested: 5 mg / mL in physiological water, 2.5 mg / mL in physiological water, 1.25 mg / mL in physiological water, 0.625 mg / mL in physiological water, 0.31 mg / mL in physiological water, 5 mg / mL in physiological water, 0.15 mg / mL in physiological water and 0 mg / mL in physiological water. Incubate for one hour at + 37 ° C in a water bath, protected from light, 150 pL of globular suspensions at 200 x 10 6 rabbit red cells / mL labeled with PKH-67 with 150 pL of immunoglobulin solution to be tested in a cytometry tube.
Deux tubes témoin négatif (hématies non opsonisées) sont préparés par addition de 150 pL d’eau physiologique à 150 pL de suspensions globulaires à 200 x 106 hématies de lapin/mL marquées au PKH67. Two negative control tubes (non-opsonized red blood cells) are prepared by adding 150 μL of physiological water to 150 μL of globular suspensions at 200 × 10 6 rabbit red cells / mL labeled with PKH67.
Après l’incubation, les tubes sont lavés deux fois en ajoutant 3 ml de milieu IMDM+ 10%SVF par tube et centrifugé pendant 5 minutes à 1730 g. Les surnageant sont ensuite éliminés et les culots repris dans 300 pL de milieu IMDM+ 10%SVF (100x106 hématies/m L) After the incubation, the tubes are washed twice by adding 3 ml of IMDM + 10% FCS medium per tube and centrifuged for 5 minutes at 1730 g. The supernatants are then removed and the pellets taken up in 300 μL of IMDM + 10% FCS medium (100 × 10 6 red blood cells / m L)
4/ Etape de phagocytose : 4 / Phagocytosis step:
La phagocytose a été étudiée avec des hématies sensibilisées avec des quantités connues d’immunoglobulines G et des cellules THP1 CD16+. Les hématies de lapin marquées avec le PKH67 sont mélangées à 100 pL de cellules THP1 CD16 + à 1x106 cellules/ml, avec des concentrations croissantes d'immunoglobulines G polyvalentes. Les essais ont été réalisés en double exemplaire. Un échantillon de contrôle négatif est réalisé avec 10OmI d’hématies de lapin marquées au PKH67 auxquelles sont ajoutées 100 mI de cellules THP1 CD16+ à 1x106 cellules/mL. L'incubation est effectuée à 37°C pendant 1 heure. À la fin de l'incubation, le marquage PKH67est éteint en ajoutant 100 pL de bleu trypan dilué au 1/20 et maintenu à 4°C, afin d’éliminer le signal des hématies de lapîn collées aux cellules THP1 CD16+. Un lavage est ensuite effectué en ajoutant 3 ml d’eau physiologique et en centrifugeant les tubes pendant 3 minutes à +4°C et à 600 g. Phagocytosis was studied with red blood cells sensitized with known amounts of immunoglobulins G and THP1 CD16 + cells. The rabbit red blood cells labeled with PKH67 are mixed with 100 μL of THP1 CD16 + cells at 1x10 6 cells / ml, with increasing concentrations of polyvalent immunoglobulins G. The tests were carried out in duplicate. A negative control sample is produced with 10OmI of rabbit red blood cells labeled with PKH67 to which are added 100mI of THP1 CD16 + cells at 1x10 6 cells / mL. Incubation is carried out at 37 ° C. for 1 hour. At the end of the incubation, the PKH67 labeling is quenched by adding 100 μL of trypan blue diluted to 1/20 and maintained at 4 ° C., in order to eliminate the signal from the rabbit red blood cells stuck to the THP1 CD16 + cells. Washing is then carried out by adding 3 ml of physiological water and by centrifuging the tubes for 3 minutes at + 4 ° C. and at 600 g.
Après une étape de lavage, les cellules THP1 CD16 + sont marquées avec 5pl anticorps anti-CD45 fluorescent dans 500pl de PBS par tube pendant 15 minutes à température ambiante et à l'abri de la lumière. Les échantillons sont lavés à nouveau par ajout de 3 ml d’eau physiologique et en centrifugeant les tubes pendant 3 minutes à +4°C et à 600 g.After a washing step, the THP1 CD16 + cells are labeled with 5 μl fluorescent anti-CD45 antibody in 500 μl of PBS per tube for 15 minutes at room temperature and protected from light. The samples are washed again by adding 3 ml of physiological water and centrifuging the tubes for 3 minutes at + 4 ° C and at 600 g.
Les échantillons sont lavés à nouveau et les hématies sont lysées avec 500 pL de solution de Versalyse Lysing pendant 20 minutes à la température ambiante, à l'abri de la lumière, afin d'éliminer les hématies non phagocytées (les hématies phagocytées par les cellules cibles ne sont pas sensibles à ces traitements). Les échantillons sont lavés à nouveau et fixés avec 500 pL de solution de fixation diluée au 1/40 avant analyse. Le pourcentage de cellules THP1 CD45+ contenant les hématies PKH67 (pourcentage de phagocytose) et leur intensité de fluorescence moyenne PKH67 (MFI) sont mesurés par cytométrie de flux avec un cytomètre Galios Flow de la société Beckman Coulter. Les résultats sont ensuite analysés avec le logiciel Kaluza Analysis. Lecture des tubes au cytomètre Gallios (Beckman Coulter) (Conservation à l’abri de la lumière avant la lecture) : expression de PKH-67 en FL1 avec une fenêtre sur les cellules CD45+. The samples are washed again and the red blood cells are lysed with 500 μL of Versalyse Lysing solution for 20 minutes at room temperature, protected from light, in order to eliminate the non-phagocytized red blood cells (the red blood cells phagocytosed by the cells targets are not sensitive to these treatments). The samples are washed again and fixed with 500 μL of fixing solution diluted to 1/40 before analysis. The percentage of CD45 + THP1 cells containing the PKH67 red blood cells (percentage of phagocytosis) and their mean PKH67 fluorescence intensity (MFI) are measured by flow cytometry with a Galios Flow cytometer from the company Beckman Coulter. The results are then analyzed with the Kaluza Analysis software. Reading the tubes on the Gallios cytometer (Beckman Coulter) (Store in the dark before reading): expression of PKH-67 in FL1 with a window on CD45 + cells.
