Classifications

• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
  • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
  • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
  • C12N15/86—Viral vectors
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
  • A61P31/12—Antivirals
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
  • C07K14/52—Cytokines; Lymphokines; Interferons
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
  • C07K14/52—Cytokines; Lymphokines; Interferons
  • C07K14/521—Chemokines
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
  • C07K14/52—Cytokines; Lymphokines; Interferons
  • C07K14/54—Interleukins [IL]
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
  • C12N9/14—Hydrolases (3)
  • C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
  • C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
  • C12N9/64—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue
  • C12N9/6421—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue from mammals
  • C12N9/6472—Cysteine endopeptidases (3.4.22)
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12Y—ENZYMES
  • C12Y204/00—Glycosyltransferases (2.4)
  • C12Y204/02—Pentosyltransferases (2.4.2)
  • C12Y204/02036—NAD(+)--diphthamide ADP-ribosyltransferase (2.4.2.36)
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12Y—ENZYMES
  • C12Y304/00—Hydrolases acting on peptide bonds, i.e. peptidases (3.4)
  • C12Y304/22—Cysteine endopeptidases (3.4.22)
  • C12Y304/22062—Caspase-9 (3.4.22.62)
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2730/00—Reverse transcribing DNA viruses
  • C12N2730/00011—Details
  • C12N2730/10011—Hepadnaviridae
  • C12N2730/10111—Orthohepadnavirus, e.g. hepatitis B virus
  • C12N2730/10122—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
  • C12N2750/00011—Details
  • C12N2750/14011—Parvoviridae
  • C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
  • C12N2750/14141—Use of virus, viral particle or viral elements as a vector
  • C12N2750/14143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
  • C12N2760/00011—Details
  • C12N2760/16011—Orthomyxoviridae
  • C12N2760/16111—Influenzavirus A, i.e. influenza A virus
  • C12N2760/16122—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
  • C12N2760/00011—Details
  • C12N2760/16011—Orthomyxoviridae
  • C12N2760/16211—Influenzavirus B, i.e. influenza B virus
  • C12N2760/16222—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
  • C12N2770/00011—Details
  • C12N2770/20011—Coronaviridae
  • C12N2770/20022—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes

