WO2021015419A1 - 인산화된 베타-카테닌에 특이적으로 결합하는 항체 및 이의 용도 - Google Patents

인산화된 베타-카테닌에 특이적으로 결합하는 항체 및 이의 용도 Download PDF

Info

Publication number
WO2021015419A1
WO2021015419A1 PCT/KR2020/007855 KR2020007855W WO2021015419A1 WO 2021015419 A1 WO2021015419 A1 WO 2021015419A1 KR 2020007855 W KR2020007855 W KR 2020007855W WO 2021015419 A1 WO2021015419 A1 WO 2021015419A1
Authority
WO
WIPO (PCT)
Prior art keywords
catenin
beta
serine
antibody
cells
Prior art date
Application number
PCT/KR2020/007855
Other languages
English (en)
French (fr)
Inventor
이경호
김보연
김선옥
황준성
성낙균
차현주
Original Assignee
한국생명공학연구원
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 한국생명공학연구원 filed Critical 한국생명공학연구원
Publication of WO2021015419A1 publication Critical patent/WO2021015419A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2565/00—Nucleic acid analysis characterised by mode or means of detection
    • C12Q2565/60—Detection means characterised by use of a special device
    • C12Q2565/626—Detection means characterised by use of a special device being a flow cytometer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2565/00—Nucleic acid analysis characterised by mode or means of detection
    • C12Q2565/60—Detection means characterised by use of a special device
    • C12Q2565/627—Detection means characterised by use of a special device being a mass spectrometer
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2440/00—Post-translational modifications [PTMs] in chemical analysis of biological material
    • G01N2440/14—Post-translational modifications [PTMs] in chemical analysis of biological material phosphorylation

Definitions

  • the present invention relates to an antibody that specifically binds to phosphorylated beta-catenin and to its use, and more particularly, to an antibody that specifically binds to phosphorylated beta-catenin by serine 47 (Ser47) And its use.
  • the primary cilium is a non-motile, microtubule-based cellular antenna-like structure that exists in most mammalian epithelial and stromal cells. Unlike motile cilia, non-motile primary cilia perform dynamic assembly and division during cell cycle progression. Primary cilia assemble at the center of the mother centrioles during the quiescent phase of the cell cycle (G0 phase) and rapidly disintegrate before entering mitosis. However, it is still not well known how the formation of primary cilia is regulated by cellular signaling pathways. Conversely, the important role of primary cilia in the cellular signaling pathway has been confirmed through many studies. In particular, primary cilia are essential for transduction of the Hedgehog (Hh) signaling pathway required for tissue production. In this process, Hh signaling is detected by the primary cilia, and Hh signaling components are transmitted by motor proteins inside and outside the cilia. This lack of transport mechanisms leads to ciliopathy and cancer.
  • Hh Hedgehog
  • Wnt signaling is a major signaling pathway that controls the fate of various cells during development, such as cell migration, polarity, and differentiation, and regulates homeostasis in adult tissues.
  • abnormal regulation of Wnt signaling leads to developmental disorders and a variety of human diseases including cancer.
  • the canonical pathway is known to regulate the expression of various genes through stabilization of beta-catenin, and the noncanonical pathway is known to regulate many cellular processes such as cell polarity and fate determination.
  • Beta-catenin is the mammalian homologue of armadillo in Drosophila and plays a variety of roles in embryonic development, tissue homeostasis, and cell regeneration. Historically, beta-catenin has been discovered twice because of its two distinct functions, including functions as a major component of the Wnt signaling pathway and as an E-cadherin-related cell adhesion molecule. Beta-catenin is a key molecule in the standard Wnt signaling pathway, and various phosphorylation sites are produced by various kinases. To date, more than 20 beta-catenin phosphorylation sites have been identified, but no association with primary cilia development has yet been confirmed.
  • Wnt3a a standard Wnt ligand, induces primary cilia development, and phosphorylation at a specific site of beta-catenin in the process.
  • the present invention has been completed by finding that is increased.
  • an object of the present invention to provide an antibody or antigen-binding fragment thereof that specifically binds to phosphorylated beta-catenin of serine 47 (Ser47).
  • Another object of the present invention is to provide a polynucleotide encoding the antibody or antigen-binding fragment thereof.
  • Another object of the present invention is to provide a recombinant expression vector containing the polynucleotide.
  • Another object of the present invention is to provide a host cell transformed with a recombinant expression vector.
  • Another object of the present invention is a substance that inhibits the expression or activity of Wnt3a; Or it is to provide a pharmaceutical composition for inhibiting anticancer drug resistance, including a substance that inhibits phosphorylation of serine 47 (Ser47) of beta-catenin as an active ingredient.
  • substances that inhibit the expression or activity of Wnt3a are to provide a pharmaceutical composition for inhibiting anticancer drug resistance made of a substance that inhibits phosphorylation of serine 47 (Ser47) of beta-catenin.
  • substances that inhibit the expression or activity of Wnt3a are to provide a pharmaceutical composition for inhibiting anticancer drug resistance consisting essentially of a substance that inhibits phosphorylation of serine 47 (Ser47) of beta-catenin.
  • Another object of the present invention is to provide a composition for diagnosing anticancer drug resistance, including an agent for measuring the phosphorylation level of serine 47 (Ser47) of beta-catenin.
  • composition for diagnosing anticancer drug resistance comprising an agent that measures the phosphorylation level of serine 47 (Ser47) of beta-catenin.
  • compositions for diagnosing resistance to anticancer drugs consisting essentially of an agent for measuring the phosphorylation level of serine 47 (Ser47) of beta-catenin.
  • Another object of the present invention is to provide a kit for diagnosing anticancer drug resistance, including an agent for measuring the phosphorylation level of serine 47 (Ser47) of beta-catenin.
  • Another object of the present invention is (a) measuring the phosphorylation level of serine 47 (Ser47) of beta-catenin in a biological sample provided from a cancer patient; (b) It is to provide a method of providing information for diagnosis of resistance to anticancer drugs, comprising diagnosing resistance to anticancer drugs when the level of phosphorylation of serine 47 of beta-catenin is higher than that of a normal control group.
  • Another object of the present invention is (a) contacting the test substance with cells or tissues expressing beta-catenin; (b) measuring the phosphorylation level of serine 47 (Ser47) of beta-catenin in cells or tissues contacted with the test substance; And (c) measuring the phosphorylation level of serine 47 of beta-catenin in cells or tissues not contacted with the test substance, thereby reducing the phosphorylation level of serine 47 of beta-catenin measured in step (b). It is to provide a method for screening an anticancer drug resistance inhibitor comprising the step of selecting the tested substance.
  • Another object of the present invention is a substance that inhibits the expression or activity of Wnt3a for preparing a pharmaceutical preparation for inhibiting anticancer drug resistance; Or it is to provide a use of a substance that inhibits the phosphorylation of serine 47 (Ser47) of beta-catenin.
  • Another object of the present invention is a substance that inhibits the expression or activity of Wnt3a; Or it provides a method for inhibiting anticancer drug resistance comprising administering an effective amount of a composition containing as an active ingredient a substance that inhibits phosphorylation of serine 47 (Ser47) of beta-catenin to a subject in need thereof. will be.
  • Another object of the present invention is to provide a use of an agent for measuring the phosphorylation level of serine 47 (Ser47) of beta-catenin for preparing an anticancer drug resistance diagnostic agent.
  • Another object of the present invention is (a) measuring the phosphorylation level of serine 47 (Ser47) of beta-catenin in a biological sample provided from a cancer patient; (b) to provide a method for diagnosing anticancer drug resistance, comprising diagnosing anticancer drug resistance when the phosphorylation level of serine 47 of the beta-catenin is higher than that of a normal control group.
  • the present invention provides an antibody or antigen-binding fragment thereof that specifically binds to phosphorylated beta-catenin of serine #47 (Ser47).
  • the present invention provides a polynucleotide encoding the antibody or antigen-binding fragment thereof.
  • the present invention provides a recombinant expression vector comprising the polynucleotide.
  • the present invention provides a host cell transformed with the recombinant expression vector.
  • the present invention is a substance that inhibits the expression or activity of Wnt3a; Or it provides a pharmaceutical composition for inhibiting anticancer drug resistance, comprising a substance that inhibits phosphorylation of serine 47 (Ser47) of beta-catenin as an active ingredient.
  • substances that inhibit the expression or activity of Wnt3a Or it provides a pharmaceutical composition for inhibiting anticancer drug resistance made of a substance that inhibits phosphorylation of serine 47 (Ser47) of beta-catenin.
  • substances that inhibit the expression or activity of Wnt3a or it provides a pharmaceutical composition for inhibiting anticancer drug resistance consisting essentially of a substance that inhibits phosphorylation of serine 47 (Ser47) of beta-catenin.
  • the present invention provides a composition for diagnosing anticancer drug resistance, including an agent for measuring the phosphorylation level of serine 47 (Ser47) of beta-catenin.
  • composition for diagnosing anticancer drug resistance comprising an agent that measures the phosphorylation level of serine 47 (Ser47) of beta-catenin.
  • composition for diagnosing anticancer drug resistance consisting essentially of an agent for measuring the phosphorylation level of serine 47 (Ser47) of beta-catenin.
  • the present invention provides a kit for diagnosing anticancer drug resistance, including an agent for measuring the phosphorylation level of serine 47 (Ser47) of beta-catenin.
  • the present invention includes the steps of: (a) measuring the phosphorylation level of serine 47 (Ser47) of beta-catenin in a biological sample provided from a cancer patient; (b) Provides a method of providing information for diagnosis of anticancer resistance, comprising diagnosing anticancer resistance when the phosphorylation level of serine 47 of the beta-catenin is higher than that of a normal control group.
  • the present invention includes the steps of: (a) contacting a test substance with cells or tissues expressing beta-catenin; (b) measuring the phosphorylation level of serine 47 (Ser47) of beta-catenin in cells or tissues contacted with the test substance; And (c) measuring the phosphorylation level of serine 47 of beta-catenin in cells or tissues not contacted with the test substance, thereby reducing the phosphorylation level of serine 47 of beta-catenin measured in step (b). It provides a method for screening an anticancer drug resistance inhibitor comprising the step of selecting the tested substance.
  • the present invention is a substance that inhibits the expression or activity of Wnt3a for preparing a pharmaceutical preparation for inhibiting anticancer drug resistance; Or it is to provide a use of a substance that inhibits the phosphorylation of serine 47 (Ser47) of beta-catenin.
  • the present invention is a substance that inhibits the expression or activity of Wnt3a; Or it provides a method for inhibiting anticancer drug resistance comprising administering an effective amount of a composition containing as an active ingredient a substance that inhibits phosphorylation of serine 47 (Ser47) of beta-catenin to a subject in need thereof.
  • a composition containing as an active ingredient a substance that inhibits phosphorylation of serine 47 (Ser47) of beta-catenin to a subject in need thereof.
  • the present invention provides a use of an agent for measuring the phosphorylation level of serine 47 (Ser47) of beta-catenin for preparing an anticancer drug resistance diagnostic agent.
  • the present invention includes the steps of: (a) measuring the phosphorylation level of serine 47 (Ser47) of beta-catenin in a biological sample provided from a cancer patient; (b) to provide a method for diagnosing anticancer drug resistance, comprising diagnosing anticancer drug resistance when the phosphorylation level of serine 47 of the beta-catenin is higher than that of a normal control group.
  • the present invention provides an antibody or antigen-binding fragment thereof that specifically binds to phosphorylated beta-catenin of serine 47 (Ser47).
  • beta-catenin refers to a protein having a size of about 94 kDa that binds to the cytoplasmic region of cadherin, an important adhesion molecule between cells, and binds to cadherin and ⁇ -catenin. Forms a complex.
  • the beta-catenin is responsible for a part of the wnt-mediated signaling pathway in addition to the ability to bind to cadherin, and the wnt-mediated signaling plays an important role in maintaining the homeostasis of the embryonic process and adult tissue, and the signal It is known that a variety of diseases, including cancer, occur when there is an abnormality in delivery.
  • the beta-catenin may be regarded as a component of the wnt-mediated signaling pathway consisting of wnt, GSK-3beta, APC, beta-catenin and beta-catenin:TCF, but is not particularly limited thereto.
  • the beta-catenin is also called CTNNB1, CTNNB, MRD19, armadillo, catenin beta 1, EVR7, NEDSDV, etc. In humans, it is encoded by the CTNNB1 gene on chromosome 3 (3p22).
  • Beta-catenin is found as a protein consisting of 781 amino acids (aa), which is known as the NCBI reference sequence NP_001091679, NP_001091680, NP_001159374, NP_031640, and the like, preferably consisting of the amino acid sequence of SEQ ID NO: 1.
  • VKMLGSPVDS VLFYAITTLH NLLLHQEGAK MAVRLAGGLQ KMVALLNKTN VKFLAITTDC
  • beta-catenin which is phosphorylated with serine #47 (Ser47)
  • Ser47 serine #47
  • the rate of formation, the length of the cilia, and the thickness of the cilia are all significantly increased. Since ciliopathy, in which the primary cilia abnormally develops in cells, is closely related to the onset of various diseases and affects anticancer drug resistance of cancer, this pattern can detect phosphorylation of serine 47 of beta-catenin.
  • the antibody of the present invention can be very usefully used in various basic research related to primary cilia of cells, drug development, and disease diagnosis.
  • antibody is also called immunoglobulin (Ig), and is a generic term for proteins that selectively act on antigens and are involved in immunity in vivo.
  • Whole antibodies found in nature are generally composed of two pairs of light chain (LC) and heavy chain (HC), which are polypeptides consisting of multiple domains, or two pairs of these HC/LC.
  • the structure is composed of basic units.
  • There are 5 types of heavy chains that make up mammalian antibodies and there are 5 types, denoted by the Greek letters alpha, delta, epsilon, gamma, and mu, and different types of antibodies such as IgA, IgD, IgE, IgG, and IgM, respectively, depending on the type of heavy chain. Will constitute.
  • There are two types of light chains constituting mammalian antibodies represented by lambda and kappa.
  • the heavy and light chains of an antibody are structurally divided into variable regions and constant regions according to the variability of the amino acid sequence.
  • the constant region of the heavy chain is composed of 3 or 4 heavy chain constant regions such as CH1, CH2 and CH3 (IgA, IgD and IgG antibodies) and CH4 (IgE and IgM antibodies) depending on the type of antibody, and the light chain is one constant region. It is composed of phosphorus CL.
  • the variable regions of the heavy and light chains each consist of one domain of the heavy chain variable region (VH) or the light chain variable region (VL).
  • the light chain and the heavy chain are connected by one covalent disulfide bond by aligning each variable region and the constant region side by side, and the heavy chain of the two molecules bound to the light chain is connected through two covalent disulfide bonds.
  • the whole antibody specifically binds to the antigen through the variable regions of the heavy and light chains, and the whole antibody consists of two pairs of heavy and light chains (HC/LC), so the entire antibody of one molecule has two variable regions. Thus, it has a bivalent monospecificity that binds to the same two antigens.
  • the antibody variable region that binds to the antigen is called the antigen-binding site of the antibody, and the portion recognized by the antibody on the surface of the antigen is called the epitope.
  • variable region of an antibody containing an antigen-binding site is a framework region (FR) with low sequence variability and a complementary determining region, which is a hypervariable region with high sequence variability. , CDR).
  • FR framework region
  • CDR complementary determining region with high sequence variability.
  • three CDRs and four FRs are arranged in the order of FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4 in the direction from the N-terminus to the C-terminus, respectively.
  • the CDR with the highest sequence variability directly binds to the antigen, and is most important for antigen specificity of the antibody.
  • the antibody or antigen-binding fragment thereof according to the present invention is an antibody that specifically binds to phosphorylated beta-catenin, serine 47 (Ser47), comprising an amino acid sequence represented by SEQ ID NO: 2 It may be characterized by recognizing the polypeptide as an epitope.
  • the amino acid sequence represented by SEQ ID NO: 2 is composed of the 42nd to 51st amino acids in the beta-catenin full-length protein, and the specific sequence is TAPSLpSGKGN.
  • serine which is the 6th amino acid, is phosphorylated (pS).
  • the antibody or antigen-binding fragment thereof preferably comprises a heavy chain complementarity determining region (CDR) 1 comprising an amino acid sequence represented by SEQ ID NO: 3, an amino acid sequence represented by SEQ ID NO: 4
  • a heavy chain variable region comprising a heavy chain CDR2 and a heavy chain CDR3 comprising an amino acid sequence represented by SEQ ID NO: 5
  • a light chain variable region comprising a light chain CDR1 comprising an amino acid sequence represented by SEQ ID NO: 6, a light chain CDR2 comprising an amino acid sequence represented by SEQ ID NO: 7 and a light chain CDR3 comprising an amino acid sequence represented by SEQ ID NO: 8. It can be characterized by that.
  • the antibody or antigen-binding fragment thereof according to the present invention preferably comprises a heavy chain variable region comprising an amino acid sequence represented by SEQ ID NO: 9; And a light chain variable region comprising the amino acid sequence represented by SEQ ID NO: 10.
  • the antibody or antibody fragment according to the present invention is not limited in its type as long as it has the above-described CDR, VH and VL, or light and heavy chain configurations, and the antibody may be an IgG, IgA, IgM, IgE or IgD type antibody. have. Preferably, it may be an antibody in the form of an IgG.
  • the antigen-binding fragment of the antibody refers to a fragment of an antibody that maintains specific binding power to beta-catenin phosphorylated with Serine #47 (Ser47).
  • Serine #47 Serine #47
  • Fab fragment antigen-binding
  • F(ab)2 is a fragment produced by hydrolyzing an antibody with pepsin. Two Fabs are linked by a disulfide bond at a heavy chain hinge.
  • F(ab') is a monomeric antibody fragment in which a heavy chain hinge is added to a Fab separated by reducing the disulfide bond of the F(ab')2 fragment.
  • Fv (variable fragment) is an antibody fragment consisting only of the variable regions of the heavy and light chains.
  • a single chain variable fragment (scFv) is a recombinant antibody fragment in which VH and VL are connected by a flexible peptide linker.
  • a diabody refers to a fragment in which the VH and VL of an scFv are connected by a very short linker, so that they cannot be bonded to each other, and form a dimer by binding to the VL and VH of another scFv of the same type, respectively.
  • the antibody according to the present invention may be a monoclonal antibody derived from a single B cell, or a polyclonal antibody derived from a plurality of B cells, and the amino acid sequences of the heavy and light chains of the antibody are It is preferably a monoclonal antibody that is a population of substantially identical antibodies.
  • the antibody or antibody fragment according to the present invention may be derived from any animal including mammals, birds, etc., including humans, and may be chimera antibodies or fragments of antibodies that have antibody sequences of different species together. I can.
  • the antibody or fragment thereof of the present invention may be conjugated to an enzyme, a fluorescent substance, a radioactive substance, or a protein, but is not limited thereto.
  • the present invention also provides a polynucleotide encoding the antibody or antigen-binding fragment thereof.
  • the'polynucleotide' may be described as an oligonucleotide or nucleic acid, and DNA molecules (eg, cDNA or genomic DNA), RNA molecules (eg, mRNA), nucleotide analogues are used.
  • DNA molecules eg, cDNA or genomic DNA
  • RNA molecules eg, mRNA
  • nucleotide analogues are used.
  • the resulting analogs of the DNA or RNA eg, peptide nucleic acids and non-naturally occurring nucleotide analogs
  • the polynucleotide may be single-stranded or double-stranded.
  • the polynucleotide is a nucleotide sequence encoding an antibody consisting of heavy and light chains having a specific CDR configuration for the polypeptide containing the amino acid of SEQ ID NO: 2, or VH and VL Means.
  • the polynucleotide encoding the antibody or antigen-binding fragment thereof of the present invention can be obtained by a method well known in the art. For example, based on the DNA sequence or the corresponding amino acid sequence encoding part or all of the heavy and light chains of the antibody, an oligonucleotide synthesis technique well known in the art, for example, a polymerase chain reaction (PCR) method, etc. Can be used to synthesize.
  • PCR polymerase chain reaction
  • the present invention also provides a vector comprising the polynucleotide.
  • The'vector' of the present invention is used for the purpose of replication or expression of the polynucleotide of the present invention for recombinant production of the antibody or antigen-binding fragment thereof of the present invention.
  • a signal sequence, origin of replication, one or more markers It contains one or more of a gene, an enhancer element, a promoter and a transcription termination sequence.
  • the vector of the present invention may preferably be an expression vector, more preferably a vector comprising a polynucleotide of the present invention operably linked to a regulatory sequence, for example, a promoter.
  • Plasmid refers to a linear or circular double-helix DNA molecule to which external polynucleotide fragments can be bound.
  • a viral vector e.g., replication defective retroviruses, adenoviruses and adeno-associated viruses
  • additional DNA fragments are It can be introduced into the viral genome.
  • viral vectors e.g., replication defective retroviruses, adenoviruses and adeno-associated viruses
  • Certain vectors are self-replicating (bacterialvectors) in the host cell into which they are introduced (e.g. bacterial vectors, including bacterial origin and episomal mammalian vectors). autonomous replication).
  • Other vectors e.g., non-episomal mammalian vectors
  • the'vector' may be understood to have the same meaning as the'expression vector', which is a form of a vector capable of expressing the polynucleotide.
  • a polynucleotide sequence is “operably linked” to the regulatory sequence when the regulatory sequence affects the expression (eg, level, timing or location of expression) of the polynucleotide sequence.
  • the regulatory sequence is a sequence that affects the expression (eg, level, timing or location of expression) of the nucleic acid to which it is operably linked.
  • the regulatory sequence exerts its effect, for example, directly on the regulated nucleic acid or through the action of one or more other molecules (e.g., the regulatory sequence and/or polypeptides that bind to the nucleic acid). Can be done.
  • the regulatory sequences include promoters, enhancers and other expression control elements.
  • the vector of the present invention may preferably be pOptiVECTM-TOPO and pcDNATM3.3-TOPO.
  • the present invention also provides a cell transformed with the vector.
  • the cell of the present invention is not particularly limited as long as it is a cell that can be used to express a polynucleotide encoding an antibody or fragment thereof contained in the expression vector of the present invention.
  • Cells (host cells) transformed with the expression vector according to the present invention are prokaryotes (e.g., E. coli), eukaryotes (e.g., yeast or other fungi), plant cells (e.g., tobacco or tomato plants). Cells), animal cells (eg, human cells, monkey cells, hamster cells, rat cells, mouse cells), insect cells, or hybridomas derived therefrom. It may be cells derived from mammals, including humans.
  • Prokaryotes suitable for this purpose are Gram-negative or Gram-positive organisms, for example Enterobacteriaceae, for example Escherichia, for example E. E.coli, Enterobacter, Erwinia, Klebsiella, Proteus, Salmonella, for example Salmonella typhimurium, Serratia (Serratia), for example Serratia marcescans and Shigella, and Bacilli, for example B. Subtilis and B. Licheniformis, Pseudomonas, for example P. aeruginosa and Streptomyces.
  • the cells of the present invention are not particularly limited as long as they can express the vector of the present invention, but are preferably E. It could be coli.
  • Saccharomyces cerevisiae is most commonly used in eukaryotes.
