FR3101640A1 - Human monocyte cell line and its use as a cell model of phagocytosis. - Google Patents

Abstract

The present invention relates to a human monocyte cell line which stably and functionally expresses human Fc gamma (FcγR) CD16, CD32 and CD64 receptors on their surface, as well as a method for in vitro evaluation of the phagocytic activity of said human monocyte. line. The present invention also relates to a method of selecting antibodies with high ADCP activity mediated by the human CD16, CD32 and / or CD64 Fc gamma receptors (FcγR) as well as a method of selecting an inhibitor of ADCP mediated by human ADCP. human CD16, CD32 and / or CD64 Fc gamma (FcγR) receptors.

Description

Human monocyte cell line and its use as a cell model of phagocytosis.

The present invention relates to a new cell line of human monocytes, and its use as a cell model of phagocytosis.

Phagocytosis is the cellular process by which certain cells grouped under the general name of phagocytes can ingest solid foreign particles of micrometric scale. Phagocytosis is usually considered to be a special form of endocytosis.

It is distinguished from other cell internalization processes (endocytosis, pinocytosis) by at least two general criteria:

• phagocytosis is induced by physical contact with the target particle;
• the phagocytosis target particle is larger than 0.5 µm.

Although phagocytosis has been observed experimentally in several cell types, it is generally strongly associated with certain categories of leukocytes, such as macrophages, dendritic cells or neutrophils. Its action is essential in the immune response. Whether innate or adaptive, phagocytosis is involved in the elimination of pathogens. It is the first line of defense against infection. However, it also plays an important role in maintaining tissue homeostasis as well as in tissue remodeling and repair.

The spleen is a soft organ of the lymphatic system. It plays a key role in immunity and the blood cell renewal process. The spleen is made up of two main types of tissue, each with a different function: white pulp and red pulp.

The white pulp is a component of the defense system against infections (immune system). It contains white blood cells called lymphocytes, which in turn produce antibodies (specialized proteins that fight invasion by a foreign substance).

The red pulp filters the blood and removes unwanted elements. It contains other white blood cells, macrophages, which ingest microorganisms, such as bacteria, fungi and viruses. In addition, it also controls red blood cells, destroying those that are abnormal, too old or those that no longer work properly. Finally, it serves as a reservoir for various blood elements: mainly white blood cells and platelets (pseudo-cellular particles involved in coagulation). The elimination of these elements, however, is only a minor function of the red pulp.

Macrophages residing in the red pulp of the spleen also play a major role in the clearance of blood cells opsonized by immunoglobulin G (IgG), such as in immunological thrombocytopenic purpura (ITP) or in autoimmune hemolytic anemia (AIHA). Blood cells are phagocytosed via Fc gamma receptors (FcγRs).

These splenic macrophages are distinct in humans from splenic monocytes and circulating monocyte-derived macrophages in terms of expression of FcγRs and other surface markers. Indeed, human red pulp macrophages predominantly express the low affinity CD32a (or FcRγIIa) and CD16a (or FcγRIIIa) receptors. They do not express CD32b (or FcγRIIb) and very weakly express the CD64 high affinity receptor (FcγRI).

The process of phagocytosis as defined today is characterized by three main stages;

• the adhesion phase, which takes place thanks to receptors for foreign microorganisms or senescent cells present on the surface of the macrophage, or via opsonin receptors,
• the phase of internalization or ingestion which leads to the formation of the phagosome and
• the phase of degradation by various enzymes which accumulate in the phagosome following its fusion with the lysosomes.

It is the recognition of the particle that triggers the cascade of signals that lead to the polymerization of actin, the production of various toxic products and the synthesis of cytokines and anti-inflammatory chemokines.

Phagocytosis is also implicated in many pathologies, and in particular in immune thrombocytopenia associated with purpura (ITP). It can also represent the mechanism of action of certain drugs, such as anti-D.

Currently, there is no stable and established cellular model of phagocytosis mediated by Fcγ receptors, in particular by CD16 (FcγRIII), allowing a reliable and reproducible result to be obtained. This is why the inventors have developed a new cell line of monocytes intended to be used as a cell model of phagocytosis, in particular for the phagocytosis of antibody/target entity complexes, for example anti-D/red blood cells and antibodies/platelets.

Thus, the present invention relates to a cell line of human monocytes expressing in a stable and functional manner the human Fc gamma receptors (FcγR) CD16, CD32 and CD64 on their surface.

By "cell line" is meant, within the meaning of the present invention, a set of cells originating from the same parent cell and possessing the same genetic characteristics as this parent cell. A cell line is further characterized by its ability to multiply in a culture medium stably in vitro for a large number of generations.

By "expressing in a stable manner", it is meant within the meaning of the present invention that the cell line of human monocytes according to the invention is capable of expressing the human Fc gamma receptors (FcγR) CD16, CD32 and CD64 on their surface after a large number of passages in cell culture, in particular after at least 20 passages, advantageously at least 25 passages, advantageously at least 30 passages. By "expressing in a stable manner", it is also meant within the meaning of the present invention, that the cell line of human monocytes according to the invention is capable of expressing the human Fc gamma receptors (FcγR) CD16, CD32 and CD64 on their surface. without significant change in the level of expression over time.

By "expressing in a functional manner" is meant, within the meaning of the present invention, the capacity of the human Fc gamma receptors (FcγR) thus expressed as being capable of binding the Fc region, constant portion, of immunoglobulins, in order to induce the phagocytosis. By "expressing in a functional manner", it is also meant within the meaning of the present invention, that the cell line of human monocytes according to the invention is capable of expressing sufficient human Fc gamma receptors (FcγR) CD16, CD32 and CD64, in order to to obtain a phagocytosis activity mediated by one or the combination of the Fc gamma receptors (FcγR) CD16, CD32 and CD64, during functional tests by blocking the other receptors.

The human monocyte cell line according to the invention stably and functionally expresses the human Fc gamma receptors (FcγR) CD16, CD32 and CD64.

In a particularly advantageous embodiment, the human monocyte cell line is derived from the peripheral blood of a patient suffering from acute myelomonocytic leukemia. Advantageously, the human monocyte cell line is derived from the peripheral blood of a one-year-old male patient suffering from acute myelomonocytic leukemia. In a particularly advantageous embodiment, the human monocyte cell line is derived from the THP1 cell line. Advantageously, the human monocyte cell line is derived from the THP1 cell line, deposited with the ECACC under number 88081201.

In a particular embodiment, the human monocyte cell line according to the invention is capable of expressing the human Fc gamma (FcγR) receptors CD16, CD32 and CD64 in a stable and functional manner after at least 30 cell culture passages. Advantageously, the cell line of human monocytes according to the invention expresses in a stable and functional manner at least 50,000 CD16 receptors, advantageously at least 60,000 CD16 receptors, advantageously at least 70,000 CD16 receptors, advantageously at least 80,000 CD16 receptors, advantageously at least 90,000 CD16 receptors, advantageously at least 95,000 CD16 receptors, advantageously at least 96,000 CD16 receptors, advantageously at least 97,000 CD16 receptors, advantageously at least 98,000 CD16 receptors, advantageously at least 99,000 CD16 receptors, advantageously at least 100,000 CD16 receptors, advantageously at least 105,000 CD16 receptors after at least 30 cell culture passages. Advantageously, the cell line of human monocytes according to the invention expresses in a stable and functional manner at least 5000 CD32 receptors, advantageously at least 6000 CD32 receptors, advantageously at least 7000 CD32 receptors, advantageously at least 8000 CD32 receptors, advantageously at least 9,000 CD32 receptors, advantageously at least 10,000 CD32 receptors, advantageously at least 11,000 CD32 receptors, advantageously at least 12,000 CD32 receptors, advantageously at least 13,000 CD32 receptors, advantageously at least 14,000 CD32 receptors, advantageously at least 14,000 CD32 receptors, advantageously at least 16,000 CD32 receptors, advantageously at least 17,000 CD32 receptors after at least 30 cell culture passages. Advantageously, the cell line of human monocytes according to the invention expresses in a stable and functional manner at least 20,000 CD64 receptors, advantageously at least 21,000 CD64 receptors, advantageously at least 22,000 CD64 receptors, advantageously at least 23,000 CD64 receptors, advantageously at least 24,000 CD64 receptors, advantageously at least 25,000 CD64 receptors, advantageously at least 26,000 CD64 receptors, advantageously at least 27,000 CD64 receptors, advantageously at least 28,000 CD64 receptors, advantageously at least 29,000 CD64 receptors, advantageously at least 30,000 CD64 receptors, advantageously at least 31,000 CD64 receptors, advantageously at least 32,000 CD64 receptors after at least 30 cell culture passages.