Exemple 7 : Inhibition par des immunoglobulines G polyvalentes de la phagocytose d’hématies opsonisées Example 7: Inhibition by polyvalent immunoglobulins G of the phagocytosis of opsonized red blood cells
Ce mode opératoire décrit les étapes à réaliser pour évaluer la capacité d’immunoglobulines polyvalentes à inhiber la phagocytose d’hématies humaines opsonisées par des anticorps anti-hématies (modèle d’Anémie Hémolytique Auto- Immune), par des cellules monocytaires humaines THP1 exprimant les récepteurs Fc (FcyRs) CD32, CD64 et transfectées avec le récepteur CD16. L’Anémie Hémolytique Auto-Immune (AHAI) est une maladie auto-immune médiée par des auto-anticorps anti-hématies induisant la destruction des hématies. Le mécanisme d’action majoritaire impliqué dans la clairance des hématies opsonisées est la phagocytose par les macrophages de la pulpe rouge de la rate de phénotype CD16+/CD32+/CD64+. This procedure describes the steps to be carried out in order to evaluate the capacity of polyvalent immunoglobulins to inhibit phagocytosis of human red blood cells opsonized by anti-red blood cells (Autoimmune Hemolytic Anemia model), by human THP1 monocyte cells expressing the Fc receptors (FcyRs) CD32, CD64 and transfected with the CD16 receptor. Autoimmune Hemolytic Anemia (AHAI) is an autoimmune disease mediated by anti-red blood cell autoantibodies inducing destruction of red blood cells. The major mechanism of action involved in the clearance of opsonized red blood cells is phagocytosis by macrophages of the red pulp of the spleen of the CD16 + / CD32 + / CD64 + phenotype.
Des essais cliniques ont montré l’efficacité des immunoglobulines polyvalentes dans le traitement de cette pathologie. Cette efficacité thérapeutique serait médiée par le blocage des FcyRs exprimées par les macrophages spléniques. Clinical trials have shown the efficacy of polyvalent immunoglobulins in the treatment of this pathology. This therapeutic efficacy would be mediated by the blockade of FcyRs expressed by splenic macrophages.
Des hématies humaine RhD-i- marquées par un fluorochrome et opsonisées avec un anticorps anti-D, jouant le rôle d’auto-anticorps, sont incubées avec les cellules THP1 CD16+ à +37°C en présence de concentrations croissantes d’immunoglobulines polyvalentes. La présence d’hématies fluorescentes internalisées par les cellules phagocytaires est recherchée par cytométrie en flux. RhD-i- human red blood cells labeled with a fluorochrome and opsonized with an anti-D antibody, playing the role of autoantibodies, are incubated with the THP1 CD16 + cells at + 37 ° C in the presence of increasing concentrations of polyvalent immunoglobulins. . The presence of fluorescent red blood cells internalized by the phagocytic cells is sought by flow cytometry.
1/ Lavage des hématies humaines RhD+ 1 / Washing of human RhD + red blood cells
Ajouter 5 mL d’eau physiologique sont ajoutés aux 10 mL d’hématies OR2R2, puis la suspension contenant les hématies est homogénéisé. La suspension contenant les hématies est ensuite lavée 2 fois avec 10 ml d’eau physiologique par centrifugation à 1730 g pendant 5 minutes. Après 2 lavages successifs, le culot globulaire est repris avec 400 pL d’eau physiologique. Add 5 mL of physiological water are added to 10 mL of OR2R2 red blood cells, then the suspension containing the red blood cells is homogenized. The suspension containing the red blood cells is then washed twice with 10 ml of physiological water by centrifugation at 1730 g for 5 minutes. After 2 successive washes, the red blood cell pellet is taken up in 400 μL of physiological water.
2/ Marquage des hématies RhD+ au PKH67 2 / Labeling of RhD + red blood cells with PKH67
Les 4000mI de culot sont mélangés avec 2ml de diluant C et ensuite avec 2ml de solution de PKH67 à 4x106M diluée au 1/250 en diluent C (concentration finale : 2x106M). Après un rapide mélange, la suspension a été incubée pendant 5 minutes dans l’obscurité. 4ml de sérum de veau foetal (SVF) ont été ajoutés, le surnageant a été éliminé par centrifugation pendant 5 min à 1730g et le culot lavé trois fois dans de 15 ml eau physiologique. Le marquage par PKH67 a été contrôlé par cytométrie. Toutes les hématies présentent une fluorescence. Réajuster la suspension d’hématies de lapin à 200 x 106 cellules/mL par ajout d’eau physiologique. The 4000 ml of pellet are mixed with 2 ml of diluent C and then with 2 ml of PKH67 solution at 4x10 6 M diluted to 1/250 in diluent C (final concentration: 2x10 6 M). After rapid mixing, the suspension was incubated for 5 minutes in the dark. 4 ml of fetal calf serum (FCS) were added, the supernatant was removed by centrifugation for 5 min at 1730 g and the pellet washed three times in 15 ml of physiological water. Labeling with PKH67 was checked by cytometry. All red blood cells fluoresce. Readjust the suspension of rabbit red blood cells to 200 x 10 6 cells / mL by adding physiological water.
3/ Sensibilisation des hématies humaines RhD+ 3 / Sensitization of human RhD + red blood cells
La suspension d’hématies est incubée pendant une heure à +37°C au bain-marie, à l’abri de la lumière, 500 pL de suspensions globulaires à 200 x 106 hématies/mL marquées au PKH-67 avec 500 pL de solution d’immunoglobulines à tester dans un tube de cytométrie. Un tube témoin négatif (hématies non opsonisées) est préparés par addition de 500 mI_ d’eau physiologique à 500 mI_ de suspensions globulaires à 200 x 106 hématies de lapin/mL marquées au PKH67. The red blood cell suspension is incubated for one hour at + 37 ° C in a water bath, protected from light, 500 μL of red blood cell suspensions at 200 x 10 6 red cells / mL labeled with PKH-67 with 500 μL of solution of immunoglobulins to be tested in a cytometry tube. A negative control tube (non-opsonized red blood cells) is prepared by adding 500 ml of physiological water to 500 ml of red blood cells at 200 × 10 6 rabbit red cells / ml labeled with PKH67.