  • many other genera, species and strains including but not limited to, such as Schizosaccharomyces pombe, Kluyveromyces host, for example K. Lactis, K. Fragilis (ATCC 12,424), K. Bulgaricus (ATCC 16,045), K. Wickeramii (ATCC 24,178), K. K. waltii (ATCC 56,500), K. Drosophilarum (ATCC 36,906), K. Thermotolerans (K. thermotolerans) and K.
  • the “transformation” refers to a modification of the genotype of a host cell by introduction of an exogenous polynucleotide, and refers to the introduction of an exogenous polynucleotide into the host cell regardless of the method used for the transformation.
  • the foreign polynucleotide introduced into the host cell may be integrated and maintained or not integrated into the genome of the host cell, and the present invention includes both.
  • An antibody or a recombinant expression vector capable of expressing an antibody or fragment thereof that specifically binds to phosphorylated beta-catenin of serine 47 (Ser47) according to the present invention is a method known in the art, for example Although not limited thereto, transient transfection, microinjection, transduction, cell fusion, calcium phosphate precipitation, liposome-mediated transfection, DEAE dextran-mediated trait Infection (DEAE dextran-mediated transfection), polybrene-mediated transfection, electroporation, gene gun, and antibodies by known methods for introducing nucleic acids into cells Or it can be transformed by introducing it into the cell to produce the fragment.
  • DEAE dextran-mediated trait Infection DEAE dextran-mediated transfection
  • polybrene-mediated transfection polybrene-mediated transfection
  • electroporation gene gun
  • the cell of the present invention is a cultured cell that can be transformed or transfected with the polynucleotide of the present invention or a vector containing the same, which can be continuously expressed in the host cell.
  • Recombinant cells refer to cells transformed or transfected with a polynucleotide to be expressed.
  • the cells of the present invention can also be cells that do not express the polynucleotide of the present invention at a desired level unless a regulatory sequence is introduced into the cell such that it is operably linked to the polynucleotide.
  • the cells of the present invention can be cultured in a variety of media.
  • Commercially available media such as Ham's F10 (Sigma-Aldrich Co., St. Louis, MO), minimal essential media (MEM, Sigma-Aldrich Co.), RPMI-1640 (Sigma-Aldrich Co.), And Dulbecco's modified Eagle's medium (DMEM, Sigma-Aldrich Co.) is suitable for culturing cells.
  • Hormones and/or other growth factors, salts, buffers, nucleotides, antibiotics, trace elements and glucose or equivalent energy sources may be added to the medium if necessary.
  • the present invention comprises the steps of culturing the cell under conditions in which the polynucleotide is expressed to produce a polypeptide including a light chain and a heavy chain variable region, and recovering the polypeptide from the cell or a culture medium in which the same is cultured.
  • the cell of the production method in the present invention is as described above, and contains a polynucleotide encoding the antibody of the present invention.
  • the polypeptide of the above production method may be an antibody of the present invention or a fragment thereof, or an amino acid sequence other than the antibody or fragment thereof of the present invention may be additionally bound.
  • the culture medium composition and culture conditions may vary depending on the type of cells, which can be appropriately selected and controlled by a person skilled in the art.
  • the antibody molecule may be accumulated in the cytoplasm of the cell, secreted from the cell, or targeted to periplasm or extracellular medium (supernatant) by an appropriate signal sequence, and targeted to periplasm or extracellular medium. It is desirable. In addition, it is desirable to refold the produced antibody molecule using a method well known to those skilled in the art and to have a functional conformation. The recovery of the polypeptide may vary depending on the characteristics of the produced polypeptide and the characteristics of the cells, which can be appropriately selected and controlled by a person skilled in the art.
  • the polypeptide can be produced intracellularly, in the surrounding cytoplasmic space, or directly secreted into the medium. If the polypeptide is produced inside the cell, the cell can be destroyed to release the protein as a first step. Particulate debris, host cells or lysed fragments are removed, for example by centrifugation or ultrafiltration. When the antibody is secreted into the medium, the supernatant from this expression system is generally first concentrated using a commercially available protein concentration filter, such as an Amicon or Millipore Pellicon ultrafiltration unit. Protease inhibitors such as PMSF may be included in any preceding step to inhibit proteolysis, and antibiotics may be included to prevent the growth of accidental contaminants. Antibodies prepared from cells may be purified using, for example, hydroxyapatite chromatography, gel electrophoresis, dialysis, and affinity chromatography, and the antibody of the present invention may be preferably purified through affinity chromatography. have.
  • the present invention also relates to substances that inhibit the expression or activity of Wnt3a; Or it provides a pharmaceutical composition for inhibiting anticancer drug resistance, comprising a substance that inhibits phosphorylation of serine 47 (Ser47) of beta-catenin as an active ingredient.
  • the survival rate of the cells treated with Wnt3a was significantly higher than that of untreated cells. appear.
  • substances that inhibit the expression or activity of Wnt3a can inhibit primary cilia in cancer cells, and as a result, has the effect of inhibiting the resistance of cancer cells to anticancer drugs. Can be indicated.
  • the substance that inhibits the expression of Wnt3a may be a substance that can control the expression of the Wnt3a gene, and the substance that inhibits the activity of Wnt3a may include a substance that can directly inhibit the activity of the Wnt3a protein. have.
  • the material capable of regulating the expression of the Wnt3a gene is not limited thereto, but may include one or more of antisense oligonucleotides, siRNA, shRNA, miRNA, ribozymes, and PNAs that complementarily bind to the mRNA of the Wnt3a gene.
  • substances that inhibit the activity of the Wnt3a protein may include natural products and chemical substances such as aptamers, antibodies that specifically bind to Wnt3a, peptides, peptide mimetics, and substrate analogs, without limitation.
  • the "antisense oligonucleotide” refers to a DNA or RNA containing a nucleic acid sequence complementary to a specific mRNA sequence, or a derivative thereof, and inhibits translation of mRNA into a protein by binding to a complementary sequence in the mRNA. It works.
  • the antisense sequence of the present invention refers to a DNA or RNA sequence that is complementary to the Wnt3a gene and capable of binding to Wnt3a mRNA, and is capable of translating Wnt3a mRNA, translocation into the cytoplasm, maturation, or all other overall biological functions. It can inhibit essential activity against.
  • the length of the antisense nucleic acid is 6 to 100 bases, preferably 8 to 60 bases, and more preferably 10 to 40 bases.
  • siRNA refers to a nucleic acid molecule capable of mediating RNA interference or gene silencing. Since siRNA can inhibit the expression of a target gene, it is provided as an efficient gene knock-down method or as a gene therapy method.
  • the siRNA molecule may have a structure in which a sense strand (a sequence corresponding to a Wnt3a mRNA sequence) and an antisense strand (a sequence complementary to a Wnt3a mRNA sequence) are located on opposite sides to form a double chain.
  • the siRNA molecule of the present invention may have a single-stranded structure having a self-complementary sense and antisense strand.
  • the siRNA molecule may particularly comprise a nucleotide sequence complementary to SEQ ID NO: 1 of the present invention.
  • shRNA small hairpin RNA or short hairpin RNA
  • shRNA refers to a sequence of RNA that makes a strong hairpin turn, which can be used to suppress gene expression through RNA interference.
  • shRNA uses a vector for cell introduction and mainly uses a U6 promoter capable of expressing shRNA. These vectors are always delivered to daughter cells, allowing gene silencing to be inherited.
  • the shRNA hairpin structure is degraded into siRNA, an intracellular machinery, and bound to the RNA-induced silencing complex.
  • the above-described complex binds to and degrades mRNA matched to the siRNA bound thereto.
  • shRNA is transcribed by RNA polymerase III, and shRNA production in mammalian cells may trigger interferon reactions, just as cells recognize shRNA as viral attacks and seek defenses.
  • the "aptamer” is a nucleic acid molecule having binding activity to a predetermined target molecule, and a specific chemistry by an evolutionary method using an oligonucleotide library called SELEX (systematic evolution of ligands by exponential enrichment). It can be obtained by isolating an oligomer that binds to a molecule or biological molecule with high affinity and selectivity. Aptamer can inhibit the activity of a given target molecule by binding to a given target molecule.
  • the aptamer of the present invention may be RNA, DNA, a modified nucleic acid, or a mixture thereof, and there is no limitation on a form such as a linear or cyclic form.
  • the "antibody” may be a monoclonal antibody or a polyclonal antibody that inhibits the activity of Wnt3a protein.
  • Antibodies that inhibit the activity of the Wnt3a protein can effectively inhibit the activity of the Wnt3a protein by specifically binding to the Wnt3a protein.
  • Antibodies that specifically bind to the Wnt3a protein can be prepared by known methods known to those skilled in the art, or commercially available antibodies can be purchased and used.
  • antibodies that inhibit the activity of Wnt3a protein include antigen-binding fragments of antibodies in addition to the complete form having the full length of two heavy chains and two light chains, as long as it can specifically bind to and inhibit the activity of Wnt3a protein. do.
  • peptides, peptide mimetics, and substrate analogs that can be included as the inhibitor of Wnt3a protein activity of the present invention inhibit the activity of the protein by inhibiting a specific domain of the Wnt3a protein.
  • Peptidomimetics may be peptides or non-peptides, and may consist of amino acids linked by non-peptide bonds, such as psi bonds.
  • Peptide mimetics are structured similar to the secondary structural properties of Ttyh1 protein, can mimic the inhibitory properties of large molecules such as antibodies or water-soluble receptors, and can be novel small molecules that can act with the same effect as natural antagonists.
  • a substance that inhibits phosphorylation of serine 47 of beta-catenin is not particularly limited, and, for example, serine 47 of beta-catenin (Ser47) It may be a substance that inhibits phosphorylation by binding complementarily, or inhibits phosphorylation by competing with serine #47 of beta-catenin, which is a substrate, through a phosphorylation enzyme.
  • the phosphorylation inhibitor that complementarily binds to serine 47 (Ser47) of beta-catenin may be a substrate analog, a compound, a peptide, a peptide mimetics, an aptamer, or an antibody.
  • the phosphorylation inhibitor which acts competitively and inhibits phosphorylation may be a polypeptide, which is a fragment containing serine #47 in beta-catenin protein.
  • the "anticancer agent or anticancer drug” of the “anticancer drug resistance” refers to a chemical substance used for treatment including reduction, inhibition, and elimination of malignant tumors.
  • the anticancer agent may be, for example, alkylating agents, antimetabolites, natural substances, hormones and antagonists thereof, targeted therapeutic agents, or combinations thereof.
  • the alkylated drugs are, for example, Cisplatin, Carboplatin, Oxaliplatin, Mechlorethamine, Cyclophosphamide, Ifosfamide, Melphalan (Melphalan), Chlorambucil, Thiotepa, Altretamine, Procarbazine, Busulfan, Carmustine (BCNU), Lomustine, CCNU), dacarbazine (DTIC), or a combination thereof.
  • the anti-metabolites include, for example, Fluorouracil (5-FU), capecitabine, cytarabine, gemcitabine, methotrexate, and mercaptopurine.
  • Mercaptopurine 6-MP
  • the natural substances are, for example, vinblastine, vincristine, vinorelbine, paclitaxel, docetaxel, etoposide, topotecan, irinotecan (Irinotecan), Dactinomycin, Doxorubicin, Daunorubicin, Mitomycin, Bleomycin, L-Asparaginase, or combinations thereof can do.
  • the hormone and its antagonist drugs are, for example, Mitotane, Aminoglutethimide, Prednisone, Prednisolone, Progestin, Estrogen, Androgen, Tamoxifen (Tamoxifen), flutamide (Flutamide), leuprolide (Leuprolide), or a combination thereof may be included.
  • the target therapeutic agent is, for example, Imatinib, Gefitinib, Erlotinib, Lapatinib, Sunitinib, Sorafenib, Dasatinib. , Nilotinib, Tofacitinib, Crizotinib, Vemurafenib, Dabrafenib, Trametinib, Bortezomib, O Patumumab, Alemtuzumab, Trastuzumab, Trastuzumab emtansine (T-DM1), Cetuximab, Bevacizumab, Risoxi Mab (Rituxomab), panitumumab (Panitumumab), ipilimumab (Ipilimumab), Pertuzumab (Pertuzumab), or a combination thereof.
  • the "drug-resistance” refers to a symptom that exhibits extremely low sensitivity to an anticancer drug treatment regimen, so that the symptoms of cancer are not improved, alleviated, alleviated or treated by the treatment regimen.
  • Anticancer drug resistance may appear because cancer may have resistance from the beginning to a specific anticancer treatment regimen, and initially did not show resistance, but due to a long treatment, the properties of cancer cells change and thus no longer show sensitivity to the same treatment.
  • the cancer may be a solid cancer or a non-solid cancer.
  • Solid cancer refers to cancerous tumors in organs such as liver, lungs, breasts, and skin.
  • Non-solid cancer is a cancer that occurs in the blood and is also called blood cancer.
  • the cancer may be carcinoma, sarcoma, hematopoietic cell-derived cancer, germ cell tumor, or blastoma.
  • the cancer is, for example, breast cancer, colorectal cancer, head and neck cancer, colon cancer, skin cancer, pancreatic cancer, lung cancer, gastric cancer, ovarian cancer, prostate cancer, bladder cancer, urethral cancer, liver cancer, kidney cancer, clear cell sarcoma, melanoma, cerebrospinal cancer.
  • Brain cancer Brain cancer, thymus, mesothelioma, esophageal cancer, biliary tract cancer, testicular cancer, germ cell tumor, thyroid cancer, parathyroid cancer, cervical cancer, endometrial cancer, lymphoma, myelodysplastic syndromes (MDS), myelofibrosis, acute leukemia , Chronic leukemia, multiple myeloma, Hodgkin's Disease, endocrine cancer, and sarcoma.
  • MDS myelodysplastic syndromes
  • the pharmaceutical composition according to the present invention comprises a substance that inhibits the expression or activity of Wnt3a; Alternatively, it may contain only a substance that inhibits phosphorylation of serine 47 (Ser47) of beta-catenin, or may be formulated in a suitable form with a pharmaceutically acceptable carrier, and additionally contain an excipient or diluent. can do.
  • the carrier includes all kinds of solvents, dispersion media, oil-in-water or water-in-oil emulsions, aqueous compositions, liposomes, microbeads and microsomes.
  • the pharmaceutically acceptable carrier may further include, for example, a carrier for oral administration or a carrier for parenteral administration.
  • Carriers for oral administration may include lactose, starch, cellulose derivatives, magnesium stearate, stearic acid, and the like. In addition, it may contain various drug delivery materials used for oral administration.
  • the carrier for parenteral administration may include water, suitable oil, saline, aqueous glucose and glycol, and the like, and may further include stabilizers and preservatives. Suitable stabilizers are antioxidants such as sodium hydrogen sulfite, sodium sulfite or ascorbic acid. Suitable preservatives are benzalkonium chloride, methyl- or propyl-paraben and chlorobutanol.
  • the pharmaceutical composition of the present invention may further include a lubricant, a wetting agent, a sweetening agent, a flavoring agent, an emulsifying agent, a suspending agent, etc. in addition to the above components.
  • a lubricant e.g., a talc, a kaolin, a kaolin, a kaolin, a kaolin, a kaolin, a kaolin, etc.
  • Other pharmaceutically acceptable carriers and preparations may be referred to those described in known literature.
  • composition of the present invention can be administered to mammals including humans by any method.
  • it can be administered orally or parenterally.
  • Parenteral administration methods include, but are not limited to, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intracardiac, transdermal, subcutaneous, intraperitoneal, intranasal, intestinal, topical, sublingual or rectal administration Can be
  • composition of the present invention can be formulated into a formulation for oral administration or parenteral administration according to the route of administration as described above.
  • the composition of the present invention may be formulated using a method known in the art as a powder, granule, tablet, pill, dragee, capsule, liquid, gel, syrup, slurry, suspension, etc. I can.
  • tablets or dragees can be obtained by mixing the active ingredient with a solid excipient, pulverizing it, adding a suitable auxiliary, and processing into a granule mixture.
  • excipients examples include sugars including lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol and maltitol, and starches including corn starch, wheat starch, rice starch and potato starch, cellulose, Fillers such as celluloses including methyl cellulose, sodium carboxymethylcellulose and hydroxypropylmethyl-cellulose, gelatin, and polyvinylpyrrolidone may be included. In addition, in some cases, cross-linked polyvinylpyrrolidone, agar, alginic acid or sodium alginate may be added as a disintegrant. Furthermore, the pharmaceutical composition of the present invention may further include an anti-aggregating agent, a lubricant, a wetting agent, a flavoring agent, an emulsifying agent and a preservative.
  • a formulation for parenteral administration it can be formulated in the form of injections, creams, lotions, ointments for external use, oils, moisturizers, gels, aerosols, and nasal inhalants by methods known in the art. These formulations are described in literature generally known in all pharmaceutical chemistry.
  • the total effective amount of the composition of the present invention may be administered to a patient in a single dose, and may be administered by a fractionated treatment protocol that is administered for a long time in multiple doses.
  • the pharmaceutical composition of the present invention may vary the content of the active ingredient according to the severity of the disease.
  • the preferred total dose of the pharmaceutical composition of the present invention may be about 0.01 ⁇ g to 10,000 mg, most preferably 0.1 ⁇ g to 500 mg per 1 kg of patient body weight per day.
  • the dosage of the pharmaceutical composition is determined by taking into account various factors such as the patient's age, weight, health condition, sex, disease severity, diet and excretion rate, as well as the formulation method, route of administration and number of treatments.
  • the pharmaceutical composition according to the present invention is not particularly limited in its formulation, route of administration, and method of administration as long as it exhibits the effects of the present invention.
  • the present invention is also for inhibiting anticancer drug resistance comprising an antibody or antigen-binding fragment thereof specifically binding to phosphorylated beta-catenin of serine 47 (Ser47) as an active ingredient; Or it provides a pharmaceutical composition for preventing or treating ciliary dystrophy (ciliopathy).
  • beta-catenin which is phosphorylated with serine #47 (Ser47)
  • Ser47 serine #47
  • the rate of formation, the length of the cilia, and the thickness of the cilia are all significantly increased.
  • Ciliary dystrophy in which the primary cilia abnormally develops in cells, is closely related to the onset of various diseases, and has been reported to affect the resistance of cancer to anticancer drugs. Therefore, the antibody specifically binding to the phosphorylated beta-catenin of serine 47 is anticancer drug resistance by blocking sub-signaling involved in the abnormal development of primary cilia; Or it can effectively control ciliary dystrophy.
  • the foregoing may be referred to for the antibody or antigen-binding fragment thereof specifically binding to phosphorylated beta-catenin by serine 47 (Ser47).
  • the foregoing may be referred to for the anticancer drug resistance.
  • the ciliary dystrophy includes various diseases that appear as structural or functional abnormalities of the primary cilia.
  • the ciliary dystrophy refers to a disease caused by abnormal expression of primary cilia.
  • the abnormal expression of the primary cilia includes underexpression, overexpression of the primary cilia, and an abnormal change in the thickness/length of the primary cilia, and preferably may mean overexpression of the primary cilia and an abnormal increase in the thickness/length of the primary cilia.
  • Primary cilia play an important role in detecting various external senses (sight, smell, hearing, motor sense, osmotic pressure, etc.), and important signal transduction processes within cells occur through the primary cilia. Thus, abnormal expression of primary cilia can mediate various diseases.
  • the type of ciliary dysfunction is not particularly limited if it is a disease caused by abnormal expression of primary cilia, and non-limiting examples thereof include developmental malformations of the cerebellum and brain stem, kidney disease, retinal degeneration, and loss of olfactory sense. , Polydactyly, obesity, intellectual disability, Alstrom syndrome, polycystic kidney disease, Badet-Biedl syndrome, kidney cyst, infertility, respiratory disease, visceral inversion (situs inversus) and hypertension.
  • the present invention also provides a composition for diagnosing anticancer drug resistance, including an agent for measuring the level of phosphorylation of serine 47 (Ser47) of beta-catenin.
  • beta-catenin in a biological sample of a specific patient compared to a normal control group. If the level of phosphorylation of serine 47 (Ser47) is increased, it can be diagnosed that the patient will exhibit anticancer drug resistance.
  • the agent for measuring the phosphorylation level of serine 47 of beta-catenin is an antibody specifically binding to beta-catenin phosphorylated with serine 47, an antigen-binding fragment thereof, or It may be an aptamer.
  • the agent for measuring the phosphorylation level of serine 47 (Ser47) of the beta-catenin in the present invention specifically binds to the epitope represented by SEQ ID NO: 2. It may be a characterized antibody or antigen-binding fragment thereof.
  • the agent for measuring the phosphorylation level of serine 47 (Ser47) of beta-catenin is a heavy chain complementarity determining region (CDR) comprising an amino acid sequence represented by SEQ ID NO: 3 1, a heavy chain variable region comprising a heavy chain CDR2 comprising an amino acid sequence represented by SEQ ID NO: 4 and a heavy chain CDR3 comprising an amino acid sequence represented by SEQ ID NO: 5; And a light chain variable region comprising a light chain CDR1 comprising an amino acid sequence represented by SEQ ID NO: 6, a light chain CDR2 comprising an amino acid sequence represented by SEQ ID NO: 7 and a light chain CDR3 comprising an amino acid sequence represented by SEQ ID NO: 8. It may be an antibody or antigen-binding fragment thereof.
  • CDR heavy chain complementarity determining region
  • the agent for measuring the phosphorylation level of serine 47 (Ser47) of the beta-catenin includes a heavy chain variable region comprising an amino acid sequence represented by SEQ ID NO: 9; And a light chain variable region comprising an amino acid sequence represented by SEQ ID NO: 10. It may be an antibody or antigen-binding fragment thereof.
  • the present invention also provides a kit for diagnosing anticancer drug resistance, including an agent for measuring the phosphorylation level of serine 47 (Ser47) of beta-catenin.
  • kits for diagnosing anticancer drug resistance of the present invention in order to measure the phosphorylation level of serine 47 of beta-catenin, serine 47 is selectively phosphorylated in beta-catenin.
  • the antibody or aptamer that binds, as well as one or more other component compositions, solutions or devices suitable for the assay method may be included.
  • the kit is a western blot, ELISA, radioimmunoassay, radioimmuno diffusion method, octeroni immune diffusion method, rocket immunoelectrophoresis, immunostaining method, immunoprecipitation assay, complement fixation assay, FACS or protein chip method. It may be a diagnostic kit characterized in that it includes a known essential element and ancillary elements necessary for, but is not limited thereto.
  • the kit includes an antibody specific for beta-catenin in which serine 47 (Ser47) is phosphorylated.
  • the antibody is an antibody that has high specificity and affinity for beta-catenin phosphorylated with serine 47 (Ser47) and has little cross-reactivity to other proteins, and is a monoclonal antibody, a polyclonal antibody, or a recombinant antibody.
  • the kit may contain an antibody specific for a control protein. Antibodies provided in the kit can be labeled with a detectable moiety as such, as described above.
  • the kit is a separate reagent capable of detecting the bound antibody, e.g., labeled secondary antibodies, chromophores, enzymes (as conjugated with antibodies) and their substrates or antibodies. It may contain other materials that can be used.