In a particular embodiment, the cell line of human monocytes according to the invention is capable of expressing in a stable and functional manner between 50,000 and 105,000 CD16 receptors, between 5,000 and 17,000 CD32 receptors and between 20,000 and 32 000 CD64 receptors on its surface after at least 30 cell culture passages. Advantageously, the cell line of human monocytes according to the invention is capable of expressing in a stable and functional manner between 60,000 and 105,000 CD16 receptors, between 6,000 and 17,000 CD32 receptors and between 21,000 and 32,000 CD64 receptors at its surface after at least 30 cell culture passages. Advantageously, the cell line of human monocytes according to the invention is capable of expressing in a stable and functional manner between 70,000 and 105,000 CD16 receptors, between 7,000 and 17,000 CD32 receptors and between 22,000 and 32,000 CD64 receptors at its surface after at least 30 cell culture passages. Advantageously, the human monocyte cell line according to the invention is capable of expressing in a stable and functional manner between 80,000 and 105,000 CD16 receptors, between 8,000 and 17,000 CD32 receptors and between 22,000 and 32,000 CD64 receptors at its surface after at least 30 cell culture passages. Advantageously, the human monocyte cell line according to the invention is capable of expressing in a stable and functional manner between 90,000 and 105,000 CD16 receptors, between 9,000 and 17,000 CD32 receptors and between 23,000 and 32,000 CD64 receptors at its surface after at least 30 cell culture passages. Advantageously, the human monocyte cell line according to the invention is capable of expressing in a stable and functional manner between 95,000 and 105,000 CD16 receptors, between 10,000 and 17,000 CD32 receptors and between 24,000 and 32,000 CD64 receptors at its surface after at least 30 cell culture passages. Advantageously, the human monocyte cell line according to the invention is capable of expressing in a stable and functional manner between 96,000 and 105,000 CD16 receptors, between 11,000 and 17,000 CD32 receptors and between 25,000 and 32,000 CD64 receptors at its surface after at least 30 cell culture passages. Advantageously, the human monocyte cell line according to the invention is capable of expressing in a stable and functional manner between 97,000 and 105,000 CD16 receptors, between 12,000 and 17,000 CD32 receptors and between 26,000 and 32,000 CD64 receptors at its surface after at least 30 cell culture passages. Advantageously, the human monocyte cell line according to the invention is capable of expressing in a stable and functional manner between 98,000 and 105,000 CD16 receptors, between 13,000 and 17,000 CD32 receptors and between 27,000 and 32,000 CD64 receptors at its surface after at least 30 cell culture passages. Advantageously, the human monocyte cell line according to the invention is capable of expressing in a stable and functional manner between 99,000 and 105,000 CD16 receptors, between 14,000 and 17,000 CD32 receptors and between 27,000 and 32,000 CD64 receptors at its surface after at least 30 cell culture passages. Advantageously, the human monocyte cell line according to the invention is capable of expressing in a stable and functional manner between 100,000 and 105,000 CD16 receptors, between 15,000 and 17,000 CD32 receptors and between 30,000 and 32,000 CD64 receptors at its surface after at least 30 cell culture passages.

In a particular embodiment, the human monocyte cell line according to the invention stably and functionally expresses 102,000 CD16 receptors, 16,000 CD32 receptors and 31,000 CD64 receptors on its surface after at least 30 cell culture passages.

In a particular embodiment of the invention, the cell line of human monocytes according to the invention was obtained by retroviral transduction with a lentiviral vector comprising at least one nucleic acid of sequence SEQ ID No.1 or a variant of nucleic acid of sequence SEQ ID No.1.

By "transfection" or "transduction" is meant, within the meaning of the present invention, a process by which cells incorporate an exogenous nucleic acid and integrate this nucleic acid into their genome.

By "nucleic acid" is meant, within the meaning of the present invention, an oligomer or a polymer, single or double stranded, of nucleotide bases read from the 5' end towards the 3' end. The term “nucleic acid” can refer to a DNA, RNA or hybrid RNA/DNA molecule, of natural or synthetic origin. In the nucleotide notation used in the present application, unless specifically mentioned, the left end of a single-stranded nucleotide sequence is the 5' end.

In a particularly advantageous embodiment, the nucleic acid of SEQ ID No.1 codes for a protein corresponding to the extracellular domain of the human Fc gamma CD16 (FcγRIII) receptor, in particular for a protein corresponding to the extracellular domain of the Fc gamma CD16a receptor (FcγRIII) human.

Acide nucléique de SEQ ID No.1 : atgcggactgaagatctcccaaaggctgtggtgttcctggagcctcaatggtacagggtgctcgagaaggacagtgtgactctgaagtgccagggagcctactcccctgaggacaattccacacagtggtttcacaatgagagcctcatctcaagccaggcctcgagctacttcattgacgctgccacagtcgacgacagtggagagtacaggtgccagacaaacctctccaccctcagtgacccggtgcagctagaagtccatatcggctggctgttgctccaggcccctcggtgggtgttcaaggaggaagaccctattcacctgaggtgtcacagctggaagaacactgctctgcataaggtcacatatttacagaatggcaaaggcaggaagtattttcatcataattctgacttctacattccaaaagccacactcaaagacagcggctcctacttctgcagggggctttttgggagtaaaaatgtgtcttcagagactgtgaacatcaccatcactcaaggtttggcagtgtcaaccatctcatcattctttccacctggg.

By "variant of the nucleic acid of sequence SEQ ID No.1", is meant within the meaning of the present invention, a nucleic acid which differs by one or more bases compared to the nucleic acid of SEQ ID No.1 . A variant nucleic acid may be of natural origin, such as an allelic variant found naturally, or may also be a non-natural variant obtained for example by mutagenesis techniques. In general, the differences between the reference nucleic acid and the variant nucleic acid are reduced such that the nucleotide sequences of the reference nucleic acid and the variant nucleic acid are very close and, in many regions , identical. The nucleotide modifications present in a variant nucleic acid can be silent, which means that they do not alter the amino acid sequences encoded by said variant nucleic acid.

However, nucleotide changes in a variant nucleic acid may also result in substitutions, additions, deletions in the polypeptide encoded by the variant nucleic acid relative to the protein encoded by the nucleic acid of SEQ ID No.1. In addition, nucleotide changes in the coding regions can produce substitutions, conservative or nonconservative, in the amino acid sequence. Preferably, the variant nucleic acids of the nucleic acid of sequence SEQ ID No.1 according to the invention encode proteins which retain substantially the same function or biological activity as the proteins encoded by the reference nucleic acid or else the ability to be recognized by antibodies directed against the proteins encoded by the initial nucleic acid. Advantageously, the nucleic acids variants of the nucleic acid of sequence SEQ ID No.1 according to the invention retain the same human CD16 (FcγRIII) receptor binding capacity, or have an increased human CD16 (FcγRIII) receptor binding capacity or diminished. Advantageously, the nucleic acids variants of the nucleic acid of sequence SEQ ID No.1 according to the invention retain the same human CD16a (FcγRIII) receptor binding capacity, or have an increased human CD16a (FcγRIII) receptor binding capacity or diminished.

By way of example of a variant of the nucleic acid of SEQ ID No.1 according to the invention, mention may in particular be made of the nucleic acid of SEQ ID No.2.

Acide nucléique de SEQ ID No.2 : atgcggactgaagatctcccaaaggctgtggtgttcctggagcctcaatggtacagggtgctcgagaaggacagtgtgactctgaagtgccagggagcctactcccctgaggacaattccacacagtggtttcacaatgagagcctcatctcaagccaggcctcgagctacttcattgacgctgccacagtcgacgacagtggagagtacaggtgccagacaaacctctccaccctcagtgacccggtgcagctagaagtccatatcggctggctgttgctccaggcccctcggtgggtgttcaaggaggaagaccctattcacctgaggtgtcacagctggaagaacactgctctgcataaggtcacatatttacagaatggcaaaggcaggaagtattttcatcataattctgacttctacattccaaaagccacactcaaagacagcggctcctacttctgcagggggcttgttgggagtaaaaatgtgtcttcagagactgtgaacatcaccatcactcaaggtttggcagtgtcaaccatctcatcattctttccacctggg.

In a particular embodiment of the invention, a variant of the nucleic acid of sequence SEQ ID No.1 is the nucleic acid of SEQ ID No.2.

Advantageously, the nucleic acid of SEQ ID No.2 encodes a protein corresponding to the extracellular domain of the human CD16 (FcγRIII) receptor, in which the amino acid at position 158 has been replaced by valine.

By "vector" is meant, within the meaning of the present invention, a transit vehicle based on nucleic acids, a nucleic acid molecule adapted to deliver nucleic acid or a DNA molecule capable of autonomous replication. in the monocyte, for example a plasmid, a cosmid, a phagemid, a viral genome (chromosome), a phage genome (chromosome), and which allows the cloning of DNA molecules. In a particularly advantageous embodiment, the vector used is a lentiviral vector.