Definitions

• the disclosure provides methods and compositions utilizing recombinant nucleic acid constructs or a replication incompetent virus-like particle encoding a chemokine, cytokine, or apoptosis inducing protein (e.g. Caspase 9 (Casp9)), in a form which will only be transcribed in the presence of a viral polymerase.
• a chemokine cytokine
• apoptosis inducing protein e.g. Caspase 9 (Casp9)
• Caspase 9 Caspase 9
• HBV infection hepatitis B virus
• CHB chronic hepatitis B
• HCC hepatocellular carcinoma
• HBV persistence in infected hepatocytes is due to the presence of covalently closed circular DNA (cccDNA), the template for the transcription of viral RNAs.
• cccDNA covalently closed circular DNA
• Antiviral therapies with nucleoside analogues inhibit replication of HBV DNA in capsids present in the cytoplasm of infected cells, but do not reduce or destroy nuclear cccDNA.
• antiviral drugs are currently only effective against a few viral diseases.
• a recombinant nucleic acid sequence comprising: a negative strand nucleic acid molecule or a pgRNA nucleic acid molecule encoding a chemokine, a cytokine, an apoptosis inducing protein, or a combination thereof, flanked by a first and second viral transcription recognition signal, and further comprising a first promoter upstream (5’) of the first viral transcription recognition signal and a second promoter adjacent and 5’ to the negative strand nucleic acid molecule or pgRNA nucleic acid molecule encoding a chemokine, a cytokine, a apoptosis inducing protein, or combination thereof.
• the negative strand nucleic acid molecule is negative sense RNA, negative sense DNA, single or double strand DNA that expresses a non-coding, negative sense RNA, or pgRNA, or any combination thereof.
• the viral transcription recognition signal is selected from a virus selected from a negative strand virus, an RNA reverse transcribing virus, or a DNA reverse transcribing virus.
• the recombinant nucleic acid further comprises a poly A tail downstream (3’) of the negative strand nucleic acid molecule or pgRNA nucleic acid molecule encoding a chemokine, a cytokine, an apoptosis inducing protein, or combination thereof.
• the apoptosis inducing protein is selected from the group consisting of BAX, BID, BAK, BAD, caspase 2, caspase 8, caspase 9, caspase 10, caspase 11, caspase 12, cytochrome C, SMAC, and apoptosis-inducing factor, or combinations thereof.
• the first promoter comprises a strong ubiquitous promoter or a liver-tis sue- specific promoter, selected from the group consisting of TBG (Thyroxine Binding Globulin), albumin promoter and/or enhancing element, AFP (alpha- fetoprotein) promoter, AAT (Alpha- 1 -antitrypsin) promoter, ApoE ( Apolipoprotein E ) promoter or PEPCK (Phosphoenolpyruvate carboxykinase) promoter.
• TBG Thiroxine Binding Globulin
• albumin promoter and/or enhancing element
• AFP alpha- fetoprotein
• AAT Alpha- 1 -antitrypsin
• ApoE Apolipoprotein E
• PEPCK Phosphoenolpyruvate carboxykinase
• the second promoter comprises elongation factor 1 alpha binding sequence (EFS).
• EFS elongation factor 1 alpha binding sequence
• the chemokine is selected from CCL1, CCL2, CCL3, CCL4, CCL5, CCL6, CCL7, CCL8, CCL9, CCL10, CCL11, CCL12, CCL13, CCL14, CCL15, CCL16, CCL17, CCL18, CCL19, CCL20, CCL21, CCL22, CCL23, CCL24, CCL25, CCL26, CCL27, CCL28, CXCL1, CXCL2, CXCL8, CXCL9, CXCL10, CXCL11, CXCL12, CXCL13, CXCL14, CXCL15, CXCL16, CXCL17, XCL1, XCL2, and CX3CL1.
• the cytokine is selected from the group consisting of IL-15, IL-2, IL-8, IL-10, IL-12, IL-6, IFN-a, IFN-b, IFN-g, TNF- a, CD40L, Mig, and Crg-2.
• the virus is Hepatitis B virus, Hepatitis D virus, ebola virus, Marburg virus, human parainfluenza virus 1, measles virus, mumps virus, human respiratory syncytial virus, vesicular stomatitis Indiana virus, rabies virus, bovine ephemeral fever virus, lymphocytic choriomeningitis virus, Bunyamwera virus, Hantaan virus, Stuttgart sheep disease virus, sandfly fever Sicilian virus, influenza virus A, influenza virus C, Thogoto virus, mouse mammary tumor virus, murine leukemia virus, avian leukosis virus, Mason-Pfizer monkey virus, bovine leukemia virus, human immunodeficiency virus 1, human spumavirus, duck hepatitis B virus, and a combination thereof.
• the viral infection comprises an infection from a coronavirus, such as the virus referred to as COVID-19, SARS, or MERS.
• a coronavirus such as the virus referred to as COVID-19, SARS, or MERS.
• the subject has an acute, chronic, or latent viral infection.
• administration induces an immune response against a cell infected with the virus causing the viral infection.
• a method of inducing an immune response against a cell infected with a virus, in a subject in need thereof comprising contacting the subject with any of the recombinant nucleic acid molecules described herein, or the vectors described herein, or the pharmaceutical compositions described herein, or the replication incompetent virus-like particles described herein.
• a method of inducing an apoptotic response against a cell infected with a virus, in a subject in need thereof comprising contacting the subject with any of the recombinant nucleic acid molecules described herein, or the vectors described herein, or the pharmaceutical compositions described herein, or the replication incompetent virus-like particles described herein.
• the virus is HBV, HDV, hepatitis A virus (HAV), hepatitis C virus (HCV), or any combination thereof.
• HBV hepatitis A virus
• HCV hepatitis C virus
• a method of treating hepatitis B in a subject comprising administering to the subject a recombinant nucleic acid molecule described herein, or a vector described herein, or the pharmaceutical compositions described herein, or the replication incompetent virus-like particle described herein.
• the method further comprises administering at least one antiviral agent, HBV polymerase inhibitor, interferon, TLR modulators such as TLR-7 agonists or TLR-9 agonists, therapeutic vaccines, immune activator of certain cellular viral RNA sensors, viral entry inhibitor, viral maturation inhibitor, distinct capsid assembly modulator, antiviral compounds of distinct or unknown mechanism, and any combination thereof.
• TLR modulators such as TLR-7 agonists or TLR-9 agonists
• therapeutic vaccines immune activator of certain cellular viral RNA sensors, viral entry inhibitor, viral maturation inhibitor, distinct capsid assembly modulator, antiviral compounds of distinct or unknown mechanism, and any combination thereof.
• the method further comprises administering at least one antiviral agent 3TC, FTC, L-FMAU, interferon, adefovir dipivoxil, entecavir, telbivudine (L-dT), valtorcitabine (3’-valinyl L-dC), .beta.
• DXG -D-dioxolany 1-guanine
• DAPD .beta.- D-dioxolanyl-2,6-diaminopurine
• ACP .beta.-D-dioxolanyl-6-chloropurine
• famciclovir penciclovir, lobucavir, ganciclovir, ribavirin, and any combination thereof.
• the treatment is administered periodically, including once every week, once every 2 weeks, once every 3 weeks, once a month, to once every two months, to once every 3 months, to once every 4 months, to once every 5 months, to once every 6 months, or once every 7 months, or once every 8 months, or once every 9 months, or once every 10 months, or every 11 months, or once annually as a maintenance treatment, or for as long as the patient requires to achieve stable or undetectable disease.
• FIGURE 1A and FIGURE IB include a plasmid map and recombinant construct schematic showing features of the AAV8-HBV-DRS2 construct (6005bp).
• FIGURE 5A and FIGURE 5B show a plasmid map (FIGURE 5A) and comparative graph (FIGURE 5B) showing the results for test and control constructs in HepG2 vs HepAD38 cells for experiment 2.
• FIGURE 8 is a plasmid map and construct schematic showing features of the AAV8-HBV-DRS2 construct and sequences.
• FIGURE 9 is a schematic illustrating the in vivo testing utilizing model mice to evaluate distribution, efficacy, specificity/functionality, and safety of the targeted recombinant constructs.
• FIGURE 10A and FIGURE 10B are a schematic and a graph showing how the “influenza hijack/suicide vectors” hijack the viral machinery to induce apoptosis in infected cells (FIGURE 10A), and in vitro results showing that the test constructs delivered in irons to engage with influenza polymerase hijacks the viral machinery to induce cell death in influenza infected cells 40% more rapidly than untreated infected cells (FIGURE 10B).
• FIGURE 13 illustrates a schematic showing the mechanism of action of SARS-CoV-2 hijack RNA in SARS-CoV-2-infected cells.
• compositions utilizing recombinant nucleic acid constructs or a replication incompetent virus-like particle encoding a chemokine, cytokine, or apoptosis inducing protein (e.g. Caspase 9 (Casp9) and others as provided herein), which will only be transcribed in the presence of a viral polymerase are provided.