  • the kit of the present invention may include a washing solution or an eluent capable of removing excess chromogenic substrate and unbound protein, and retaining only protein markers bound to the antibody.
  • kits provided by the present invention may be the aforementioned antibodies provided by the present invention.
  • the present invention also comprises the steps of: (a) measuring the phosphorylation level of serine 47 (Ser47) of beta-catenin in a biological sample provided from a cancer patient; (b) Provides a method of providing information for diagnosis of anticancer resistance, comprising diagnosing anticancer resistance when the phosphorylation level of serine 47 of the beta-catenin is higher than that of a normal control group.
  • biological samples include whole blood, plasma, blood cells, serum, vascular endothelial cells, nerve cells, cerebrospinal fluid, saliva, nasal fluid, sputum, joint capsule fluid, amniotic fluid, ascites, cervical secretions, vaginal secretions, and urine. It may be selected from the group consisting of, but is not limited thereto.
  • the method of measuring the phosphorylation level of serine 47 of the beta-catenin in the step (a) of the present invention is an automatic radiograph method, a liquid scintillation counting method, a molecular weight analysis method, a liquid chromatographic mass analysis method, and Western Group consisting of blot, ELISA, radioimmunoassay, radioimmuno diffusion method, Ouchterlony immunodiffusion method, rocket immunoelectrophoresis, immunofluorescence staining, immunohistochemical staining, immunoprecipitation analysis, complement fixation analysis, FACS and protein chip It may be selected from, but is not limited thereto.
  • the phosphorylation level of serine 47 of beta-catenin in the subject measured by the method in step (a) was measured by the same method as that of a normal person. Compare with A subject whose phosphorylation level of serine 47 of beta-catenin is increased compared to that of healthy healthy subjects may be considered to be patients with anticancer drug resistance.
  • the present invention also includes the steps of (a) contacting the test substance with cells or tissues expressing beta-catenin; (b) measuring the phosphorylation level of serine 47 (Ser47) of beta-catenin in cells or tissues contacted with the test substance; And (c) measuring the phosphorylation level of serine 47 of beta-catenin in cells or tissues not contacted with the test substance, thereby reducing the phosphorylation level of serine 47 of beta-catenin measured in step (b). It provides a method for screening an anticancer drug resistance inhibitor comprising the step of selecting the tested substance.
  • test substance used while referring to the screening method of the present invention refers to an unknown substance used in screening to test whether it affects the phosphorylation level of serine 47 (Ser47) of beta-catenin.
  • the test substances are siRNA (small interference RNA), shRNA (short hairpin RNA), miRNA (microRNA), ribozyme, DNAzyme, PNA (peptide nucleic acids), antisense oligonucleotides, antibodies, aptamers, natural extracts, or Including, but not limited to, chemicals.
  • the cells used in step (a) may be provided in the form of an experimental animal, and in this case, contact with the test substance includes parenteral or oral administration, or stereotactic injection, but is not limited thereto. You will be able to choose an appropriate method for testing the test substance on animals.
  • Treating the test substance means adding the test substance to the cell or tissue culture medium and then culturing the cells for a certain time.
  • contact with the test substance is not limited thereto, including parenteral or oral administration, or stereotactic injection, and those skilled in the art can select an appropriate method for testing the test substance on the animal. will be.
  • the method of measuring the phosphorylation level of serine 47 of the beta-catenin in step (b) is an autoradiography method, a liquid scintillation counting method, a molecular weight analysis method, a liquid chromatographic mass analysis method, western blot, ELISA. , Radioimmunoassay, radioimmunoassay, Ouchterlony immunodiffusion method, rocket immunoelectrophoresis, immunofluorescence staining, immunohistochemical staining, immunoprecipitation analysis, complement fixation analysis, FACS and protein chip. However, it is not limited thereto.
  • step (c) the phosphorylation level of serine 47 of beta-catenin in cells or tissues not contacted with the test substance is measured, and the phosphorylation level of serine 47 of beta-catenin measured in step (b)
  • This reduced test substance can be selected as a candidate anticancer drug resistance inhibitor.
  • the present invention is a substance that inhibits the expression or activity of Wnt3a for preparing a pharmaceutical preparation for inhibiting anticancer drug resistance; Or it provides the use of a substance that inhibits the phosphorylation of serine 47 (Ser47) of beta-catenin.
  • the present invention is a substance that inhibits the expression or activity of Wnt3a; Or it provides a method for inhibiting anticancer drug resistance comprising administering an effective amount of a composition containing as an active ingredient a substance that inhibits phosphorylation of serine 47 of beta-catenin to an individual in need thereof. .
  • The'effective amount' of the present invention refers to an amount exhibiting an effect on inhibiting anticancer drug resistance when administered to an individual, and the'individual' may be an animal, preferably an animal including a mammal, particularly a human, and in an animal It may be derived cells, tissues, organs, etc. The individual may be a patient in need of the effect.
  • the present invention provides a use of a preparation for measuring the phosphorylation level of serine 47 (Ser47) of beta-catenin for preparing a preparation for diagnosis of anticancer drug resistance.
  • the present invention includes the steps of: (a) measuring the phosphorylation level of serine 47 (Ser47) of beta-catenin in a biological sample provided from a cancer patient; (b) It provides a method for diagnosing anticancer drug resistance, comprising diagnosing anticancer drug resistance when the phosphorylation level of serine 47 of the beta-catenin is higher than that of the normal control group.
  • the present invention provides a method for diagnosing anticancer drug resistance and inhibiting anticancer drug resistance comprising the steps of:
  • the step (c) is a step of performing anticancer drug resistance suppression through administration of an anticancer drug resistance inhibitory drug or surgery to an individual whose anticancer drug resistance is diagnosed in step (b).
  • The'anticancer drug resistance inhibitory drug' is not particularly limited as long as it is a type of drug commonly used to suppress anticancer drug resistance.
  • the drug is administered to an individual in a'therapeutically effective amount', and the therapeutically effective amount can be determined by those skilled in the art to determine the age, weight, health status, sex, and disease
  • the effective dosage for a patient can be determined by considering various factors such as severity, diet and excretion rate.
  • the route of administration of the therapeutic drug is not particularly limited, and may be administered orally or parenterally, and includes both local administration as well as systemic administration.
  • the parenteral administration may be, but is not limited to, intranasal drug application, subcutaneous injection, and the like, and as another example, intramuscular injection, intravenous injection, or the like may be used.
  • The'biological sample' of the present invention is obtained separately from an individual suspected of anticancer drug resistance, and is not limited thereto, but may be selected from the group consisting of cells, tissues, blood, serum, plasma, saliva, mucous membranes, and urine.
  • The'individual' may be an animal, preferably an animal including a mammal, particularly a human, and may be a cell, tissue, organ, etc. derived from an animal. The individual may be a patient in need of the therapeutic effect.
  • the present invention also provides a research composition and/or kit comprising an antibody or antigen-binding fragment thereof specifically binding to phosphorylated beta-catenin of serine 47 (Ser47) as an active ingredient.
  • the term for the study includes all of those used for in vitro, in vivo, and in situ studies, preferably for in vitro studies, and more preferably for immunostaining analysis studies.
  • the foregoing may be referred to for the antibody or antigen-binding fragment thereof specifically binding to phosphorylated beta-catenin by serine 47 (Ser47).
  • serine 47 is phosphorylated beta in cells using an antibody that specifically binds to phosphorylated beta-catenin of serine #47 (Ser47) provided by the present invention.
  • Ser47 serine #47
  • the intracellular location of beta-catenin was confirmed very accurately. Therefore, by using the antibody provided by the present invention, it is possible to very accurately identify a new intracellular location of beta-catenin, which is not known before, so that it can be very usefully utilized in various research fields related to beta-catenin.
  • the term'comprising' in the present invention is used in the same way as'containing' or'as a feature', and does not exclude additional component elements or method steps that are not mentioned in the composition or method. .
  • the term'consisting of' means excluding additional elements, steps, or ingredients that are not separately described.
  • the term'consisting essentially of' is meant to include, in the scope of a composition or method, the component elements or steps described, as well as the component elements or steps, etc. that do not substantially affect the basic properties thereof.
  • the present invention provides a novel antibody capable of measuring the level of phosphorylation of serine 47 (Ser47) of beta-catenin, which is directly involved in the development of primary cilia in cells, and the use thereof.
  • Figure 1 including Figures 1a to 1i, is a result of confirming that Wnt3a, a standard ligand of Wnt, promotes primary cilia in hTERT-RPE cells.
  • FIGS. 2A to 2D is a result of confirming that Wnt3a, a standard ligand of Wnt, promotes primary cilia in hTERT-RPE cells.
  • Figure 3 including Figures 3a to 3c, is a result of confirming that primary cilia development is seriously damaged by the deletion of beta-catenin or CK1 ⁇ .
  • FIG. 5 including FIGS. 5A to 5F is a result of confirming that phosphorylation of beta-catenin serine 47 (Ser47) residues by CK1 ⁇ kinase activity plays a very important role in primary cilia development.
  • FIGS. 6A to 6F is a result of confirming that the activation of CK1 ⁇ kinase induced by Wnt3 promotes phosphorylation of beta-catenin serine 47 (Ser47) residues.
  • Figure 7 including Figures 7a to 7e is a result of confirming that the centrosome localization of beta-catenin in which the serine 47 (Ser47) residue is phosphorylated by Wnt3 promotes primary cilia development.
  • Figure 8 including Figures 8a to 8d, is a result of confirming that stimulation of the standard Wnt ligand, Wnt3a, promotes recruitment of the centriole satellite to the pericentric region.
  • Figure 9 including Figures 9a to 9j, is a result of confirming that centrosome recruitment of centriole satellites is dependent on phosphorylation of serine 47 (Ser47) residues of beta-catenin.
  • FIG. 10 including FIGS. 10A to 10I is a result of confirming the occurrence of Wnt3a-dependent primary cilia in the MCF-7/ADR cell line, which is a multidrug-resistant tumor cell model.
  • FIGS. 11A to 11C is a result of confirming that the cells exhibit resistance to doxorubicin, an anticancer agent, when treated with Wnt3a on the MCF-7/ADR cell line, which is a multidrug-resistant tumor cell model.
  • mice expressing beta-catenin wild-type form (WT) or various mutant forms [each truncated form ('T' mutant) and alanine/aspartic acid substitution mutant ("A"/"D” mutant)] are pcDNA It was produced by subcloning in the BamI-NotI position of -FLAG, or by subcloning at the SaIl position of pHR'-CMV-SV-puro.
  • Each full-length A/D mutant and truncated fragment was generated by PCR using pCDNA3-Flag-beta-catenin WT and pEGFP-C1-beta-catenin WT.
  • Expression constructs of mouse CK1 ⁇ or CK1 ⁇ were generated according to a conventionally known method.
  • shRNA-expressing lentiviral construct (sh1746), nucleotide 1746-1769 annealed from human beta-catenin (accession number BC058926) open reading frame (forward: 5′-CCGG GGATGTTCACAACCGAATTGTTAT GCTAGC ATAACAATTCGGTTG - GAACATCC TTTTTGTGAACAT 3'and reverse: 5'-AATTCAAAAA GGATGTTCACAACCGAATTGTTAT GCTAGC ATAACAATTCGGTTGTGAACATCC -3' targeting sequence is underlined) was subcloned in the AgeI-EcoRI position of the pLKO.1-puro vector.
  • a mouse beta-catenin plasmid construct that is resistant to the silencing effects of beta-catenin sh1746 RNA contains three different nucleotides (5'-ggacgttcacaaccggattgtaat -3'). All mutants were generated using PCR-based site-directed mutagenesis.
  • the target sequences of shGL (CGTACGCGGAATACTTCGA) and shCK1 ⁇ (AGGCTACCCTTCCGAATTT) were subcloned into the pLKO.1-puro vector in the same manner as sh-catenin.
  • Plasmid and siRNA were transfected into the corresponding cells using X-tremeGENE HP DNA transfection reagent (Roche) or Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions.
  • Plasmid and siRNA were transfected into the corresponding cells using X-tremeGENE HP DNA transfection reagent (Roche) or Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions.
  • pLKO.1-puro-sh luciferase (shGL), -shbeta-catenin, or -shCK1 ⁇ constructs were used in pHR'-CMV-VSV-G (protein G of vesicular stomatitis virus) and pHR. '-CMV ⁇ R8.2 ⁇ vpr and HEK293T cells were co-transfected.
  • pHR'-CMV-SV-puro-vector pHR'-CMV-SV-puro-vector-beta-catenin wild-type R (R, sh1746-resistant mouse beta-catenin ), S45A R , S47A R , T217A R , or S47D R constructs were co-transfected into HEK293T cells with pHR'-CMV-VSV-G and pHR'-CMV ⁇ R8.2 ⁇ vpr. Cells were infected with each lentivirus for one day and selected by puromycin treatment (4-20 ⁇ g/ml, 2-3 days).
  • hTERT-RPE cells harvested with 1 x PBS were harvested with 1 x TBSN buffer [20 mM Tris-Cl (pH 8.0), 0.5% NP-40, 150 mM NaCl, 1.5 mM EDTA, 5 mM EGTA, 10 mg/ml pNPP ( p-nitrophenylphosphate; Sigma) and protease inhibitor cocktail].
  • the total cell lysate was centrifuged at 15,000 g for 20 minutes at 4°C. Clear cell lysates were incubated with the indicated antibody at 4° C.
  • Immune precipitate was separated by 6-12% SDS-PAGE and transferred to a PVDF membrane.
  • Membranes were sequentially incubated with the primary antibody for 2 to 4 hours at room temperature (or overnight at 4° C.) with the HRP-conjugated secondary antibody for an additional hour at room temperature. Subsequently, the membrane was washed extensively with 1 x TBST [(50 mM Tris-Cl (pH 7.5), 0.05% Tween 20, 150 mM NaCl)] at least three times. Immune responsive signals were detected with the ECL detection system.
  • Rabbit polyclonal anti-beta-catenin phosphorylation-Ser47 (p-S47) antibody is a synthetic phosphorylation-peptide, NH2-TAPSL-pS-GKGN-C-COOH (42-51 amino acids) (AbFRONTIER Inc., Seoul) administration.
  • p-S47 antibody was a synthetic phosphorylation-peptide, NH2-TAPSL-pS-GKGN-C-COOH (42-51 amino acids) (AbFRONTIER Inc., Seoul) administration.
  • the immunized rabbit serum was purified by affinity chromatography, and the production of anti-beta-catenin p-S47 antibody was monitored by ELISA immunoassay.
  • 5 ⁇ g to 10 ⁇ g/ml non-phosphorylated peptide was added to the antibody solution.
  • RNA prep. was performed from the CTNB1-p-S47 hybridoma cell line, and after cDNA synthesis, the variable region genes of the light and heavy chains were PCR amplified. The sequence of the variable region genes of the PCR amplified light chain and heavy chain was confirmed through sequencing analysis after T-vector cloning. The identified sequence was organized by displaying the CDRs by the Kabat numbering method.
  • GST-beta-catenin WT various alanine substitution mutants of GST-beta-catenin and GST- by isopropyl beta-d-1-thiogalactopyranoside (IPTG) induction in E. coli BL21.
  • IPTG isopropyl beta-d-1-thiogalactopyranoside
  • CK1delta- WT was expressed. Subsequently, it was purified with glutathione (GSH)-agarose.
  • kinase cocktail [50 mM Tris-Cl (pH 7.5), 10 mM MgCl2, 2 mM EGTA, 5 mM dithiothreitol, 10 mg/ml pNPP (p-nitrophenylphosphate; Sigma) and protease- Inhibitor cocktail], 10 ⁇ M cold-ATP and 10 ⁇ Ci [gamma- 32 P]ATP at 30° C. for 30 minutes.
  • the resulting sample was subjected to SDS-PAGE.
  • IP-kinase analysis For immunoprecipitation (IP)-kinase analysis, hTERT-RPE cells transfected with Myc-tagged mCK1 ⁇ were starved for 6 hours and then stimulated with control- or Wnt3a-CM (conditioned medium) for an additional 24 hours. The cells were then harvested and immunoprecipitated with anti-Myc antibody. The immunoprecipitates were subjected to in vitro kinase assays in a kinase cocktail as described above.
  • in vitro kinase assays were performed as described above in the absence of radioactive isotopes. After applying the resulting sample to SDS-PAGE, the gel was stained with GelCode Blue Stain Reagent according to the manufacturer's instructions. The GST-beta-catenin band was excised from the gel and digested in the gel with trypsin. Mass spectrometry was performed on the resulting sample according to a conventionally known method.
  • a serum deficiency-based ciliogenesis assay, the number of cells with cilia, and the measurement of the length/thickness of the primary cilia were essentially performed according to a conventionally known method. Briefly, hTERT-RPE or MCF-7/ADR cells cultured on a cover slip for 24 hours in 12 culture wells were washed 3 times with 1 ⁇ PBS and then incubated for 6 hours in DMEM alone medium. Cells were treated with control/Wnt3a CM for an additional 48 hours.
  • the resulting cells were co-immunized with an anti-acetylated ⁇ -tubulin antibody (Sigma, 1:200) and anti-gamma-tubulin antibody (Sigma, 1:200) as previously described. Made it.
  • hTERT-RPE or MCF-7/ADR cells were subjected to 4% paraformaldehyde for 10 min at room temperature. Then, it was permeated with cold methanol at -20°C for 2 minutes. The resulting sample was then extensively washed 4 times with 1 X PBST. Immunofluorescence analysis was performed according to a conventionally known method. Briefly, the primary antibody was incubated at room temperature for 2-4 hours (or overnight at 4° C. for phosphorylated-antibody) and washed 3 times with 1 ⁇ PBST.
  • the fluorescence-stained conjugated secondary antibody was incubated for 1 hour at room temperature. DNA was stained with 1 ⁇ g/ml of DAPI solution while incubating for 10 minutes at room temperature. The resulting cover slip was mounted with a Fluoro-Gel mounting medium, observed and photographed with a Zeiss LSM 700 confocal microscope, Zeiss AxioObserver or Nikon Eclipse ti-u inverted fluorescence microscope system.
  • Wnt3a activity in CM was neutralized by adding anti-Wnt3a antibody to Wnt3a CM at a final concentration of 5 ⁇ g/ml. A mixture of antibody and CM was incubated overnight at 4° C. and then applied to the cells.
  • HTERT-RPE cells treated with control or Wnt3a CM were harvested by trypsinization and FACS analysis was performed.
  • PI sodium iodide staining was performed using the BD cycletest TM Plus DNA reagent kit (BD Biosciences, CA) according to the manufacturer's protocol.
  • the resulting sample was applied to a BD FACSCalibur flow cytometer for FACS analysis, and the resulting data was analyzed with CellQuest Pro v6.0 (BD Biosciences).
  • CM or Wnt3a CM were treated with control CM or Wnt3a CM and cultured for 24 hours.
  • the cultured cells were treated with 2 mM or 10 mM doxorubicin, followed by additional culture for 6 to 10 days.
  • the cultured cells were stained with Wright staining (Sigma-Aldrich) solution and observed under a microscope or analyzed by flow cytometry (FACS).
  • FACS analysis was performed using a BD FACSCalibur TM Flow Cytometer (BD Biosciences) with propidium iodide staining (BD cycletest TM Plus DNA reagent kit), and the data was analyzed using CellQuest Pro v6.0 (BD Biosciences).
  • hTERT-RPE cells were serum deficient and stimulated with Wnt3a according to the schedule shown in FIG. 1A. 48 hours after treatment, cells were harvested, immunoblotted and immunostained with the indicated antibodies. Since cell density affects primary cilia development, the number of cells with primary cilia was counted in a similar cell density area of the control or Wnt3a conditioned media (CM)-treated coverslips. Surprisingly, Wnt3a stimulation significantly increased the number of cells with primary cilia compared to the control group (Figs. 1B and 1C).
  • CM conditioned media
  • Wnt3a CM stimulation had an effect on primary cilia in terms of the number of cells in which cilia occurred, the length and thickness of the cilia.
  • pre-incubation of Wnt3a CM and anti-Wnt3a antibody suppressed Wnt3a-induced primary cilia development.
  • control CM approximately 50% cilia occurred, whereas stimulation of Wnt3a CM caused more than 70% cilia, and pre-incubation of Wnt3a CM and anti-Wnt3a antibody produced less than 30% cilia in hTERT-RPE cells.
  • pre-culture of Wnt3a CM and control IgG did not affect Wnt3a-induced primary cilia development with approximately 71% cilia as observed in Wnt3a CM-treated cells (FIGS. 2A and 2B ).
  • the neutralizing effect of Wnt3a by pre-culture of anti-Wnt3a antibody was observed not only in the incidence of cilia, but also in the length and thickness of the cilia.
  • the long and thick cilia of the Wnt3a CM-treated cells were similar to those observed in the control CM-treated cells, but the length and thickness of the cilia were decreased after pre-incubation of Wnt3a CM and anti-Wnt3a antibody (FIGS. 2C and 2D ). .
  • cilia length 48 hours after serum deficiency (96 hours after sh-lentivirus infection), primary cilia of about 3.5 ⁇ m length are produced in shGL lentivirus-infected cells, whereas primary cilia of about 1.9 or 2.1 ⁇ m length Cilia were produced in shbeta-catenin or CK1 ⁇ lentivirus-infected cells, respectively (FIG. 3C ).
  • the present inventors searched for candidates for CK1 ⁇ -induced beta-catenin phosphorylation sites in the primary sequence of the T1 mutant according to the consensus phosphorylation sequence for CK1 ⁇ (S/Tp-X1-2-S/T). To increase the likelihood of phosphorylation site selection, the latter S/T residues and the former S/T residues of the consensus sequence were included in candidate selection.
  • beta-catenin wild-type (WT) expressing cells developed about 35% of primary cilia, and cells expressing S45A or T217A mutations developed about 30% of primary cilia. Made it. Cells expressing the S47A mutant developed about 15% of primary cilia (FIG. 5F).
  • the present inventors focused on the beta-catenin Ser47 residue to study primary ciliation with respect to Wnt3a.
  • Wnt3a stimulation promotes CK1 ⁇ activity-dependent phosphorylation of beta-catenin Ser47 residues.
  • CK1 ⁇ induces the endogenous beta-catenin p-S47 epitope in vivo (FIG. 6D ).
  • Overexpression of Myc-CK1 ⁇ WT significantly increased the endogenous beta-catenin p-S47 epitope in immunoblotting assays using anti-p-S47-specific antibodies compared to vector-only expression or Myc-CK1 ⁇ WT (Fig. 6d).
  • overexpression of CK1 ⁇ a kinase similar to CK1 ⁇ , did not enhance p-S47 signal compared to empty vector or CK1 ⁇ expression.
  • the primary cilia development was further analyzed using hTERT-RPE cells stably expressing an empty vector, beta-catenin WT, S47A or S47D.
  • the deficiency of endogenous beta-catenin was confirmed through immunoblotting analysis and this cell line was used for the analysis (Fig. 7a). The ability of these cell lines to exhibit primary ciliation was investigated through a serum deficiency-based ciliogenesis assay.
  • beta-catenin p-S47 changes in the intracellular location of beta-catenin p-S47 were monitored after Wnt3a stimulation in hTERT-RPE cells.
