WO2021048961A1

WO2021048961A1 - Agent for suppressing/improving bad skin caused by fatigue and/or stress and screening method for agents for suppressing/improving bad skin caused by fatigue and/or stress

Info

Publication number: WO2021048961A1
Application number: PCT/JP2019/035784
Authority: WO
Inventors: 美郷豊田; 信一郎土師; 雅史宮井; 麻衣子光村; 瞳遠藤; 真紀白土
Original assignee: 株式会社資生堂
Priority date: 2019-09-11
Filing date: 2019-09-11
Publication date: 2021-03-18
Also published as: JPWO2021048961A1; CN114502137A; JP2023182737A

Abstract

By promoting the expression or suppressing reductions in the expression of caspase 14, this agent for suppressing/improving bad skin suppresses/improves bad skin that is caused by increases in cortisol caused by fatigue and/or stress. This screening method makes it possible to select substances that suppress/improve bad skin that is caused by fatigue and/or stress. An agent for suppressing/improving bad skin that includes camellia flower extract and/or shekwasha extract. The agent for suppressing/improving bad skin suppresses/improves bad skin that is caused by fatigue and/or stress by promoting the expression or suppressing reductions in the expression of caspase 14.

Description

Rough skin control / ameliorating agent due to fatigue and / or stress and its screening method

The present invention relates to an agent for suppressing / improving rough skin due to fatigue and / or stress, and a screening method thereof.

It is well known that stress causes mental and physical damage. From a beauty point of view, stress impairs the water retention function and barrier function of the skin, and causes skin troubles and skin diseases such as dry skin, disordered texture, acne, eczema, atopic dermatitis, and allergic dermatitis. Is known (Patent Documents 1 to 3). Further, it is known that when stress is overlapped, a state in which work efficiency is lowered, that is, a state in which fatigue is generated (Non-Patent Document 1).

The current lifestyle is flooded with various information stimuli through sight, hearing, etc., and it is possible that such stimuli may cause stress and fatigue. However, the effects of fatigue or stress caused by such information stimuli on the skin have not been investigated so far.

Cortisol is known as a marker for evaluating stress. Cortisol is a steroid hormone whose secretion increases due to stress, and is also called "stress hormone". Cortisol is released from the adrenal cortex and has anti-inflammatory, immunosuppressive, glucose metabolism, protein metabolism, lipid metabolism enhancing effects, etc., but in skin cells, cortisol reduces phyllagulin and collagen (Non-Patent Document 2). It has been reported that the expression of loricrin is reduced (Non-Patent Document 3) and the like.

Therefore, it is desirable to search for substances that can suppress the deterioration of skin condition due to fatigue and stress. However, until now, it has not been fully elucidated what kind of substance suppresses deterioration of skin condition such as rough skin caused by an increase in cortisol due to fatigue and stress, for example, fatigue and stress caused by information stimulation.

Japanese Patent No. 3935636 Japanese Patent No. 4780817 Japanese Patent No. 5661994 JP-A-2017-160187 Japanese Patent No. 6052719 Japanese Unexamined Patent Publication No. 2013-096826 Japanese Unexamined Patent Publication No. 2011-115108

An object of the present invention is to provide an agent for suppressing / improving rough skin due to fatigue and / or stress.

The present inventors conducted diligent research to suppress / improve rough skin caused by fatigue and stress. As a result, it was discovered that an increase in cortisol, which is strongly associated with fatigue and stress, causes a decrease in the expression of caspase 14. Based on these findings, we have established a method for screening agents for suppressing / ameliorating rough skin due to fatigue and / or stress. By such a screening method, a novel substance having an action of suppressing / improving rough skin due to fatigue and / or stress was also discovered.