• constructs carry sequences encoding for Casp9, which will result in killing of virally infected cells.
• the present methods and compositions are based at least in part on utilizing the viral machinery present typically in the cytoplasm of an infected cell.
• a recombinant nucleic acid construct or a replication incompetent virus-like particle (VLP) into a virally infected cell wherein the construct or VLP comprises a single stranded RNA nucleic acid construct containing a sequence coding for a chemokine, cytokine, or apoptosis inducing protein, e.g., Casp 9 (and its promoter), flanked by hepatitis B epsilon signal binding sequences, to form a construct that will only be transcribed when recognized by the hepatitis B reverse transcriptase, will engage the epsilon sequence to transcribe the segment and result in translation of the coding sequence for Casp 9, which will trigger apoptosis of the
• This viral polymerase is what recognizes the flanking epsilon sequences in the recombinant nucleic acid constructs and replication incompetent virus-like particles described herein, and results in production of the toxic agent. Thus, only the virally infected cells will be killed by the production of the chemokine, cytokine, or apoptosis inducing protein (e.g. Caspase 9 (Casp9)).
• the chemokine, cytokine, or apoptosis inducing protein e.g. Caspase 9 (Casp9)
• the chemokine, cytokine, or apoptosis inducing protein is flanked by the viral 5’ UTR and the viral 3’ UTR, such that the nucleic acid can be represented by the formula X-Y-Z, wherein X is the viral 5’ UTR, Y is the protein of interest, such as a chemokine, cytokine, or apoptosis inducing protein (e.g. Caspase 9 or others as provided for herein, or diphtheria toxin A fragment), and Z is the viral 3’ UTR. There may be intervening sequences between the 5’ UTR and the protein of interest or the 3’ UTR and the protein of interest. When the transcript is recognized by the cell it will produce a 5 ’-3’ reverse complement encoding the protein of interest. This can be delivered as well in an AAV expression vector or other appropriate viral vector.
• the 5 ’-UTR is the 5’ Leading Sequence of a coronavirus such as the virus that is referred to as COVID-19 (or COVD-19), SARS, or MERS.
• the 5 ’-UTR comprises the sequence, or complement thereof, of:
• the 3 ’UTR comprises the sequence, or complement thereof, of:
• the nucleic acid sequence encoding diphtheria toxin A fragment comprises (or the complement thereof):
• nucleic acid sequence encoding diphtheria toxin A fragment is provided as the reverse complement, which can comprise the sequence of:
• sequence is provided as the reverse complement, which can comprise the sequence of: CATGAAGACAGTGTTTAGCAAGATTGTTTTTTTGTCATTCTCCTAAGAAGCTA TTAAAATCACATGGGGATAGCACTACTAAAATTAATTTTACACATTAGGGCTC TTCCATATAGGCAGCTCTCCCTAGCATTGTTCACTGTACACTCGATCGTACTC CGCGTGGCCTCGGTGAAAATGTGGTGGCTCTTTCAAGTCCTCCCTAATGTTAC ACACTGATTAAAGATTGTTACAATGAGCTACCTACTGATCGCCTGACACGATT TCCTGCACAGGCTTGAGCCATATACTCATACATCGCATCTTGGCCACGTTTTC CACGGGTTTCAAAATTAATCTCAAGTTCTACGCTTAACGCTTTCGCCTGTTCC CAGTTATTAATATATTCAACGCTAGAACTCCCCTCAGCGAAGGGAAGGCTGAG CACTACACGCGAAGCACCATCACCATCACCATCACCATCACCATCACCATCACCATCACCATCACC
• sequences provided herein are represented as DNA sequences, the corresponding RNA sequences are also provided.
• nucleic acid sequence and “nucleic acid molecule”, as used herein, can be used interchangeably.
• a recombinant nucleic acid sequence comprises a negative strand nucleic acid molecule or a pgRNA nucleic acid molecule encoding a chemokine, a cytokine, an apoptosis inducing protein, or a combination thereof, flanked by a first and second viral transcription recognition signal, and further comprising a first promoter upstream (5’) of the first viral transcription recognition signal and a second promoter adjacent and 5’ to the negative strand nucleic acid molecule or pgRNA nucleic acid molecule encoding a chemokine, a cytokine, a apoptosis inducing protein, diphtheria toxin A (or fragment thereof), or any combination thereof.
• Non-limiting examples of chemokines, cytokines, and apoptosis inducing proteins are provided herein.
• the actual protein that is flanked by the first and second viral transcription recognition signal can be any suitable protein.
• This encoded protein can also be replaced with any protein of interest, not just that encode for a chemokine, a cytokine, a apoptosis inducing protein, or a diphtheria toxin A (or fragment thereof).
• the viral transcription recognition signal is derived from or based on a virus that is, for example, a negative strand virus, an RNA reverse transcribing virus, or a DNA reverse transcribing virus.
• the viral transcription recognition signal is a negative strand virus viral transcription recognition signal.
• the viral transcription recognition signal is a RNA reverse transcribing virus viral transcription recognition signal.
• the viral transcription recognition signal is a DNA reverse transcribing virus viral transcription recognition signal.
• the recombinant nucleic acid sequence comprises a poly A tail downstream (3’) of the negative strand nucleic acid molecule or pgRNA nucleic acid molecule that also encodes the protein of interest, such as a toxin, chemokine, a cytokine, an apoptosis inducing protein, or combination thereof.
• the protein of interest is not a viral protein.
• chemokines that can be used or encoded for by the present embodiments, include, but are not limited to, CCL1, CCL2, CCL3, CCL4, CCL5, CCL6, CCL7, CCL8, CCL9, CCL10, CCL11, CCL12, CCL13, CCL14, CCL15, CCL16, CCL17, CCL18, CCL19, CCL20, CCL21, CCL22, CCL23, CCL24, CCL25, CCL26, CCL27, CCL28, CXCL1, CXCL2, CXCL8, CXCL9, CXCL10, CXCL11, CXCL12, CXCL13, CXCL14, CXCL15, CXCL16, CXCL17, XCL1, XCL2, and/or CX3CL1.
• the cytokine is selected from the group consisting of IL-15, IL-2, IL-8, IL-10, IL-12, IL-6, IFN-a, IFN-b, IFN-g, TNF- a, CD40L, Mig, and Crg-2.
• the recombinant nucleic acid sequence can further comprise a promoter that directs the expression of the nucleic acid sequences in the cell.
• the promoter is a constitutive promoter.
• the promoter is a tissue specific promoter.
• the promoter is a liver-tissue-specific promoter.
• liver-tissue-specific promoters include, but are not limited to, TBG (Thyroxine Binding Globulin), albumin promoter and/or enhancing element, AFP (alpha- fetoprotein) promoter, AAT (Alpha- 1 -antitrypsin) promoter, ApoE (Apolipoprotein E ) promoter or PEPCK (Phosphoenolpyruvate carboxykinase) promoter.
• TBG Thiroxine Binding Globulin
• albumin promoter and/or enhancing element AFP (alpha- fetoprotein) promoter
• AAT Alpha- 1 -antitrypsin
• ApoE Adoprotein E
• PEPCK Phosphoenolpyruvate carboxykinase
• the recombinant nucleic acid sequence comprises a second promoter.
• a second promoter is elongation factor 1 alpha binding sequence (EFS).
• the viral transcription recognition signal comprises epsilon recognition signal (SEQ ID NO:l) or a corona virus recognition sequence (such as those found in SEQ ID: 25, SEQ ID: 26, SEQ ID: 28, or SEQ ID: 30).
• SEQ ID NO:l epsilon recognition signal
• corona virus recognition sequence such as those found in SEQ ID: 25, SEQ ID: 26, SEQ ID: 28, or SEQ ID: 30.
• Other viral transcription recognition signal sequences can also be used and be substituted for one that is specific for the virus or viral infection to be treated.
• the present embodiments can be used to treat viral infections.
• the compositions and methods can be used to specifically kill virally infected cells.
• the benefit of specifically killing virally infected cells is that it can lead to the destruction of only of the cells that harbor the virus.
• viruses that can be used for the viral transcription recognition signal include, but are not limited to, corona virus (e.g.
• Hepatitis B virus Hepatitis D virus
• ebola virus Marburg virus
• human parainfluenza virus 1 measles virus
• mumps virus human respiratory syncytial virus
• vesicular stomatitis Indiana virus rabies virus
• bovine ephemeral fever virus lymphocytic choriomeningitis virus
• Bunyamwera virus Hantaan virus, Stuttgart sheep disease virus, sandfly fever Sicilian virus, influenza virus A, influenza virus C, Thogoto virus, mouse mammary tumor virus, murine leukemia virus, avian leukosis virus, Mason-Pfizer monkey virus, bovine leukemia virus, human immunodeficiency virus 1, human spumavirus, duck hepatitis B virus, coronavirus, and a combination thereof.
• the choice of the viral transcription recognition signal sequence can be used to determine which type of viral infection is treated. For example, if the viral transcription recognition signal sequence is the COVID-19 viral transcription recognition signal sequence the nucleic acid molecules provided herein would only be expressed in cells infected COVID-19. COVID-19 is merely used as non limiting example and should not be used to limit the embodiments provided herein.