In this case, the nucleic acid sequence used is placed under the control of signals allowing its expression in the cell line of human monocytes. The vector should include a promoter, translation initiation and termination signals, and appropriate transcriptional regulatory regions. It must be able to be maintained in a stable manner in the monocyte and may possibly possess particular signals specifying the secretion of the translated proteins. For this purpose, the nucleic acid sequence can be inserted into self-replicating vectors within the human monocyte cell line, or integrative vectors of the human monocyte cell line.

Such vectors will be prepared according to the methods commonly used by those skilled in the art, and the resulting clones can be introduced into the cell line of human monocytes by standard methods such as, for example, transfection by precipitation with calcium phosphate, lipofection , electroporation, thermal shock.

Transduction into the human monocyte cell line of the vector can be accomplished in an equimolar amount by standard procedures such as calcium phosphate precipitation or lipofectin. Then, the transfected lines are selected in the appropriate culture media.

In a particular embodiment of the invention, the lentiviral vector further comprises a nucleic acid of sequence SEQ ID No. 3.

Nucleic acid of sequence SEQ ID No. 3: cctcagctctgctatatcctggatgccatcctgtttctgtatggaattgtcctcaccctcctctactgtcgactgaaggtaatccaagtgcgaaaggcagctataaccagctatgagaaatcagatggtgtttacacgggcctgagcaccaggaaccaggagacttacgagactctgaagcatgagaaaccaccacag.

Advantageously, the nucleic acid of SEQ ID No.3 encodes a protein corresponding to the transmembrane and intracellular domains of the gamma chain of human FcεRI receptors.

In another particularly advantageous embodiment of the invention, the lentiviral vector comprises a nucleic acid of sequence SED IQ No.4 consisting of the nucleic acid of sequence SEQ ID No.2 and of the nucleic acid of sequence SEQ ID No. 3.

Acide nucléique de séquence SEQ ID No.4 : atgcggactgaagatctcccaaaggctgtggtgttcctggagcctcaatggtacagggtgctcgagaaggacagtgtgactctgaagtgccagggagcctactcccctgaggacaattccacacagtggtttcacaatgagagcctcatctcaagccaggcctcgagctacttcattgacgctgccacagtcgacgacagtggagagtacaggtgccagacaaacctctccaccctcagtgacccggtgcagctagaagtccatatcggctggctgttgctccaggcccctcggtgggtgttcaaggaggaagaccctattcacctgaggtgtcacagctggaagaacactgctctgcataaggtcacatatttacagaatggcaaaggcaggaagtattttcatcataattctgacttctacattccaaaagccacactcaaagacagcggctcctacttctgcagggggcttgttgggagtaaaaatgtgtcttcagagactgtgaacatcaccatcactcaaggtttggcagtgtcaaccatctcatcattctttccacctgggcctcagctctgctatatcctggatgccatcctgtttctgtatggaattgtcctcaccctcctctactgtcgactgaaggtaatccaagtgcgaaaggcagctataaccagctatgagaaatcagatggtgtttacacgggcctgagcaccaggaaccaggagacttacgagactctgaagcatgagaaaccaccacag

In another particularly advantageous embodiment of the invention, the lentiviral vector comprises a nucleic acid of sequence SED IQ No.5 consisting of the nucleic acid of sequence SEQ ID No.1 and of the nucleic acid of sequence SEQ ID No. 3.

Acide nucléique de séquence SEQ ID No.5 : atgcggactgaagatctcccaaaggctgtggtgttcctggagcctcaatggtacagggtgctcgagaaggacagtgtgactctgaagtgccagggagcctactcccctgaggacaattccacacagtggtttcacaatgagagcctcatctcaagccaggcctcgagctacttcattgacgctgccacagtcgacgacagtggagagtacaggtgccagacaaacctctccaccctcagtgacccggtgcagctagaagtccatatcggctggctgttgctccaggcccctcggtgggtgttcaaggaggaagaccctattcacctgaggtgtcacagctggaagaacactgctctgcataaggtcacatatttacagaatggcaaaggcaggaagtattttcatcataattctgacttctacattccaaaagccacactcaaagacagcggctcctacttctgcagggggctttttgggagtaaaaatgtgtcttcagagactgtgaacatcaccatcactcaaggtttggcagtgtcaaccatctcatcattctttccacctgggcctcagctctgctatatcctggatgccatcctgtttctgtatggaattgtcctcaccctcctctactgtcgactgaaggtaatccaagtgcgaaaggcagctataaccagctatgagaaatcagatggtgtttacacgggcctgagcaccaggaaccaggagacttacgagactctgaagcatgagaaaccaccacag

In a particularly advantageous embodiment of the invention, the cell line of human monocytes according to the invention was obtained by retroviral transduction with a lentiviral vector comprising:
- a nucleic acid of sequence SED IQ No.4 consisting of the nucleic acid of sequence SEQ ID No.2 and the nucleic acid of sequence SEQ ID No. 3, or
- a nucleic acid of sequence SED IQ No.5 consisting of the nucleic acid of sequence SEQ ID No.1 and of the nucleic acid of sequence SEQ ID No. 3.

In a particular embodiment, the nucleic acids of sequences SEQ ID No.4 and SEQ ID No.5 code respectively for a chimeric protein comprising the extracellular domain of the human CD16 (FcγRIII) receptor and the transmembrane and intracellular domains of the gamma chain human FcεRI receptors.

Advantageously, the nucleic acid of sequence SEQ ID No.4 encodes a chimeric protein comprising the extracellular domain of the human CD16 (FcγRIII) receptor in which the amino acid at position 158 has been replaced by valine and the transmembrane and intracellular domains of the gamma chain of human FcεRI receptors.

Advantageously, the nucleic acid of sequence SEQ ID No.5 encodes a chimeric protein comprising the extracellular domain of the human CD16 (FcγRIII) receptor in which the amino acid at position 158 is phenylalanine and the transmembrane and intracellular domains of the human FcεRI receptor gamma.

In another particular embodiment of the invention, the cell line of human monocytes according to the invention was obtained by retroviral transduction with a lentiviral vector comprising a nucleic acid of sequence SEQ ID No.6.

Acide nucléique de séquence SEQ ID No.6 : atgtggcagctgctgctgccgaccgcgctgctgctgctggtgagcgcgggcatgcgcaccgaagatctgccgaaagcggtggtgtttctggaaccgcagtggtatcgcgtgctggaaaaagatagcgtgaccctgaaatgccagggcgcgtatagcccggaagataacagcacccagtggtttcataacgaaagcctgattagcagccaggcgagcagctattttattgatgcggcgaccgtggatgatagcggcgaatatcgctgccagaccaacctgagcaccctgagcgatccggtgcagctggaagtgcatattggctggctgctgctgcaggcgccgcgctgggtgtttaaagaagaagatccgattcatctgcgctgccatagctggaaaaacaccgcgctgcataaagtgacctatctgcagaacggcaaaggccgcaaatattttcatcataacagcgatttttatattccgaaagcgaccctgaaagatagcggcagctatttttgccgcggcctgtttggcagcaaaaacgtgagcagcgaaaccgtgaacattaccattacccagggcctggcggtgagcaccattagcagcttttttccgccgggctatcaggtgagcttttgcctggtgatggtgctgctgtttgcggtggataccggcctgtattttagcgtgaaaaccaacattcgcagcagcacccgcgattggaaagatcataaatttaaatggcgcaaagatccgcaggataaa

Advantageously, the nucleic acid of SEQ ID No.6 encodes a protein corresponding to the native human CD16 (FcγRIII) receptor.

In another particular embodiment of the invention, the cell line of human monocytes according to the invention constitutes a cell model of splenic phagocytosis. In another particular embodiment of the invention, the cell line of human monocytes according to the invention constitutes a cell model of phagocytosis in the red pulp of the spleen.

Another aspect of the invention relates to a method for obtaining the line of human monocytes as described above, comprising the following steps:
a) isolating human monocytes from the peripheral blood of a patient suffering from acute myelomonocytic leukemia,
b) transduction of human monocytes with a lentiviral vector comprising a nucleic acid of sequence chosen from sequence chosen from SEQ ID No.1, SEQ ID No.4, SEQ ID No.5, SEQ ID No.6 or a variant of nucleic acid of sequence SEQ ID No.1,
c) selecting for expression of human monocytes with a selection medium, and
d) check the expression levels of the CD16, CD32 and CD64 receptors.

Another aspect of the invention relates to a method for obtaining the line of human monocytes as described above, comprising the following steps:
a) obtaining an established human monocyte line
b) transduction of human monocytes with a lentiviral vector comprising a nucleic acid sequence chosen from sequence chosen from SEQ ID No.1, SEQ ID No.4, SEQ ID No.5, SEQ ID No.6 or a variant of the acid nucleus of sequence SEQ ID No.1,
c) selecting for expression of human monocytes with a selection medium, and
d) check the expression levels of the CD16, CD32 and CD64 receptors.