  • the change in the position of beta-catenin p-S47 to the centrosome was confirmed by immunofluorescence analysis using an anti-p-S47 antibody in hTERT-RPE cells.
  • beta-catenin p-S47 was co-immunized with CEP170, a marker of the parent central body.
  • the co-localization of these proteins was monitored using a super-resolution microscope (Figure 7f).
  • Co-localization of the two proteins was confirmed in the confocal microscopy image, and the ring-like structure of the two proteins was observed in the super-resolution image.
  • the cyclic beta-catenin p-S47 structure is surrounded by a CEP170 ring and the two proteins are partially co-localized (Figure 4F).
  • Wnt3a-induced-beta-catenin S47 phosphorylation promotes reconstruction of centriolar satellites around the centrosome.
  • PCM1 is known to be a platform necessary for the formation and maintenance of centrosome satellites. Therefore, we observed PCM1 dependent and ciliogenic centrioles such as PCM1, AZI1/CEP131, CEP290, BBS4 and OFD1.
  • the present inventors investigated whether the stimulation of Wnt3a changes the subcellular localization of the selected centrosomes.
  • PCM1 spots dispersed in control CM-treated cells were significantly recruited/accumulated around ⁇ -tubulin (Fig. 8A, upper panel) and the basal body of cilia (Fig. 8a, lower panel) by Wnt3a stimulation.
  • Figs. 8A and 8B To monitor other selected centrioles, cells were treated in the same manner as PCM1, immunostained and observed.
  • AZI1/CEP131 and CEP290 showed similar results to PCM1, whereas BBS4 and OFD1 did not.
  • Pericentriolar signals of AZI1/CEP131 and CEP290 were significantly increased in Wnt3a CM-treated cells compared to control CM-treated cells, but the pericentriolar signals of BBS4 and OFD1 were significant between the control and Wnt3a CM-treated cells. There was no difference (FIGS. 8C and 8D ).
  • centrosomes can be reconstituted by phosphorylation of beta-catenin S47.
  • shbeta-catenin cells expressing the empty vector (+Vec) showed a significant decrease in PCM1 pericentric signal intensity, while beta-catenin WT (+WTR) or phosphorylation mimicking S47D mutant (+S47DR).
  • beta-catenin WT (+WTR) or phosphorylation mimicking S47D mutant (+S47DR Significantly increased the accumulation of PCM1 around the centrosome.
  • the phosphorylation-deficient S47A mutant (+S47AR) showed the lowest accumulation of PCM1 around the centrosome (FIGS. 9A and 9B ).
  • AZI1/CEP131 and CEP290 showed similar results to PCM1, whereas BBS4 and OFD1 did not (Figs. 9c to 9f).
  • beta-catenin p-S47 was used as an anti-beta-catenin p-S47 antibody for 24 hours of serum deficiency. Immunoprecipitation was performed in hTERT-RPE cells. Interestingly, the physical interaction of beta-catenin p-S47 and PCM1/AZI1/CEP290/CEP170 was confirmed in the immunoprecipitation assay (Fig. 9k).
  • MCF-7/ADR cell line highly expressed MDR1, a marker protein for drug resistance, compared to the adriamycin-sensitive MCF-7 cells (FIG. 10A).
  • Stimulation of Wnt3a induced more cell populations expressing cilia in the MCF-7/ADR cell line, and also induced a longer cilia length.
  • very long primary cilia were observed in MCF-7/ADR cells after Wnt3a stimulation (FIGS. 10B to 10E ).
  • the average length of primary cilia in Wnt3a-treated MCF-7/ADR cells was about 11 ⁇ m, which was about twice that of Wnt3a-treated hTERT-RPE cells (about 5 ⁇ m).
  • MCF-7/ADR cells frequently showed primary cilia with a length of 20 ⁇ m or more after Wnt3a stimulation. This is a surprising result considering that the longest primary cilia in hTERT-RPE cells induced by Wnt3a stimulation is about 10 ⁇ m.
  • the present inventors analyzed the effect of Wnt3a on the loci of beta-catenin p-S47 and PCM1 in MCF-7/ADR cells as in hTERT-RPE cells. Similar to the results of hTERT-RPE cells, stimulation of Wnt3a caused an increase in beta-catenin p-S47 in the centrosome and accumulation of PCM1 around the pericentric body (FIGS. 10F to 10I ). In summary, the effect of Wnt3a on primary cilia production, centriole localization of beta-catenin p-S47 and recruitment of PCM1 was judged to be greater in MCF-7/ADR cells than in hTERT-RPE cells.
  • the standard Wnt ligand, Wnt3a induces CK1 ⁇ -dependent beta-catenin S47 residue phosphorylation and its localization to the centrosome.
  • This series of events recruits centrosome satellites such as PCM1, AZI1/CEP131, and CEP290 as centrosomes/basal bodies, ultimately inducing primary cilia development.
  • the present invention provides a novel antibody capable of measuring the level of phosphorylation of serine 47 (Ser47) of beta-catenin, which is directly involved in the development of primary cilia in cells, and the use thereof.
  • Can provide a method for diagnosing anticancer drug resistance of cancer cells by primary cilia or screening anticancer drug resistance inhibitors by measuring the phosphorylation level of serine 47 of beta-catenin. Very likely.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Analytical Chemistry (AREA)
  • Pathology (AREA)
  • Medicinal Chemistry (AREA)
  • Biochemistry (AREA)
  • Hematology (AREA)
  • Urology & Nephrology (AREA)
  • Genetics & Genomics (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • General Physics & Mathematics (AREA)
  • Food Science & Technology (AREA)
  • Biophysics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Cell Biology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Engineering & Computer Science (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Oncology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Hospice & Palliative Care (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Neurology (AREA)
  • Neurosurgery (AREA)
  • Peptides Or Proteins (AREA)

Abstract

본 발명은 인산화된 베타-카테닌(beta-catenin)에 특이적으로 결합하는 항체 및 이의 용도에 관한 것으로, 보다 상세하게는 47번 세린(Ser47)이 인산화된 베타-카테닌에 특이적으로 결합하는 항체 및 이의 용도에 관한 것이다. 본 발명은 세포에서 일차섬모발생에 직접적으로 관여하는, 베타-카테닌(beta-catenin)의 47번 세린(Ser47)의 인산화 수준을 측정할 수 있는 신규한 항체 및 이의 용도를 제공하며, 또한 본 발명은 베타-카테닌(beta-catenin)의 47번 세린(Ser47)의 인산화 수준을 측정함으로써 일차섬모에 의한 암 세포의 항암제 내성을 진단하거나, 항암제 내성 억제제를 스크리닝 하는 방법을 제공할 수 있어 암의 진단 및 치료에 매우 유용하게 활용될 수 있다.

Description

인산화된 베타-카테닌에 특이적으로 결합하는 항체 및 이의 용도
본 출원은 2019년 7월 23일에 출원된 대한민국 특허출원 제10-2019-0089078호 및 2020년 2월 3일에 출원된 대한민국 특허출원 제10-2020-0012754호를 우선권으로 주장하고, 상기 명세서 전체는 본 출원의 참고문헌이다.
본 발명은 인산화된 베타-카테닌(beta-catenin)에 특이적으로 결합하는 항체 및 이의 용도에 관한 것으로, 보다 상세하게는 47번 세린(Ser47)이 인산화된 베타-카테닌에 특이적으로 결합하는 항체 및 이의 용도에 관한 것이다.
일차섬모(primary cilium)은 대부분의 포유류 상피 세포와 기질 세포에 존재하는 비운동성, 미세소관 기반의 세포성 안테나 유사 구조이다. 운동성 섬모와 달리, 운동성이 없는 일차섬모는 세포주기 진행 동안 동적조립 및 분해주기를 수행한다. 일차섬모는 세포주기의 정지 단계 (G0 단계) 동안 모중심소체(mother centrioles) 중심에서 조립되며 유사 분열에 들어가기 전에 빠르게 분해된다. 그러나, 일차섬모의 형성이 세포 신호 경로에 의해 어떻게 조절되는지는 여전히 잘 알려져 있지 않다. 반대로, 세포 신호 전달 경로에서 일차섬모의 중요한 역할은 많은 연구를 통해 확인되고 있다. 특히, 일차섬모는 조직 생성에 필요한 Hedgehog (Hh) 신호 전달 경로의 형질 도입에 필수적이다. 이 과정에서 Hh 신호 전달은 일차섬모에 의해 감지되고 Hh 신호 전달 성분은 섬모 내외부에서 운동 단백질에 의해 전달된다. 이러한 수송 기전의 결핍은 섬모이상증(ciliopathy) 및 암으로 이어진다.
일차섬모가 인간 유전자 질환을 유도하는데 중요하지만, 섬모이상증의 분자적 기초는 알려져 있지 않다. 또한, 인간 암과 일차섬모 사이의 밀접한 상관 관계가 확인된 바 있지만, 일차섬모와 관련된 종양 형성의 정확한 메커니즘은 연구되지 않았다.
Wnt 신호전달은 발달과정 동안 세포 이동, 극성 및 분화와 같은 다양한 세포의 운명을 제어하고, 성인 조직의 항상성을 조절하는 주요 신호전달 경로이다. 따라서, Wnt 신호전달의 비정상적인 조절은 발달장애 및 암을 포함한 다양한 인간 질병을 초래한다. 표준경로(canonical pathway)는 beta-카테닌 안정화를 통해 다양한 유전자의 발현을 조절하고, 비표준경로(noncanonical pathway)는 세포 극성 및 운명 결정과 같은 많은 세포 과정을 조절하는 것으로 알려져 있다. 비록, 일차섬모와 Wnt 신호 사이의 관계가 고려된 바 있고, 일차섬모에 의한 표준경로의 Wnt 신호 억제가 확인된 바 있지만, Wnt-매개 일차섬모발생(primary ciliogenesis)의 명확한 증거는 확인된 바 없다(Nat. Cell Biol., 13 (2011), pp. 700-707.)
베타-카테닌은 초파리에서 아르마딜로의 포유류 상동체이며 배아발달, 조직 항상성 및 세포재생에서 다양한 역할을 한다. 역사적으로, 베타-카테닌은 Wnt 신호전달 경로의 주요 성분으로서, 그리고 E-카드헤린 관련 세포 부착 분자로서의 기능을 포함하는 두 번의 구별된 기능 때문에 두 차례 발견되었다. 베타 -카테닌은 표준 Wnt 신호전달 경로에서 핵심 분자이며, 다양한 키나아제에 의해 다양한 인산화 부위가 생성된다. 현재까지 20 개가 넘는 베타-카테닌 인산화 부위가 확인되었지만, 아직 일차섬모발생과의 연관성은 확인된 바 없다.
이에, 본 발명자는 Wnt 신호전달과 일차섬모발생과의 연관성을 밝히기 위해 예의 연구를 거듭한 결과, 표준적인 Wnt 리간드인 Wnt3a가 일차섬모발생을 유도하며, 그 과정에서 베타-카테닌의 특정 부위에서 인산화가 증가됨을 발견함으로써 본 발명을 완성하게 되었다.
따라서, 본 발명의 목적은 47번 세린(Ser47)이 인산화된 베타-카테닌(beta-catenin)에 특이적으로 결합하는 항체 또는 이의 항원 결합 단편을 제공하는 것이다.
본 발명의 다른 목적은 상기 항체 또는 이의 항원 결합 단편을 암호화하는 폴리뉴클레오티드를 제공하는 것이다.
본 발명의 다른 목적은 상기 폴리뉴클레오티드를 포함하는 재조합 발현벡터를 제공하는 것이다.
본 발명의 다른 목적은 재조합 발현벡터로 형질전환된 숙주세포를 제공하는 것이다.
본 발명의 다른 목적은 Wnt3a의 발현 또는 활성을 억제하는 물질; 또는 베타-카테닌(beta-catenin)의 47번 세린(Ser47)의 인산화를 억제하는 물질을 유효성분으로 포함하는 항암제 내성 억제용 약학적 조성물을 제공하는 것이다.
또한 Wnt3a의 발현 또는 활성을 억제하는 물질; 또는 베타-카테닌(beta-catenin)의 47번 세린(Ser47)의 인산화를 억제하는 물질로 이루어진 항암제 내성 억제용 약학적 조성물을 제공하는 것이다.
또한 Wnt3a의 발현 또는 활성을 억제하는 물질; 또는 베타-카테닌(beta-catenin)의 47번 세린(Ser47)의 인산화를 억제하는 물질로 필수적으로 이루어진 항암제 내성 억제용 약학적 조성물을 제공하는 것이다.
본 발명의 다른 목적은 베타-카테닌(beta-catenin)의 47번 세린(Ser47)의 인산화 수준을 측정하는 제제를 포함하는 항암제 내성 진단용 조성물을 제공하는 것이다.
또한, 베타-카테닌(beta-catenin)의 47번 세린(Ser47)의 인산화 수준을 측정하는 제제로 이루어진 항암제 내성 진단용 조성물을 제공하는 것이다.
또한, 베타-카테닌(beta-catenin)의 47번 세린(Ser47)의 인산화 수준을 측정하는 제제로 필수적으로 이루어진 항암제 내성 진단용 조성물을 제공하는 것이다.
본 발명의 다른 목적은 베타-카테닌(beta-catenin)의 47번 세린(Ser47)의 인산화 수준을 측정하는 제제를 포함하는 항암제 내성 진단용 키트를 제공하는 것이다.
본 발명의 다른 목적은 (a) 암 환자로부터 제공된 생물학적 시료에서 베타-카테닌(beta-catenin)의 47번 세린(Ser47)의 인산화 수준을 측정하는 단계; (b) 상기 베타-카테닌의 47번 세린의 인산화 수준이 정상 대조군보다 높을 경우 항암제 내성으로 진단하는 단계를 포함하는, 항암제 내성 진단을 위한 정보를 제공하는 방법을 제공하는 것이다.
본 발명의 다른 목적은 (a) 시험물질을 베타-카테닌(beta-catenin)을 발현하는 세포 또는 조직과 접촉시키는 단계; (b) 상기 시험물질이 접촉된 세포 또는 조직에서 베타-카테닌의 47번 세린(Ser47)의 인산화 수준을 측정하는 단계; 및 (c) 상기 시험물질이 접촉되지 않은 세포 또는 조직에서의 베타-카테닌의 47번 세린의 인산화 수준을 측정하여, 상기 (b) 단계에서 측정된 베타-카테닌의 47번 세린의 인산화 수준이 감소된 시험물질을 선별하는 단계를 포함하는, 항암제 내성 억제제 스크리닝 방법을 제공하는 것이다.
본 발명의 다른 목적은 항암제 내성 억제를 위한 약학적 제제를 제조하기 위한 Wnt3a의 발현 또는 활성을 억제하는 물질; 또는 베타-카테닌(beta-catenin)의 47번 세린(Ser47)의 인산화를 억제하는 물질의 용도를 제공하는 것이다.
본 발명의 다른 목적은 Wnt3a의 발현 또는 활성을 억제하는 물질; 또는 베타-카테닌(beta-catenin)의 47번 세린(Ser47)의 인산화를 억제하는 물질을 유효성분으로 포함하는 조성물의 유효량을 이를 필요로 하는 개체에 투여하는 것을 포함하는 항암제 내성 억제 방법을 제공하는 것이다.
본 발명의 다른 목적은 항암제 내성 진단용 제제를 제조하기 위한 베타-카테닌(beta-catenin)의 47번 세린(Ser47)의 인산화 수준을 측정하는 제제의 용도를 제공하는 것이다.
본 발명의 다른 목적은 (a) 암 환자로부터 제공된 생물학적 시료에서 베타-카테닌(beta-catenin)의 47번 세린(Ser47)의 인산화 수준을 측정하는 단계; (b) 상기 베타-카테닌의 47번 세린의 인산화 수준이 정상 대조군보다 높을 경우 항암제 내성으로 진단하는 단계를 포함하는, 항암제 내성 진단 방법을 제공하는 것이다.
전술한 본 발명의 목적을 달성하기 위하여 본 발명은 47번 세린(Ser47)이 인산화된 베타-카테닌(beta-catenin)에 특이적으로 결합하는 항체 또는 이의 항원 결합 단편을 제공한다.
본 발명의 다른 목적을 달성하기 위하여 본 발명은 상기 항체 또는 이의 항원 결합 단편을 암호화하는 폴리뉴클레오티드를 제공한다.
본 발명의 다른 목적을 달성하기 위하여 본 발명은 상기 폴리뉴클레오티드를 포함하는 재조합 발현벡터를 제공한다.
본 발명의 다른 목적을 달성하기 위하여 본 발명은 상기 재조합 발현벡터로 형질전환된 숙주세포를 제공한다.
본 발명의 다른 목적을 달성하기 위하여 본 발명은 Wnt3a의 발현 또는 활성을 억제하는 물질; 또는 베타-카테닌(beta-catenin)의 47번 세린(Ser47)의 인산화를 억제하는 물질을 유효성분으로 포함하는 항암제 내성 억제용 약학적 조성물을 제공한다.
또한 Wnt3a의 발현 또는 활성을 억제하는 물질; 또는 베타-카테닌(beta-catenin)의 47번 세린(Ser47)의 인산화를 억제하는 물질로 이루어진 항암제 내성 억제용 약학적 조성물을 제공한다.
또한 Wnt3a의 발현 또는 활성을 억제하는 물질; 또는 베타-카테닌(beta-catenin)의 47번 세린(Ser47)의 인산화를 억제하는 물질로 필수적으로 이루어진 항암제 내성 억제용 약학적 조성물을 제공한다.
본 발명의 다른 목적을 달성하기 위하여 본 발명은 베타-카테닌(beta-catenin)의 47번 세린(Ser47)의 인산화 수준을 측정하는 제제를 포함하는 항암제 내성 진단용 조성물을 제공한다.
또한, 베타-카테닌(beta-catenin)의 47번 세린(Ser47)의 인산화 수준을 측정하는 제제로 이루어진 항암제 내성 진단용 조성물을 제공한다.
또한, 베타-카테닌(beta-catenin)의 47번 세린(Ser47)의 인산화 수준을 측정하는 제제로 필수적으로 이루어진 항암제 내성 진단용 조성물을 제공한다.
본 발명의 다른 목적을 달성하기 위하여 본 발명은 베타-카테닌(beta-catenin)의 47번 세린(Ser47)의 인산화 수준을 측정하는 제제를 포함하는 항암제 내성 진단용 키트를 제공한다.
본 발명의 다른 목적을 달성하기 위하여 본 발명은 (a) 암 환자로부터 제공된 생물학적 시료에서 베타-카테닌(beta-catenin)의 47번 세린(Ser47)의 인산화 수준을 측정하는 단계; (b) 상기 베타-카테닌의 47번 세린의 인산화 수준이 정상 대조군보다 높을 경우 항암제 내성으로 진단하는 단계를 포함하는, 항암제 내성 진단을 위한 정보를 제공하는 방법을 제공한다.
본 발명의 다른 목적을 달성하기 위하여 본 발명은 (a) 시험물질을 베타-카테닌(beta-catenin)을 발현하는 세포 또는 조직과 접촉시키는 단계; (b) 상기 시험물질이 접촉된 세포 또는 조직에서 베타-카테닌의 47번 세린(Ser47)의 인산화 수준을 측정하는 단계; 및 (c) 상기 시험물질이 접촉되지 않은 세포 또는 조직에서의 베타-카테닌의 47번 세린의 인산화 수준을 측정하여, 상기 (b) 단계에서 측정된 베타-카테닌의 47번 세린의 인산화 수준이 감소된 시험물질을 선별하는 단계를 포함하는, 항암제 내성 억제제 스크리닝 방법을 제공한다.
본 발명의 다른 목적을 달성하기 위하여 본 발명은 항암제 내성 억제를 위한 약학적 제제를 제조하기 위한 Wnt3a의 발현 또는 활성을 억제하는 물질; 또는 베타-카테닌(beta-catenin)의 47번 세린(Ser47)의 인산화를 억제하는 물질의 용도를 제공하는 것이다.
본 발명의 다른 목적을 달성하기 위하여 본 발명은 Wnt3a의 발현 또는 활성을 억제하는 물질; 또는 베타-카테닌(beta-catenin)의 47번 세린(Ser47)의 인산화를 억제하는 물질을 유효성분으로 포함하는 조성물의 유효량을 이를 필요로 하는 개체에 투여하는 것을 포함하는 항암제 내성 억제 방법을 제공하는 것이다.
본 발명의 다른 목적을 달성하기 위하여 본 발명은 항암제 내성 진단용 제제를 제조하기 위한 베타-카테닌(beta-catenin)의 47번 세린(Ser47)의 인산화 수준을 측정하는 제제의 용도를 제공하는 것이다.
본 발명의 다른 목적을 달성하기 위하여 본 발명은 (a) 암 환자로부터 제공된 생물학적 시료에서 베타-카테닌(beta-catenin)의 47번 세린(Ser47)의 인산화 수준을 측정하는 단계; (b) 상기 베타-카테닌의 47번 세린의 인산화 수준이 정상 대조군보다 높을 경우 항암제 내성으로 진단하는 단계를 포함하는, 항암제 내성 진단 방법을 제공하는 것이다.
이하, 본 발명에 대해 상세히 설명한다.
본 발명은 47번 세린(Ser47)이 인산화된 베타-카테닌(beta-catenin)에 특이적으로 결합하는 항체 또는 이의 항원 결합 단편을 제공한다.
본 발명의 용어 "베타-카테닌(beta-catenin)"이란, 세포간의 중요한 접착분자인 카드헤린의 세포질영역과 결합하는 약 94kDa의 크기를 갖는 단백질을 의미하는데, 카드헤린 및 α-카테닌과 결합하여 복합체를 형성한다. 한편, 상기 베타-카테닌은 카드헤린과 결합하는 능력 이외에도 wnt 매개 신호전달 경로의 일부를 담당하는데, 상기 wnt 매개 신호전달은 배아발생과정과 성인조직의 항상성을 유지하는데 중요한 역할을 수행하고, 상기 신호전달에 이상이 생긴 경우 암을 비롯한 다양한 질병이 발병된다고 알려져 있다. 본 발명의 목적상 상기 베타-카테닌은 wnt, GSK-3beta, APC, beta-catenin 및 beta-catenin:TCF로 구성된 wnt 매개 신호전달 경로의 구성요소로서 간주될 수 있으나, 특별히 이에 제한되지는 않는다. 상기 베타-카테닌은 CTNNB1, CTNNB, MRD19, armadillo, catenin beta 1, EVR7, NEDSDV 등으로 불리기도 하며, 인간에서는 3번 염색체 상(3p22)의 CTNNB1 유전자에 의하 암호화되어 있다. 베타-카테닌은 781개의 아미노산(aa)으로 이루어진 단백질로 발견되며, 이는 NCBI reference sequence NP_001091679, NP_001091680, NP_001159374, NP_031640 등으로 공지되어 있으며, 바람직하게는 서열번호 1의 아미노산 서열로 이루어진 것일 수 있다.