• the nucleic acid molecules does not comprise sequences (coding or noncoding) for viral polymerase, reverse transcriptase, capsid, envelope, a packaging signal, or a translocation motif. In some embodiments, the recombinant nucleic acid molecule does not comprise sequences (coding or noncoding) for a viral polymerase. In some embodiments, the recombinant nucleic acid molecule does not comprise sequences (coding or noncoding) for a reverse transcriptase. In some embodiments, the recombinant nucleic acid molecule does not comprise sequences (coding or noncoding) for a capsid protein.
• the recombinant nucleic acid molecule does not comprise sequences (coding or noncoding) for an envelope protein. In some embodiments, the recombinant nucleic acid molecule does not comprise sequences (coding or noncoding) for a packaging signal. In some embodiments, the recombinant nucleic acid molecule does not comprise sequences (coding or noncoding) for a translocation motif.
• the recombinant nucleic acid molecules provided herein can be provided in a vector.
• the vector for example, can be a delivery vector or vehicle for delivery to, for example, a mammalian cell, such as a human cell.
• the cell is a cyno (e.g. monkey) cell.
• the vector is a vector that can deliver the recombinant nucleic acid molecule to a human and a cyno cell.
• the vector is a vector that can deliver the recombinant nucleic acid molecule to a human cell, but not a cyno cell.
• the vector is a vector that can deliver the recombinant nucleic acid molecule to a cyno cell, but not a human cell.
• a replication incompetent virus-like particle comprising a recombinant nucleic acid molecule, such as those provided herein (e.g. negative strand nucleic acid molecule or a pgRNA nucleic acid molecule), encoding a protein of interest (e.g., chemokine, a cytokine, a apoptosis inducing protein, or a combination thereof), flanked by a first and second target viral transcription recognition signal, and further comprising a first promoter upstream (5’) of the first viral transcription recognition signal and a second promoter adjacent and 5’ to the negative strand nucleic acid molecule or pgRNA nucleic acid molecule encoding a chemokine, a cytokine, a apoptosis inducing protein, or a combination thereof, wherein the VLP exhibits tropism for the target virally infected cells.
• a recombinant nucleic acid molecule such as those provided herein (e.
• the replication incompetent virus-like particle further comprises a poly A tail sequence downstream (3’) of the negative strand nucleic acid molecule or pgRNA nucleic acid molecule encoding a chemokine, a cytokine, a apoptosis inducing protein, or combination thereof.
• Baltimore Group IV viruses possess positive- sense single stranded RNA genomes, including the picornaviruses (which is a family of viruses that includes well-known viruses like Hepatitis A virus, enteroviruses, rhinoviruses, poliovirus, and foot-and-mouth virus), SARS virus, hepatitis C virus, yellow fever virus, and rubella virus. This group also includes the coronaviruses, hepeviruses (Hepatitis E), as well as the flaviviviruses, such as Dengue virus, hepatitis C virus, yellow fever virus, and Zika virus.
• picornaviruses which is a family of viruses that includes well-known viruses like Hepatitis A virus, enteroviruses, rhinoviruses, poliovirus, and foot-and-mouth virus
• SARS virus hepatitis C virus
• yellow fever virus yellow fever virus
• rubella virus rubella virus.
• This group also includes the coronaviruses, hepeviruses (
• Negative- strand RNA viruses can be classified into 21 distinct families.
• the families consisting of nonsegmented genomes include Rhabdo-, Paramyxo-, Filo- and Borna-.
• Orthomyxo-, Bunya-, Arenaviridae- contain genomes of six to eight, three, or two negative- sense RNA segments, respectively.
• NSV respiratory syncytial virus
• RSV respiratory syncytial virus
• influenza viruses influenza viruses
• Ebola virus Marburg virus
• the life cycle of NSV has a number of steps.
• the virus first infects the host cell by binding to the host cell receptor through a viral surface glycoprotein.
• the fusion of the glycoprotein viral membrane with the plasma membrane of the host cell in an acidic environment allows for the release of viral ribonucleoprotein (RNP) complexes into the cytoplasm.
• RNP viral ribonucleoprotein
• Most NSV replicate in the cytoplasm of infected cells.
• Newly synthesized RNP complexes are assembled with viral structural proteins at the plasma membrane or at membranes of the Golgi apparatus. This is all followed by the release of the newly synthesized viruses.
• HBV DNA virus with unusual features similar to retroviruses.
• HBV replicates through an RNA intermediate and can integrate into the host genome.
• the unique features of the HBV replication cycle confer a distinct ability of the virus to persist in infected cells.
• Virological and serological assays have been developed for diagnosis of various forms of HBV-associated disease and for treatment of chronic hepatitis B infection.
• HBV infection leads to a wide spectrum of liver disease ranging from acute (including fulminant hepatic failure) to chronic hepatitis, cirrhosis, and hepatocellular carcinoma.
• Acute HBV infection can be either asymptomatic or present with symptomatic acute hepatitis.
• the term “about” is intended to mean ⁇ 5% of the value it modifies. Thus, about 100 means 95 to 105. Additionally, the term “about” modifies a term in a series of terms, such as “about 1, 2, 3, 4, or 5” it should be understood that the term “about” modifies each of the members of the list, such that “about 1, 2, 3, 4, or 5” can be understood to mean “about 1, about 2, about 3, about 4, or about 5.” The same is true for a list that is modified by the term “at least” or other quantifying modifier, such as, but not limited to, “less than,” “greater than,” and the like.
• FIGURE 1A Vector maps of the exemplary constructs used to test recombinant variants described herein are shown in FIGURE 1A, FIGURE IB, FIGURE 2A, FIGURE 3A, FIGURE 4 A, FIGURE 5A, FIGURE 6A, FIGURE 7, AND FIGURE 8. While graphs of results testing these constructs are shown in FIGURE 2B, FIGURE 3B, FIGURE 4B FIGURE 4C, FIGURE 5B, FIGURE 6B and FIGURE 6C. Exemplary sequences useful in these constructs are provided in SEQ ID NOs:l-9. These are non- limiting examples and can be modified or tailored based on the virus of interest to be treated.
• co-administration are meant to encompass administration of the selected therapeutic agents to a single patient, and are intended to include treatment regimens in which the agents are administered by the same or different route of administration or at the same or different time.
• agonist refers to a compound, the presence of which results in a biological activity of a protein that is the same as the biological activity resulting from the presence of a naturally occurring ligand for the protein.
• partial agonist refers to a compound the presence of which results in a biological activity of a protein that is of the same type as that resulting from the presence of a naturally occurring ligand for the protein, but of a lower magnitude.
• an antagonist refers to a compound, the presence of which results in a decrease in the magnitude of a biological activity of a protein. In certain embodiments, the presence of an antagonist results in complete inhibition of a biological activity of a protein. In certain embodiments, an antagonist is an inhibitor.
• administering when used in conjunction with a therapeutic composition (e.g. recombinant nucleic acid constructs and replication incompetent virus-like particles and compositions comprising these products) means to administer a therapeutic directly into or onto a target tissue or to administer a therapeutic to a patient whereby the therapeutic positively impacts the tissue to which it is targeted.
• a therapeutic composition e.g. recombinant nucleic acid constructs and replication incompetent virus-like particles and compositions comprising these products
• the term “subject” or “patient” as used herein includes, but is not limited to, humans and non-human vertebrates such as wild, domestic, and farm animals.
• the subject or patient described herein is an animal.
• the subject or patient is a mammal.
• the subject is a human.
• the subject or patient is a non-human animal.
• the subject or patient is a non-human mammal.
• the subject or patient is a domesticated animal, such as a dog, cat, cow, pig, horse, sheep, or goat.
• the subject or patient is a companion animal such as a dog or cat.
• the subject or patient is a livestock animal such as a cow, pig, horse, sheep, or goat. In certain embodiments, the subject or patient is a zoo animal. In another embodiment, the subject or patient is a research animal such as a rodent, dog, or non-human primate. In certain embodiments, the subject or patient is a non-human transgenic animal such as a transgenic mouse or transgenic pig.