The present application provides the following inventions:
(1) An agent for suppressing / improving rough skin due to fatigue and / or stress, which contains camellia flower extract and / or shikuwasa extract as an active ingredient.
(2) The rough skin suppressing / improving agent according to (1), wherein the fatigue and / or stress is information fatigue and / or information stress.
(3) The rough skin suppressing / improving agent according to (1) or (2), wherein the rough skin is rough skin caused by a decrease in the expression of caspase 14 due to an increase in cortisol due to fatigue and / or stress.
(4) The rough skin suppressing / ameliorating agent according to any one of (1) to (3), which prevents / improves the rough skin by suppressing the expression of caspase 14 or increasing the expression of caspase 14.
(5) An expression enhancer for caspase 14 containing camellia flower extract and / or shikuwasa extract as an active ingredient.
(6) The caspase 14 expression-enhancing agent according to (5) for preventing / ameliorating rough skin through increased expression of caspase 14.
(7) The agent for enhancing the expression of caspase 14 according to (5) or (6), wherein the rough skin is rough skin caused by a decrease in the expression of caspase 14 due to an increase in cortisol due to fatigue and / or stress.
(8) The agent for enhancing the expression of caspase 14 according to (7), wherein the fatigue and / or stress is information fatigue and / or information stress.
(9) A cosmetological method for preventing / ameliorating rough skin due to fatigue and / or stress by administering a composition containing a camellia flower extract and / or a shikuwasa extract to a subject.
(10) The cosmetological method according to (9), wherein the rough skin is rough skin caused by a decrease in the expression of caspase 14 due to an increase in cortisol due to fatigue and / or stress.
(11) The beauty method according to (9) or (10), wherein the fatigue and / or stress is information fatigue and / or information stress.
(12) The cosmetological method according to any one of (9) to (11), wherein the rough skin is prevented / ameliorated by increasing or suppressing the expression of caspase 14.
(13) A method for screening an agent for suppressing / ameliorating rough skin due to fatigue and / or stress, using the suppression of increased expression of caspase 14 or the suppression of decreased expression of caspase 14 as an index.
(14) The screening method according to (13), wherein the fatigue and / or stress is information fatigue and / or information stress.
(15) The screening method according to (13) or (14), wherein the decreased expression of caspase 14 is due to an increase in cortisol.
(16) The screening method according to any one of (13) to (15), wherein the rough skin is rough skin caused by a decrease in the expression of caspase 14 due to an increase in cortisol due to fatigue and / or stress.
(17) A screening method for an agent for suppressing / ameliorating rough skin caused by an increase in cortisol due to fatigue and / or stress.
Applying candidate drugs to skin samples;
To measure the expression of caspase 14 in skin samples before and after applying the candidate drug;
When the expression of caspase 14 in the skin sample to which the candidate drug is applied is increased as compared with that before the drug is applied, it is evaluated that the drug has an effect of suppressing / ameliorating rough skin due to fatigue and / or stress;
The method described above.
(18) The method according to (17), wherein the fatigue and / or stress is information fatigue and / or information stress.
(19) The method according to (17) or (18), wherein the measurement is performed by measuring the expression of caspase 14 in a skin sample in the presence of cortisol.
(20) A camellia flower extract and / or a shikuwasa extract that suppresses / improves rough skin through increased expression of caspase 14.
(21) The camellia flower extract and / or shikuwasa extract according to (20), wherein the rough skin is rough skin due to a decrease in the expression of caspase 14 due to an increase in cortisol due to fatigue and / or stress.
(22) The method according to (21), wherein the fatigue and / or stress is information fatigue and / or information stress.
(23) The camellia flower extract according to any one of (20) to (22), which prevents / improves rough skin by increasing the expression of caspase 14 or suppressing the decrease in the expression of caspase 14 by increasing cortisol. / Or Shikuwasa extract.

The rough skin suppressing / improving agent of the present invention can enhance the expression of caspase 14 and suppress the decrease in the expression of caspase 14 due to the increase in cortisol. When the expression of caspase 14 is enhanced or decreased as described above, rough skin caused by, for example, information fatigue and / or fatigue such as information stress and / or cortisol increase due to stress is suppressed / ameliorated. Rough skin inhibitory / ameliorating agents containing camellia flower extract and / or shikuwasa extract are effective in suppressing / ameliorating rough skin due to fatigue and / or stress through suppression of upregulation or decrease in expression of caspase 14. In addition, the rough skin inhibitor / improver selected by the screening method of the present invention is caused by fatigue and / or stress by enhancing the expression of caspase 14 and / or suppressing the decrease in the expression of caspase 14 due to the increase in cortisol. Suppresses / improves rough skin. According to the present invention, the water retention function and the barrier function of the skin are restored or strengthened, and skin troubles and skin diseases caused by fatigue and / or stress can be improved.