Another aspect of the invention relates to the use of the monocyte cell line according to the invention as a cell model of phagocytosis, in particular for the phagocytosis of antibody/target entity complexes.

By "target entities" is meant, within the meaning of the present invention, organisms and particles having a surface antigen capable of binding an antibody. Advantageously, the organisms can be living organisms or dead organisms, said living or dead organisms containing RNA or DNA. In a particular embodiment, the organisms are chosen from viruses, bacteria, fungi, mycoplasmas, virions, yeasts, living cells, in particular modified living cells and unmodified living cells, cell precursors , and fragments thereof. In another particular embodiment, the particles having a surface antigen capable of binding an antibody can be synthetic chemical particles, in particular nanoparticles.

In a particular embodiment, the monocyte cell line according to the invention can be used as a cell model of the phagocytosis of the anti-D/erythrocytes complex. In another particular embodiment, the monocyte cell line according to the invention can be used as a cell model of platelet phagocytosis. In another particular embodiment, the monocyte cell line according to the invention can be used as a cell model for the phagocytosis of cancer cells.

Another aspect of the invention relates to a method for in vitro evaluation of the phagocytic activity of a cell line of human monocytes comprising the following steps:
a) labeling and sensitization of the target entities with antibodies directed against said target entities,
b) bringing the target entities from step a) into contact with the human monocyte cell line as described above,
c) measurement of the phagocytic activity mediated by the antibodies directed against said target entities by flow cytometry, and
d) determination of phagocytosis

Another aspect of the invention relates to a method for in vitro evaluation of the phagocytic activity of a cell line of human monocytes comprising the following steps:
a) labeling and sensitization of the target entities with antibodies directed against said target entities,
b) pre-incubation of the human monocyte cell line as defined above in the presence of an agent blocking the human CD16, CD32 and/or CD64 Fc gamma receptors (FcγR) on the surface of the monocyte cell line,
c) bringing the target entities from step a) into contact with the human monocyte cell line from step b),
d) measurement of the phagocytic activity mediated by the antibodies directed against said target entities by flow cytometry, and
e) determination of phagocytosis.

Phagocytosis is determined using any standard technique known to those skilled in the art. In particular, the determination of the phagocytosis can be carried out for example by one or more different methods such as the determination of the percentage of phagocytosis, the measurement of the intensity of fluorescence. In particular, the determination of phagocytosis can be carried out by different methods allowing to analyze the process of phagocytosis in its entirety:

• Recognition and adherence of the target organism, entity or particle. For example, by analyzing the rosette formation visible under a microscope or by any usual technique known to those skilled in the art,
• Activation of the signaling pathway. For example, by analyzing the state of phosphorylation of proteins involved in the phagocytosis signaling pathway by cytometry, western blot or any usual technique known to those skilled in the art.
• Ingestion. For example, by analyzing the percentage of effector cells having phagocytosed targets or the number of targets phagocytosed by cytometry, microscopy or any usual technique known to those skilled in the art.
• Release of cellular components. For example, by analyzing the compounds released into the medium by ELISA immunoassay, cytometry or any usual technique known to those skilled in the art.

The method for in vitro evaluation of the phagocytic activity of a cell line of human monocytes has the advantage of being reliable, precise, sensitive and reproducible. Thus, the method according to the invention can be used as a cell model of phagocytosis.

In a particular embodiment of the invention, the target entities are chosen from organisms and particles having a surface antigen capable of binding an antibody. In another particular embodiment of the invention, the organisms are chosen from living organisms and dead organisms, said living or dead organisms containing RNA or DNA. In a particular embodiment, the organisms are chosen from viruses, bacteria, fungi, mycoplasmas, virions, yeasts, living cells, in particular modified living cells and unmodified living cells, cell precursors , and fragments thereof. In another particular embodiment, the particles having a surface antigen capable of binding an antibody can be synthetic chemical particles, in particular nanoparticles.

In a particular embodiment of the invention, the living cells are chosen from platelets, erythrocytes and cancer cells.

In a particular embodiment of the invention, the particles having a surface antigen capable of binding an antibody are nanoparticles.

In a particular embodiment of the invention, the antibodies directed against said target entities are chosen from anti-D antibodies, in particular Roledumab, and anti-platelet antibodies, in particular anti-CD41.

In a particular embodiment of the invention, the target entities are previously labeled with PKH67.

In a particular embodiment of the invention, the agent blocking the human CD16, CD32 and/or CD64 Fc gamma receptors (FcγR) on the surface of the monocyte cell line is chosen from a polyvalent immunoglobulin G and/or a recombinant Fc fragment. Advantageously, any concentrate of polyvalent immunoglobulins G currently on the market can be used. By way of example, the product Iqymune ^® (LFB) can be used.

In a particular embodiment, the method for in vitro evaluation of the phagocytic activity of a cell line of human monocytes according to the invention comprising the following steps:
a) labeling with PKH67 and sensitization of erythrocytes with an anti-D antibody,
b) bringing the erythrocytes from step a) into contact with the cell line of human monocytes in the presence of immunoglobulins G,
c) measurement of the phagocytic activity mediated by the anti-D antibody, by flow cytometry, and
d) determination of phagocytosis.

The method according to the invention using red blood cells as target organisms constitutes a reliable, precise, sensitive and reproducible cellular model of the mechanism of action of Roledumab.

In another particular embodiment, the method for in vitro evaluation of the phagocytic activity of a cell line of human monocytes according to the invention comprising the following steps:
a) labeling with PKH67 and sensitization of the platelets with an anti-CD41 antibody,
b) pre-incubation of the human monocyte cell line as defined above in the presence of a polyvalent immunoglobulin G and/or a recombinant Fc fragment,
c) bringing the platelets from step a) into contact with the human monocyte cell line from step b),
d) measurement of the phagocytic activity mediated by an anti-platelet antibody, in particular the anti-CD41 antibody, by flow cytometry, and
e) determination of phagocytosis.

The method according to the invention using platelets as target organisms constitutes a reliable, precise, sensitive and reproducible cellular model of immune thrombocytopenia associated with purpura (ITP).

Another aspect of the invention relates to a method for selecting antibodies with high ADCP activity mediated by human Fc gamma receptors (FcγR) CD16, CD32 and/or CD64.

Antibody-dependent cellular phagocytosis (ADCP) is the mechanism by which antibodies (through their Fc fragment) will act as opsonins to promote the ingestion of target entities by the human monocyte cell line according to the invention.

By "antibody with high ADCP activity", is meant within the meaning of the present invention, an antibody having a strong ability to induce the phagocytosis of the target entities by the cell line of human monocytes according to the invention.

Advantageously, the method for selecting antibodies with high ADCP activity mediated by human Fc gamma receptors (FcγR) CD16, CD32 and/or CD64 comprising the following steps:
a) pre-incubation of the human monocyte cell line according to the invention in the presence of an agent blocking the human Fc gamma receptors (FcγR) CD16, CD32 and/or CD64 on the surface of the monocyte cell line,
b) contacting the cell line of human monocytes from step a) with said antibodies to be selected, said antibodies being bound to their target entities,
c) determination of phagocytosis, and
d) selection of antibodies with strong ADCP activity mediated by CD16 and/or CD32 and/or CD64.

In a particular embodiment, the agent blocking human Fc gamma receptors (FcγR) on the surface of the monocyte cell line is chosen from a polyvalent immunoglobulin G and/or a recombinant Fc fragment. Advantageously, any polyvalent immunoglobulin G currently on the market can be used. For example, the product Iqymune® (LFB) can be used.

Another aspect of the invention relates to a method of selecting an ADCP inhibitor mediated by human CD16, CD32 and/or CD64 Fc gamma receptors (FcγR).

By "ADCP inhibitor" is meant within the meaning of the present invention, any molecule, in particular an antibody, capable of inhibiting the phagocytosis of the target entities by the cell line of human monocytes according to the invention.

Advantageously, the method for selecting an ADCP inhibitor mediated by the human Fc gamma (FcγR) CD16, CD32 and/or CD64 receptors comprising the following steps:
a) opsonization of the target entities with an antibody with high ADCP activity directed against said target entities,
b) bringing the cell line of human monocytes according to the invention into contact with the target entities opsonized during step a) and said inhibitors to be selected,
c) determination of phagocytosis, and
d) selection of ADCP inhibitors mediated by CD16 and/or CD32 and/or CD64.

FIGURES

FIG. 1 represents the restriction map of the lentiviral vector comprising a nucleic acid of SEQ ID No.1.

FIG. 2 represents the expression profile of the human Fc gamma (FcγR) receptors (CD16, CD32 and CD64) of the human monocyte cell line of the invention. The expression profile was obtained by flow cytometry using the following specific fluorescent antibodies: CD16-FITC, CD32-PE and CD64-PC7.