[서열번호 1]
MATQADLMEL DMAMEPDRKA AVSHWQQQSY LDSGIHSGAT TTAPSLSGKG NPEEEDVDTS
QVLYEWEQGF SQSFTQEQVA DIDGQYAMTR AQRVRAAMFP ETLDEGMQIP STQFDAAHPT
NVQRLAEPSQ MLKHAVVNLI NYQDDAELAT RAIPELTKLL NDEDQVVVNK AAVMVHQLSK
KEASRHAIMR SPQMVSAIVR TMQNTNDVET ARCTAGTLHN LSHHREGLLA IFKSGGIPAL
VKMLGSPVDS VLFYAITTLH NLLLHQEGAK MAVRLAGGLQ KMVALLNKTN VKFLAITTDC
LQILAYGNQE SKLIILASGG PQALVNIMRT YTYEKLLWTT SRVLKVLSVC SSNKPAIVEA
GGMQALGLHL TDPSQRLVQN CLWTLRNLSD AATKQEGMEG LLGTLVQLLG SDDINVVTCA
AGILSNLTCN NYKNKMMVCQ VGGIEALVRT VLRAGDREDI TEPAICALRH LTSRHQEAEM
AQNAVRLHYG LPVVVKLLHP PSHWPLIKAT VGLIRNLALC PANHAPLREQ GAIPRLVQLL
VRAHQDTQRR TSMGGTQQQF VEGVRMEEIV EGCTGALHIL ARDVHNRIVI RGLNTIPLFV
QLLYSPIENI QRVAAGVLCE LAQDKEAAEA IEAEGATAPL TELLHSRNEG VATYAAAVLF
RMSEDKPQDY KKRLSVELTS SLFRTEPMAW NETADLGLDI GAQGEPLGYR QDDPSYRSFH
SGGYGQDALG MDPMMEHEMG GHHPGADYPV DGLPDLGHAQ DLMDGLPPGD SNQLAWFDTD
L
본 발명의 일 실시예에 따르면, 47번 세린(Ser47)이 인산화된 베타-카테닌은 세포의 일차섬모발생 과정에서 필수적으로 관여하며, 베타-카테닌의 47번 세린의 인산화가 증가한 세포에서 세포의 섬모화 비율, 섬모의 길이 및 섬모의 두께가 모두 현저히 증가하는 것으로 확인된 바 있다. 세포에서 일차섬모가 비정상적으로 발달하는 섬모 이상증(ciliopathy)이 다양한 질환의 발병과 밀접하게 관련되어 있고, 암의 항암제 내성에도 영향을 미치기 때문에 베타-카테닌의 47번 세린의 인산화를 검출할 수 있는 본 발명의 항체는 세포의 일차섬모와 관련된 다양한 기초연구, 약물개발, 질병진단 등의 분야에서 매우 유용하게 활용될 수 있다.
본 발명에서 “항체(antibody)”는 면역글로불린(immunoglobulin, Ig)이라고도 불리며, 항원에 선택적으로 작용하여 생체 면역에 관여하는 단백질의 총칭이다. 자연에서 발견되는 전체 항체(whole antibody)는 일반적으로 여러 도메인으로 이루어진 폴리펩티드인 경쇄(light chain, LC) 및 중쇄(heavy chain, HC)의 2개 쌍으로 이루어지거나, 이들 HC/LC의 2개의 쌍으로 된 구조를 기본 단위로 구성된다. 포유류의 항체를 구성하는 중쇄의 종류는 그리스 문자 alpha, delta, epsilon, gamma 및 mu로 표시되는 5가지 유형이 있으며, 중쇄의 종류에 따라 각각 IgA, IgD, IgE, IgG 및 IgM 등 다른 종류의 항체를 구성하게 된다. 포유류의 항체를 구성하는 경쇄의 종류는 lambda 및 kappa로 표시되는 2가지 종류가 존재한다.
항체의 중쇄와 경쇄는 구조적으로 아미노산 서열의 가변성에 따라 가변영역과 불변영역으로 구분된다. 중쇄의 불변영역은 항체의 종류에 따라 CH1, CH2 및 CH3(IgA, IgD 및 IgG 항체) 및 CH4(IgE 및 IgM 항체) 등 3 또는 4개의 중쇄불변영역으로 구성되어 있으며, 경쇄는 1개의 불변영역인 CL으로 구성되어 있다. 중쇄와 경쇄의 가변영역은 각각 중쇄가변영역(VH) 또는 경쇄가변영역(VL)의 하나의 도메인으로 이루어져 있다. 경쇄와 중쇄는 각각의 가변영역과 불변영역이 나란히 정렬되어 1개의 공유 이황결합(disulfide bond)에 의해 연결되고, 경쇄와 결합한 두 분자의 중쇄는 2개의 공유 이황결합을 통해 연결되어 전체 항체의 형태를 형성한다. 전체 항체는 중쇄 및 경쇄의 가변영역을 통해 항원에 특이적으로 결합하며, 전체 항체는 2개의 중쇄 및 경쇄의 쌍(HC/LC)으로 구성되어 있으므로, 한 분자의 전체 항체는 두 개의 가변영역을 통해 동일한 두 개의 항원에 결합하는 2가의 단일특이성을 갖게 된다. 항원에 결합하는 항체 가변영역을 항체의 항원결합부위(antigen-binding site)라고 하고, 항원의 표면에서 항체에 의해 인식되는 부분을 항원결정부(epitope)라고 한다.
항원결합부위(antigen-binding site)를 포함하고 있는 항체의 가변영역은 서열 가변성이 적은 골격 부위(framework region, FR)와 서열 가변성이 높은 과가변성 부위(hypervariable region)인 상보성 결정부위(complementary determining region, CDR)로 세분된다. VH와 VL은 각각 3개의 CDR 및 4개의 FR이 N-말단부터 C-말단의 방향으로 FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4의 순서로 배열되어 있다. 항체의 가변영역 안에서도 서열 가변성이 가장 높은 CDR이 항원과 직접 결합하는 부위로, 항체의 항원특이성에 가장 중요하다.
본 발명의 일 양태에서, 본 발명에 따른 항체 또는 이의 항원 결합 단편은 47번 세린(Ser47)이 인산화된 베타-카테닌에 특이적으로 결합하는 항체로서, 서열번호 2로 표시되는 아미노산 서열을 포함하는 폴리펩티드를 항원결정부(epitope)로 인식하는 것을 특징으로 할 수 있다. 상기 서열번호 2로 표시되는 아미노산 서열은 베타-카테닌 전장(full-length) 단백질에서 42번째 내지 51번째 아미노산으로 이루어진 것이며, 구체적인 서열은 TAPSLpSGKGN 이다. 상기 서열번호 2의 아미노산 서열에서 6번째 아미노산인 세린이 인산화(pS)되어 있는 것을 특징으로 한다.
본 발명의 일 양태에서, 본 발명에 따른 항체 또는 이의 항원 결합 단편은 바람직하게는 서열번호 3으로 표시되는 아미노산 서열을 포함하는 중쇄 상보성 결정부위(CDR)1, 서열번호 4 표시되는 아미노산 서열을 포함하는 중쇄 CDR2 및 서열번호 5로 표시되는 아미노산 서열을 포함하는 중쇄 CDR3을 포함하는 중쇄가변영역; 및 서열번호 6으로 표시되는 아미노산 서열을 포함하는 경쇄 CDR1, 서열번호 7로 표시되는 아미노산 서열을 포함하는 경쇄 CDR2 및 서열번호 8로 표시되는 아미노산 서열을 포함하는 경쇄 CDR3을 포함하는 경쇄가변영역을 포함하는 것을 특징으로 할 수 있다.
본 발명의 다른 일 양태에서, 본 발명에 따른 항체 또는 이의 항원 결합 단편은 바람직하게는 서열번호 9로 표시되는 아미노산 서열을 포함하는 중쇄가변영역; 및 서열번호 10으로 표시되는 아미노산 서열을 포함하는 경쇄가변영역을 포함하는 것을 특징으로 할 수 있다.
본 발명에 따른 항체 또는 항체의 단편은 상기한 CDR, VH와 VL, 또는 경쇄와 중쇄의 구성을 갖는 것이라면 그 종류에 제한이 없으며, 항체는 IgG, IgA, IgM, IgE 또는 IgD 형태의 항체일 수 있다. 바람직하게는 IgG 형태의 항체일 수 있다.
또한 본 발명에서 항체의 항원 결합 단편은 47번 세린(Ser47)이 인산화된 베타-카테닌에 특이적인 결합력을 유지하고 있는 항체의 단편을 의미하며, 구체적으로는 Fab, F(ab)2, Fab', F(ab')2, Fv, 디아바디(diabody), scFv 등의 형태일 수 있다. Fab(fragment antigen-binding)는 항체의 항원 결합 단편으로, 중쇄와 경쇄 각각의 하나의 가변영역과 불변영역으로 구성되어 있다. F(ab')2는 항체를 펩신으로 가수분해시켜서 생성되는 단편으로, 두 개의 Fab가 중쇄 경첩(hinge)에서 이황결합(disulfide bond)으로 연결된 형태를 하고 있다. F(ab')는 F(ab')2 단편의 이황결합을 환원하여 분리시킨 Fab에 중쇄 경첩이 부가된 형태의 단량체 항체 단편이다. Fv(variable fragment)는 중쇄와 경쇄 각각의 가변영역으로만 구성된 항체 단편이다. scFv(single chain variable fragment)는 VH와 VL이 유연한 펩티드 링커로 연결되어 있는 재조합 항체 단편이다. 디아바디(diabody)는 scFv의 VH와 VL가 매우 짧은 링커로 연결되어 서로 결합하지 못하고, 동일한 형태의 다른 scFv의 VL와 VH와 각각 결합하여 이량체를 형성하고 있는 형태의 단편을 의미한다.
또한 본 발명에 따른 항체는 단일한 B 세포에서 유래하는 단일클론(monoclonal) 항체일 수도 있고, 복수의 B 세포에서 유래하는 다클론(polyclonal) 항체일 수도 있으며, 항체의 중쇄와 경쇄의 아미노산 서열이 실질적으로 동일한 항체의 집단인 단일클론 항체인 것이 바람직하다. 본 발명에 따른 항체 또는 항체의 단편은 인간을 포함하는 포유동물, 조류 등을 포함한 임의의 동물에서 유래한 것일 수 있으며, 상이한 종의 항체 서열을 함께 가지고 있는 키메라(chimera) 항체 또는 항체의 단편일 수 있다. 본 발명의 항체 또는 그 단편은 효소, 형광 물질, 방사선 물질 및 단백질 등과 접합된 것일 수 있으나, 이에 한정되지는 않는다.
본 발명은 또한 상기 항체 또는 이의 항원 결합 단편을 암호화하는 폴리뉴클레오티드를 제공한다.
본 발명에서 '폴리뉴클레오티드'는 올리고뉴클레오티드 또는 핵산으로 기재될 수도 있으며, DNA분자들(예를들어, cDNA 또는 유전체(genomic DNA), RNA 분자들(예를 들어, mRNA), 뉴클레오티드 유사체들을 사용하여 생성된 상기 DNA 또는 RNA의 유사체들(예를 들어, 펩티드 핵산들 및 비-자연적으로 발생하는 뉴클레오티드 유사체들) 및 이들의 하이브리드들이 포함된다. 상기 폴리뉴클레오티드는 단일-가닥(single-stranded) 또는 이중-가닥(doublestranded)이 될 수 있다. 상기 폴리뉴클레오티드는 상기한 서열번호 2의 아미노산을 포함하는 폴리펩티드에 특이적인 CDR구성, 또는 VH와 VL의 구성을 갖는 중쇄 및 경쇄로 이루어지는 항체를 암호화하는 염기서열을 의미한다.
본 발명의 항체 또는 이의 항원 결합 단편을 암호화하는 폴리뉴클레오티드는 당 업계에 잘 알려진 방법에 의하여 얻어질 수 있다. 예를 들어, 상기 항체의 중쇄 및 경쇄의 일부분 또는 전부를 코딩하는 DNA 서열 또는 해당 아미노산 서열에 근거하여, 당 분야에 잘 알려진 올리고뉴클레오타이드 합성기법, 예를 들어 중합효소 연쇄 반응(PCR)법 등을 사용하여 합성할 수 있다.
본 발명은 또한 상기 폴리뉴클레오티드를 포함하는 벡터를 제공한다.
본 발명의 '벡터(vector)'는 본 발명의 항체 또는 이의 항원 결합 단편의 재조합 생산을 위하여 본 발명의 폴리뉴클레오티드의 복제 또는 발현의 목적으로 이용되며, 일반적으로 시그날 서열, 복제 기원, 하나 이상의 마커 유전자, 인핸서 요소, 프로모터 및 전사 종결 서열 중 하나 이상을 포함한다. 본 발명의 벡터는 바람직하게는 발현벡터일 수 있으며, 더욱 바람직하게는 조절시퀀스, 예를 들어 프로모터에 작동 가능하게 연결된 본 발명의 폴리뉴클레오티드를 포함하는 벡터일 수 있다.
벡터의 일종인 플라스미드(plasmid)는 외부의 폴리뉴클레오티드 단편들이 결합될 수 있는 선형 또는 원형의 이중 나선의 DNA 분자를 의미한다. 벡터의 다른 형태는 바이러스성 벡터(viral vector; 예를 들어, 복제-결핍 레트로바이러스(replication defective retroviruses), 아데노바이러스들 및 아데노-연관 바이러스들 (adenoassociated viruses))이며, 여기에서 부가의 DNA 단편들은 상기 바이러스성 게놈(viral genome) 내로 도입될 수 있다. 특정의 벡터들은 그 안으로 이들이 도입되는 숙주세포(예를 들어, 박테리아 유래(bacterial origin) 및 에피좀의 포유류 벡터(episomal mammalian vectors)를 포함하는 박테리아성 벡터들(bacterialvectors)) 내에서의 자가복제(autonomous replication)를 할 수 있다. 다른 벡터들(예를 들어, 비-에피좀의 포유동물 벡터들(non-episomal mammalian vectors))이 숙주세포 내로의 도입에 의한 숙주세포의 게놈내로 통합(integrated)되고 그리고 그에 의하여 상기 숙주 게놈과 함께 복제된다.
본 발명에서 상기 '벡터'는 '발현벡터(expression vector)'와 동일한 의미로 이해될 수 있으며, 이는 상기 폴리뉴클레오티드의 발현할 수 있는 벡터의 한 형태이다. 하나의 폴리뉴클레오티드 시퀀스는, 조절 시퀀스가 상기 폴리뉴클레오티드 시퀀스의 발현(예를 들어, 수준, 타이밍 또는 발현의 위치)에 영향을 주는 경우, 상기 조절 시퀀스(regulatory sequence)에 "작동가능하게 연결"된다. 상기 조절 시퀀스는 그것이 작동가능하게 연결되는 핵산의 발현(예를 들어, 수준, 타이밍 또는 발현의 위치)에 영향을 주는 서열이다. 상기 조절 시퀀스는, 예를 들어, 조절된 핵산에 직접적으로 또는 하나 또는 그 이상의 다른 분자들(예를 들어, 상기 조절 시퀀스 및/또는 상기 핵산에 결합하는 폴리펩티드들)의 작용을 통하여 그의 영향이 미치도록 할 수 있다. 상기 조절 시퀀스에는 프로모터(promoters), 인핸서(enhancers) 및 다른 발현 조절 요소들이 포함된다. 본 발명의 벡터는 바람직하게는 pOptiVEC™-TOPO 및 pcDNA™3.3-TOPO일 수 있다.
본 발명은 또한 상기 벡터로 형질 전환된 세포를 제공한다.
본 발명의 세포는 본 발명의 발현 벡터에 포함된 항체 또는 그 단편을 암호화하는 폴리뉴클레오티드를 발현하는데 사용될 수 있는 세포라면 그 종류는 특별히 제한되지 아니한다. 본 발명에 따른 발현 벡터로 형질 전환된 세포(숙주세포)는 원핵생물(예를 들어, 대장균), 진핵생물(예를 들어, 효모 또는 다른 균류), 식물 세포(예를 들어, 담배 또는 토마토 식물 세포), 동물 세포(예를 들어, 인간 세포, 원숭이 세포, 햄스터(hamster) 세포, 랫 세포(rat cell), 마우스 세포(mouse cell), 곤충 세포 또는 이들에서 유래한 하이브리도마일 수도 있다. 바람직하게는 인간을 포함하는 포유류에서 유래한 세포일 수 있다.
본 목적에 적합한 원핵생물은 그람 음성 또는 그람 양성 유기체, 예를 들어 엔테로박테리아새(Enterobacteriaceae), 예를 들어 에스케리치아(Escherichia), 예를 들어 이. 콜라이(E.coli), 엔테로박터(Enterobacter), 에르위니아(Erwinia), 클렙시엘라(Klebsiella), 프로테우스(Proteus), 살모넬라(Salmonella), 예를 들어, 살모넬라 티피무륨(Salmonella typhimurium), 세라티아(Serratia), 예를 들어, 세라티아 마르세스칸스(Serratia marcescans) 및 시겔라(Shigella), 및 바실리(Bacilli), 예를 들어, 비. 섭틸리스(B. subtilis) 및 비. 리케니포르미스(B. licheniformis), 슈도모나스(Pseudomonas), 예를 들어 피.애루기노사(P.aeruginosa) 및 스트렙토마이세스(Streptomyces)를 포함한다. 본 발명의 세포는 본 발명의 벡터를 발현 가능한 것이면, 특별히 제한되지 아니하나, 바람직하게는 이. 콜라이일 수 있다.
본 발명의 세포로서 진핵생물은 사카로마이세스 세레비지아에(Saccharomyces cerevisiae)가 가장 흔히 사용된다. 그러나, 많은 다른 속, 종 및 균주, 이에 한정되지 아니하나, 예를 들어 쉬조사카로마이세스폼베(Schizosaccharomyces pombe), 클루이베로마이세스 숙주, 예를 들어 케이. 락티스(K.lactis), 케이. 프라길리스(K. fragilis)(ATCC 12,424), 케이. 불가리쿠스(K. bulgaricus)(ATCC 16,045), 케이. 위커라미(K.wickeramii)(ATCC 24,178), 케이. 왈티(K. waltii)(ATCC 56,500), 케이. 드로소필라룸(K.drosophilarum)(ATCC 36,906), 케이. 테르모톨레란스((K. thermotolerans) 및 케이. 마르시아누스(K.marxianus); 야로위아(yarrowia)(EP 402,226); 피키아 파스토리스(Pichia pastoris)(EP 183,070); 칸디다(Candida); 트리코데르마 레에시아(Trichoderma reesia(EP 244,234)); 뉴로스포라 크라사(Neurospora crassa);쉬바니오마이세스(Schwanniomyces), 예를 들어 쉬바니오마이세스 옥시덴탈리스(occidentalis); 및 필라멘트성진균, 예를 들어 뉴로스포라, 페니실리움(Penicillium), 톨리포클라디움(Tolypocladium) 및 아스퍼질러스(Aspergillus) 숙주, 예를 들어 에이. 니둘란스(A. nidulans) 및 에이. 니거(A. niger)가 사용가능하다.
상기 “형질전환(transformation)”은 외래성 폴리뉴클레오티드가 도입됨에 의한 숙주 세포의 유전자형의 변형을 의미하며, 그 형질전환에 사용된 방법과 상관없이 외래성 폴리뉴클레오티드가 숙주 세포 내로 도입된 것을 의미한다. 숙주 세포 내로 도입된 외래성 폴리뉴클레오티드는 숙주 세포의 게놈 내로 통합되어 유지되거나 통합되지 않고 유지될 수 있는데, 본 발명은 양자 모두 포함한다.
본 발명에 따른 47번 세린(Ser47)이 인산화된 베타-카테닌(beta-catenin)에 특이적으로 결합하는 항체 또는 그 단편을 발현할 수 있는 재조합 발현 벡터는 당 업계에 공지된 방법, 예를 들어 이에 한정되지는 않으나, 일시적 형질감염(transient transfection), 미세주사, 형질도입(transduction), 세포융합, 칼슘 포스페이트 침전법, 리포좀 매개된 형질감염(liposome-mediated transfection), DEAE 덱스트란-매개된 형질감염(DEAE dextran- mediated transfection), 폴리브렌-매개된 형질감염(polybrene-mediated transfection), 전기천공법(electroporation), 유전자 총(gene gun) 및 세포 내로 핵산을 유입시키기 위한 공지의 방법에 의해 항체 또는 그 단편을 생산하기 위한 세포 내부로 도입하여 형질 전환할 수 있다
또한, 본 발명의 상기세포는 본 발명의 상기 폴리뉴클레오티드 또는 이를 포함하는 벡터로 형질전환되거나 또는 형질감염(transfected)될 수 있는 배양된 세포이고, 이는 계속해서 상기 숙주세포 내에서 발현될 수 있다. 재조합 세포는 발현되어야 할 폴리뉴클레오티드로 형질전환되거나 또는 형질감염된 세포를 말한다. 본 발명의 세포는 또한 본 발명의 폴리뉴클레오티드를 포함하나, 조절 시퀀스가 상기 폴리뉴클레오티드에 작동 가능하게 연결되도록 상기 세포 내로 도입되지 않는 한 이를 원하는 수준으로 발현하지 않는 세포가 될 수 있다.
본 발명의 세포는 다양한 배지에서 배양될 수 있다. 상업적으로 이용가능한 배지, 예컨대 햄(Ham's) F1O(Sigma-Aldrich Co., St. Louis, MO), 최소 필수 배지(MEM, Sigma-Aldrich Co.), RPMI-1640(Sigma-Aldrich Co.), 및 둘베코(Dulbecco's) 개질 이글(Eagle's) 배지(DMEM, Sigma-Aldrich Co.)가 세포를 배양하기에 적합하다. 상기 배지는 필요하다면 호르몬 및/또는 다른 성장 인자, 염, 완충액, 뉴클레오티드, 항생제, 미량 원소 및 글루코스 또는 동등 에너지원이 추가될 수 있다.
본 발명은 상기 세포를 폴리뉴클레오티드가 발현되는 조건하에서 배양하여, 경쇄 및 중쇄가변영역을 포함하는 폴리펩타이드를 생산하는 단계 및 상기 세포 또는 이를 배양한 배양 배지로부터 상기 폴리펩타이드를 회수하는 단계를 포함하는 47번 세린(Ser47)이 인산화된 베타-카테닌에 결합하는 항체 또는 그 단편의 생산방법을 제공한다.
본 발명에서 생산방법의 세포에 대하여는 상기 기술한 바와 같으며, 본 발명의 항체를 암호화하는 폴리뉴클레오티드를 포함하고 있다. 상기 생산방법의 폴리펩타이드는 본 발명의 항체 또는 그 단편 그 자체일 수 있으며, 본 발명의 항체 또는 그 단편 외 다른 아미노산서열이 추가로 결합된 것일 수 있다.
이 경우 본 기술분야의 통상의 기술자에게 잘 알려져 있는 방법을 이용하여 본 발명의 항체 또는 그 단편으로부터 제거할 수 있다. 상기 배양은 상기 세포의 종류에 따라 배지 조성 및 배양 조건이 달라질 수 있으며, 이는 본 기술분야의 통상의 기술자가 적절히 선택 및 조절할 수 있다.