• inhibitor includes the administration of a therapeutic of embodiments herein to prevent the onset of the symptoms, alleviating the symptoms, or eliminating the disease, condition or disorder.
• pharmaceutically acceptable it is meant the carrier, diluent or excipient must be compatible with the other ingredients of the therapeutic and not deleterious to the recipient thereof.
• treat refers to both therapeutic treatment and prophylactic or preventative measures, wherein the object is to inhibit, prevent or slow down (lessen) an undesired physiological condition, disorder or disease, or to improve, inhibit, or otherwise obtain beneficial or desired clinical results.
• antibody refers to an immunoglobulin molecule which specifically binds with an antigen.
• Antibodies can be intact immunoglobulins derived from natural sources or from recombinant sources and can be immunoreactive portions of intact immunoglobulins.
• the antibodies may exist in a variety of forms including, for example, polyclonal antibodies, monoclonal antibodies, Fv, Fab and F(ab)2, as well as single chain antibodies and humanized antibodies.
• antibody fragment refers to a portion of an intact antibody and refers to the antigenic determining variable regions of an intact antibody.
• antibody fragments include, but are not limited to, Fab, Fab’, F(ab’)2, and Fv fragments, linear antibodies, scFv antibodies, and multispecific antibodies formed from antibody fragments.
• antigen as used herein is defined as a molecule that provokes an immune response. This immune response may involve either antibody production, or the activation of specific immunologically-competent cells, or both.
• any macromolecule including virtually all proteins or peptides, can serve as an antigen.
• antigens can be derived from recombinant or genomic DNA. A skilled artisan will understand that any DNA, which comprises a nucleotide sequences or a partial nucleotide sequence encoding a protein that elicits an immune response therefore encodes an “antigen” as that term is used herein.
• an antigen need not be encoded solely by a full length nucleotide sequence of a gene. It is readily apparent that the embodiments include, but are not limited to, the use of partial nucleotide sequences of more than one gene and that these nucleotide sequences are arranged in various combinations to elicit the desired immune response. Moreover, a skilled artisan will understand that an antigen need not be encoded by a “gene” at all. It is readily apparent that an antigen can be generated synthesized or can be derived from a biological sample. Such a biological sample can include, but is not limited to a tissue sample, a tissue sample suspected of containing a virus, a cell or a biological fluid.
• antigen as used herein is defined as a molecule that provokes an immune response. This immune response may involve either antibody production, or the activation of specific immunologically-competent cells, or both.
• ex vivo refers to “outside” the body.
• a “disease” is a state of health of a subject wherein the subject cannot maintain homeostasis, and wherein if the disease is not ameliorated then the animal’s health continues to deteriorate.
• a “disorder” in a subject is a state of health in which the subject is able to maintain homeostasis, but in which the subject’s state of health is less favorable than it would be in the absence of the disorder. Left untreated, a disorder does not necessarily cause a further decrease in the subject’s state of health.
• an “effective amount” as used herein means an amount which provides a therapeutic or prophylactic benefit.
• Encoding refers to the inherent property of specific sequences of nucleotides in a polynucleotide, such as a gene, a cDNA, or an mRNA, to serve as templates for synthesis of other polymers and macromolecules in biological processes having either a defined sequence of nucleotides (i.e., rRNA, tRNA and mRNA) or a defined sequence of amino acids and the biological properties resulting therefrom.
• a gene encodes a protein if transcription and translation of mRNA corresponding to that gene produces the protein in a cell or other biological system.
• Both the coding strand the nucleotide sequence of which is identical to the mRNA sequence and is usually provided in sequence listings, and the non-coding strand, used as the template for transcription of a gene or cDNA, can be referred to as encoding the protein or other product of that gene or cDNA.
• endogenous refers to any material from or produced inside an organism, cell, tissue or system.
• exogenous refers to any material introduced from or produced outside an organism, cell, tissue or system.
• “Homologous” refers to the sequence similarity or sequence identity between two polypeptides or between two nucleic acid molecules. When a position in both of the two compared sequences is occupied by the same base or amino acid monomer subunit, e.g., if a position in each of two DNA molecules is occupied by adenine, then the molecules are homologous at that position.
• the percent of homology between two sequences is a function of the number of matching or homologous positions shared by the two sequences divided by the number of positions compared X 100. For example, if 6 of 10 of the positions in two sequences are matched or homologous then the two sequences are 60% homologous.
• the DNA sequences ATTGCC and TATGGC share 50% homology. Generally, a comparison is made when two sequences are aligned to give maximum homology.
• protein is at least, or about, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99% homologous to the sequences provided herein.
• a “conservative amino acid substitution” is one in which the amino acid residue is replaced with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art.
• immunoglobulin or “Ig,” as used herein is defined as a class of proteins, which function as antibodies. Antibodies expressed by B cells are sometimes referred to as the BCR (B cell receptor) or antigen receptor. The five members included in this class of proteins are IgA, IgG, IgM, IgD, and IgE.
• isolated means altered or removed from the natural state.
• a nucleic acid or a peptide naturally present in a living animal is not “isolated,” but the same nucleic acid or peptide partially or completely separated from the coexisting materials of its natural state is “isolated.”
• An isolated nucleic acid or protein can exist in substantially purified form, or can exist in a non-native environment such as, for example, a host cell.
• An “isolated” biological component (such as a nucleic acid, protein or cell) has been substantially separated or purified away from other biological components (such as cell debris, other proteins, nucleic acids or cell types).
• Biological components that have been “isolated” include those components purified by standard purification methods.
• A refers to adenosine
• C refers to cytosine
• G refers to guanosine
• T refers to thymidine
• U refers to uridine.
• leukocytes or “white blood cell” as used herein refers to any immune cell, including monocytes, neutrophils, eosinophils, basophils, and lymphocytes.
• lymphocytes refer to cells commonly found in lymph, and include natural killer cells (NK cells), T-cells, and B-cells. It will be appreciated by one of skill in the art that the above listed immune cell types can be divided into further subsets.
• tumor infiltrating leukocytes refers to leukocytes that are present in a solid tumor.
• blood sample refers to any sample prepared from blood, such as plasma, blood cells isolated from blood, and so forth.
• purified sample refers to any sample in which one or more cell subsets are enriched.
• a sample may be purified by the removal or isolation of cells based on characteristics such as size, protein expression, and so forth.
• compositions and formulations suitable for pharmaceutical delivery of one or more therapeutic compositions, and additional pharmaceutical agents are conventional. Remington’s Pharmaceutical Sciences, by E. W. Martin, Mack Publishing Co., Easton, Pa., 15th Edition (1975), describes compositions and formulations suitable for pharmaceutical delivery of one or more therapeutic compositions, and additional pharmaceutical agents. [0143] In general, the nature of a suitable carrier or vehicle for delivery will depend on the particular mode of administration being employed. For instance, parenteral formulations usually comprise injectable fluids that include pharmaceutically and physiologically acceptable fluids such as water, physiological saline, balanced salt solutions, aqueous dextrose, glycerol or the like as a vehicle.
• injectable fluids that include pharmaceutically and physiologically acceptable fluids such as water, physiological saline, balanced salt solutions, aqueous dextrose, glycerol or the like as a vehicle.