FIG. 1 is a schematic diagram illustrating the information stress / fatigue task of Experiment 1. FIG. 2 shows the change in TEWL (transdermal water evaporation amount) under the information stress / fatigue task of Experiment 1 measured in Experiment 2. FIG. 3 shows the change in the degree of fatigue by the Chalder Fatigue Scale under the information stress / fatigue task of Experiment 1 measured in Experiment 3. FIG. 4 shows the time course of the amount of cortisol in saliva (ng / ml) measured in Experiment 4 under the information stress / fatigue task of Experiment 1. FIG. 5 shows the relationship between the cortisol concentration and the expression level of caspase 14 measured in Experiment 5. The expression level of caspase 14 is shown by the relative mRNA expression level with (-) as 1 when cortisol is not added. FIG. 6 shows the relationship between the expression of caspase 14 in the presence of cortisol and the concentration of camellia flower extract or citrus depressa extract measured in Experiment 6. The expression level of caspase 14 is shown as a relative mRNA expression level with (-) as 1 when the camellia flower extract or the citrus depressa extract is not added.

Caspase 14 is a cysteine protease known to be involved in the water retention function and barrier function of the skin (Patent Documents 4 to 7). It is considered that when the amount of caspase 14 or the expression level decreases, the water retention function and the barrier function are lost, causing rough skin. Further, as described above, it is also known that stress and an increase in cortisol cause rough skin (Non-Patent Document 3). However, it has not been reported so far that an increase in cortisol causes a decrease in the expression of caspase 14. Surprisingly, the present inventors have discovered that cortisol causes a decrease in the expression of caspase 14 in rough skin caused by fatigue and / or stress such as information fatigue and / or information stress. An attempt was made to construct a system simulating cortisol with cortisol, and a method for screening a drug capable of increasing the expression level of caspase 14 in the presence of cortisol was established.

The present invention is based on the findings of such inventors, and includes an agent for suppressing / ameliorating rough skin and an agent for enhancing the expression of caspase 14 (hereinafter, these may be collectively referred to as "the agent of the present invention"). It relates to the screening method, as well as cosmetic methods including administration of them. The rough skin suppressing / improving agent of the present invention may consist of or may contain an expression enhancer for caspase 14. For example, the rough skin suppressing / improving agent of the present invention causes information fatigue and / or fatigue such as information stress and / or stress by enhancing the expression of caspase 14 or suppressing the decrease in the expression of caspase 14 due to an increase in cortisol. Rough skin caused by increased cortisol can be suppressed / improved.

In the present specification, rough skin refers to deterioration of skin condition such as dry skin, redness, acne, disordered texture, eczema, itchiness, yellowing, dullness, pigmentation, and parakeratosis. Rough skin is caused by, for example, rough skin due to decreased expression of caspase 14, fatigue such as information fatigue and / or information stress and / or rough skin due to stress, fatigue such as information fatigue and / or information stress, and / or increase in cortisol due to stress. Rough skin, information fatigue and / or rough skin due to decreased expression of caspase 14 due to increased cortisol due to fatigue such as information stress and / or stress. Rough skin can be evaluated by an increase in TEWL (transdermal water evaporation), an increase in the number of cells with parakeratosis, a decrease in the water content of the stratum corneum, etc. Methods can be used, in particular known evaluation methods for rough skin due to increased cortisol, rough skin due to decreased amount or expression of caspase 14, fatigue and / or stress, such as information fatigue and / or information stress.

Nowadays, there is a flood of stimuli from various information such as advertisements, news, the Internet, SNS, lightning display boards, music, broadcasting on the premises and in cars, etc. through visual and auditory senses such as sounds, images, photographs, and characters. ing. In the present specification, the information stimulus refers to a stimulus by such various information. Information fatigue refers to fatigue caused by information stimuli, and information stress refers to stress caused by information stimuli. The present inventors have discovered that information fatigue and information stress have adverse effects on the skin, including an increase in TEWL. Therefore, the rough skin of the present invention can be caused by information fatigue and / or information stress.