Après l’incubation, les tubes sont lavés deux fois en ajoutant 3 ml de milieu IMDM+ 10%SVF par tube et centrifugé pendant 5 minutes à 1730 g. Les surnageant sont ensuite éliminés et les culots repris dans 1 mL de milieu IMDM+ 10%SVF (100x106 hématies/mL)After the incubation, the tubes are washed twice by adding 3 ml of IMDM + 10% FCS medium per tube and centrifuged for 5 minutes at 1730 g. The supernatants are then removed and the pellets taken up in 1 mL of IMDM + 10% FCS medium (100 × 10 6 red blood cells / mL)
4/ Etape de phagocytose 4 / Phagocytosis stage
Différentes concentration de solutions d’immunoglobulines G sont testées : 5 mg/mL en eau physiologique, 2,5 mg/mL en eau physiologique, 1 ,25 mg/mL en eau physiologique, 0,625 mg/mL en eau physiologique, 0,31 mg/mL en eau physiologique, 5 mg/mL en eau physiologique, 0,15 mg/mL en eau physiologique et 0 mg/mL en eau physiologique. 100 pL de cellules THP1 CD16+ à 1x106 cellules/mL sont pré-incubées avec 50 pL des concentrations croissantes d’immunoglobulines à tester pendant 30 minutes à +37°C.Different concentrations of immunoglobulin G solutions are tested: 5 mg / mL in physiological water, 2.5 mg / mL in physiological water, 1.25 mg / mL in physiological water, 0.625 mg / mL in physiological water, 0.31 mg / mL in physiological water, 5 mg / mL in physiological water, 0.15 mg / mL in physiological water and 0 mg / mL in physiological water. 100 μL of THP1 CD16 + cells at 1x10 6 cells / mL are pre-incubated with 50 μL of increasing concentrations of immunoglobulins to be tested for 30 minutes at + 37 ° C.
Les hématies marquées avec le PKFI67 sont mélangées à 100 pL de cellules THP1 CD16 + à 1x106 cellules/ml, et sensibilisées avec une concentration saturante d’anticorps anti-D. Les essais ont été réalisés en double exemplaire. Un échantillon de contrôle négatif est réalisé avec 100mI d’hématies PKH67 non opsonisées auxquelles sont ajoutées 100 mI de cellules THP1 CD16+ à 1 x106 cellules/mL. The red blood cells labeled with PKFI67 are mixed with 100 μL of THP1 CD16 + cells at 1x10 6 cells / ml, and sensitized with a saturating concentration of anti-D antibodies. The tests were carried out in duplicate. A negative control sample is produced with 100 ml of non-opsonized PKH67 red blood cells to which are added 100 ml of CD16 + THP1 cells at 1 x10 6 cells / ml.
L'incubation est effectuée à 37°C pendant 1 heure. À la fin de l'incubation, le marquage PKH67est éteint en ajoutant 100 pL de bleu trypan dilué au 1/20 et maintenu à 4°C, afin d’éliminer le signal des hématies de lapîn collées aux cellules THP1 CD16+. Un lavage est ensuite effectué en ajoutant 3 ml d’eau physiologique et en centrifugeant les tubes pendant 3 minutes à +4°C et à 600 g. Incubation is carried out at 37 ° C. for 1 hour. At the end of the incubation, the PKH67 labeling is quenched by adding 100 μL of trypan blue diluted to 1/20 and maintained at 4 ° C, in order to eliminate the signal from the rabbit red blood cells stuck to the THP1 CD16 + cells. Washing is then carried out by adding 3 ml of physiological water and centrifuging the tubes for 3 minutes at + 4 ° C and at 600 g.
Après une étape de lavage, les cellules THP1 CD16 + sont marquées avec 5pl anticorps anti-CD45 fluorescent dans 500mI de PBS par tube pendant 15 minutes à température ambiante et à l'abri de la lumière. Les échantillons sont lavés à nouveau par ajout de 3 ml d’eau physiologique et en centrifugeant les tubes pendant 3 minutes à +4°C et à 600 g.After a washing step, the THP1 CD16 + cells are labeled with 5 μl fluorescent anti-CD45 antibody in 500 μl of PBS per tube for 15 minutes at room temperature and protected from light. The samples are washed again by adding 3 ml of physiological water and centrifuging the tubes for 3 minutes at + 4 ° C and at 600 g.
Les échantillons sont lavés à nouveau et les hématies sont lysées avec 500 pL de solution de Versalyse Lysing pendant 20 minutes à la température ambiante, à l'abri de la lumière, afin d'éliminer les hématies non phagocytées (les hématies phagocytées par les cellules cibles ne sont pas sensibles à ces traitements). Les échantillons sont lavés à nouveau et fixés avec 500 pL de solution de fixation diluée au 1/40 avant analyse. Le pourcentage de cellules THP1 CD45+ contenant les hématies PKFI67 (pourcentage de phagocytose) et leur intensité de fluorescence moyenne PKH67 (MFI) sont mesurés par cytométrie de flux avec un cytomètre Galios Flow de la société Beckman Coulter. Les résultats sont ensuite analysés avec le logiciel Kaluza Analysis. Lecture des tubes au cytomètre Gallios (Beckman Coulter) (Conservation à l’abri de la lumière avant la lecture) : expression de PKFI-67 en FL1 avec une fenêtre sur les cellules CD45+. The samples are washed again and the red blood cells are lysed with 500 μL of Versalyse Lysing solution for 20 minutes at room temperature, protected from light, in order to eliminate the non-phagocytized red blood cells (the red blood cells phagocytosed by the cells targets are not sensitive to these treatments). The samples are washed again and fixed with 500 μL of fixing solution diluted to 1/40 before analysis. The percentage of THP1 CD45 + cells containing PKFI67 red blood cells (percentage of phagocytosis) and their mean fluorescence intensity PKH67 (MFI) are measured by flow cytometry with a Galios Flow cytometer from the company Beckman Coulter. The results are then analyzed with the Kaluza Analysis software. Reading of the tubes on the Gallios cytometer (Beckman Coulter) (Store away from light before reading): expression of PKFI-67 in FL1 with a window on the CD45 + cells.