FIG. 3A represents the percentage of phagocytosis of the platelets, originating from a donor 1, sensitized with the anti-CD41 antibody by the monocyte cell line according to the invention, using increasing concentrations of IGIV at 10% (Iqymune , LFB) or recombinant Fc fragments (LFBD192-DS AY, LFBD192-DS EY and LFBD191-DS AY) (Fc gamma receptor (FcγR) blocking agent), 6.66x10-5 M, 6.66x10-6 M , 6.66×10 −7 M, to 6.66×10 −8 M. The results are obtained by flow cytometry.

FIG. 3B represents the mean fluorescence intensity (MFI for Mean Fluorescence Intensity) associated with the quantity of platelets ingested by the monocyte cell line according to the invention using increasing concentrations of IGIV at 10% (Iqymune, LFB) or recombinant Fc fragments (LFBD192-DS AY, LFBD192-DS EY and LFBD191-DS AY) (Fc gamma receptor (FcγR) blocking agent), of 6.66x10-5 M, 6.66x10-6 M, 6, 66x10 -7 M, to 6.66x10 -8 M, said platelets coming from a donor 1, and having been sensitized with the anti-CD41 antibody. The results are obtained by flow cytometry.

FIG. 3C represents the percentage of phagocytosis of the platelets, originating from a donor 2, sensitized with the anti-CD41 antibody by the monocyte cell line according to the invention, using increasing concentrations of IGIV at 10% (Iqymune , LFB) or recombinant Fc fragments (LFBD192-DS AY, LFBD192-DS EY and LFBD191-DS AY) (Fc gamma receptor (FcγR) blocking agent), 6.66x10-5 M, 6.66x10-6 M , 6.66×10 −7 M, to 6.66×10 −8 M. The results are obtained by flow cytometry.

Figure 3D represents the mean fluorescence intensity (MFI) associated with the amount of platelets ingested by the monocyte cell line according to the invention using increasing concentrations of 10% IVIG (Iqymune, LFB) or Fc fragments recombinant (LFBD192-DS AY, LFBD192-DS EY and LFBD191-DS AY) (Fc gamma receptor (FcγR) blocking agent), 6.66x10-5 M, 6.66x10-6 M, 6.66x10-7 M , at 6.66×10 −8 M, said platelets coming from a donor 2, and having been sensitized with the anti-CD41 antibody. The results are obtained by flow cytometry.

FIG. 3E represents the percentage of phagocytosis of platelets, originating from a donor 3, sensitized with the anti-CD41 antibody by the monocyte cell line according to the invention, using increasing concentrations of IGIV at 10% (Iqymune , LFB) or recombinant Fc fragments (LFBD192-DS AY, LFBD192-DS EY and LFBD191-DS AY) (Fc gamma receptor (FcγR) blocking agent), 6.66x10-5 M, 6.66x10-6 M , 6.66×10 −7 M, to 6.66×10 −8 M. The results are obtained by flow cytometry.

Figure 3F represents the mean fluorescence intensity (MFI) associated with the amount of platelets ingested by the monocyte cell line according to the invention using increasing concentrations of 10% IVIG (Iqymune, LFB) or Fc fragments recombinant (LFBD192-DS AY, LFBD192-DS EY and LFBD191-DS AY) (Fc gamma receptor (FcγR) blocking agent), 6.66x10-5 M, 6.66x10-6 M, 6.66x10-7 M , at 6.66×10 −8 M, said platelets coming from a donor 3, and having been sensitized with the anti-CD41 antibody. The results are obtained by flow cytometry.

FIG. 4A represents the percentage of phagocytosis of red blood cells sensitized with the anti-D antibody (Roledumab) by the monocyte cell line according to the invention, using increasing concentrations of anti-D antibody (Roledumab), from 0, 04 to 5 µg/ml and in the presence of IVIG at a concentration of 0.25 mg/ml. The results are obtained by flow cytometry.

FIG. 4B represents the average fluorescence intensity (MFI) associated with the quantity of red blood cells ingested by the monocyte cell line according to the invention, using increasing concentrations of anti-D antibodies (Roledumab) ranging from 0, 04 to 5 μg/ml in the presence of 0.25 mg/ml of IVIG, said red blood cells having been previously sensitized with the anti-D antibody (Roledumab). The results were obtained by flow cytometry.

FIG. 4C represents the percentage of phagocytosis of red blood cells sensitized with the anti-D antibody (Roledumab) by the monocyte cell line according to the invention, in the absence of anti-D antibody (Roledumab), in the presence of anti-D antibody (Roledumab ) at a concentration of 5 µg/ml or in the presence of anti-D antibody (Roledumab ) at a concentration of 5 µg/ml and 5 µg/ml of anti-CD16 antibody. The results are obtained by flow cytometry.

FIG. 4D represents the mean fluorescence intensity (MFI) associated with the quantity of red blood cells ingested by the monocyte cell line according to the invention, in the absence of anti-D antibodies (Roledumab), in the presence of anti-D antibody (Roledumab ) at a concentration of 5 µg/ml or in the presence of anti-D antibody (Roledumab) at a concentration of 5 µg/ml and 5 µg/ml of anti-CD16 antibody. The results are obtained by flow cytometry.

FIG. 5 represents the results of the phagocytosis test of red blood cells sensitized with an anti-D antibody (RhD+RBC) by the cell line of human monocytes according to the invention (THP1 CD16+) with increasing concentrations from 0.04 to 5 μg /ml of anti-D antibody (Roledumab) in the presence of 0.25 mg/ml of IVIG. Graphs A and B were obtained with a 50% range of anti-D antibodies and graphs C and D were obtained with a 150% range of anti-D antibodies. The results are presented in percentage of phagocytosis (A and C) and in average fluorescence intensity (B and D) and represent the average of a single experiment carried out in duplicate.

FIG. 6 represents the results of the phagocytosis test of red blood cells sensitized with an anti-D antibody (RhD+RBC) by the cell line of human monocytes according to the invention (THP1 CD16+) with increasing concentrations from 0.04 to 5 μg /ml of anti-D antibody (Roledumab) in the presence of 0.25 mg/ml of IVIG. Graphs A and D were obtained after application of heat stress at 40°C for 3 months, graphs B and E were obtained after application of heat stress at 50°C for 3 weeks, and graphs C and F after application of heat stress at 50°C for 6 weeks. The results are presented in percentage of phagocytosis (A, B and C) and in average fluorescence intensity (D, E and F) and represent the average of a single experiment carried out in duplicate.

FIG. 7 represents the results of the phagocytosis test of red blood cells sensitized with an anti-D antibody (RhD+RBC) by the cell line of human monocytes according to the invention (THP1 CD16+) with increasing concentrations from 0.04 to 5 μg /ml of anti-D antibody (Roledumab) in the presence of 0.25 mg/ml of IVIG. Graphs A and D were obtained after application of chemical stress using H2O2 at a concentration of 10 mM, graphs B and E were obtained after application of chemical stress using H2O2 at a concentration of 50 mM, and graphs C and F after application of chemical stress using H2O2 at a concentration of 10 mM. The results are presented in percentage of phagocytosis (A, B and C) and in average fluorescence intensity (D, E and F) and represent the average of a single experiment carried out in duplicate.

FIG. 8 represents the results of the phagocytosis test of red blood cells sensitized with an anti-D antibody (RhD+RBC) by the cell line of human monocytes according to the invention (THP1 CD16+) with increasing concentrations from 0.04 to 5 μg /ml of anti-D antibody (Roledumab) in the presence of 0.25 mg/ml of IVIG. Graphs A and D were obtained with DF5, graphs B and E were obtained with anti-D antibody (Roledumab) treated with EndoS2 for 2 hours at 37°C, and graphs C and F were were obtained with the anti-D antibody (Roledumab, batch CB04) heated. The results are presented in percentage of phagocytosis (A, B and C) and in average fluorescence intensity (D, E and F) and represent the average of a single experiment carried out in duplicate.

FIG. 9 (graphs A and C) represents the results of the phagocytosis test of red blood cells sensitized with an anti-D antibody (RhD+RBC) by the cell line of human monocytes according to the invention (THP1 CD16+) with increasing concentrations of 0.04 to 5 µg/ml of anti-D antibody (Roledumab) in the presence of 0.25mg/ml of IVIG after 3 passages or 29 cell culture passages. FIG. 9 (B and D) represents the results of the phagocytosis test of red blood cells sensitized with an anti-D antibody (RhD+RBC) by the cell line of human monocytes according to the invention (THP1 CD16+) with increasing concentrations of 0 0.04 to 5 μg/ml of anti-D antibody (Roledumab, batch 304) having passed one or two F/T cycles in the presence of 0.25 mg/ml of IVIG. The results are presented in percentage of phagocytosis (A and B) and in average fluorescence intensity (C and D) and represent the average of a single experiment carried out in duplicate.