Suppression / improvement of rough skin means suppression / improvement of deterioration of skin condition as described above, and can be evaluated by the same method as the above-mentioned evaluation method of rough skin, although it is not limited. In certain embodiments, the suppression / amelioration of rough skin is achieved, for example, by enhancing the expression of caspase 14, or by suppressing the decrease in the expression of caspase 14 due to the increase in cortisol, and the increase in cortisol is achieved. It is caused by fatigue and stress such as information fatigue and / or information stress.

The enhanced expression of caspase 14 means that, for example, the expression level of caspase 14 has a significance level of 5, for example, when the agent of the present invention is applied, as compared with the state (control) in which the agent of the present invention is not applied. Increased with a statistically significant difference (for example, Dunnett's test) as%, or for example, 5% or more, 10% or more, 20% or more, 30% or more, 40% or more, 50% or more, It can mean that it is increased by 60% or more, 70% or more, 80% or more, 90% or more, 100% or more, 200% or more, 300% or more, 400% or more, or 500% or more.

Suppression of a decrease in the expression of caspase 14 means, for example, a decrease in the expression level of caspase 14 (for example, cortisol) when the agent of the present invention is applied as compared with a state (control) in which the agent of the present invention is not applied. Decrease in the expression level of caspase 14 due to the increase in caspase) is decreased by, for example, a statistically significant difference (for example, Wilcoxon rank sum test, t-test, etc.) with a significance level of 5%, or for example, 5 % Or more, 10% or more, 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 90% or more, or 100% decrease. obtain.

The expression level of caspase 14 may be measured by a PCR method such as the RT-PCR method as in the examples, may be measured using a commercially available kit, or may be measured by the method described in Patent Document 4. Any known technique can be used, although it can be obtained, but not limited to these.

The agent of the present invention may consist of camellia flower extract and / or shikuwasa extract, or may be contained as an active ingredient. However, the substance is not limited to these as long as it can enhance the expression of caspase 14, and for example, an agent for enhancing the expression of caspase 14 as described in Patent Document 4 or the like may be used.

The agent of the present invention may contain any one of the above active ingredients alone, or may contain two or more of them in any combination and ratio.

The agent of the present invention may also be a composition in which the above-mentioned active ingredient is combined with one or more other ingredients such as excipients, carriers and / or diluents.

Camellia (Camellia japonica) is an evergreen tree of the genus Camellia of the Theaceae family, which is widely distributed in Asian regions such as Japan and China. Camellia flowers are known to be used for whitening, anti-aging, moisturizing, etc. (Japanese Patent Laid-Open No. 2002-371092, Japanese Patent Application Laid-Open No. 2013-53108, Japanese Patent Application Laid-Open No. 2017-522354). The camellia flower extract refers to an extract obtained by extracting camellia flowers.

Citrus depressa is an evergreen shrub citrus of the Rutaceae family that is distributed in Amami Oshima, Okinawa, Taiwan, etc. Citrus depressa is known to have moisturizing, saccharification, anti-inflammatory effects, etc. (Japanese Patent Laid-Open Nos. 2009-196898, 2014-76957, and International Publication No. 2007/097286). Citrus depressa extract refers to the extract of the fruit and / or pericarp of the citrus depressa, preferably the pericarp.

The above-mentioned plant extract may be a commercially available material as a cosmetic raw material or a health food material, or may be obtained by a conventional method. The extraction method is not particularly limited, but an extraction method using a solvent is preferable. When extracting, the raw material plant can be obtained by dipping or heating at room temperature or heating with an extraction solvent, and then filtering and concentrating. Although the plant body can be used as it is, it is possible to extract the active ingredient in a short time with high extraction efficiency under mild conditions by crushing it into granules or powder and using it for extraction. The extraction temperature is not particularly limited, and may be appropriately set according to the particle size of the pulverized product, the type of solvent, and the like. Usually, it is set in the range from room temperature to the boiling point of the solvent. Further, the extraction time is not particularly limited, and may be appropriately set according to the particle size of the pulverized product, the type of solvent, the extraction temperature, and the like. Further, at the time of extraction, stirring may be performed, the mixture may be allowed to stand without stirring, or ultrasonic waves may be applied.