Claims

REVENDICATIONS
1 . Lignée cellulaire de monocytes humains exprimant de manière stable et fonctionnelle les récepteurs Fc gamma (FcyR) CD16a, CD32 et CD64 humains à leur surface, dans laquelle la lignée cellulaire a été obtenue par transduction rétrovirale avec un vecteur lentiviral comprenant au moins un acide nucléique codant pour une protéine correspondant au domaine extracellulaire du récepteur CD16a et au moins un acide nucléique codant pour une protéine correspondant aux domaines transmembranaire et intracellulaire de la chaîne gamma des récepteurs FcsRI humain. 1. Human monocyte cell line stably and functionally expressing human CD16a, CD32 and CD64 Fc gamma receptors (FcyR) on their surface, in which the cell line has been obtained by retroviral transduction with a lentiviral vector comprising at least one coding nucleic acid for a protein corresponding to the extracellular domain of the CD16a receptor and at least one nucleic acid encoding a protein corresponding to the transmembrane and intracellular domains of the gamma chain of human FcsRI receptors.
2. Lignée cellulaire de monocytes humains selon la revendication 1 , dans laquelle la lignée cellulaire de monocytes humains est dérivée d’une lignée de cellules choisies parmi les cellules U-937, les cellules Mono-Mac-6, les cellules K-562, les cellules HL- 60, les cellules Jurkat et les cellules THP1 . 2. Human monocyte cell line according to claim 1, wherein the human monocyte cell line is derived from a cell line selected from U-937 cells, Mono-Mac-6 cells, K-562 cells, HL-60 cells, Jurkat cells and THP1 cells.
3. Lignée cellulaire de monocytes humains selon l’une quelconque des revendications 1 à 2, dans laquelle la lignée cellulaire de monocytes humains est dérivée de la lignée de cellules THP1. 3. The human monocyte cell line according to any one of claims 1 to 2, wherein the human monocyte cell line is derived from the THP1 cell line.
4. Lignée cellulaire de monocytes humains selon l’une quelconque des revendications 1 à 3, dans laquelle la lignée cellulaire a été obtenue par transduction rétrovirale avec un vecteur lentiviral comprenant au moins un acide nucléique de séquence SEQ ID No.1 ou un variant de l’acide nucléique de séquence SEQ ID No.1 . 4. Human monocyte cell line according to any one of claims 1 to 3, in which the cell line has been obtained by retroviral transduction with a lentiviral vector comprising at least one nucleic acid of sequence SEQ ID No.1 or a variant of the nucleic acid of sequence SEQ ID No.1.
5. Lignée cellulaire de monocytes humains selon la revendication 4, dans laquelle le variant de l’acide nucléique de séquence SEQ ID No.1 est l’acide nucléique de séquence SEQ ID No.2. 5. A human monocyte cell line according to claim 4, in which the variant of the nucleic acid of sequence SEQ ID No.1 is nucleic acid of sequence SEQ ID No.2.
6. Lignée cellulaire de monocytes humains selon l’une quelconque des revendications 1 à 5, dans laquelle le vecteur lentiviral comprend en outre un acide nucléique de séquence SEQ ID No.3. 6. A human monocyte cell line according to any one of claims 1 to 5, wherein the lentiviral vector further comprises a nucleic acid of sequence SEQ ID No.3.
7. Lignée cellulaire de monocytes humains selon l’une des revendications 1 à 6, dans laquelle le vecteur lentiviral comprend :7. Human monocyte cell line according to one of claims 1 to 6, wherein the lentiviral vector comprises:
- un acide nucléique de séquence SEQ ID No.4 constitué de l’acide nucléique de séquence SEQ ID No.2 et l’acide nucléique de séquence SEQ ID No.3, ou - un acide nucléique de séquence SEQ ID No.5 constitué de l’acide nucléique de séquence SEQ ID No.1 et l’acide nucléique de séquence SEQ ID No.3. - a nucleic acid of sequence SEQ ID No.4 consisting of the nucleic acid of sequence SEQ ID No.2 and the nucleic acid of sequence SEQ ID No.3, or - a nucleic acid of sequence SEQ ID No.5 consisting of the nucleic acid of sequence SEQ ID No.1 and the nucleic acid of sequence SEQ ID No.3.
8. Lignée cellulaire de monocytes humains selon la revendication 7, dans laquelle l’acide nucléique de séquence SEQ ID No.4 code pour une protéine chimérique comprenant le domaine extracellulaire du récepteur CD16a (FcyRIII) humain dans lequel l’acide aminé en position 158 a été remplacé par la valine et les domaines transmembranaire et intracellulaire de la chaîne gamma des récepteurs FcsRI humain. 8. A human monocyte cell line according to claim 7, in which the nucleic acid of sequence SEQ ID No.4 encodes a chimeric protein comprising the extracellular domain of the human CD16a (FcyRIII) receptor in which the amino acid at position 158 has been replaced by valine and the transmembrane and intracellular domains of the gamma chain of human FcsRI receptors.