EXAMPLES

Example 1: Preparation of a monocyte cell line (THP1 CD16+)

The THP1 human monocyte cells were transfected twice at MOI 100 with 4 μg/ml of polybrene using the lentiviral vectors expressing the nucleic acid of SEQ ID No.1 (Figure 1). The cells were amplified and a selection of clone was made by limiting dilution. The amplified clones have been characterized beforehand.

1. Thawing and start of cell culture

Cultured cells were obtained from a bank of cryotubes by rapidly thawing at 37°C and diluting them in 10 ml of prewarmed growth medium IMDM + 20% FCS at 37°C. DMSO was removed by centrifugation of the cells at 270g for 5 minutes at room temperature and the supernatant discarded. The cells were then resuspended in fresh culture medium at 0.5×10 ⁶ cells/ml and incubated at 37° C. in humidified incubators with an atmosphere of 5% CO2 in air.

2. Maintenance and expansion of cells

To amplify the THP1 cell line, the cells were cultured in IMDM+10% FCS medium by subculturing them in the desired volume of culture at 4×10 ⁵ cells/ml for 3 days and at 3×10 ⁵ cells/ml for 4 days.

Cell cultures were incubated at 37°C in humidified incubators with an atmosphere of 5% CO2 in air.

3. Cell Concentration and Cell Viability

Total and viable cell densities were determined by automatic counting with Chemometec's NC-200 system. A sample, possibly diluted, of 0.2 ml was analyzed by automated staining with DAPI and acridine orange, followed by a series of photographs. An analysis using the associated software (NucleoView) was carried out to determine the concentrations of total and viable cells. The percentage of viability was calculated by multiplying by 100 the number of viable cells compared to the total number of cells (live and dead cells).

4. Cryopreservation

Cells in the early or mid-exponential growth phase and a viability greater than 80% were used. Cells were harvested by centrifugation and resuspended in freezing medium (95% FCS - 5% DMSO), pre-chilled at 4°C. The cell suspension was then distributed into the appropriate number of cryovials, with 1 ml of suspension per cryovial, containing 5 x 10 ⁶ cells.

The cryovials were immediately placed in a -80°C freezer. The following day, the cryovials were transferred to a cryocontainer and stored in liquid nitrogen by immersion.

5. Immunophenotyping

The THP1 CD16+ human monocyte cell lines according to the invention (during 30 passages) were characterized by flow cytometry after incubation for 15 minutes at room temperature, protected from light, of 1x10 ⁵ cells with different specific antibodies FcγRs according to the following combination: CD16-FITC (20 µL)/CD32-PE (20 µL)/CD64-PC7 (10 µL).

Isotype controls (irrelevant antibodies of the same IgG isotype and labeled with the same fluorochrome) were carried out under the same experimental conditions.

Figure 2 shows the expression profile of the CD16, CD32 and CD64 receptors of the THP1 CD16+ human monocyte cell line.

The cell line of human monocytes according to the invention therefore exhibits a stable expression of the membrane receptors CD16, CD32 and CD64.

6. Determination of the number of CD16, CD32 and CD64 receptors in the cell line of human monocytes according to the invention .

The number of CD16, CD32 and CD64 receptors expressed by the human monocyte cell line according to the invention was determined using the QIFIKIT kit from the company DAKO. For comparison, the presence of these CD16, CD32 and CD64 receptors was also tested in non-transfected THP 1 cells (THP1 WT) and classic monocytes.

More specifically, 100 μL of a cell suspension at a concentration of 2x10 ⁶ cells/mL in PBS + 1%BSA were incubated at a temperature of 4°C for 30 to 60 minutes with 1 μg of three monoclonal antibodies of non-conjugated primary mice anti-CD16, anti-CD32 and anti-CD64 or with an irrelevant mouse monoclonal antibody of the same isotype and adjusted to the same concentration used as a negative control. The samples were then washed twice with 3 mL of PBS + 1%BSA by centrifugation at 270 xg for 5 minutes.

At the same time, 100 µL of resuspended (vortexed) mounting and calibration beads, respectively, were placed in two separate test tubes and washed with 3 mL of PBS + 1% BSA by centrifugation at 270 x g for 5 minutes.

The pellets of cells and beads were incubated in the dark at 4°C for 45 minutes with 100 µL of FITC conjugate, diluted 1/50 in PBS.

The samples are washed twice with 3 mL of PBS + 1% BSA by centrifugation at 270 x g for 5 minutes.

The pellets are resuspended in 500 μL of PBS + 1%BSA before being analyzed by flow cytometry.

The results are shown in Table 1 below.

cells THP1 cell line according to the invention (THP1 CD16+) THP1WT Classic monocytes FcγRs receptors Average number of receivers (n=7 from passage 5 (P5) to passage 25 (P25)) CD16 102,000 0 0 CD32 16,000 18,000 21,000 CD64 31,000 20,000 13,000

Table 1: Determination of the number of CD16, CD32 and CD64 receptors

4/ Stability of the line

In order to validate the use of the cell line according to the invention (THP1 CD16+) for approximately 30 passages of cell culture, corresponding to 3 months of cell culture, a test was carried out to compare the THP1 cells at passages 3 (P3) and 29 (P29) (Figure 9 A/C). .Phagocytosis percentage and MFI as a function of CB04 concentration were analyzed to compare EC50 and Top values. The results are shown in Figure 9.

Figure 9 shows comparable phagocytosis activity between THP1CD16+ cells at passages P3 and P29. These results validate the use of THP1 CD16+ cells for approximately 30 cell culture passages

These results show that the cell line of human monocytes according to the invention stably expresses CD16, CD32 and CD64.

Example 2: Inhibition of platelet phagocytosis mediated by anti-CD41 antibody

1/ Preparing the pads

The platelets were isolated from peripheral blood of human blood group O (EFS, Les Ulis) stored at 22°C ± 2°C overnight and then labeled with PKH67 (Sigma) at a final concentration of 2x10^-6M and sensitized at 37°C for 30 min with shaking with 1 µg/ml of an anti-CD41 monoclonal antibody (absolute antibody) or dilution buffer (non-sensitized platelet control) for a suspension of platelets of 2x10⁷platelets/mL

The THP1 human monocyte cell line according to the invention (THP1 CD16 + cell line) (1x10 ⁶ cells) was pre-incubated for 30 min at 37° C. with increasing concentrations ranging from 6.66x10 ^-5 M, 6, 66x10 ^-6 M, 6.66x10 ^-7 M, to 6.66x10 ^-8 M of 10% IGIV (Iqymune, LFB) or recombinant Fc fragments obtained according to the method described in international application WO 2019/115773 (rFc AY068, rFc EY069 and rFc AY070), corresponding to 10, 1, 0.1 and 0.01 mg/mL for 10% IGIV (Iqymune, LFB) and 3.33; 0.33; 0.03 and 0.003 mg/mL for the recombinant Fc fragments (rFc AY068, rFc EY069 and rFc AY070).

The recombinant Fc fragment (rFc AY070) was produced in a transgenic goat line while the recombinant Fc fragments (rFc AY068 and rFc EY069) were produced in recombinant CHO cells. The fragments were designed with several mutations to increase their affinities for FcRn and CD16 receptors.

The rFc AY068 and rFc AY070 variants contain 5 mutations (K334N; P352S; A378V; V397N; N434Y and 1-N glycosylation site (N297)).

The rFc EY069 variant contains 6 mutations (Y296W, K334N; P352S; A378V; V397N; N434Y, and 1-N glycosylation site (N297)).

2/ Phagocytosis

Platelets labeled and sensitized with an anti-platelet antibody (2×10 ⁷ platelets) were added to the THP1 CD16+ human monocyte cell line (ratio 1:20) and incubated for 1 hour at 37°C.

After incubation, the THP1 cells were incubated with trypan blue to mask the fluorescence of labeled platelets that would not be internalized further, the THP1 human monocyte cell line was labeled with an anti-CD45 fluorescent antibody (Beckman Coulter). Anti-platelet antibody-mediated phagocytosis was measured by flow cytometry (Galios flow cytometer, Beckman Coulter). The results are presented in Figures 3A to 3F

When analyzing percent phagocytosis, an average of 20% phagocytosis of unsensitized platelets was obtained (data not shown) and was inferred from the results of phagocytosis of sensitized platelets.

When the platelets are incubated with 1 μg/mL of anti-CD41, an average of 55% specific phagocytosis is observed. The results were normalized on graphs in order to compare the efficacy of the product on the three donors independently of the initial phagocytosis without product.

A dose-dependent inhibition of phagocytosis was reproducibly observed with the products tested.

Thus, the cell line constitutes a reliable, precise, sensitive and reproducible cell model of immune thrombocytopenia associated with purpura (ITP) making it possible to discern the in vitro therapeutic efficacy of different products.