상기 항체 분자는 세포의 세포질 내에 축적되거나, 세포로부터 분비되거나, 적절한 신호 서열에 의하여 페리플라즘 또는 세포외 배지(supernatant)로 표적화(targeted)될 수 있으며, 페리플라즘 또는 세포외 배지로 표적화되는 것이 바람직하다. 또한, 생산된 항체 분자를 본 기술분야의 통상의 기술자에게 잘 알려져 있는 방법을 이용하여 리폴딩(refolding)시키고 기능적 형태(conformation)를 갖도록 하는 것이 바람직하다. 상기 폴리펩타이드의 회수는 생산된 폴리펩타이드의 특성 및 세포의 특성에 따라 달라질 수 있으며, 이는 본 기술분야의 통상의 지식을 가진자가 적절히 선택 및 조절할 수 있다.
상기 폴리펩타이드는 세포내, 주변 세포질 공간에 생산되거나 배지 내로 직접 분비될 수 있다. 만약 폴리펩타이드가 세포 내에서 생산되면, 이 세포는 제1단계로서 단백질을 방출하기 위하여 파괴될 수 있다. 입자형 파편, 숙주 세포 또는 용해된 단편은 예를 들어 원심분리 또는 한외여과에 의해 제거된다. 항체가 배지 내로 분비되는 경우, 이러한 발현 시스템으로부터의 상등액을 일반적으로 먼저 상업적으로 이용가능한 단백질 농축 필터, 예를 들어 Amicon 또는 Millipore Pellicon 한외여과 유닛을 사용하여 농축시킨다. 단백분해를 억제하기 위하여 프로테아제 억제제, 예를 들어 PMSF가 임의의 선행 단계에 포함될 수 있고, 우발적인 오염물의 성장을 방지하기 위하여 항생제가 포함될 수 있다. 세포로부터 제조된 항체는 예를 들어 하이드록시아파타이트 크로마토그래피, 겔 전기영동, 투석 및 친화도 크로마토그래피를 사용하여 정제될 수 있고, 본 발명의 항체는 바람직하게는 친화도 크로마토그래피를 통하여 정제할 수 있다.
본 발명은 또한 Wnt3a의 발현 또는 활성을 억제하는 물질; 또는 베타-카테닌(beta-catenin)의 47번 세린(Ser47)의 인산화를 억제하는 물질을 유효성분으로 포함하는 항암제 내성 억제용 약학적 조성물을 제공한다.
본 발명의 일 실시예에 따르면, Wnt3a를 세포에 처리하면 일차섬모를 갖는 세포의 수가 현저히 증가할 뿐 아니라, 섬모의 길이 및 두께도 현저하게 증가하는 것으로 확인되었다. 반대로, siRNA 형질 감염을 통해 내인성 Wnt3a를 결손시키거나, 항-Wnt3a 특이적 항체를 이용하여 Wnt3a를 중화시키면 세포에서 일차섬모의 생성을 현저히 감소시키는 것으로 확인되었다.
또한, 본 발명의 다른 일 실시예에 따르면, 항암제 내성을 나타내는 세포에 Wnt3a를 처리하면 베타-카테닌(beta-catenin)의 47번 세린(Ser47)의 인산화가 현저히 증가되는 것으로 확인되었다.
또한, 본 발명의 다른 일 실시예에 따르면, 항암제 내성을 나타내는 세포에 Wnt3a를 처리하거나 처리하지 않은 상태에서, 항암제를 처리한 결과, Wnt3a를 처리한 세포의 생존율이 처리하지 않은 세포보다 현저히 높은 것으로 나타났다.
이와 같은 결과는, 항암제 내성을 나타내는 암 세포주에 대한 Wnt3a의 자극은 베타-카테닌의 47번 세린(Ser47)의 인산화를 증가시키고, 결과적으로 일차섬모발생에 따른 항암제 내성에 기여하는 것으로 해석된다.
따라서, Wnt3a의 발현 또는 활성을 억제하는 물질; 또는 베타-카테닌(beta-catenin)의 47번 세린(Ser47)의 인산화를 억제하는 물질은 암 세포에서 일차섬모발생을 억제할 수 있고, 결과적으로 암 세포가 항암제에 내성을 나타내는 것을 억제하는 효과를 나타낼 수 있다.
본 발명에서 상기 Wnt3a의 발현을 억제하는 물질은 Wnt3a 유전자의 발현을 조절할 수 있는 물질일 수 있고, 상기 Wnt3a의 활성을 억제하는 물질은 Wnt3a 단백질의 활성을 직접적으로 억제할 수 있는 물질을 포함할 수 있다.
상기 Wnt3a 유전자의 발현을 조절할 수 있는 물질은 이에 제한되는 것은 아니나, Wnt3a 유전자의 mRNA에 상보적으로 결합하는 안티센스 올리고 뉴클레오타이드, siRNA, shRNA, miRNA, 리보자임 및 PNA 중 1이상을 선택하여 포함할 수 있으며, Wnt3a 단백질의 활성을 억제하는 물질은 앱타머, Wnt3a에 특이적으로 결합하는 항체, 펩타이드, 펩타이드 모방체, 기질 유사체 등의 천연물과 화학 물질이 제한 없이 포함될 수 있다.
본 발명에서 상기 "안티센스 올리고뉴클레오타이드"는 특정 mRNA의 서열에 상보적인 핵산 서열을 함유하고 있는 DNA 또는 RNA 또는 이들의 유도체를 의미하고, mRNA내의 상보적인 서열에 결합하여 mRNA의 단백질로의 번역을 저해하는 작용을 한다. 본 발명의 안티센스 서열은 Wnt3a 유전자에 상보적이고 Wnt3a mRNA에 결합할 수 있는 DNA 또는 RNA 서열을 의미하고, Wnt3a mRNA의 번역, 세포질 내로의 전위(translocation), 성숙(maturation) 또는 다른 모든 전체적인 생물학적 기능에 대한 필수적인 활성을 저해할 수 있다. 안티센스 핵산의 길이는 6 내지 100 염기이고, 바람직하게는 8 내지 60 염기이고, 보다 바람직하게는 10 내지 40 염기이다.
본 발명에서 상기 "siRNA"는 RNA 방해 또는 유전자 사일런싱을 매개할 수 있는 핵산 분자를 의미한다. siRNA는 표적 유전자의 발현을 억제할 수 있기 때문에 효율적인 유전자 넉-다운 방법으로서 또는 유전자치료 방법으로 제공된다.
본 발명에서 상기 siRNA 분자는, 센스 가닥(Wnt3a mRNA 서열에 상응하는 서열)과 안티센스 가닥(Wnt3a mRNA 서열에 상보적인 서열)이 서로 반대쪽에 위치하여 이중쇄를 이루는 구조를 가질 수 있다. 또한, 본 발명의 siRNA 분자는, 자기-상보성(self-complementary) 센스 및 안티센스 가닥을 가지는 단일쇄 구조를 가질 수 있다. 바람직한 예시로서, 상기 siRNA 분자는 특히 본 발명의 서열목록 1에 상보적인 뉴클레오타이드 서열을 포함할 수 있다.
본 발명에서 상기 "shRNA(small hairpin RNA 또는 short hairpin RNA)"는 견고한 헤어핀 턴을 만드는 RNA의 서열을 나타내며, 이는 RNA 간섭을 통해 유전자 발현을 억제시키는 데 이용될 수 있다. 통상적으로, shRNA는 세포 도입용 벡터를 이용하며 shRNA를 발현할 수 있는 U6 프로모터를 주로 이용한다. 이러한 벡터는 항상 딸세포로 전달되어 유전자 사일런싱이 유전될 수 있도록 한다. shRNA 헤어핀 구조는 세포 내 기작(machinery)인 siRNA로 분해되어 RNA-유도 사일런싱 복합체(RNA-induced silencing complex)에 결합된다. 상술한 복합체는 이에 결합된 siRNA에 상응하는(matched) mRNA에 결합하여 분해시킨다. shRNA는 RNA 폴리머라제 III에 의해 전사되며, 포유동물 세포에서 shRNA 생산은 세포가 shRNA를 바이러스 공격으로 인식하여 방어 수단을 찾는 것처럼 인터페론 반응을 야기시킬 수도 있다.
본 발명에서 상기 “앱타머”는 소정의 표적 분자에 대한 결합 활성을 갖는 핵산 분자로서, SELEX(systematic evolution of ligands by exponential enrichment)라 불리는 올리고뉴클레오타이드(oligonucleotide) 라이브러리를 이용한 진화적인 방법에 의해 특정 화학 분자나 생물학적 분자에 높은 친화력과 선별력을 갖고 결합하는 올리고머를 분리하여 수득할 수 있다, 앱타머는 소정의 표적 분자에 대하여 결합함으로써, 소정의 표적 분자의 활성을 저해할 수 있다. 본 발명의 앱타머는 RNA, DNA, 수식(modified) 핵산 또는 이들의 혼합물일 수 있으며, 직쇄상 또는 환상의 형태 등 형태에 제한이 없다.
본 발명애서 상기 “항체”는 Wnt3a 단백질의 활성을 억제하는 단일클론항체 또는 다중클론항체일 수 있다. Wnt3a 단백질의 활성을 억제하는 항체는 Wnt3a 단백질에 특이적으로 결합하여 Wnt3a 단백질의 활성을 효과적으로 억제할 수 있다. Wnt3a 단백질에 특이적으로 결합하는 항체는 당업자에게 알려진 공지의 방법에 의해 제조하거나, 또는 상업적으로 이용가능한 항체를 구입하여 사용할 수 있다. 또한, Wnt3a 단백질의 활성을 억제하는 항체는 Wnt3a 단백질에 특이적으로 결합하여 활성을 억제할 수 있는 한, 2개의 중쇄와 2개의 경쇄의 전체 길이를 갖는 완전한 형태 외에도, 항체의 항원 결합 단편을 포함한다.
또한, 본 발명의 Wnt3a 단백질 활성 억제제로서 포함될 수 있는 펩타이드, 펩타이드 모방체, 기질 유사체 등은 모두 Wnt3a 단백질의 특정 도메인을 억제하여 단백질의 활성을 억제하는 것이다. 펩티드 모방체는 펩티드 또는 비펩티드일 수 있고, psi 결합과 같은, 비펩티드 결합에 의해 결합된 아미노산으로 구성될 수 있다. 또한, "구조적으로 강제된(conformationally constrained)" 펩티드, 사이클릭 미메틱스(cyclic mimetics), 적어도 하나의 엑소사이클릭 도메인(exocyclic domain), 결합 부분(결합 아미노산) 및 활성 부위를 포함하는 사이클릭 미메틱스일 수 있다. 펩티드 모방체는 Ttyh1 단백질의 이차구조 특성과 유사하게 구조화되고 항체 또는 수용성 수용체와 같은 거대한 분자의 억제 특성을 모방할 수 있으며, 천연의 길항제와 동등한 효과로 작용할 수 있는 신규한 소분자일 수 있다.
본 발명에서 상기 베타-카테닌(beta-catenin)의 47번 세린(Ser47)의 인산화를 억제하는 물질은 그 종류가 특별히 제한되지 않으며, 예를 들면, 베타-카테닌(beta-catenin)의 47번 세린(Ser47) 상보적으로 결합함으로써 인산화를 억제하거나, 인산화 효소를 두고 기질에 해당하는 베타-카테닌(beta-catenin)의 47번 세린(Ser47)과 경쟁적으로 작용함으로써 인산화를 억제하는 물질일 수 있다.
상기 베타-카테닌(beta-catenin)의 47번 세린(Ser47)에 상보적으로 결합하는 인산화 억제제는 기질 유사체, 화합물, 펩티드, 펩티드 미메틱스, 앱타머 또는 항체 등일 수 있다. 또한, 상기 경쟁적으로 작용하여 인산화를 억제하는 인산화 억제제는 베타-카테닌(beta-catenin) 단백질에서 47번 세린(Ser47)을 포함하는 단편인 폴리펩티드일 수 있다.
상기 "항암제 내성"의 "항암제(anticancer agent 또는 anticancer drug)"는 악성 종양의 축소, 억제, 및 제거를 포함한 치료를 위하여 사용되는 화학물질을 말한다.
상기 항암제는 예를 들어, 알킬화 약물(Alkylating agents), 항대사물질(Antimetabolites), 천연물질, 호르몬 및 그 길항 약물, 표적 치료제, 또는 이들의 조합일 수 있다.
상기 알킬화 약물은 예를 들어, 시스플라틴(Cisplatin), 카르보플라틴(Carboplatin), 옥살리플라틴(Oxaliplatin), 메클로레타민(Mechlorethamine), 사이클로포스파마이드(Cyclophosphamide), 이포스파마이드(Ifosfamide), 멜팔란(Melphalan), 클로람부실(Chlorambucil), 티오테파(Thiotepa), 알트레타민(Altretamine), 프로카바진(Procarbazine), 부술판(Busulfan), 카무스틴(Carmustine, BCNU), 로무스틴(Lomustine, CCNU), 다카르바진(Dacarbazine, DTIC), 또는 이들의 조합을 포함할 수 있다.
상기 항대사물질은 예를 들어, 플루오로우라실(Fluorouracil: 5-FU), 카페시타빈(Capecitabine), 시타라빈(Cytarabine), 젬시타빈(Gemcitabine), 메소트렉세이트(Methotrexate), 메르캅토퓨린(Mercaptopurine: 6-MP), 또는 이들의 조합이다. 상기 천연물질은 예를 들어, 빈블라스틴(Vinblastine), 빈크리스틴(Vincristine), 비노렐빈(Vinorelvine), 파클리탁셀(Paclitaxel), 도세탁셀(Docetaxel), 에토포사이드(Etoposide), 토포테칸(Topotecan), 이리노테칸(Irinotecan), 닥티노마이신(Dactinomycin), 독소루비신(Doxorubicin), 다우노루비신(Daunorubicin), 미토마이신(Mitomycin), 블레오마이신(Bleomycin), 아스파라기나제(L-Asparaginase), 또는 이들의 조합을 포함할 수 있다.
상기 호르몬 및 그 길항 약물은 예를 들어, 미토테인(Mitotane), 아미노글루테티미드(Aminoglutethimide), 프레드니손(Prednisone), 프레드니솔론(Prednisolone), 프로게스틴(Progestin), 에스트로겐(Estrogen), 안드로겐(Androgen), 타목시펜(Tamoxifen), 플루타마이드(Flutamide), 루프로라이드(Leuprolide), 또는 이들의 조합을 포함할 수 있다.
상기 표적 치료제는 예를 들어, 이마티닙(Imatinib), 게피티닙(Gefitinib), 엘로티닙(Erlotinib), 라파티닙(Lapatinib), 수니티닙(Sunitinib), 소라페닙(Sorafenib), 다사티닙(Dasatinib), 닐로티닙(Nilotinib), 토파시티닙(Tofacitinib), 크리조티닙(Crizotinib), 베무라페닙(Vemurafenib), 다브라페닙(Dabrafenib), 트라메티닙(Trametinib), 보르테조밉(Bortezomib), 오파투무맙(Ofatumumab), 알렘투주맙(Alemtuzumab), 트라스투주맙(Trastuzumab), 트라스투주맙 엠탄신(Trastuzumab emtansine, T-DM1), 세툭시맙(Cetuximab), 베바시주맙(Bevacizumab), 리툭시맙(Rituxomab), 파니투무맙(Panitumumab), 이필리무맙(Ipilimumab), 퍼투주맙(Pertuzumab), 또는 이들의 조합을 포함할 수 있다.
상기 "항암제 내성(drug-resistance)"은 항암제 치료 요법에 대하여 극히 낮은 감수성을 나타내어 상기 치료 요법에 의하여 암의 증세가 호전, 완화, 경감 또는 치료증상을 나타내지 않는 증상을 말한다. 항암제 내성은 암이 특정 항암제 치료 요법에 대하여 처음부터 내성을 가질 수 있고, 최초에는 내성을 나타내지 않았으나 긴 시간의 치료로 인하여 암세포의 성질이 변하여 동일한 치료제에 대해 더이상 감수성을 나타내지 않게 되어 나타날 수 있다.
본 발명에서 상기 암은 고형암 또는 비고형암일 수 있다. 고형암은 예를 들어 간, 폐, 유방, 피부 등 장기에 암 종양이 발생한 것을 말한다. 비고형암은 혈액 내에서 발생한 암이고, 혈액암으로도 불린다. 상기 암은 암종(carcinoma), 육종(sarcoma), 조혈세포 유래의 암, 배세포 종양(germ cell tumor), 또는 모세포종(blastoma)일 수 있다. 상기 암은 예를 들어 유방암, 결장직장암, 두경부암, 대장암, 피부암, 췌장암, 폐암, 위암, 난소암, 전립선암, 방광암, 요도암, 간암, 신장암, 투명세포 육종, 흑색종, 뇌척수종양, 뇌암, 흉선종, 중피종, 식도암, 담도암, 고환암, 생식세포종, 갑상선암, 부갑상선암, 자궁 경부암, 자궁 내막암, 림프종, 골수형성이상 증후군(myelodysplastic syndromes: MDS), 골수섬유증(myelofibrosis), 급성 백혈병, 만성 백혈병, 다발성 골수종, 호치킨병(Hodgkin's Disease), 내분비계암, 및 육종으로 이루어진 군으로부터 선택될 수 있다.
본 발명에 따른 약학적 조성물은 Wnt3a의 발현 또는 활성을 억제하는 물질; 또는 베타-카테닌(beta-catenin)의 47번 세린(Ser47)의 인산화를 억제하는 물질만을 포함하거나, 약학적으로 허용되는 담체와 함께 적합한 형태로 제형화 될 수 있으며, 부형제 또는 희석제를 추가로 함유할 수 있다. 상기 담체로는 모든 종류의 용매, 분산매질, 수중유 또는 유중수 에멀젼, 수성 조성물, 리포좀, 마이크로비드 및 마이크로좀이 포함된다.
약학적으로 허용되는 담체로는 예컨대, 경구 투여용 담체 또는 비경구 투여용 담체를 추가로 포함할 수 있다. 경구 투여용 담체는 락토스, 전분, 셀룰로스 유도체, 마그네슘 스테아레이트, 스테아르산 등을 포함할 수 있다. 아울러, 경구투여용으로 사용되는 다양한 약물전달물질을 포함할 수 있다. 또한, 비경구 투여용 담체는 물, 적합한 오일, 식염수, 수성 글루코오스 및 글리콜 등을 포함할 수 있으며, 안정화제 및 보존제를 추가로 포함할 수 있다. 적합한 안정화제로는 아황산수소나트륨, 아황산나트륨 또는 아스코르 브산과 같은 항산화제가 있다. 적합한 보존제로는 벤즈알코늄 클로라이드, 메틸-또는 프로필-파라벤 및 클로로부탄올이 있다. 본 발명의 약학적 조성물은 상기 성분들 이외에 윤활제, 습윤제, 감미제, 향미제, 유화제, 현택제 등을 추가로 포함할 수 있다. 그 밖의 약학적으로 허용되는 담체 및 제제는 공지의 문헌에 기재되어 있는 것을 참고로 할 수 있다.
본 발명의 조성물은 인간을 비롯한 포유동물에 어떠한 방법으로도 투여할 수 있다. 예를 들면, 경구 또는 비경구적으로 투여할 수 있다. 비경구적인 투여방법으로는 이에 한정되지는 않으나, 정맥내, 근육내, 동맥내, 골수내, 경막내, 심장내, 경피, 피하, 복강내, 비강내, 장관, 국소, 설하 또는 직장내 투여일 수 있다.
본 발명의 약학적 조성물은 상술한 바와 같은 투여 경로에 따라 경구 투여용 또는 비경구 투여용 제제로 제형화 할 수 있다.
경구 투여용 제제의 경우에 본 발명의 조성물은 분말, 과립, 정제, 환제, 당의정제, 캡슐제, 액제, 겔제, 시럽제, 슬러리제, 현탁액 등으로 당업계에 공지된 방법을 이용하여 제형화될 수 있다. 예를 들어, 경구용 제제는 활성성분을 고체 부형제와 배합한 다음 이를 분쇄하고 적합한 보조제를 첨가한 후 과립 혼합물로 가공함으로써 정제 또는 당의정제를 수득할 수 있다. 적합한 부형제의 예로는 락토즈, 덱스트로즈, 수크로즈, 솔비톨, 만니톨, 자일리톨, 에리스리톨 및 말티톨 등을 포함하는 당류와 옥수수 전분, 밀 전분, 쌀 전분 및 감자 전분 등을 포함하는 전분류, 셀룰로즈,메틸 셀룰로즈, 나트륨 카르복시메틸셀룰로오즈 및 하이드록시프로필메틸-셀룰로즈 등을 포함하는 셀룰로즈류, 젤라틴, 폴리비닐피롤리돈 등과 같은 충전제가 포함될 수 있다. 또한, 경우에 따라 가교결합 폴리비닐피롤리돈, 한천, 알긴산 또는 나트륨 알기네이트 등을 붕해제로 첨가할 수 있다. 나아가, 본 발명의 약학적 조성물은 항응집제, 윤활제, 습윤제, 향료, 유화제 및 방부제 등을 추가로 포함할 수 있다.
비경구 투여용 제제의 경우에는 주사제, 크림제, 로션제, 외용연고제, 오일제, 보습제, 겔제, 에어로졸 및 비강 흡입제의 형태로 당업계에 공지된 방법으로 제형화할 수 있다. 이들 제형은 모든 제약 화학에 일반적으로 공지된 문헌에 기재되어 있다.
본 발명의 조성물의 총 유효량은 단일 투여량(single dose)으로 환자에게 투여될 수 있으며, 다중 투여량(multiple dose)으로 장기간 투여되는 분할 치료 방법(fractionated treatment protocol)에 의해 투여될 수 있다. 본 발명의 약학적 조성물은 질환의 정도에 따라 유효성분의 함량을 달리할 수 있다. 바람직하게 본 발명의 약학적 조성물의 바람직한 전체 용량은 1일당 환자 체중 1㎏ 당 약 0.01㎍ 내지 10,000mg, 가장 바람직하게는 0.1㎍ 내지 500mg일 수 있다. 그러나 상기 약학적 조성물의 용량은 제제화 방법, 투여 경로 및 치료 횟수뿐만 아니라 환자의 연령, 체중, 건강 상태, 성별, 질환의 중증도, 식이 및 배설율등 다양한 요인들을 고려하여 환자에 대한 유효 투여량이 결정되는 것이므로, 이러한 점을 고려할 때 당 분야의 통상적인 지식을 가진 자라면 본 발명의 조성물의 적절한 유효 투여량을 결정할 수 있을 것이다. 본 발명에 따른 약학적 조성물은 본 발명의 효과를 보이는 한 그 제형, 투여 경로 및 투여 방법에 특별히 제한되지 아니한다.
본 발명은 또한 47번 세린(Ser47)이 인산화된 베타-카테닌(beta-catenin)에 특이적으로 결합하는 항체 또는 이의 항원 결합 단편을 유효성분으로 포함하는 항암제 내성 억제용; 또는 섬모 이상증(ciliopathy) 예방 또는 치료용 약학적 조성물을 제공한다.