9. Lignée cellulaire de monocytes humains selon la revendication 7, dans laquelle l’acide nucléique de séquence SEQ ID No. 5 code pour une protéine chimérique comprenant le domaine extracellulaire du récepteur CD16a (FcyRIII) humain dans lequel l’acide aminé en position 158 a été remplacé par la phénylalanine et les domaines transmembranaire et intracellulaire de la chaîne gamma des récepteurs FcsRI humain. 9. A human monocyte cell line according to claim 7, in which the nucleic acid of sequence SEQ ID No. 5 encodes a chimeric protein comprising the extracellular domain of the human CD16a (FcyRIII) receptor in which the amino acid at position 158 has been replaced by phenylalanine and the transmembrane and intracellular domains of the gamma chain of human FcsRI receptors.
10. Lignée cellulaire de monocytes humains selon l’une quelconque des revendications 1 à 9, dans laquelle la lignée cellulaire a été obtenue par transduction rétrovirale avec un vecteur lentiviral comprenant au moins un acide nucléique de séquence SEQ ID No.6. 10. Human monocyte cell line according to any one of claims 1 to 9, wherein the cell line has been obtained by retroviral transduction with a lentiviral vector comprising at least one nucleic acid of sequence SEQ ID No.6.
11. Lignée cellulaire de monocytes humains selon l’une quelconque des revendications 1 à 10, dans laquelle la lignée cellulaire constitue un modèle de phagocytose splénique, en particulier de phagocytose dans la pulpe rouge de la rate. 11. Human monocyte cell line according to any one of claims 1 to 10, wherein the cell line constitutes a model of splenic phagocytosis, in particular of phagocytosis in the red pulp of the spleen.
12. Procédé d’obtention d’une lignée de monocytes humains tels que décrits dans l’une quelconque des revendications 1 à 10, comprenant les étapes suivantes : a) isoler les monocytes humains du sang périphérique d’un patient atteint d’une leucémie aigüe myélo-monocytaire, b) transduction des monocytes humains de l’étape a) avec un vecteur lentiviral comprenant un acide nucléique de séquence choisie parmi SEQ ID No.1 , SEQ ID No.4, SEQ ID No.5, SEQ ID No.6 ou un variant de l’acide nucléique de séquence SEQ ID No.1 , c) sélectionner les monocytes humains issus de l’étape b) exprimant les récepteurs au CD16a, CD32 et CD64 avec un milieu de sélection, et d) vérifier les niveaux d’expression des récepteurs au CD16a, CD32 et CD64 dans les monocytes humains sélectionnés de l’étape c) par rapport aux niveaux d’expression de ces mêmes récepteurs dans les monocytes humains non transfectés de l’étape a). 12. A process for obtaining a line of human monocytes as described in any one of claims 1 to 10, comprising the following steps: a) isolating the human monocytes from the peripheral blood of a patient suffering from leukemia. acute myelo-monocytic, b) transduction of human monocytes from step a) with a lentiviral vector comprising a nucleic acid of sequence chosen from SEQ ID No.1, SEQ ID No.4, SEQ ID No.5, SEQ ID No .6 or a variant of the nucleic acid of sequence SEQ ID No.1, c) select the human monocytes resulting from step b) expressing the receptors CD16a, CD32 and CD64 with a selection medium, and d) check the expression levels of CD16a, CD32 and CD64 receptors in the human monocytes selected from step c) against the expression levels of these same receptors in untransfected human monocytes from step a).
13. Procédé d’obtention d’une lignée de monocytes humains tels que décrits dans l’une quelconque des revendications 1 à 10, comprenant les étapes suivantes : a) obtenir une lignée monocytaire humaine établie, b) transduction des monocytes humains de l’étape a) avec un vecteur lentiviral comprenant un acide nucléique de séquence choisie parmi SEQ ID No.1 , SEQ ID No.4, SEQ ID No.5, SEQ ID No.6 ou un variant de l’acide nucléique de séquence SEQ ID No.1 , c) sélectionner les monocytes humains issus de l’étape b) exprimant les récepteurs au CD16a, CD32 et CD64 avec un milieu de sélection, et d) vérifier les niveaux d’expression des récepteurs au CD16a, CD32 et CD64 dans les monocytes humains sélectionnés de l’étape c) par rapport aux niveaux d’expression de ces mêmes récepteurs dans la lignée monocytaire humaine non transfectés de l’étape a). 13. A process for obtaining a line of human monocytes as described in any one of claims 1 to 10, comprising the following steps: a) obtaining an established human monocytic line, b) transducing human monocytes from the step a) with a lentiviral vector comprising a nucleic acid of sequence chosen from SEQ ID No.1, SEQ ID No.4, SEQ ID No.5, SEQ ID No.6 or a variant of the nucleic acid of sequence SEQ ID No. 1, c) select human monocytes from step b) expressing CD16a, CD32 and CD64 receptors with selection medium, and d) check expression levels of CD16a, CD32 and CD64 receptors in the human monocytes selected from step c) relative to the levels of expression of these same receptors in the human monocytic line not transfected from step a).