As the extraction solvent, any solvent can be used as long as it is usually used for extraction. For example, an aqueous solvent such as water, physiological saline, a phosphate buffer, a borate buffer, or an organic solvent such as ethanol can be used. Alcohols such as propylene glycol, 1,3-butylene glycol and glycerin, hydrous alcohols, chloroform, dichloroethane, carbon tetrachloride, acetone, ethyl acetate, hexane and the like can be used alone or in combination.

By such an extraction operation, the active ingredient is extracted and dissolved in the solvent. The solvent containing the extract may be used as it is, or may be used after adding conventional purification treatments such as sterilization, washing, filtration, decolorization, and deodorization. If necessary, it may be concentrated by freeze-drying or diluted with an arbitrary solvent before use. Further, the solvent may be completely volatilized to form a solid (dried product) before use, or the dried product may be redissolved in an arbitrary solvent before use.

Further, since the squeezed liquid obtained by squeezing the raw material plant also contains the same active ingredient as the extract, the squeezed liquid can be used instead of the extract.

The present application also provides a composition containing the agent of the present invention. The composition of the present invention may be a cosmetic composition or a food composition. The composition of the present invention may be, for example, a composition for suppressing / ameliorating rough skin due to fatigue or stress such as information fatigue or information stress.

The present application also provides a cosmetological method for preventing / ameliorating rough skin due to fatigue and stress such as information fatigue and information stress by administering the agent or composition of the present invention to a subject. The method of the present invention is a method for the purpose of cosmetology and may not be treated by a doctor or a medical professional.

Even if the subject to which the agent or composition of the present invention is administered is a subject in which fatigue or stress-induced rough skin such as information fatigue or information stress is objectively or subjectively recognized, it is desired to prevent the skin roughness due to such fatigue or stress. It may be the desired object. For example, it may be a subject judged to have high TEWL, a large number of cells with parakeratosis, etc., or rough skin due to fatigue or stress, for example, dry skin, redness, acne, disordered texture, etc. It may be an object of concern such as eczema and itching.

The agent or composition of the present invention can be administered by any route such as external administration or oral administration. As the form of external administration, for example, cream, milky lotion, liquid, sheet, spray, gel and the like can be arbitrarily selected. As the form of oral administration, for example, tablets, supplements, beverages, powders and the like can be arbitrarily selected.

The cosmetic composition of the present invention may be various cosmetics such as milky lotion, cream, beauty essence, lotion, facial mask, facial cleanser, soap, body soap, shampoo, etc., and may be liquid, milky liquid, creamy, solid, sheet. It can be in various forms such as a form, a spray form, a gel form, a foam form, and a powder form. In addition, the food composition of the present invention may be a powder, a beverage, or a tablet, and may be in various forms such as powder, liquid, solid, granular, granular, paste, and gel.

The frequency of administration is once every four weeks, once every two weeks, once a week, once every three days, once every two days, once a day, twice a day, three times a day. It can be arbitrarily selected, such as 4 times a day, 5 times a day, and each administration, but the present invention is not limited thereto.

The blending amount of active ingredients such as camellia flower extract and / or shikuwasa extract in the agent or composition of the present invention can be appropriately determined according to their types, purposes, forms, usage methods and the like. For example, the blending amount of the camellia flower extract and / or the Shikuwasa extract is 0.0001 to 100% by weight, 0.0001 to 90% by weight, 0.001 to 50% by weight, 0.01 to 5% by weight per total weight of the agent or composition of the present invention. , 0.01 to 1% by weight, 0.01 to 0.5% by weight, 0.05 to 0.2% by weight, 0.1% by weight, etc., but is not limited as long as the effect of the present invention is exhibited.

The agent or composition of the present invention can be produced by a conventional method in a formulation appropriately combined with an excipient, a carrier and / or a diluent and the like and other components according to the dosage form. The excipient of the agent or composition of the present invention may be any as long as it is usually used in a desired dosage form, for example, wheat starch, rice starch, corn starch, potato starch, dextrin, cyclodextrin. Examples thereof include starches such as starches, crystalline celluloses, lactose, glucose, sugar, reduced malt sugar, water candy, fructo-oligosaccharides, sugars such as emulsified oligosaccharides, and sugar alcohols such as sorbitol, erythritol, xylitol, lactitol and mannitol. These excipients can be used alone or in combination of two or more.