• compositions and methods described herein can treat include microbial infections such as a viral infection.
• viral infection an infection caused by the presence of a virus in the body.
• Viral infections include chronic or persistent viral infections, which are viral infections that are able to infect a host and reproduce within the cells of a host over a prolonged period of time-usually weeks, months or years, before proving fatal.
• the recombinant nucleic acid constructs and replication incompetent virus-like particles, or compositions comprising such constructs/particles can be administered simultaneously with anti- microbial, anti-viral and/or other therapeutic agents.
• constructs/particles or composition comprising such constructs/particles can be administered at selected times in advance of times when anti- microbial, anti-viral and other therapeutic agents are administered.
• Antivirals include, but are not limited to, ritonavir, acyclovir, cidofovir, ganciclovir, foscarnet, zidovudine, ribavirin, and hydroxychloroquine.
• Antivirals further include, and are not limited to HIV treatments such as:
• small molecule HIV fusion or entry inhibitors include: bevirimat (DSB;PA- 457); Vicriviroc, Maraviroc (a chemokine receptor antagonist" or a "CCR5 inhibitor”), T-20 (enfuvirtide, Fuzeon, developed by Roche and Trimeris), TRI-1144, and TRI-999 (See, Qian, K et al, Med Res Rev. 2009 Mar; 29(2):369-393, and Haggani and Tilton, Antiviral Res. 2013 May; 98(2): 158-70).
• anti-HIV mAbs include those against CCR5 and a CD4, and specifically: Ibalizumab (trade name Trogarzo) is a non-immunosuppressive humanized monoclonal antibody that binds CD4; PRO 140 is a humanized monoclonal antibody targeted against the CCR5.
• Ibalizumab trade name Trogarzo
• PRO 140 is a humanized monoclonal antibody targeted against the CCR5.
• Antiviral agents for combination treatment can include any one or combination of: an HBV polymerase inhibitor, interferon, TLR modulators such as TLR-7 agonists or TLR-9 agonists, therapeutic vaccines, immune activator of certain cellular viral RNA sensors, viral entry inhibitor, viral maturation inhibitor, distinct capsid assembly modulator, antiviral compounds of distinct or unknown mechanism.
• TLR modulators such as TLR-7 agonists or TLR-9 agonists
• therapeutic vaccines immune activator of certain cellular viral RNA sensors
• viral entry inhibitor viral maturation inhibitor
• distinct capsid assembly modulator distinct or unknown mechanism.
• Antiviral agents can also be any one or combination of: 3TC, FTC, L-FMAU, interferon, adefovir dipivoxil, entecavir, telbivudine (L-dT), valtorcitabine (3’-valinyl L-dC), .beta.
• DXG -D-dioxolany 1-guanine
• DAPD .beta.-D-dioxolanyl-2,6-diaminopurine
• ACP .beta.-D- dioxolanyl-6-chloropurine
• famciclovir penciclovir, lobucavir, ganciclovir, ribavirin, tenofovir, bictegravir, emtricitabine, Biktarvy, and any combination thereof.
• a “therapeutically effective amount” is an amount of recombinant nucleic acid constructs and replication incompetent virus-like particles, or composition comprising such constructs/particles, as described herein that results in a reduction in viral titer by at least 2.5%, at least 5%, at least 10%, at least 15%, at least 25%, at least 35%, at least 45%, at least 50%, at least 75%, at least 85%, by at least 90%, at least 95%, or at least
• a recombinant nucleic acid construct is incorporated into a viral like particle (defective in its ability to self-replicate) to mediate gene transfer to a cell.
• the virus simply will be exposed to the appropriate host cell under physiologic conditions, permitting uptake of the virus.
• the present methods can be adapted to utilize a variety of viral vectors or viral-like particles to deliver the recombinant constructs to a desired cellular target, as discussed below, and includes adenoviral vector systems, which are optimized to be incompetent, or non-replicating VLPs.
• Adenovirus is particularly suitable for use as a gene transfer vector because of its mid-sized DNA genome, ease of manipulation, high titer, wide target-cell range, and high infectivity.
• the roughly 36 kb viral genome is bounded by 100-200 base pair (bp) inverted terminal repeats (ITR), in which are contained cis-acting elements necessary for viral DNA replication and packaging.
• ITR inverted terminal repeats
• the early (E) and late (L) regions of the genome that contain different transcription units are divided by the onset of viral DNA replication.
• the El region encodes proteins responsible for the regulation of transcription of the viral genome and a few cellular genes.
• the expression of the E2 region (E2A and E2B) results in the synthesis of the proteins for viral DNA replication. These proteins are involved in DNA replication, late gene expression, and host cell shut off (Renan, M. J. (1990) Radiother Oncol., 19, 197-218).
• the products of the late genes (LI, L2, L3, L4 and L5), including the majority of the viral capsid proteins, are expressed only after significant processing of a single primary transcript issued by the major late promoter (MLP).
• MLP located at 16.8 map units
• TL tripartite leader
• ITR inverted terminal repeats
• the packaging signal for viral encapsulation is localized between 194-385 bp (0.5-1.1 map units) at the left end of the viral genome (Hearing et ak, J. (1987) Virol., 67, 2555-2558).
• This signal mimics the protein recognition site in bacteriophage lambda DNA where a specific sequence close to the left end, but outside the cohesive end sequence, mediates the binding to proteins that are required for insertion of the DNA into the head structure.
• El substitution vectors of Ad have demonstrated that a 450 bp (0-1.25 map units) fragment at the left end of the viral genome could direct packaging in 293 cells (Levrero et ak, Gene, 101:195-202, 1991).
• LTR long terminal repeat
• Retroviral vectors are able to infect a broad variety of cell types. However, integration and stable expression of many types of retroviruses require the division of host cells (Paskind et al., (1975) Virology, 67, 242-248). An approach designed to allow specific targeting of retrovirus vectors recently was developed based on the chemical modification of a retrovirus by the chemical addition of galactose residues to the viral envelope. This modification could permit the specific infection of cells such as hepatocytes via asialoglycoprotein receptors, may this be desired.
• the terminal repeats of the AAV vector can be obtained by restriction endonuclease digestion of AAV or a plasmid such as p201, which contains a modified AAV genome (Samulski et al., J. Virol., 61:3096-3101 (1987)), or by other methods, including but not limited to chemical or enzymatic synthesis of the terminal repeats based upon the published sequence of AAV. It can be determined, for example, by deletion analysis, the minimum sequence or part of the AAV ITRs which is required to allow function, i.e., stable and site- specific integration. It can also be determined which minor modifications of the sequence can be tolerated while maintaining the ability of the terminal repeats to direct stable, site-specific integration.
• AAV-mediated efficient gene transfer and expression in the lung has led to clinical trials for the treatment of cystic fibrosis (Carter and Flotte, 1995; Flotte et al., Proc. Nat’l Acad. Sci. USA, 90, 10613-10617, (1993)).
• AAV adeno-associated viral
• Both AAV8 and AAV9 have higher affinities for hepatocytes when compared to AAV2.
• AAV8 can transduce 3-4 fold more hepatocytes and deliver 3-4 fold more genomes per transduced cell when compared to AAV2 ⁇ See, Mark S. Sands, Methods Mol. Biol. 2011; 807: 141-157).
• AAV8 can transduce up to 90-95% of hepatocytes in the mouse liver following intraportal vein injection.
• comparable levels of transduction can be achieved following intravenous injection.
• Direct intraparenchymal injection of an AAV vector also mediates relatively high level long term expression. Additional specificity can be conferred by using liver- specific promoters in conjunction with AAV8 capsid proteins.
• immune reactions to transgene products can be minimized by circumventing the fixed tissue macrophages of the liver, Kupffer cells, and limiting expression to hepatocytes.
• the ability to target hepatocytes by virtue of the AAV serotype and the use of liver- specific promoters allows testing novel therapeutic approaches.
• the recombinant nucleic acid or replication incompetent VLPs are transduced into the target cells, by electroporation, or by transfection of nucleic acids, proteins, site-specific nucleases, self-replicating RNA viruses or integration- deficient lentiviral vectors (for such vectors see, U.S. Patent No. 10,131,876).