14. Procédé d’obtention d’une lignée de monocytes humains selon l’une des revendications 12 ou 13, dans lequel l’étape c) de sélection des monocytes humains est réalisée par cytométrie de flux en utilisant une combinaison d’anticorps spécifiques des FcyRs selon la combinaison suivante : CD16-FITC, CD32-PE et CD64-PC7. 14. Process for obtaining a line of human monocytes according to one of claims 12 or 13, in which step c) of selecting the human monocytes is carried out by flow cytometry using a combination of antibodies specific for the human monocytes. FcyRs according to the following combination: CD16-FITC, CD32-PE and CD64-PC7.
15. Procédé d’évaluation in vitro de l’activité phagocytaire d’une lignée cellulaire de monocytes humains comprenant les étapes suivantes : a) marquage et sensibilisation des entités cibles avec des anticorps dirigés contre lesdites entités cibles, b) mise en contact des entités cibles issues de l’étape a) avec la lignée cellulaire de monocytes humains selon l’une des revendications 1 à 10, c) mesure de l’activité phagocytaire médiée par les anticorps dirigés contre lesdites entités cibles par cytométrie de flux, et d) détermination de la phagocytose. 15. A method of in vitro evaluation of the phagocytic activity of a human monocyte cell line comprising the following steps: a) labeling and sensitizing the target entities with antibodies directed against said target entities, b) bringing the entities into contact. targets from step a) with the human monocyte cell line according to one of claims 1 to 10, c) measurement of the phagocytic activity mediated by the antibodies directed against said target entities by flow cytometry, and d) determination of phagocytosis.
16. Procédé d’évaluation in vitro de l’activité phagocytaire d’une lignée cellulaire de monocytes humains comprenant les étapes suivantes : a) marquage et sensibilisation des entités cibles avec des anticorps dirigés contre lesdites entités cibles, b) pré-incubation de la lignée cellulaire de monocytes humains selon l’une des revendications 1 à 10 en présence d’un agent bloquant les récepteurs Fc gamma (FcyR) CD16a, CD32 et/ou CD64 humains à la surface de la lignée cellulaire de monocytes, c) mise en contact des entités cibles issues de l’étape a) avec la lignée cellulaire de monocytes humains issue de l’étape b), d) mesure de l’activité phagocytaire médiée par les anticorps dirigés contre lesdits entités cibles par cytométrie de flux, et e) détermination de la phagocytose. 16. A method of in vitro evaluation of the phagocytic activity of a human monocyte cell line comprising the following steps: a) labeling and sensitization of the target entities with antibodies directed against said target entities, b) pre-incubation of the human monocyte cell line according to one of claims 1 to 10 in the presence of an agent blocking the human Fc gamma (FcyR) CD16a, CD32 and / or CD64 receptors on the surface of the monocyte cell line, c) placing in contact of the target entities from step a) with the human monocyte cell line from step b), d) measurement of the phagocytic activity mediated by the antibodies directed against said target entities by flow cytometry, and e ) determination of phagocytosis.
17. Procédé d’évaluation in vitro de l’activité phagocytaire d’une lignée cellulaire de monocytes humains selon l’une quelconque des revendications 15 ou 16, dans lequel les entités cibles sont choisies parmi les organismes et les particules disposant d’un antigène de surface susceptible de fixer un anticorps. 17. A method of in vitro evaluation of the phagocytic activity of a human monocyte cell line according to any one of claims 15 or 16, wherein the target entities are chosen from organisms and particles having an antigen. surface capable of binding an antibody.
18. Procédé d’évaluation in vitro de l’activité phagocytaire d’une lignée cellulaire de monocytes humains selon la revendication 17, dans lequel lesdits organismes sont choisis parmi les organismes vivants et les organismes morts, lesdits organismes vivants ou morts contenant de l’ARN ou de l’ADN. 18. A method of in vitro evaluation of the phagocytic activity of a human monocyte cell line according to claim 17, wherein said organisms are selected from living organisms and dead organisms, said living or dead organisms containing. RNA or DNA.
19. Procédé d’évaluation in vitro de l’activité phagocytaire d’une lignée cellulaire de monocytes humains selon la revendication 18 dans lequel les organismes, sont choisis parmi les virus, les bactéries, les champignons, les mycoplasmes, les virions, les levures, les cellules vivantes, en particulier des cellules vivantes modifiées ou des cellules vivantes non modifiées, les précurseurs cellulaires, et les fragments de ceux- ci. 19. A method of in vitro evaluation of the phagocytic activity of a human monocyte cell line according to claim 18, in which the organisms are chosen from viruses, bacteria, fungi, mycoplasmas, virions, yeasts. , living cells, in particular modified living cells or unmodified living cells, cell precursors, and fragments thereof.