본 발명의 일 실시예에 따르면, 47번 세린(Ser47)이 인산화된 베타-카테닌은 세포의 일차섬모발생 과정에서 필수적으로 관여하며, 베타-카테닌의 47번 세린의 인산화가 증가한 세포에서 세포의 섬모화 비율, 섬모의 길이 및 섬모의 두께가 모두 현저히 증가하는 것으로 확인된 바 있다. 세포에서 일차섬모가 비정상적으로 발달하는 섬모 이상증이 다양한 질환의 발병과 밀접하게 관련되어 있고, 암의 항암제 내성에도 영향을 미치는 것으로 보고되고 있다. 따라서, 47번 세린이 인산화된 베타-카테닌에 특이적으로 결합하는 항체는 일차섬모의 비정상적인 발생에 관여하는 하위 신호전달을 차단함으로써 항암제 내성; 또는 섬모 이상증을 효과적으로 제어할 수 있다.
본 발명에서 상기 47번 세린(Ser47)이 인산화된 베타-카테닌(beta-catenin)에 특이적으로 결합하는 항체 또는 이의 항원 결합 단편에 대해서는 전술한 바가 참고될 수 있다.
본 발명에서 상기 항암제 내성에 대해서는 전술한 바가 참고될 수 있다.
본 발명에서 상기 섬모 이상증은 일차섬모의 구조적 또는 기능적 이상으로 나타나는 다양한 질환을 포함한다. 바람직하게는, 상기 섬모 이상증은 일차섬모의 비정상적인 발현에 의해 유발되는 질환을 의미한다. 상기 일차섬모의 비정상적인 발현은 일차섬모의 저발현, 과발현 및 일차섬모 두께/길이의 비정상적인 변화를 포함하며, 바람직하게는 일차섬모의 과발현 및 일차섬모 두께/길이의 비정상적인 증대를 의미하는 것일 수 있다.
일차섬모는 외부에서 오는 다양한 감각(시각, 후각, 청각, 운동 감각, 삼투압 등)을 감지하는데 중요한 역할을 하고, 세포 내 중요한 신호전달과정이 일차섬모를 매개로 일어난다. 따라서, 일차섬모의 비정상적인 발현은 다양한 질환을 매개할 수 있다.
본 발명에서 상기 섬모 이상증은 일차섬모의 비정상적인 발현으로 유발되는 질환이라면 그 종류가 특별히 제한되지 않으며, 이의 비제한적인 예시로 소뇌와 뇌간(brain stem)의 발달기형, 신장질환, 망막퇴화, 후각상실, 다지증(polydactyly), 비만, 지적장애, 알스트롬 증후군(Alstrom syndrome), 다낭성 신장질환(polycystic kidney disease), 바뎃-비들 증후군(Bardet-Biedl syndrome), 신장 낭종, 불임, 호흡기질환, 내장역위증(situs inversus) 및 고혈압을 포함한다.
본 발명은 또한 베타-카테닌(beta-catenin)의 47번 세린(Ser47)의 인산화 수준을 측정하는 제제를 포함하는 항암제 내성 진단용 조성물을 제공한다.
본 발명의 일 실시예에 따르면, 베타-카테닌(beta-catenin)의 47번 세린(Ser47)의 인산화가 증가되면 항암제 내성을 나타내는 세포에서 섬모화된 세포의 비율이 증가하고, 일차섬모의 길이도 길어지는 것으로 확인되었다.
또한, 본 발명의 다른 일 실시예에 따르면, 항암제 내성을 나타내는 세포에 대한 Wnt3a 자극에 의해 베타-카테닌(beta-catenin)의 47번 세린(Ser47)의 인산화가 증가되면, 항암제 내성이 증가하여 암 세포의 사멸이 현저히 감소되는 것으로 확인되었다.
즉, 환자로부터 제공된 생물학적 시료에서 베타-카테닌(beta-catenin)의 47번 세린(Ser47)의 인산화 수준을 측정한 결과, 정상 대조군과 비교하여 특정 환자의 생물학적 시료에서 베타-카테닌(beta-catenin)의 47번 세린(Ser47) 인산화 수준이 증가되어 있었다면 상기 환자는 항암제 내성을 나타낼 것이라고 진단할 수 있다.
본 발명에서 상기 베타-카테닌(beta-catenin)의 47번 세린(Ser47)의 인산화 수준을 측정하는 제제는 47번 세린이 인산화된 베타-카테닌에 특이적으로 결합하는 항체, 이의 항원 결합 단편, 또는 압타머일 수 있다.
바람직하게는, 본 발명에서 상기 베타-카테닌(beta-catenin)의 47번 세린(Ser47)의 인산화 수준을 측정하는 제제는 서열번호 2로 표시되는 항원결정부(epitope)에 특이적으로 결합하는 것을 특징으로 하는 항체 또는 이의 항원 결합 단편일 수 있다.
더 바람직하게는, 본 발명에서 상기 베타-카테닌(beta-catenin)의 47번 세린(Ser47)의 인산화 수준을 측정하는 제제는 서열번호 3으로 표시되는 아미노산 서열을 포함하는 중쇄 상보성 결정부위(CDR)1, 서열번호 4 표시되는 아미노산 서열을 포함하는 중쇄 CDR2 및 서열번호 5로 표시되는 아미노산 서열을 포함하는 중쇄 CDR3을 포함하는 중쇄가변영역; 및 서열번호 6으로 표시되는 아미노산 서열을 포함하는 경쇄 CDR1, 서열번호 7로 표시되는 아미노산 서열을 포함하는 경쇄 CDR2 및 서열번호 8로 표시되는 아미노산 서열을 포함하는 경쇄 CDR3을 포함하는 경쇄가변영역을 포함하는 항체 또는 이의 항원 결합 단편일 수 있다.
가장 바람직하게는, 본 발명에서 상기 베타-카테닌(beta-catenin)의 47번 세린(Ser47)의 인산화 수준을 측정하는 제제는 서열번호 9로 표시되는 아미노산 서열을 포함하는 중쇄가변영역; 및 서열번호 10으로 표시되는 아미노산 서열을 포함하는 경쇄가변영역을 포함하는 것을 특징으로 하는 항체 또는 이의 항원 결합 단편일 수 있다.
본 발명은 또한 베타-카테닌(beta-catenin)의 47번 세린(Ser47)의 인산화 수준을 측정하는 제제를 포함하는 항암제 내성 진단용 키트를 제공한다.
본 발명의 항암제 내성 진단용 키트에는 베타-카테닌(beta-catenin)의 47번 세린(Ser47)의 인산화 수준을 측정하기 위하여 선택적으로 47번 세린(Ser47)이 인산화된 베타-카테닌(beta-catenin)에 결합하는 항체 또는 앱타머 뿐만 아니라 분석 방법에 적합한 한 종류 또는 그 이상의 다른 구성 성분 조성물, 용액 또는 장치가 포함될 수 있다. 구체적인 양태로서 상기 키트는 웨스턴 블랏, ELISA, 방사선면역분석, 방사선 면역 확산법, 오우크테로니 면역 확산법, 로케트 면역전기영동, 면역염색법, 면역침전 분석법, 보체 고정 분석법, FACS 또는 단백질 칩 방법을 수행하기 위해 필요한 공지의 필수요소 및 부수 요소를 포함하는 것을 특징으로 하는 진단 키트일 수 있으나, 이에 제한되지 않는다.
일례로, 상기 키트는 47번 세린(Ser47)이 인산화된 베타-카테닌(beta-catenin)에 특이적인 항체를 포함한다. 상기 항체는 47번 세린(Ser47)이 인산화된 베타-카테닌(beta-catenin)에 대한 특이성 및 친화성이 높고 다른 단백질에 대한 교차 반응성이 거의 없는 항체로, 단클론 항체, 다클론 항체 또는 재조합 항체이다. 또한 상기 키트는 대조군 단백질에 특이적인 항체를 포함할 수 있다. 키트에 제공되는 항체는 그 자체로서 검출가능한 모이어티로 표지될 수 있으며, 이는 전술한 바와 같다. 그 외 상기 키트는 결합된 항체를 검출할 수 있는 별도의 시약, 예를 들면, 표지된 2차 항체, 발색단(chromophores), 효소(항체와 컨주게이트된 형태로서) 및 그의 기질 또는 항체와 결합할 수 있는 다른 물질 등을 포함할 수 있다. 또한, 본 발명의 키트는 잉여의 발색 기질 및 결합되지 않은 단백질 등은 제거하고 항체와 결합된 단백질 마커만을 보유할 수 있는 세척액 또는 용리액을 포함할 수 있다.
본 발명에서 제공하는 상기 키트에 포함될 수 있는 바람직한 항체는 본 발명이 제공하는 전술한 항체일 수 있다.
본 발명은 또한 (a) 암 환자로부터 제공된 생물학적 시료에서 베타-카테닌(beta-catenin)의 47번 세린(Ser47)의 인산화 수준을 측정하는 단계; (b) 상기 베타-카테닌의 47번 세린의 인산화 수준이 정상 대조군보다 높을 경우 항암제 내성으로 진단하는 단계를 포함하는, 항암제 내성 진단을 위한 정보를 제공하는 방법을 제공한다.
본 발명의 상기 (a) 단계에서 생물학적 시료란 전혈, 혈장, 혈구, 혈청, 혈관 내피세포, 신경세포, 뇌척수액, 타액, 비액, 객담, 관절낭액, 양수, 복수, 자궁경부 분비물, 질 분비물 및 소변으로 이루어진 군에서 선택될 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 상기 (a) 단계에서 상기 베타-카테닌의 47번 세린의 인산화 수준을 측정하는 방법은 방사선자동사진법, 액체섬광계수(liquid scintillation counting)법, 분자량 분석법, 액체 색층 분석 매스 분석법, 웨스턴 블롯, ELISA, 방사선면역분석법, 방사면역확산법, 오우크레로니(Ouchterlony) 면역확산법, 로케트 면역전기영동, 면역형광염색법, 면역조직화학염색, 면역침전분석, 보체고정분석, FACS 및 단백질 칩으로 이루어진 군에서 선택될 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 상기 (b) 단계에서는 상기 (a) 단계의 방법으로 측정한 피검체의 베타-카테닌(beta-catenin)의 47번 세린(Ser47)의 인산화 수준을, 동일한 방법으로 측정한 정상인의 그것과 비교한다. 베타-카테닌(beta-catenin)의 47번 세린(Ser47)의 인산화 수준이 건강한 정상인에 비하여 증가되어 있는 피검체는 항암제 내성을 나타내는 환자인 것으로 판단할 수 있다.
본 발명은 또한 (a) 시험물질을 베타-카테닌(beta-catenin)을 발현하는 세포 또는 조직과 접촉시키는 단계; (b) 상기 시험물질이 접촉된 세포 또는 조직에서 베타-카테닌의 47번 세린(Ser47)의 인산화 수준을 측정하는 단계; 및 (c) 상기 시험물질이 접촉되지 않은 세포 또는 조직에서의 베타-카테닌의 47번 세린의 인산화 수준을 측정하여, 상기 (b) 단계에서 측정된 베타-카테닌의 47번 세린의 인산화 수준이 감소된 시험물질을 선별하는 단계를 포함하는, 항암제 내성 억제제 스크리닝 방법을 제공한다.
본 발명 스크리닝 방법을 언급하면서 사용되는 용어 “시험물질”은 베타-카테닌의 47번 세린(Ser47)의 인산화 수준에 영향을 미치는지 여부를 검사하기 위하여 스크리닝에서 이용되는 미지의 물질을 의미한다. 상기 시험물질은 siRNA(small interference RNA), shRNA(short hairpin RNA), miRNA(microRNA), 리보자임(ribozyme), DNAzyme, PNA(peptide nucleic acids), 안티센스 올리고뉴클레오타이드, 항체, 앱타머, 천연추출물 또는 화학물질을 포함하나, 이에 제한되는 것은 아니다.
또한, 상기 (a) 단계에서 사용되는 세포는 실험동물의 형태로 제공될 수 있으며, 이 경우 시험물질과의 접촉은 비경구 또는 경구투여, 정위주사를 포함하나, 이로 제한하는 것은 아니며, 당업자라면 시험물질을 동물에게 테스트하기 위해 적절한 방법을 선택할 수 있을 것이다.
시험물질을 처리하는 것은 시험물질을 세포 또는 조직 배양 배지에 추가한 후 세포를 일정 시간 배양하는 것을 의미한다. 상기 세포가 실험동물 형태로 제공될 때, 시험물질과의 접촉은 비경구 또는 경구 투여, 정위주사를 포함하는 이로 제한되는 것은 아니며, 당업자라면 시험물질을 동물에게 테스트하기 위해 적절한 방법을 선택할 수 있을 것이다.
상기 (b) 단계에서 상기 베타-카테닌의 47번 세린의 인산화 수준을 측정하는 방법은 방사선자동사진법, 액체섬광계수(liquid scintillation counting)법, 분자량 분석법, 액체 색층 분석 매스 분석법, 웨스턴 블롯, ELISA, 방사선면역분석법, 방사면역확산법, 오우크레로니(Ouchterlony) 면역확산법, 로케트 면역전기영동, 면역형광염색법, 면역조직화학염색, 면역침전분석, 보체고정분석, FACS 및 단백질 칩으로 이루어진 군에서 선택될 수 있으나, 이에 제한되는 것은 아니다.
상기 (c) 단계에서는 상기 시험물질이 접촉되지 않은 세포 또는 조직에서의 베타-카테닌의 47번 세린의 인산화 수준을 측정하여, 상기 (b) 단계에서 측정된 베타-카테닌의 47번 세린의 인산화 수준이 감소된 시험물질을 항암제 내성 억제제 후보물질로 선택할 수 있다.
또한, 본 발명은 항암제 내성 억제를 위한 약학적 제제를 제조하기 위한 Wnt3a의 발현 또는 활성을 억제하는 물질; 또는 베타-카테닌(beta-catenin)의 47번 세린(Ser47)의 인산화를 억제하는 물질의 용도를 제공한다.
또한, 본 발명은 Wnt3a의 발현 또는 활성을 억제하는 물질; 또는 베타-카테닌(beta-catenin)의 47번 세린(Ser47)의 인산화를 억제하는 물질을 유효성분으로 포함하는 조성물의 유효량을 이를 필요로 하는 개체에 투여하는 것을 포함하는 항암제 내성 억제 방법을 제공한다.
본 발명의 상기 '유효량'이란 개체에게 투여하였을 때, 항암제 내성 억제에 효과를 나타내는 양을 말하며, 상기 '개체'란 동물, 바람직하게는 포유동물, 특히 인간을 포함하는 동물일 수 있으며, 동물에서 유래한 세포, 조직, 기관 등일 수도 있다. 상기 개체는 상기 효과가 필요한 환자(patient) 일 수 있다.
또한, 본 발명은 항암제 내성 진단용 제제를 제조하기 위한 베타-카테닌(beta-catenin)의 47번 세린(Ser47)의 인산화 수준을 측정하는 제제의 용도를 제공한다.
또한, 본 발명은 (a) 암 환자로부터 제공된 생물학적 시료에서 베타-카테닌(beta-catenin)의 47번 세린(Ser47)의 인산화 수준을 측정하는 단계; (b) 상기 베타-카테닌의 47번 세린의 인산화 수준이 정상 대조군보다 높을 경우 항암제 내성으로 진단하는 단계를 포함하는, 항암제 내성 진단 방법을 제공한다.
하나의 실시양태에서, 본 발명은 하기 단계를 포함하는 항암제 내성 진단 진단 및 항암제 내성을 억제하는 방법을 제공한다:
(a) 암 환자로부터 제공된 생물학적 시료에서 베타-카테닌(beta-catenin)의 47번 세린(Ser47)의 인산화 수준을 측정하는 단계;
(b) 상기 베타-카테닌의 47번 세린의 인산화 수준이 정상 대조군보다 높을 경우 항암제 내성으로 진단하는 단계; 및
(c) 상기 진단된 환자에 항암제 내성을 억제하는 약물을 투여하거나 수술을 통해 항암제 내성을 억제하는 단계.
상기 (c) 단계는 상기 (b) 단계에서 항암제 내성이 진단된 개체에 항암제 내성 억제 약물의 투여 또는 수술 등의 수단을 통해 항암제 내성 억제를 수행하는 단계이다.
상기 '항암제 내성 억제 약물'은 통상적으로 항암제 내성을 억제하기 위해 사용되는 약물 종류라면 그 종류가 특별히 제한되지 않는다. 또한 상기 약물은 '치료학적으로 유효한 양'으로 개체에 투여되며, 상기 치료학적으로 유효한 양은 당업자가 약물의 고유성질, 투여 경로 및 치료 횟수뿐만 아니라 환자의 연령, 체중, 건강 상태, 성별, 질환의 중증도, 식이 및 배설율 등 다양한 요인들을 고려하여 환자에 대한 유효 투여량을 결정할 수 있다. 상기 치료 약물의 투여 경로는 특별히 제한되지 않으며, 경구 또는 비경구적으로 투여되는 것일 수 있으며, 국소적 투여뿐만 아니라 전신적 경로의 투여를 모두 포함한다. 상기 비경구적 투여는, 이에 제한되지 않으나, 일례로 비강내 약물 도포, 피하주사 등일 수 있으며, 또 다른 일례로 근육내 주사, 정맥 주사 등의 방법을 사용하는 것일 수 있다.
본 발명의 상기 '생물학적 시료'는 항암제 내성이 의심되는 개체로부터 분리 수득되는 것으로서, 이에 제한되지는 않으나, 세포, 조직, 혈액, 혈청, 혈장, 타액, 점막액 및 뇨로 이루어진 군에서 선택될 수 있으며, 상기'개체'란 동물, 바람직하게는 포유동물, 특히 인간을 포함하는 동물일 수 있으며, 동물에서 유래한 세포, 조직, 기관 등일 수도 있다. 상기 개체는 상기 치료 효과가 필요한 환자(patient) 일 수 있다.
본 발명은 또한 47번 세린(Ser47)이 인산화된 베타-카테닌(beta-catenin)에 특이적으로 결합하는 항체 또는 이의 항원 결합 단편을 유효성분으로 포함하는 연구용 조성물 및/또는 키트를 제공한다.
상기 연구용이란 in vitro, in vivo, in situ 연구에 활용되는 것을 모두 포함하며, 바람직하게는 in vitro 연구용, 보다 더 바람직하게는 면역염색실험(immunostaining analysis) 연구용일 수 있다.
본 발명에서 상기 47번 세린(Ser47)이 인산화된 베타-카테닌(beta-catenin)에 특이적으로 결합하는 항체 또는 이의 항원 결합 단편에 대해서는 전술한 바가 참고될 수 있다.
본 발명의 일 실시예에 따르면, 본 발명이 제공하는 47번 세린(Ser47)이 인산화된 베타-카테닌(beta-catenin)에 특이적으로 결합하는 항체를 이용하여 세포에서 47번 세린이 인산화된 베타-카테닌을 면역염색하고, 초고해상도현미경을 이용해 관찰한 결과, 베타-카테닌의 세포 내 위치가 매우 정확하게 확인된 바 있다. 따라서, 본 발명이 제공하는 항체를 이용하면 기존에 알려져 있지 않은 베타-카테닌의 새로운 세포 내 위치를 매우 정확하게 동정할 수 있어 베타-카테닌과 관련된 다양한 연구 분야에서 매우 유용하게 활용될 수 있다.
본 발명의 용어 '~을 포함하는(comprising)'이란 '함유하는' 또는 '특징으로 하는'과 동일하게 사용되며, 조성물 또는 방법에 있어서, 언급되지 않은 추가적인 성분 요소 또는 방법 단계 등을 배제하지 않는다. 용어 '~로 구성되는(consisting of)'이란 별도로 기재되지 않은 추가적인 요소, 단계 또는 성분 등을 제외하는 것을 의미한다. 용어 '필수적으로 구성되는(consisting essentially of)'이란 조성물 또는 방법의 범위에 있어서, 기재된 성분 요소 또는 단계와 더불어 이의 기본적인 특성에 실질적으로 영향을 미치지 않는 성분 요소 또는 단계 등을 포함하는 것을 의미한다.
본 발명은 세포에서 일차섬모발생에 직접적으로 관여하는, 베타-카테닌(beta-catenin)의 47번 세린(Ser47)의 인산화 수준을 측정할 수 있는 신규한 항체 및 이의 용도를 제공하며, 또한 본 발명은 베타-카테닌(beta-catenin)의 47번 세린(Ser47)의 인산화 수준을 측정함으로써 일차섬모에 의한 암 세포의 항암제 내성을 진단하거나, 항암제 내성 억제제를 스크리닝 하는 방법을 제공할 수 있어 암의 진단 및 치료에 매우 유용하게 활용될 수 있다.
도 1a 내지 1i를 포함하는 도 1은 Wnt의 표준적인 리간드인 Wnt3a가 hTERT-RPE 세포에서 일차섬모발생을 촉진한다는 것을 확인한 결과이다.
도 2a 내지 2d를 포함하는 도 2는 Wnt의 표준적인 리간드인 Wnt3a가 hTERT-RPE 세포에서 일차섬모발생을 촉진한다는 것을 확인한 결과이다.
도 3a 내지 3c를 포함하는 도 3은 beta-카테닌 또는 CK1δ의 결손에 의해 일차섬모발생이 심각하게 손상된다는 것을 확인한 결과이다.
도 4는 정제된 GST-CK1δ 및 GST-beta-카테닌을 사용한 시험관내 키나제 분석 결과, CK1δ 키나제 활성에 의한 beta-카테닌의 강한 특이적 인산화 신호가 관찰된다는 것을 확인한 결과이다.
도 5a 내지 5f를 포함하는 도 5는 CK1δ키나제 활성에 의한 beta-카테닌 세린47(Ser47) 잔기의 인산화가 일차섬모발생에 매우 중요한 역할을 한다는 것을 확인한 결과이다.
도 6a 내지 6f를 포함하는 도 6은 Wnt3에 의해 유도된 CK1δ키나제 활성화가 beta-카테닌 세린47(Ser47) 잔기의 인산화를 촉진한다는 것을 확인한 결과이다.
도 7a 내지 7e를 포함하는 도 7은 Wnt3에 의해 유도된 세린47(Ser47) 잔기가 인산화된 beta-카테닌의 중심소체성 위치화가 일차섬모발생을 촉진한다는 것을 확인한 결과이다.
도 8a 내지 8d를 포함하는 도 8은 표준적인 Wnt 리간드인 Wnt3a의 자극은 중심소체위성의 주변중심소체 영역으로의 모집을 촉진한다는 것을 확인한 결과이다.
도 9a 내지 9j를 포함하는 도 9는 중심소체위성의 중심소체성 모집은 beta-카테닌의 세린47(Ser47) 잔기 인산화에 의존적이라는 것을 확인한 결과이다.
도 10a 내지 10i를 포함하는 도 10은 다약제-내성 종양 세포 모델인 MCF-7/ADR 세포주에서 Wnt3a 의존적인 일차섬모발생을 확인한 결과이다.
도 11a 내지 11c를 포함하는 도 11은 다약제-내성 종양 세포 모델인 MCF-7/ADR 세포주에 Wnt3a를 처리하면 세포가 항암제인 독소루비신에 내성을 나타낸다는 것을 확인한 결과이다.
이하, 본 발명을 하기 실시예에 의해 상세히 설명한다. 단, 하기 실시예는 본 발명을 예시하기 위한 것일 뿐, 본 발명이 이들에 의해 제한되는 것은 아니다.