Other additives include colorants, preservatives, thickeners, binders, disintegrants, dispersants, stabilizers, gelling agents, antioxidants, surfactants, preservatives, pH regulators, oils, Known substances such as water, alcohols, chelating agents, silicones, ultraviolet absorbers, moisturizers, fragrances, various medicinal ingredients, preservatives, and neutralizing agents can be appropriately selected and used.

Furthermore, the present application also provides a screening method for an agent for suppressing / ameliorating rough skin due to information fatigue and / or fatigue such as information stress and / or stress, using the suppression of increased expression of caspase 14 or decreased expression of caspase 14 as an index. Rough skin or decreased expression of caspase 14 due to fatigue and / or stress such as information fatigue and / or information stress may be caused by an increase in cortisol. The screening method of the present invention is to apply a candidate drug to a skin sample; to measure the expression of caspase 14 in the skin sample before and after the candidate drug is applied; to measure the expression of caspase 14 in the skin sample to which the candidate drug is applied. When the increase is compared with that before the drug is applied, it may be evaluated that the drug has an effect of suppressing / ameliorating fatigue and / or rough skin due to stress such as information fatigue and / or information stress; At this time, cortisol may be added to the skin sample.

The skin sample may be a skin sample after collection, for example, a skin sample in an ex vivo state after being collected from an animal such as a human, or a cultured skin cell, for example, a cultured keratinocyte or a cultured fibroblast. It may be in an in vitro state such as a cell. Alternatively, it may be an artificial skin sample such as a 3D skin model. The skin sample is not limited as long as the expression level of caspase 14 can be measured.

Further, in the present application, a camellia flower extract and / or a shikuwasa extract that suppresses / improves rough skin due to a decrease in the expression of caspase 14 due to an increase in cortisol through an increase in the expression of caspase 14 or a suppression of a decrease in the expression of caspase 14 due to an increase in cortisol. We also provide things.

Next, the present invention will be described in more detail by way of examples. The present invention is not limited thereto.

Experiment 1: Information stress / fatigue task A task experiment related to vision and hearing was conducted. We hired 19 healthy women aged 28 to 34 years old who understood the content of the test and obtained free will to participate in the test, and examined the relationship between stress / fatigue and skin condition. ..

The above subjects were asked to perform the following 2 back tasks and music viewing tasks at the same time for 30 minutes a day for 5 consecutive days from the 1st day to the 5th day, and stress and fatigue were given. From the first day on each test day, the doctor in charge of the test asked questions about the psychological and physical aspects, and after confirming his / her intention to continue the test, the test was continued.

2-back task Fig. 1 The 2-back task as shown in the above figure was performed. Specifically, the characters A, B, C, and D were randomly switched and displayed on the screen one by one. Only one character was presented at a time for 500 milliseconds, then disappeared, and after 2000 milliseconds the next character was presented repeatedly. The subject is presented with these series of letters, determines whether the letters displayed on the currently presented screen are the same as the letters displayed twice before, and presses a predetermined key on the keyboard to answer. Was instructed to.

Music viewing task Fig. 1 The music viewing task was performed as shown in the figure below. Specifically, the subjects were instructed to wear earphones, and music was played for 30 minutes through the earphones at the same time as the start of the experiment. The music was pop music with vocals and back music, and copyright-free music was used. The music stopped for 5 seconds several times during the 30 minutes and then resumed. Subjects were instructed to raise their hands when the music stopped.

Experiment 2: Effect of stress / fatigue on the skin In order to investigate the effect of stress / fatigue on the skin, the skin conditions were compared on the first and fifth days of the test of Experiment 1 before the task was performed. TEWL (transdermal water evaporation) was measured as an index of skin condition. TEWL was measured using a Vapo meter manufactured by Delfin.