Example 3: anti-D antibody-mediated phagocytosis of red blood cells

1/ Preparation of red blood cells

Papainated commercial red blood cells (RBC) were washed twice in 0.9% NaCl for 5 minutes at 1730 g and the pellet was suspended in 400 μL of 0.9% NaCl. The suspension is first mixed with 2ml of diluent C and then with 2ml of PKH67 solution at 4×10 ⁻⁶ M in diluent C (final concentration: 2×10 ⁻⁶ M). After rapid mixing, the suspension was incubated for 5 minutes in the dark. 4ml of fetal calf serum (FCS) were added, the supernatant was discarded and the pellet washed three times in 0.9% NaCL. Labeling by PKH67 was checked by cytometry. All red blood cells show fluorescence.

2/ Phagocytosis

Phagocytosis was studied with red blood cells sensitized with known amounts of anti-D antibodies and THP1 CD16+ cells.

Red cells (RBC) labeled with PKH67 are washed twice in 0.9% NaCl for 5 minutes at 1730 g and 50 µL of a 1:30 dilution of red cell pellets in 0.9% NaCl are were mixed with 50 μl of a suspension of fluorescent microbeads (flowcount fluorospheres) and 2 ml of 0.9% NaCl.

The concentration of red blood cells is determined by flow cytometry. The red blood cells were then resuspended in 0.9% NaCl at 2×10 ⁸ red blood cells/ml (± 15%).

The THP1 CD16+ cells (monocyte cell line according to the invention) are counted and then resuspended in an IMDM+10% fetal calf serum (FCS) medium at 1×10 ⁶ cells/ml (±15%).

The red blood cells at a concentration of 2x10 ⁸ red blood cells/mL in 0.9% NaCl are incubated with preparations of anti-D antibodies (Roledumab) at 0.04, 0.08, 0.16, 0.31, 0, 62, 1.25, 2.5 and 5 µg/mL (v/v) or with 0.9% NaCl (non-sensitized red blood cells (NS-RBC)) for 30 minutes at 37°C. The samples are washed twice in IMDM+10% FCS medium and the pellets are suspended at 1×10 ⁸ red blood cells/mL in IMDM+10% FCS medium.

100 µL of red blood cells at 1x10 ⁸ red blood cells/mL are mixed with 100 µL of THP1 CD16 + cells at 1x10 ⁶ cells/mL (i.e. a THP1 cell/red blood cell ratio of 1/100) in the presence of 0.25 mg/mL d human normal immunoglobulins (IVIG). The tests were carried out with 10 samples, each in duplicate. A CD16 specificity control sample is produced with sensitized red blood cells using an anti-D concentration of 5 μg/mL and an anti-CD16 antibody concentration of 5 μg/mL. The incubation is carried out at 37° C. for 1 hour. At the end of the incubation, the PKH67 labeling is extinguished by adding 100 μL of trypan blue, in order to eliminate the signal from the red blood cells stuck to the THP1 CD16+ cells.

After a washing step in 0.9% NaCl, the THP1 CD16+ cells are labeled with a fluorescent anti-CD45 antibody for 15 minutes at room temperature and away from light. The samples are washed again and the red blood cells are lysed with 500 µL of Versalyse Lysing solution for 20 minutes at room temperature, away from light, in order to eliminate non-phagocytosed red blood cells (red blood cells phagocytosed by the cells targets are not sensitive to these treatments). The samples are washed again and fixed with 500 μL of fixing solution diluted to 1/40 before analysis. The percentage of THP1 CD45+ cells containing PKH67 red blood cells (percentage of phagocytosis) and their mean PKH67 fluorescence intensity (MFI) are measured by flow cytometry with a Galios Flow cytometer from the company Beckman Coulter. The results are then analyzed with the Kaluza Analysis software. The results are shown in Figures 4A-4D.

Findings:

Phagocytosis activity (percentage (Figure 4A) and MFI (Figure 4B)) is proportional to anti-D concentration with a maximum of 91% phagocytosis. The negative control without anti-D (NS-RBC) and with the anti-CD16 antibody (S-RBC + Anti-CD16) shows 2% and 4% (Figure 4C) of phagocytosis, respectively. Phagocytosis signals are specifically mediated by the binding of anti-D coated red cells to the CD16 receptor.

The cell line according to the invention therefore expresses, in addition to CD32 and CD64, functional CD16.

Example 4: Method for selecting antibodies with high phagocytosis activity (ADCP)

1/ Sensitivity

Forced degradation was performed on the anti-D antibody (Roledumab, lot CB04), to examine the sensitivity of the method and to determine if it indicates stability.

The batch was supplied in pre-filled syringes at a protein concentration of 0.3 mg/mL in the following formulation: trisodium citrate dihydrate (8.82 g/L) at pH 6.5, sodium chloride (3. 25g/L), mannitol (17g/L). L) and Polysorbate 80 at 400 ppm.

Degradation stresses will focus on heat stress, oxidation and deglycosylation. The prepared samples are described in Table 2 below.

Applied Stress Nature Terms Settings JCD16 activity Heating Thermal +40°C
+50°C
+50°C 3 months
3 weeks
6 weeks 55
59
43 Oxidation Chemical _{H2O2 _} 10mM, 24 hours at +25°C
50mM, 24 hours at +25°C
100mM, 24 hours at +25°C 70
61
53 Deglycosylation Enzymatic EndoS2 2 hours at 37°C 0.1

Table 2: Summary of forced degradation applied to anti-D antibody (Roledumab, lot CB04).

1.1/ Sensitivity to heat stress

Thermal stress is used to accelerate chemical or physical degradation phenomena.

Roledumab (anti-D antibody - lot CB04) is known to be temperature sensitive; thermal stress induces aggregation, structural modification (fragmentation, chemical modification, etc.) and loss of activity (CD16 activity). Rroledumab vials will be placed at +40°C for 3 months, at +50°C for 3 weeks and 6 weeks.

The percentage of phagocytosis and the MFI according to the concentration of anti-D antibodies (Roledumab - batch CB04) were analyzed to compare the EC50 values and the maximum value of the heated sample. The results are shown in Figure 6.

Figure 6 shows a significant but slight decrease in the percentage of phagocytosis after heating for 6 weeks at +50°C (EC50: 77%, top: 86%). On the other hand, a very significant decrease in MFI Top was observed after heating to reach 40%, after 6 weeks at +50°C. Heat stress and the associated degradation seem to have a significant negative impact on the activity of phagocytosis, in particular on the quantity of red blood cells ingested.

1.2/ Chemical sensitivity: oxidation by H ₂ O ₂

Oxidative degradation that occurs in biotherapeutic treatments is one of the chemical degradation pathways of recombinant monoclonal antibodies (mAbs). Monoclonal antibodies are exposed to processing and storage conditions that can influence the rate and extent of these changes. Oxidation of methionine (primary), as well as cysteine, histidine, tryptophan and tyrosine can be induced by incubation with oxidizing agents such as H ₂ O ₂ .

Potential sources of oxidation include the use of excipients containing trace amounts of oxidizing species (e.g., polysorbate 80) or contact of the drug substance with residual disinfectants or depyrogenating agents that possess some oxidative potential. .

Oxidation stress was performed by adding 10 mM, 50 mM and 100 mM H ₂ O ₂ with an incubation time of 24 hours at +25°C. A negative control with the same volume as H ₂ O ₂ was made with water. The percentage of phagocytosis and the MFI according to the concentration of anti-D antibodies (Roledumab - batch CB04) were analyzed to compare the EC50 values and the maximum value of the oxidized sample. The results are shown in Figure 7.

Figure 7 shows no decrease in phagocytosis activity after treatment with 10 mM H ₂ O ₂ . A slight decrease in the percentage of phagocytosis (EC50) after treatment with 50 mM and 100 mM was observed (respectively 87% and 79%).

In contrast, as for heat stress, a greater and comparable decrease in peak MFI was observed after treatment with 50 mM and 100 mM H ₂ O ₂ : 75% and 77% respectively.

Oxidative stress and the associated degradation (fragmentation, oxidation, etc.) seem to have a significant negative impact on the activity of phagocytosis, in particular on the quantity of red blood cells ingested.

1.3/ Deglycosylation

DF5 is an anti-D IgG1 monoclonal antibody produced by a human lymphoblastoid cell line. This highly fucosylated antibody shows low binding affinity for FcγRIIIa (CD16a).

Deglycosylation was performed by adding 3 µg of EndoS2 to 150 µg of anti-D antibody (Roledumab, batch CB04, called “CB04”) with an incubation time of 2 hours at +37°C. A negative control with the same volume as H ₂ O ₂ is carried out with water.

The percentage of phagocytosis and the MFI according to the concentration of Aanti-D were analyzed to compare the EC50 and Top values of DF5 and the anti-D antibody (Roledumab, lot CB04). The results are shown in Figure 8.