20. Procédé d’évaluation in vitro de l’activité phagocytaire d’une lignée cellulaire de monocytes humains selon la revendication 19, dans lequel les cellules vivantes sont choisies parmi les plaquettes, les érythrocytes et les cellules cancéreuses. 20. A method of in vitro evaluation of the phagocytic activity of a human monocyte cell line according to claim 19, wherein the living cells are selected from platelets, erythrocytes and cancer cells.
21. Procédé d’évaluation in vitro de l’activité phagocytaire d’une lignée cellulaire de monocytes humains selon la revendication 17, dans lequel les particules disposant d’un antigène de surface susceptible de fixer un anticorps sont des nanoparticules. 21. A method of in vitro evaluation of the phagocytic activity of a human monocyte cell line according to claim 17, wherein the particles having a surface antigen capable of binding an antibody are nanoparticles.
22. Procédé d’évaluation in vitro de l’activité phagocytaire d’une lignée cellulaire de monocytes humains selon l’une des revendications 15 ou 16, dans lequel les anticorps dirigés contre lesdites entités cibles sont choisis parmi les anticorps anti-D, en particulier Roledumab, et les anticorps anti-plaquettes, en particulier l’anti-CD41 . 22. A method of in vitro evaluation of the phagocytic activity of a human monocyte cell line according to one of claims 15 or 16, in which the antibodies directed against said target entities are chosen from anti-D antibodies, in particularly Roledumab, and anti-platelet antibodies, in particular anti-CD41.
23. Procédé d’évaluation in vitro de l’activité phagocytaire d’une lignée cellulaire de monocytes humains selon la revendication 16, dans lequel l’agent bloquant les récepteurs Fc gamma (FcyR) humains CD16a, CD32 et/ou CD64 à la surface de la lignée cellulaire de monocytes est choisi parmi une immunoglobuline G polyvalente et/ou un fragment Fc recombinant. 23. A method of in vitro evaluation of the phagocytic activity of a human monocyte cell line according to claim 16, wherein the agent blocking human Fc gamma receptors (FcyR) CD16a, CD32 and / or CD64 at the surface. of the monocyte cell line is chosen from a polyvalent immunoglobulin G and / or a recombinant Fc fragment.
24. Procédé de sélection d'anticorps à forte activité ’ADCP médiée par les récepteurs Fc gamma (FcyR) CD16a, CD32 et/ou CD64 humains comprenant les étapes suivantes : a) pré-incubation de la lignée cellulaire de monocytes humains selon l’une des revendications 1 à 10 en présence d’un agent bloquant les récepteurs Fc gamma (FcyR) CD16a, CD32 et/ou CD64 humains à la surface de la lignée cellulaire de monocytes, b) mise en contact de la lignée cellulaire de monocytes humains issue de l’étape a) avec lesdits anticorps à sélectionner, lesdits anticorps étant liés à leurs entités cibles c) détermination de la phagocytose, et d) sélection des anticorps à forte activité ADCP médiée par le CD16a et/ou CD32 et/ou CD64. 24. A process for the selection of antibodies with strong ADCP activity mediated by the human CD16a, CD32 and / or CD64 gamma Fc receptors (FcyR) comprising the following steps: a) pre-incubation of the human monocyte cell line according to the procedure. one of claims 1 to 10 in the presence of an agent blocking the human CD16a, CD32 and / or CD64 Fc gamma (FcyR) receptors on the surface of the monocyte cell line, b) bringing the human monocyte cell line into contact resulting from step a) with said antibodies to be selected, said antibodies being linked to their target entities c) determination of phagocytosis, and d) selection of antibodies with high ADCP activity mediated by CD16a and / or CD32 and / or CD64 .
25. Procédé de sélection d’un inhibiteur de l’ADCP médiée par les récepteurs Fc gamma (FcyR) CD16a, CD32 et/ou CD64 humains comprenant les étapes suivantes : a) opsonisation des entités cibles avec un anticorps à forte activité ADCP dirigés contre lesdites entités cibles, b) mise en contact de la lignée cellulaire de monocytes humains selon l’une des revendications 1 à 10 avec les entités cibles opsonisées lors de l’étape a) et lesdits inhibiteurs à sélectionner, c) détermination de la phagocytose, et d) sélection des inhibiteurs de l’ADCP médiée par le CD16a et/ou CD32 et/ou CD64. 25. A method of selecting an ADCP inhibitor mediated by the human CD16a, CD32 and / or CD64 Fc gamma receptors (FcyR) comprising the following steps: a) opsonization of the target entities with an antibody with high ADCP activity directed against said target entities, b) bringing the human monocyte cell line according to one of claims 1 to 10 into contact with the target entities opsonized during step a) and said inhibitors to be selected, c) determination of phagocytosis, and d) selection of CD16a and / or CD32 and / or CD64-mediated ADCP inhibitors.
PCT/EP2020/077961 2019-10-07 2020-10-06 Human monocyte cell line and use of same as a cell model of phagocytosis WO2021069417A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
FR1911088A FR3101640B1 (en) 2019-10-07 2019-10-07 Human monocyte cell line and its use as a cellular model of phagocytosis.
FRFR1911088 2019-10-07