The results are shown in Fig. 2. As shown in FIG. 2, TEWL showed a significant increase on the 5th day compared to the 1st day. This result suggests that the barrier function is impaired by stress and fatigue. Similarly, an increase in the number of immature stratum corneum cells was observed with the accumulation of stress and fatigue (data not shown).

Experiment 3: Changes in the degree of fatigue due to the task In order to investigate the effect of the task on fatigue, the degree of fatigue was compared on the first and fifth days of the test of Experiment 1 before the task was performed. The degree of fatigue was evaluated using the Chalder Fatigue Scale based on the answers obtained from the subjects using the questionnaire described in Non-Patent Document 4 as an index.

The results are shown in Fig. 3. As shown in FIG. 3, the Chalder Fatigue Scale showed a significant increase on the 5th day compared to the 1st day. From this result, it was found that the task increased fatigue.

Experiment 4: Increase in the amount of cortisol due to the task In order to investigate the change in the amount of cortisol due to the task, on each test day of Experiment 1, the saliva of the subject was collected immediately after the task was performed, and the cortisol level in the saliva was measured by Cortisol of Salimetrics. Quantified using the EIA kit. As a baseline, on the pre-measurement day, which is 3 days before the task start date, the subject was asked to rest for the same time as the task, saliva was collected after the rest, and the saliva cortisol level was measured by the same method as above. , That value was used as the control value. Since it is known that the cortisol level changes with time, the test implementation time was adjusted so that the saliva collection time on each test day would be the same.

The results are shown in Fig. 4. As shown in FIG. 4, cortisol increased from the first day.

Experiment 5: Relationship between cortisol and caspase 14 Normal human neonatal epidermal keratinocytes (Kurabo) were seeded on a plate containing Humedia-KG2 (Kurabo) medium and cultured at _{37 ° C. and 5% CO 2.} Two days after sowing, the medium was exchanged with a fresh Humedia-KB2 medium supplemented with a growth additive other than hydrocortisone (hereinafter referred to as Humedia-KG2 (cortisol (-)) medium). One day later, the medium was exchanged with Humedia-KG2 (cortisol (-)) medium supplemented with cortisol to 1.5 mM Ca2 + and each concentration (300 nM, 1 μM, 2 μM), and cells were sampled 24 hours later. RNA was extracted from the sampled cells using Roche's RNA extraction kit (MagNA Pure LC RNA Isolation Kit-High Performace), and caspase by RT-PCR using the PCR primer (C14 primer) of the following sequence. The expression level of 14 mRNAs was measured.
C14 primer sequence
F: TGCACGTTTATTCCACGGTA
R: TGCTTTGGATTTCAGGGTTC

Similarly, the expression level of PGK1, which is a housekeeping gene, was quantified using a PGK1 primer (Takarabio, Human Housekeeping Gene Primer Set) and used as an internal standard, and the mRNA expression level of caspase 14 relative to the expression level of PGK1 was used as a relative value. It was calculated as.

The results are shown in Fig. 5. As shown in FIG. 5, it was shown that the addition of cortisol significantly reduced the expression of caspase 14.

From the above results, it was found that cortisol causes a decrease in the expression of caspase 14 in rough skin caused by fatigue and stress. Therefore, a system simulating a rough skin condition was constructed using cortisol as shown below, and a screening agent for suppressing / improving rough skin due to fatigue and stress was performed.

Experiment 6: Screening method for substances having a skin roughness suppressing / improving effect due to fatigue / stress that enhances the expression of caspase 14 in the presence of cortisol. Screening was performed using 74 kinds of raw materials. For the camellia flower extract, "Camellia flower extract BG" manufactured by Nichiyu Co., Ltd. was used, and for the shikuwasa extract, "Shikuwasa extract BG" manufactured by Nichiyu Co., Ltd. was used. "Camellia flower extract BG" contains 1% camellia flower extract and 49.5% 1,3-BG and 49.5% water. "Citrus depressa extract BG" contains 1.4% citrus depressa peel extract, 59.2% 1,3-BG and 39.4% water.