Figure 8 shows that the highly fucosylated antibody DF5 has low phagocytosis (A/D) activity and the deglycosylated anti-D (Roledumab, lot CB04) antibody was not able to induce phagocytosis of red blood cells (B/E). The negative control (C/F) is comparable to untreated anti-D antibody (Roledumab, lot CB04).

The method therefore allows the selection of antibodies according to their ability to phagocytose (ADCP: Antibody-Dependent Cell Phagocytosis).

2/ Accuracy

Precision is the close agreement between multiple sample measurements of a homogeneous sample under recommended conditions.

Accuracy was studied using anti-D antibody (Roledumab) lot CB04.

Twenty-five assays of two independent series of 8 determinations of anti-D (Roledumab) lot CB04 antibody were performed.

The EC50, maximum phagocytosis and mean fluorescence intensity (MFI) of each series (2 values/parameter/assay, i.e. 50 values/parameter) are used to calculate the standard deviation (SD), the coefficient of variation (CV) and the confidence interval (CI) to determine the intermediate precision of the method (PI or CVR).

For this study, 3 cryotubes of THP1 CD16+ cell line, 9 preparations of red blood cells (PKH67 labeling) and different batches of reagents, including 3 batches of PKH67 kit, were used. The statistical analysis is presented in Table 3 below.

%phagocytosis MFI Setting EC50 (µg/mL) Top (%) EC50 (µg/mL) Top (MFI) Mean 0.4257 89.31 0.831 183.4 SD 0.0586 3.92 0.118 64.6 CVR%(IP) 14% 4% 14% 8%(CVr) THIS Result ±0.1178 Result ±7.89 Result ±0.238 Result ±29.6

Legend: * Variance IP= S ² _R = S ² _r + S ² _{g -} CV _R = S _R /µ x 100 - CI = result ± tx S _R

The intermediate precision is 14% for the EC50 parameter regardless of the signal read (% phagocytosis or MFI) and 4% for the maximum percentage of phagocytosis (%Top). For the MFI Top, this signal being directly dependent on the fluorescence of the red blood cells, this differs from one test to another, only the repeatability has been calculated, it is 8%.

The method is therefore sufficiently precise to make it possible to select antibodies according to their ADCP capacity.

Findings:

The phagocytosis test developed for red blood cells sensitized by the anti-D antibody using the monocyte cell line according to the invention (THP1 CD16 + cells) is:
- Accurate and reproducible : the maximum variation of 14% was obtained during the statistical analysis of 25 independent analyses.
- Sensitive , because an evolution of the EC50 and the Top according to the type of degradation and proportional to the intensity of the degradation was observed, with the Top parameter of fluorescence, which seems to be the most relevant for the study of stressed/structurally modified samples.

Claims (19)

Cell line of human monocytes expressing in a stable and functional manner the human Fc gamma receptors (FcγR) CD16, CD32 and CD64 on their surface, in which the cell line is obtained by retroviral transduction with a lentiviral vector comprising at least one nucleic acid of sequence SEQ ID No.1 or a nucleic acid of sequence SEQ ID No.2. A human monocyte cell line according to claim 1, wherein the human monocyte cell line is derived from the THP1 cell line. A human monocyte cell line according to any one of claims 1 to 2, wherein the lentiviral vector further comprises a nucleic acid of sequence SEQ ID No.3. Cell line of human monocytes according to one of claims 1 to 3, in which the lentiviral vector comprises:
- a nucleic acid of sequence SEQ ID No.4 consisting of the nucleic acid of sequence SEQ ID No.2 and the nucleic acid of sequence SEQ ID No.3, or
- a nucleic acid of sequence SEQ ID No.5 consisting of the nucleic acid of sequence SEQ ID No.1 and the nucleic acid of sequence SEQ ID No.3. Cell line of human monocytes according to any one of claims 1 to 4, in which the cell line has been obtained by retroviral transduction with a lentiviral vector comprising at least one nucleic acid of sequence SEQ ID No.6. Use of a human monocyte cell line according to any one of claims 1 to 5, as a model of splenic phagocytosis, in particular of phagocytosis in the red pulp of the spleen. Process for obtaining human monocytes as described in any one of claims 1 to 5, comprising the following steps:
a) isolating human monocytes from the peripheral blood of a patient suffering from acute myelomonocytic leukemia,
b) transduction of human monocytes with a lentiviral vector comprising a nucleic acid of sequence chosen from SEQ ID No.1, SEQ ID No.4, SEQ ID No.5, SEQ ID No.6 or a nucleic acid of sequence SEQ ID No .2,
c) selecting for expression of human monocytes with a selection medium, and
d) check the expression levels of the CD16, CD32 and CD64 receptors. Process for obtaining human monocytes as described in any one of claims 1 to 5, comprising the following steps:
a) obtaining an established human monocyte line
b) transduction of human monocytes with a lentiviral vector comprising a nucleic acid sequence chosen from SEQ ID No.1, SEQ ID No.4, SEQ ID No.5, SEQ ID No.6 or a nucleic acid of sequence SEQ ID No. 2,
c) selecting for expression of human monocytes with a selection medium, and
d) check the expression levels of the CD16, CD32 and CD64 receptors. Method for in vitro evaluation of the phagocytic activity of a cell line of human monocytes comprising the following steps:
a) labeling and sensitization of the target entities with antibodies directed against said target entities,
b) bringing the target entities from step a) into contact with the cell line of human monocytes according to one of claims 1 to 5,
c) measurement of the phagocytic activity mediated by the antibodies directed against said target entities by flow cytometry, and
d) determination of phagocytosis. Method for in vitro evaluation of the phagocytic activity of a cell line of human monocytes comprising the following steps:
a) labeling and sensitization of the target entities with antibodies directed against said target entities,
b) preincubation of the human monocyte cell line according to one of Claims 1 to 5 in the presence of an agent blocking the human CD16, CD32 and/or CD64 Fc gamma receptors (FcγR) on the surface of the cell line monocytes,
c) bringing the target entities from step a) into contact with the human monocyte cell line from step b),
d) measurement of the phagocytic activity mediated by the antibodies directed against said target entities by flow cytometry, and
e) determination of phagocytosis. Method for in vitro evaluation of the phagocytic activity of a human monocyte cell line according to any one of claims 9 or 10, in which the target entities are chosen from organisms and particles having a surface antigen capable of binding an antibody. A method for in vitro evaluation of the phagocytic activity of a human monocyte cell line according to claim 11, wherein said organisms are selected from living organisms and dead organisms, said living or dead organisms containing RNA or DNA. A method for in vitro evaluation of the phagocytic activity of a cell line of human monocytes according to claim 12, in which the organisms are chosen from viruses, bacteria, fungi, mycoplasmas, virions, yeasts, living cells, in particular modified living cells or unmodified living cells, cell precursors, and fragments thereof. A method for in vitro evaluation of the phagocytic activity of a cell line of human monocytes according to claim 13, in which the living cells are chosen from platelets, erythrocytes and cancer cells. Method for in vitro evaluation of the phagocytic activity of a cell line of human monocytes according to claim 11, in which the particles having a surface antigen capable of binding an antibody are nanoparticles. Method for in vitro evaluation of the phagocytic activity of a cell line of human monocytes according to one of Claims 9 or 10, in which the antibodies directed against the said target entities are chosen from anti-D antibodies, in particular Roledumab , and anti-platelet antibodies, in particular anti-CD41. A method for the in vitro evaluation of the phagocytic activity of a human monocyte cell line according to claim 10, in which the agent blocking the human Fc gamma receptors (FcγR) CD16, CD32 and/or CD64 on the surface of the monocyte cell line is selected from a polyvalent immunoglobulin G and/or a recombinant Fc fragment. Method for selecting antibodies with high ADCP activity mediated by human Fc gamma (FcγR) CD16, CD32 and/or CD64 receptors comprising the following steps:
a) preincubation of the human monocyte cell line according to one of claims 1 to 5 in the presence of an agent blocking the human Fc gamma receptors (FcγR) CD16, CD32 and/or CD64 on the surface of the cell line monocytes,
b) contacting the cell line of human monocytes from step a) with said antibodies to be selected, said antibodies being bound to their target entities
c) determination of phagocytosis, and
d) selection of antibodies with strong ADCP activity mediated by CD16 and/or CD32 and/or CD64. A method of selecting an ADCP inhibitor mediated by human CD16, CD32 and/or CD64 Fc gamma receptors (FcγR) comprising the following steps:
a) opsonization of the target entities with an antibody with high ADCP activity directed against said target entities,
b) bringing the cell line of human monocytes according to one of claims 1 to 5 into contact with the target entities opsonized during step a) and the said inhibitors to be selected,
c) determination of phagocytosis, and
d) selection of ADCP inhibitors mediated by CD16 and/or CD32 and/or CD64.