• delivery of the recombinant nucleic acid or replication incompetent VLPs may be performed by transducing said cells with lentiviral vectors (See, Cockrell Adam S el al., “Gene delivery by lentivirus vectors”, Molecular Biotechnology, vol. 36, No. 3, Jul. 2007.)
• Lentiviral vectors with the VSVG pseudotype enable efficient transduction under automated manufacturing method.
• the present methods are entirely suitable for the use of any type of lentiviral vector (with e.g.
• ML-LV measles virus
• GALV gibbon ape leukaemia virus
• RD114 feline endogenous retrovirus
• BaEV baboon endogenous retrovirus
• Other viral vectors such as gamma or alpha retroviral vectors can be used.
• Transduction enhancer reagents can be added when necessary using the automated manufacturing described in this invention.
• viral vectors can be employed as expression constructs in the present methods and compositions.
• Vectors derived from viruses such as vaccinia virus (Ridgeway, (1988) In: Vectors: A survey of molecular cloning vectors and their uses, pp. 467-492; Baichwal and Sugden, (1986) In, Gene Transfer, pp. 117-148; Coupar et al., Gene, 68:1-10, 1988) canary poxvirus, and herpes viruses are employed. These viruses offer several features for use in gene transfer into various mammalian cells.
• the present methods also encompass methods of treatment or prevention of a viral disease or condition where administration of recombinant nucleic acids, VLP products, or pharmaceutical compositions can be delivered in various effective amounts.
• contacted and “exposed,” when applied to a cell, tissue or organism, are used herein to describe the process by which the pharmaceutical composition and/or another agent, such as for example an anti- viral agent, are delivered to a target cell, tissue or organism or are placed in direct juxtaposition with the target cell, tissue or organism.
• another agent such as for example an anti- viral agent
• recombinant nucleic acids, VLP products or pharmaceutical compositions thereof , and/or additional agent(s) are delivered to one or more cells in a combined amount effective to kill the virally infected cell(s) or prevent them from dividing.
• compositions may be formulated for aerosolized delivery to a subject.
• the compositions described may be formulated in aqueous solutions such as water or in physiologically compatible buffers such as Hanks’s solution, Ringer’s solution, or physiological saline buffer.
• the solution may contain one or more formulatory agents such as suspending, stabilizing or dispersing agents.
• Delivery systems of the disclosure that deliver the polynucleotides of the disclosure to a desired cell of a subject are not limited to the VLPs of the disclosure.
• the delivery vector comprises an adeno-associated virus (AAV) vector, a liposome, a nanoparticle, a micelle, a polymeric vesicle or a polymersome.
• AAV adeno-associated virus
• the compounds can be used for combination are selected from the group consisting of a HBV polymerase inhibitor, interferon, TLR modulators such as TLR-7 agonists or TLR-9 agonists, therapeutic vaccines, immune activator of certain cellular viral RNA sensors, viral entry inhibitor, viral maturation inhibitor, distinct capsid assembly modulator, antiviral compounds of distinct or unknown mechanism, and combination thereof.
• TLR modulators such as TLR-7 agonists or TLR-9 agonists
• therapeutic vaccines immune activator of certain cellular viral RNA sensors
• viral entry inhibitor viral maturation inhibitor
• distinct capsid assembly modulator distinct capsid assembly modulator
• antiviral compounds of distinct or unknown mechanism and combination thereof.
• the pharmacokinetics, biodistribution, or other parameter of the drug can be altered by such combination or alternation therapy.
• combination therapy is typically preferred over alternation therapy because it induces multiple simultaneous stresses on the virus.
• kits can be provided.
• any of the recombinant nucleic acids, or VLP products can be provided frozen and packaged as a kit, alone or along with separate containers of any of the other agents from the pre-conditioning or post-conditioning steps, and optional instructions for use.
• any of the methods or treatment regimens would be repeated periodically to boost the immune system response to the viral agent/s.
• Such periodic treatment can vary from once every week, month, to once every two months, to once every 3 months, to once every 4 months, to once every 5 months, to once every 6 months, or once every 7 months, or once every 8 months, or once every 9 months, or once every 10 months, or every 11 months, or once annually as a maintenance treatment for as long as the patient requires.
• Hep G2 cells are epithelial in morphology, have a modal chromosome number of 55, and are not tumorigenic in nude mice.
• the cells secrete a variety of major plasma proteins, e.g., albumin, and the acute-phase proteins fibrinogen, alpha 2-macroglobulin, alpha 1- antitrypsin, transferrin and plasminogen. They have been grown successfully in large-scale cultivation systems. Hepatitis B virus surface antigens have not been detected on these cells. Hep G2 will respond to stimulation with human growth hormone. Thus, Hep G2 cells are a suitable in vitro model system for the study of polarized human hepatocytes.
• the AAV8-HB V-DRS 1 (EFla > HBV-rcCasp9) construct was further tested in HepG2 cells and HepAD38 cells and in certain test groups the Caspase-9 inhibitor Z-LEHD-FMK was used to illustrate that the killing was the result of Casp9 expression (See Group 3 and Group 5).
• the results from these experiments illustrate the viral specific cell death in the Group 2 HepAD38 cells, which exhibited an almost 80% rate of cell death.
• FIGURE 5A is a vector map and FIGURE 5B is a combined graph showing the effects of the test constructs and various controls in the HepG2 cells and HepAD38 cells to highlight the drastic cell death in the HepAD38 cells infected with the AAV8-HBV-DRS1 (EFla > HBV- rcCasp9) construct.
• the Group 1 cells were untransduced, the Group 2 cells were the test cells transduced with AAV8-HBV-DRS2 (TBG > HBV-rcCasp9); the Group 3 cells were the same with the addition of the Casp9 inhibitor z-LEHD.fmk; the Group 4 cells were contacted with only the Casp9 inhibitor z-LEHD.fmk as a control; the Group 5 cells were transduced with a construct containing GFP to further track the construct expression; the Group 6 cells were transduced with the same GFP construct and also incubated with the Casp9 inhibitor z- LEHD.fmk.
• FIGURE 11C A novel AAV vector to hijack HBV pol specifically induced overexpression of Casp-9 and apoptosis in HBV-expressing cells in vitro and in vivo.
• FIGURE 11C A schematic showing an overview of this process is shown in FIGURE 11C.
• the lack of decrease in peripheral HBeAg was expected because regenerating liver tissue in transgenic mice constitutively express the antigen.
• SEP ID NO:l HBV RNA Polymerase Epsilon Signal
• SEP ID NP:3 Casuase 9 (Casp9) Human PRF
• SEQ ID NO:5 Reverse complement of EFS promoter
• SEQ ID NO:6 SV40 polyA
• SEQ ID NO:7 Reverse complement of SV40 polyA
• SEQ ID NO:8 Construct (transcript): (1746 bp)
• Adeno-associated virus was packaged with a novel vector expressing ncRNA, (which can be thought of as influenza “hijack RNA”, or an RNA suicide vector for influenza infected cells), that transcribes the reverse complementary strand of zsGreen marker (AAV.infv.rcZsGreen) or caspase-9 (casp9) gene (AAV.infv.rcCasp9) between influenza genomic RNA non-coding sequence (NCS) regions that are highly conserved across several influenza virus strains. Embodiments of these sequences are shown below as SEQ ID NOs 10- 24.
• Madin-Darby Canine Kidney (MDCK) cells were infected with influenza A H1N1 or H3N2, or influenza B virus at 0.1 MOI, as an in vitro system to test these influenza (nc)RNA constructs.
• Influenza infected and uninfected MDCK cells were transduced with AAV.infv.rcZsGreen vector, and with AAV.infv.rcCasp9 in the presence and absence of casp9 inhibitor Z-LEHD-FMK to determine the functionality of the hijack vector, or RNA suicide vector for influenza infected cells.
• Flow cytometry was used to determine zsGreen expression. Cell viability and proliferation were evaluated daily by FACS, Annexin assay, and automated cell count.
• SEQ ID NO: 13 5’ non-coding region of the vector: AGTAGAAACAAGG
• SEQ ID NO: 14 Non-specific buffer sequence GTG
• RNA delivered or expressed in trans to engage with SARS-CoV-2 RdRp hijacked the virus machinery and induced rapid death in infected cells but not in uninfected cells.
• Hijack RNA’s translation into the kill molecule DT-A was dependent on viral RdRp as demonstrated in several different cell lines, confirming specificity and sensitivity of the treatment. This novel approach could be used to develop an effective treatment to eradicate COVID-19 infection.