Publications (1)

Publication Number Publication Date
WO2021069417A1 true WO2021069417A1 (en) 2021-04-15

Family

ID=69810923

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2020/077961 WO2021069417A1 (en) 2019-10-07 2020-10-06 Human monocyte cell line and use of same as a cell model of phagocytosis

Country Status (2)

Country Link
FR (1) FR3101640B1 (en)
WO (1) WO2021069417A1 (en)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7833789B2 (en) * 2006-08-01 2010-11-16 Fondazione Centro San Raffaele Del Monte Tabor Monocyte cell
WO2019115773A1 (en) 2017-12-15 2019-06-20 Laboratoire Français Du Fractionnement Et Des Biotechnologies Variants with fc fragment having an increased affinity for fcrn and an increased affinity for at least one receptor of the fc fragment

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7833789B2 (en) * 2006-08-01 2010-11-16 Fondazione Centro San Raffaele Del Monte Tabor Monocyte cell
WO2019115773A1 (en) 2017-12-15 2019-06-20 Laboratoire Français Du Fractionnement Et Des Biotechnologies Variants with fc fragment having an increased affinity for fcrn and an increased affinity for at least one receptor of the fc fragment

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
FLEIT H B ET AL: "THE HUMAN MONOCYTE-LIKE CELL LINE THP-1 EXPRESSES FCGAMMARI AND FCGAMMARII", JOURNAL OF LEUKOCYTE BIOLOGY, FEDERATION OF AMERICAN SOCIETIES FOR EXPERIMENTAL BIOLOGY, US, vol. 49, no. 6, 1 June 1991 (1991-06-01), pages 556 - 565, XP000973452, ISSN: 0741-5400 *
LI YI ET AL: "Increased expression of FcÎ3RI/CD64 on circulating monocytes parallels ongoing inflammation and nephritis in lupus", ARTHRITIS RESEARCH AND THERAPY, BIOMED CENTRAL, LONDON, GB, vol. 11, no. 1, 14 January 2009 (2009-01-14), pages R6, XP021053371, ISSN: 1478-6354 *
RAFAEL MARINO ET AL: "Interaction of immune complexes isolated from hepatitis C virus-infected individuals with human cell lines", MEDICAL MICROBIOLOGY AND IMMUNOLOGY, vol. 194, no. 1-2, 1 January 2005 (2005-01-01), DE, pages 73 - 80, XP055753850, ISSN: 0300-8584, DOI: 10.1007/s00430-003-0216-8 *
SIETSE Q. NAGELKERKE ET AL: "Key Points", BLOOD ADVANCES, vol. 2, no. 8, 24 April 2018 (2018-04-24), pages 941 - 953, XP055702768, ISSN: 2473-9529, DOI: 10.1182/bloodadvances.2017015008 *
WEI HSEUN YEAP ET AL: "CD16 is indispensable for antibody-dependent cellular cytotoxicity by human monocytes", SCIENTIFIC REPORTS, vol. 6, no. 1, 1 September 2016 (2016-09-01), XP055703516, DOI: 10.1038/srep34310 *

Also Published As

Publication number Publication date
FR3101640A1 (en) 2021-04-09
FR3101640B1 (en) 2024-04-12

Similar Documents

Publication Publication Date Title
WO2012093704A1 (en) Method for improving physical properties of antibody
AU2016202380A1 (en) Notum protein modulators and methods of use
KR20120128688A (en) Antibody against serotype i lipopolysaccharide of pseudomonas aeruginosa
CA2506331A1 (en) Protein specific to pancreatic beta cells in islets of langerhans and applications thereof
FR3024731A1 (en) ANTI-CK8 ANTIBODIES FOR USE IN THE TREATMENT OF CANCERS
FR2631239A1 (en) HUMAN MONOCLONAL ANTIBODY AND HYBRIDOMA PRODUCING THE SAME
FR2939667A1 (en) IMMUNOGLOBIN G COMPOSITION AS A MEDICAMENT FOR THE TREATMENT OF NEONATAL ICTERA BY FETOMATERNAL INCOMPATIBILITY IN THE ABO SYSTEM
Radomski et al. NK cell-mediated processing of Chlamydia psittaci drives potent anti-bacterial Th1 immunity
WO2021069417A1 (en) Human monocyte cell line and use of same as a cell model of phagocytosis
JP2019182834A (en) Endoplasmic reticulum targeted nanovehicle and method of using the same
EP2350315B1 (en) Method for detecting atheromatous disease
EP2773749B1 (en) Human mast cell lines, preparation and uses
JP2024505818A (en) Red blood cells with modified cell surfaces and their preparation method
WO1999045028A1 (en) Monoclonal antibodies esm-1 protein specific, and use of said antibodies for detecting esm-1 protein
EP1697410A1 (en) Isolated cytotoxic factor associated with multiple sclerosis and method of detecting said cytotoxic factor
CA2611828C (en) Process for screening anti-cancer substances; kit for implementing the process
WO2010128232A2 (en) Method for diagnosing propionibacterium acnes infections
JP6697385B2 (en) Method for measuring the stability of a composition comprising a soluble Fc gamma receptor in vitro
WO2021074376A1 (en) Novel human therapeutic monoclonal antibodies and uses thereof
EP3535589A1 (en) Method for determining the haemoglobin f content of an erythroid cell
JP2022103708A (en) Methods for purifying antigen binding molecules, nucleic acid compositions, vector compositions, cells and bacteroides dorei
EP4157311A1 (en) Immunomodulatory complex and uses thereof for therapy
FR3128713A1 (en) Binding agent with enhanced affinity for the prevention and treatment of sarbecovirus-related diseases
Ashok et al. Retrotranslocation of prion proteins from the er by preventing gpi signal sequence transamidation
WO2012010799A1 (en) Formulation of anti-cd20 antibodies

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20781568

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 20781568

Country of ref document: EP

Kind code of ref document: A1