In the same manner as in Experiment 5, normal human neonatal epidermal keratinocytes (Kurabo) were seeded using Humedia-KG2 (Kurabo) medium and cultured at _{37 ° C. and 5% CO 2.} One day after sowing, the medium was replaced with fresh Humedia-KG2 (cortisol (-)) medium. One day later, the medium was replaced with Humedia-KG2 (cortisol (-)) medium to which 1.5 mM Ca2 +, 1 μM cortisol, and the above-mentioned Shikuwasa extract or camellia flower extract were added to a concentration of 0.10% (w / w). went. As a control, a medium having the same composition was used except that these extracts were not contained. Cells were sampled after 24 hours. From the sampled cells, the mRNA expression level of caspase 14 was measured by the same method as in Experiment 5, and PGK1 was used as an internal standard, and the mRNA expression level of caspase 14 was calculated as a relative value to the expression level of PGK1.

The results are shown in Fig. 6. From FIG. 6, when the camellia flower extract and the citrus depressa extract were used among the 74 candidate drugs, the expression of caspase 14 in the presence of cortisol was increased as compared with the control. These extracts were selected as substances that suppress / improve rough skin due to fatigue and stress by suppressing the expression-enhancing action of caspase 14 or the decrease in the expression of caspase 14 due to the increase in cortisol.

Claims

A rough skin suppressor / improver containing camellia flower extract and / or shikuwasa extract as an active ingredient to prevent / improve rough skin due to fatigue and / or stress.
The rough skin suppressing / improving agent according to claim 1, wherein the fatigue and / or stress is information fatigue and / or information stress.
The rough skin inhibitor / improver according to claim 1 or 2, wherein the rough skin is rough skin caused by a decrease in the expression of caspase 14 due to an increase in cortisol due to fatigue and / or stress.
The rough skin suppressing / improving agent according to any one of claims 1 to 3, which prevents / improves the rough skin by suppressing the expression of caspase 14 or increasing the expression of caspase 14.
An expression enhancer for caspase 14 containing camellia flower extract and / or shikuwasa extract as an active ingredient.
The caspase 14 expression enhancer according to claim 5, for preventing / ameliorating rough skin through increased expression of caspase 14.
The caspase 14 expression enhancer according to claim 5 or 6, wherein the rough skin is rough skin caused by a decrease in the expression of caspase 14 due to an increase in cortisol due to fatigue and / or stress.
The caspase 14 expression enhancer according to claim 7, wherein the fatigue and / or stress is information fatigue and / or information stress.
A cosmetological method for preventing / ameliorating rough skin due to fatigue and / or stress by administering a composition containing camellia flower extract and / or shikuwasa extract to a subject.
The cosmetological method according to claim 9, wherein the rough skin is rough skin caused by a decrease in the expression of caspase 14 due to an increase in cortisol due to fatigue and / or stress.
The beauty method according to claim 9 or 10, wherein the fatigue and / or stress is information fatigue and / or information stress.
The cosmetological method according to any one of claims 9 to 11, wherein the rough skin is prevented / ameliorated by increasing or suppressing the expression of caspase 14.
A screening method for an agent for suppressing / ameliorating rough skin due to fatigue and / or stress, using the suppression of increased expression of caspase 14 or the suppression of decreased expression of caspase 14 as an index.
The screening method according to claim 13, wherein the fatigue and / or stress is information fatigue and / or information stress.
The screening method according to claim 13 or 14, wherein the decreased expression of caspase 14 is caused by an increase in cortisol.
The screening method according to any one of claims 13 to 15, wherein the rough skin is rough skin caused by a decrease in the expression of caspase 14 due to an increase in cortisol due to fatigue and / or stress.
A screening method for agents that suppress / improve rough skin caused by increased cortisol due to fatigue and / or stress.
Applying candidate drugs to skin samples;
To measure the expression of caspase 14 in skin samples before and after applying the candidate drug;
When the expression of caspase 14 in the skin sample to which the candidate drug is applied is increased as compared with that before the drug is applied, it is evaluated that the drug has an effect of suppressing / ameliorating rough skin due to fatigue and / or stress;
The method described above.
The method according to claim 17, wherein the fatigue and / or stress is information fatigue and / or information stress.
The method according to claim 17 or 18, wherein the measurement is performed by measuring the expression of caspase 14 in a skin sample in the presence of cortisol.