Landscapes

• Health & Medical Sciences (AREA)
• Chemical & Material Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Organic Chemistry (AREA)
• Genetics & Genomics (AREA)
• Zoology (AREA)
• General Health & Medical Sciences (AREA)
• Engineering & Computer Science (AREA)
• Biochemistry (AREA)
• Molecular Biology (AREA)
• Medicinal Chemistry (AREA)
• Bioinformatics & Cheminformatics (AREA)
• Wood Science & Technology (AREA)
• Biophysics (AREA)
• General Engineering & Computer Science (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• Biomedical Technology (AREA)
• Gastroenterology & Hepatology (AREA)
• Toxicology (AREA)
• Biotechnology (AREA)
• Virology (AREA)
• Microbiology (AREA)
• Plant Pathology (AREA)
• Physics & Mathematics (AREA)
• Pharmacology & Pharmacy (AREA)
• Public Health (AREA)
• Veterinary Medicine (AREA)
• Communicable Diseases (AREA)
• Animal Behavior & Ethology (AREA)
• Oncology (AREA)
• Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
• General Chemical & Material Sciences (AREA)
• Chemical Kinetics & Catalysis (AREA)
• Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
• Medicines Containing Material From Animals Or Micro-Organisms (AREA)
• Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
• Micro-Organisms Or Cultivation Processes Thereof (AREA)

Priority Applications (10)

Applications Claiming Priority (8)

Publications (1)

Family

ID=74686046

Family Applications (1)

Country Status (11)

Cited By (2)

Citations (2)

Family Cites Families (1)

• 2020
  • 2020-08-28 EP EP20858496.1A patent/EP4022072A4/de active Pending
  • 2020-08-28 WO PCT/US2020/048370 patent/WO2021041787A1/en active Application Filing
  • 2020-08-28 AU AU2020335886A patent/AU2020335886A1/en active Pending
  • 2020-08-28 CN CN202080069618.7A patent/CN114761566A/zh active Pending
  • 2020-08-28 JP JP2022513124A patent/JP2022546402A/ja active Pending
  • 2020-08-28 BR BR112022003814A patent/BR112022003814A2/pt unknown
  • 2020-08-28 MX MX2022002211A patent/MX2022002211A/es unknown
  • 2020-08-28 KR KR1020227010035A patent/KR20220095183A/ko unknown
  • 2020-08-28 CA CA3149041A patent/CA3149041A1/en active Pending
• 2022
  • 2022-02-23 IL IL290826A patent/IL290826A/en unknown
  • 2022-02-24 ZA ZA2022/02370A patent/ZA202202370B/en unknown

Patent Citations (2)

Non-Patent Citations (1)

Also Published As

Similar Documents

Legal Events