실험방법
1. 플라스미드 제작 및 돌연변이 유발
beta-카테닌 야생형 형태를 발현하는 마우스(WT) 또는 다양한 돌연변이 형태 [각각의 절단체('T'돌연변이체) 및 알라닌/아스파르트산 치환 돌연변이체 ("A"/"D"돌연변이체)]는 pcDNA-FLAG의 BamI-NotI 위치 내에 서브클론되거나, 또는 pHR'-CMV-SV-puro의 SaIl 위치에 서브클론하여 제작하였다.
각각의 전장 A/D 돌연변이체 및 절단 단편은 pCDNA3-Flag-beta-카테닌 WT 및 pEGFP-C1-beta-카테닌 WT를 사용하여 PCR에 의해 생성되었다. 마우스 CK1δ 또는 CK1ε의 발현 작제물은 종래 공지된 방법에 따라 생성하였다.
beta-카테닌, shRNA-발현 렌티바이러스 작제물(sh1746)을 생성하기 위해, 인간 beta-카테닌으로부터 어닐링 된 뉴클레오티드 1746-1769 (수탁 번호 BC058926) 오픈 리딩 프레임 ( forward: 5′-CCGG GGATGTTCACAACCGAATTGTTATGCTAGC　 ATAACAATTCGGTTGTGAACATCCTTTTTG-3′ 및 reverse: 5′-AATTCAAAAA GGATGTTCACAACCGAATTGTTATGCTAGC ATAACAATTCGGTTGTGAACATCC-3′표적화 서열은 밑줄로 표시됨)는 pLKO.1-puro 벡터의 AgeI-EcoRI 위치 내에 서브클로닝 되었다.
beta-카테닌 sh1746 RNA (인간 beta-카테닌 서열을 기초로 함)의 침묵 효과에 대해 내성이 있는 마우스 beta-카테닌 플라스미드 작제물은 3개의 상이한 뉴클레오티드 (5'-ggacgttcacaaccggattgtaat -3 ')를 포함한다. 모든 돌연변이체는 PCR-기반 부위-지정 돌연변이 유발을 사용하여 생성되었다. shGL (CGTACGCGGAATACTTCGA) 및 shCK1δ (AGGCTACCCTTCCGAATTT)의 표적서열은 sh-카테닌과 동일한 방식으로 pLKO.1- puro 벡터로 서브클로닝되었다.
2. 형질감염
플라스미드 및 siRNA를 제조사의 지시에 따라 X-tremeGENE HP DNA 형질 감염 시약 (Roche) 또는 리포펙타민 2000(Invitrogen)을 사용하여 상응하는 세포에 형질감염시켰다.
3. 렌티바이러스 생성 및 감염
shRNA 렌티 바이러스를 생성하기 위해, pLKO.1-puro-sh루시퍼라제　(shGL),　 -sh 2. 형질감염
플라스미드 및 siRNA를 제조사의 지시에 따라 X-tremeGENE HP DNA 형질 감염 시약 (Roche) 또는 리포펙타민 2000(Invitrogen)을 사용하여 상응하는 세포에 형질감염시켰다.
3. 렌티바이러스 생성 및 감염
shRNA 렌티 바이러스를 생성하기 위해, pLKO.1-puro-sh루시퍼라제　(shGL),　-shbeta-카테닌, 또는　-shCK1δ　작제물을 pHR'-CMV-VSV-G　(protein G of vesicular stomatitis virus) 및 pHR′-CMVΔR8.2Δvpr와 HEK293T 세포에 공동 형질감염시켰다. 렌티바이러스를 발현하는 단백질을 생성하기 위해, pHR'- CMV-SV-puro-벡터,　pHR′-CMV-SV-puro-벡터-beta-카테닌 wild-type R　(R,　sh1746-저항성 마우스　beta-카테닌),　S45A R, S47A R, T217A R,　또는　S47D R　작제물을 pHR’-CMV-VSV-G 및 pHR′-CMVΔR8.2Δvpr와 함께 HEK293T 세포에 공동 형질감염시켰다. 세포를 하루 동안 각각의 렌티 바이러스로 감염시키고 퓨로마이신 처리 (4~20㎍/ml, 2~3일)로 선택하였다.
4. 면역침강 및 면역블롯팅 분석
면역침강법은 종래 공지된 바와 같이 수행되었다. 간략하게, 1 x PBS로 수확된 hTERT-RPE 세포를 1 x TBSN 완충액 [20 mM Tris-Cl (pH 8.0), 0.5% NP-40, 150mM NaCl, 1.5mM EDTA, 5mM EGTA, 10mg/ml pNPP (p- 니트로페닐포스페이트; Sigma) 및 프로테아제 억제제 칵테일]에 용해시켰다. 이어서, 총 세포 용해물을 4 ℃에서 20분 동안 15,000g에서 원심분리 하였다. 투명 세포 용해물을 4 ℃에서 4 내지 6시간 동안 지시된 항체와 함께 인큐베이션 한 후, 항체를 4 ℃에서 추가 3 간 동안 단백질 A 또는 G- 세파로스비드에 결합시켰다. 짧은 원심분리로 비드를 침전시키고 1 x TBSN으로 4 회 이상 세척하였다. 생성된 비드에 2 x Laemmli 샘플 완충액 [120 mM Tris-Cl (pH 6.8), 4 % SDS, 20 % 글리세롤, 10 % 2-머캅토 에탄올 및 0.02% 브로모페놀블루]을 첨가하고 95 내지 100℃에서 15 분 동안 끓였다. 생성된 샘플을 SDS-PAGE에 적용하였다.
면역 침전물을 6 내지 12% SDS-PAGE으로 분리하고 PVDF 막으로 옮겼다. 막을 실온에서 2 내지 4시간 동안(또는 4℃에서 밤새) 1차 항체와 실온에서 추가로 1시간 동안 HRP-접합된 2차 항체와 순차적으로 인큐베이션 하였다. 이어서, 막을 3 회 이상 1 x TBST [(50 mM 트리스-Cl (pH 7.5), 0.05 % 트윈 20, 150 mM NaCl)]로 광범위하게 세척하였다. 면역 반응성 신호는 ECL 검출 시스템으로 검출했다.
5. 항체 제작
토끼 폴리클로날 항-beta-카테닌 인산화-Ser47(p-S47) 항체는 합성 인산화-펩타이드, NH2-TAPSL-pS-GKGN-C-COOH(42 ~ 51 아미노산) (AbFRONTIER Inc., 서울)의 투여에 의해 생성되었다. 면역화한 토끼 혈청을 친화성 크로마토그래피로 정제하고, 항-beta-카테닌 p-S47 항체의 생산을 ELISA 면역시험으로 모니터링 하였다. 항-beta-카테닌 p-S47 항체의 특이성을 위해, 5μg 내지 10μg/ml 비-인산화 펩티드를 항체 용액에 첨가하였다.
CTNB1-p-S47 하이브리도마 세포주로부터 RNA prep.을 진행한 다음 cDNA 합성 후에 경쇄와 중쇄의 가변 영역 유전자를 PCR 증폭하였다. PCR 증폭된 경쇄와 중쇄의 가변 영역 유전자는 T-vector cloning한 후 sequencing 분석을 통해 서열을 확인하였다. 확인된 서열은 Kabat numbering 방법으로 CDR을 표시하여 정리하였다.
6. In vitro 키나제 어세이, 면역 침전-키나제 어세이, 및 Mass spectrometry 분석
In vitro 키나제 분석을 위해, 대장균 BL21에서 이소프로필 beta-d-1-티오 갈락토피라노시드(IPTG) 유도로 GST-beta-카테닌 WT, GST-beta-카테닌의 다양한 알라닌 치환 돌연변이체 및 GST-CK1delta -WT를 발현시켰다. 이어서 글루타티온 (GSH)-아가로스로 정제하였다. In vitro 키나제 반응을 키나제 칵테일 [50 mM Tris-Cl (pH 7.5), 10 mM MgCl2, 2 mM EGTA, 5 mM 디티오트레이톨, 10 mg/ml pNPP (p-니트로페닐포스페이트; Sigma) 및 프로테아제-저해제 칵테일], 10μM cold-ATP 및 10μCi [gamma- 32P]ATP와 함께 30℃에서 30분 동안 수행하였다. 생성된 샘플을 SDS-PAGE에 적용하였다.
면역 침전(IP)-키나제 분석을 위해, Myc-태그된 mCK1δ로 형질감염된 hTERT-RPE 세포를 6시간 동안 굶주린 후, 대조군- 또는 Wnt3a-CM(conditioned medium)로 추가로 24 시간 동안 자극하였다. 이후 세포를 수확하고 항-Myc 항체로 면역 침전시켰다. 면역 침전물을 상기 기재된 바와 같이 키나제 칵테일에서 in vitro 키나제 분석에 적용하였다.
CK1δ 반응에 의한 in vitro beta-카테닌 인산화 부위를 확인하기 위해, in vitro 키나제 분석을 방사성 동위원소의 부재하에 상기 기재된 바와 같이 수행하였다. 생성된 샘플을 SDS-PAGE에 적용한 후, 겔을 제조사의 지시에 따라 GelCode Blue Stain Reagent로 염색했다. GST-beta-카테닌 밴드를 겔로부터 절제하고 트립신으로 겔 내에서 소화시켰다. 생성된 샘플에 대해 종래 공지된 방법에 따라 질량 분석법을 수행하였다.
7. 혈청-결핍에 기초한 섬모발생 어세이 및 면역형광 어세이
혈청 결핍 기반의 섬모발생 어세이, 섬모가 있는 세포의 수, 일차섬모의 길이/두께의 측정은 본질적으로 종래 공지된 방법에 따라 수행했다. 간략하게, 12개의 배양 웰에서 24 시간 동안 커버 슬립에서 배양된 hTERT-RPE 또는 MCF-7/ADR 세포를 1 x PBS로 3회 세척한 다음 DMEM 단독 배지에서 6시간 동안 배양하였다. 세포를 추가로 48 시간 동안 대조군/Wnt3a CM으로 처리하였다. 일차섬모를 관찰하기 위해, 생성된 세포를 이전에 기재된 바와 같이 항-아세틸 화된 α- 튜불린 항체(Sigma, 1 : 200) 및 항-gamma-튜불린 항체(Sigma, 1 : 200)와 공동 면역화시켰다.
일차섬모 함유 세포를 Nikon Eclipse ti-u 역 형광현미경 또는 Zeiss AxioObserver Z1 현미경으로 수동으로 계수하였다. 일차섬모의 길이 또는 두께를 측정하기 위해, 1388 X 1040 픽셀 및 12 비트 해상도에서 Zeiss AxioObserver Z1 현미경으로 이미지를 획득하고, ZEN v2.1소프트웨어로 분석하였다.
beta-카테닌 인산화-Ser47(p-S47) 및 중심소체위성(centriolar satellites)의 중심체성 위치화를 검출하기 위해, hTERT-RPE 또는 MCF-7/ADR 세포를 실온에서 10분 동안 4% 파라포름알데히드로 고정한 다음, -20℃의 차가운 메탄올로 2분간 투과시켰다. 이어서, 생성된 샘플을 1 X PBST로 4회 광범위하게 세척하였다. 면역형광 분석은 종래 공지된 방법에 따라 수행되었다. 간단히, 1차 항체를 실온에서 2 내지 4 시간 동안 (또는 인산화-항체의 경우 4 ℃에서 밤새) 배양하고 1 x PBST로 3 회 세척하였다. 형광-염색 접합된 이차 항체를 1시간 동안 실온에서 인큐베이션 하였다. 실온에서 10분 동안 배양하면서 1μg/ml의 DAPI 용액으로 DNA를 염색하였다. 생성된 커버 슬립을 Fluoro-Gel 장착 매체로 장착하고, 관찰하고 Zeiss LSM 700 공초점 현미경, Zeiss AxioObserver 또는 Nikon Eclipse ti-u 역 형광 현미경 시스템으로 사진을 찍었다.
8. Wnt3a의 중화
CM(conditioned medium)에서 Wnt3a 활성은 5㎍/ml의 최종 농도에서 Wnt3a CM에 항-Wnt3a 항체를 첨가함으로써 중화되었다. 항체 및 CM의 혼합물을 4℃에서 밤새 인큐베이션한 후 세포에 적용하였다.
9. FACS (flow cytometry) 분석
대조군 또는 Wnt3a CM으로 처리된 hTERT-RPE 세포를 트립신화로 수확하고 FACS 분석을 수행하였다. PI(propidium iodide)염색은 제조사의 프로토콜에 따라 BD cycletest TM Plus DNA 시약 키트(BD Biosciences, CA)를 사용하여 수행하였다. 결과 샘플을 FACS 분석을 위해 BD FACSCalibur쪠 유세포 분석기에 적용하고 결과 데이터를 CellQuest Pro v6.0 (BD Biosciences)으로 분석하였다.
10. 항암제 내성 세포주에서의 in vitro 분석
MCF7/ADR를 6시간 동안 serum starvation한 후, 세포에 control CM 또는 Wnt3a CM 을 처리하여 24시간 동안 배양하였다. 배양된 세포에 doxorubicin을 2 mM 또는 10 mM 처리하여 6 ~ 10일 동안 추가 배양하였다. 배양된 세포를 Wright 염색(Sigma-Aldrich)용액으로 염색하여 현미경으로 관찰하거나 Flow cytometry (FACS) 분석하였다. FACS 분석은 propidium iodide 염색(BD cycletest TM Plus DNA reagent kit)을 하여 BD FACSCalibur TM Flow Cytometer (BD Biosciences)를 이용하여 수행하였으며, 데이터는 CellQuest Pro v6.0 (BD Biosciences)를 이용해서 분석하였다.
실험결과
1. Wnt의 표준 리간드인 Wnt3a에 의한 자극은 일차섬모발생을 유도함
일차섬모발생에 대한 표준적인 Wnt 자극의 효과를 평가하기 위해, hTERT-RPE 세포를 혈청 결핍시키고, 도 1a에 나타낸 스케줄에 따라 Wnt3a로 자극하였다. 처리 48 시간 후, 세포를 수확하고 면역 블롯팅하고 지시된 항체로 면역 염색시켰다. 세포밀도는 일차섬모발생에 영향을 미치기 때문에, 일차섬모를 가진 세포의 수는 대조군 또는 Wnt3a CM(conditioned media)-처리된 커버슬립의 유사한 세포밀도 영역에서 계수되었다. 놀랍게도, Wnt3a 자극은 대조군과 비교하여 일차섬모를 갖는 세포의 수를 현저하게 증가시켰다(도 1b 및 1c). hTERT-RPE 세포에서 Wnt3a CM의 자극은 대략 70%의 일차섬모를 유도하는 반면, 대조 CM 처리는 단지 약 40% 섬모를 유도했다(도 1c). 이들 관찰에 더하여, 대조군 CM-처리된 세포와 비교하여 Wnt3a CM-처리된 세포에서 길고 두꺼운 일차섬모가 빈번하게 관찰되었다(도 1d 및 1f). 따라서, 본 발명자들은 면역형광신호를 사용하여 각 섬모 축삭의 길이 및 두께를 측정하였다. 일차섬모의 평균 길이는 대조 CM-처리된 세포 및 Wnt3a CM-처리된 세포에서 각각 2.59 및 4.77μm였다(도 1e). 또한, 섬모축삭(ciliary axoneme)의 두께는 대조군 CM- 및 Wnt3a CM-처리된 세포에서 각각 0.27 및 0.44μm였다(도 1g).
이와 같이, Wnt3a CM 자극은 섬모가 발생한 세포의 수, 섬모의 길이 및 두께 측면에서 일차섬모발생에 영향을 미치는 것으로 확인되었다.
일차섬모발생에 대한 Wnt3a의 효과는 Wnt3a siRNA 형질 감염을 통한 내인성 Wnt3a의 고갈과 항-Wnt3a 특이적 항체를 사용한 Wnt3a의 중화에 의해 추가로 확인되었다. 내인성 Wnt3a의 고갈은 대조군과 비교하여 일차섬모의 생성을 절반으로 감소시켰다. 대조군 siRNA-형질감염된 hTERT-RPE 세포는 48 시간의 혈청 결핍 후 대략 40%의 섬모를 나타냈지만, Wnt3a siRNA-형질감염된 세포는 약 20%만이 섬모화되었다(도 1i).
추가로, Wnt3a CM과 항-Wnt3a 항체의 예비 배양은 Wnt3a-유도된 일차섬모발생을 억제했다. 대조군 CM의 존재하에, 대략 50% 섬모가 발생하는 반면, Wnt3a CM의 자극은 70% 이상의 섬모를 유발하였고, Wnt3a CM과 항-Wnt3a 항체의 예비 배양은 hTERT-RPE 세포에서 30% 미만의 섬모를 생성하였다. 한편, Wnt3a CM과 대조 IgG의 예비 배양은 Wnt3a CM-처리된 세포에서 관찰된 바와 같이 대략 71% 섬모로 Wnt3a-유도된 일차섬모발생에 영향을 미치지 않았다(도 2a 및 2b). 항-Wnt3a 항체 예비 배양에 의한 Wnt3a의 중화효과는 섬모 발생률뿐만 아니라 섬모 길이 및 두께에서도 관찰되었다. Wnt3a CM-처리된 세포의 길고 두꺼운 섬모는 대조 CM-처리된 세포에서 관찰된 것과 유사하였으나, Wnt3a CM과 항-Wnt3a 항체의 예비 배양 후에는 섬모의 길이 및 두께가 감소되었다(도 2c 및 2d).
2. CK1δ키나제 활성에 의한 beta-카테닌 세린47(Ser47) 잔기의 인산화가 일차섬모발생에 매우 중요한 역할을 함
본 발명자들이 진행한 이전 연구에 따르면, beta-카테닌 또는 CK1δ의 결손이 대조군 낙다운 샘플보다 일차섬모를 적게 유도한다는 것이 확인된 바 있다. 따라서, 본 발명에서는 일차섬모발생에서 Wnt3a와 beta-catenin-CK1δ 사이의 기능적 연관성을 확인하고자 하였다. 이를 위해 먼저 일차섬모발생에 대한 beta-카테닌 또는 CK1δ의 결손 효과를 자세히 확인하였다. sh-렌티 바이러스 감염을 통해 hTERT-RPE 세포에서 대조군 루시퍼라제, beta-카테닌 또는 CK1δ를 결손시키고, 혈청 결핍 후 0, 24 및 48시간 째에 일차섬모를 관찰하였다(도 S4A 및 S4B). 일차섬모발생은 beta-카테닌 또는 CK1δ의 결손에 의해 심각하게 손상되었다(도 3a 내지 3c). 48 시간의 혈청 결핍 후(sh-렌티 바이러스 감염 후 96 시간), shLuciferase (shGL) 렌티바이러스에 감염된 세포에서 52%의 세포가 일차섬모를 생성한 반면, shbeta-카테닌 또는 shCK1δ 렌티바이러스에 감염된 세포에서는 각각 18% 또는 23%의 세포만이 일차섬모를 생성하였다(도 3b). 섬모길이의 관점에서, 혈청 결핍 후 48 시간(sh-렌티 바이러스 감염 후 96 시간)에, 약 3.5μm 길이의 일차섬모가 shGL 렌티바이러스-감염된 세포에서 생성되는 반면, 약 1.9 또는 2.1μm 길이의 일차섬모가 각각 shbeta-카테닌 또는 CK1δ 렌티바이러스-감염 세포에서 생성되었다(도 3c). 이러한 결과는 beta-카테닌 및 CK1δ가 일차섬모발생에서 매우 중요한 역할을 한다는 것을 나타낸다.
이러한 결과에 기초하여, 본 발명자들은 다음에 일차섬모발생에서 beta-카테닌과 CK1δ 사이의 직접적인 관계를 확인하려고 시도했다. 정제된 GST-CK1δ 및 GST-beta-카테닌을 사용한 시험관내 키나제 분석 결과, CK1δ 키나제 활성에 의한 beta-카테닌의 강한 특이적 인산화 신호가 확인되었다(도 4).
그런 다음, 일차섬모발생을 유도하는 CK1δ 매개 beta-카테닌의 인산화 위치를 확인하고자 하였다. 이를 위해, beta-카테닌의 전장을 도메인 아미노산 서열에 따라 N-말단 부분(T1), 중간부분(T2) 및 C-말단 부분 (T3)의 세 부분으로 나누었다(도 5a). 각 절단된 돌연변이 단백질을 박테리아 발현시스템을 사용하여 정제하고 GST-CK1δ와 반응시켰다. 3 개의 돌연변이 중에서, T1만이 CK1δ 키나제 활성에 의해 인산화 신호를 보인 반면, 다른 돌연변이인 T2 및 T3은 특정 신호를 나타내지 않았다(도 5b). 따라서, 본 발명자들은 CK1δ(S/Tp-X1-2-S/T)에 대한 컨센서스 인산화 서열에 따라 T1 돌연변이체의 일차 서열에서 CK1δ-유도된 beta-카테닌 인산화 위치의 후보를 검색하였다. 인산화 부위 선택의 가능성을 증가시키기 위해, 컨센서스 서열의 후자 S/T 잔기 및 전자 S/T 잔기가 후보 선별에 포함되었다.
본 발명자들은 beta-카테닌의 T1 돌연변이 체로부터 10 개의 후보 잔기를 선택하고 각각에 대해 인산화 결핍 알라닌("A") 돌연변이체를 생성하였다. 각각의 "A"돌연변이체를 박테리아 발현 시스템에서 발현시키고 정제하여 생성된 단백질을 CK1δ와 반응시켰다. beta-카테닌의 10 개의 "A"돌연변이 중 3개 (즉, S45A, S47A 및 T217A)는 인산화에 명백한 결핍을 나타냈다(도 5c). 3개의 확인된 후보들 사이에서 일차섬모발생을 담당하는 중요한 잔기를 결정하기 위해, 본 발명자는 각 돌연변이를 안정적으로 발현하는 hTERT-RPE 세포주를 생성하고 각 돌연변이체의 일차섬모발생력을 확인했다(도 5d 내지 5f). 내인성 beta-카테닌이 결손된 hTERT-RPE 세포에서, beta-카테닌 야생형(WT) 발현 세포는 약 35%의 일차섬모를 발생시켰고, S45A 또는 T217A 돌연변이를 발현하는 세포는 약 30%의 일차섬모를 발생시켰다. S47A 돌연변이체를 발현하는 세포는 약 15%의 일차섬모를 발생시켰다(도 5f). 이들 결과는 beta-카테닌 세린47(Ser47) 잔기의 인산화가 일차섬모발생에 결정적임을 시사한다.
따라서, 이후, 본 발명자들은 Wnt3a와 관련하여 일차섬모발생을 연구하기 위해 beta-catenin Ser47 잔기에 초점을 맞추었다.
3. Wnt3a 자극은 CK1δ 활성-의존적인 beta-카테닌 Ser47 잔기의 인산화를 촉진함
다양한 종에서 beta-카테닌 Ser47 잔기가 보존되어 있다는 것은, 이것이 얼마나 중요한지를 다시 확인할 수 있도록 한다(도 6a).
인산화-S47(p-S47) 에피토프에 대해 생성된 인산화-특이적 항체에 의한 후속 면역블롯팅 분석 결과, beta- 카테닌 야생형(WT)을 이소성으로 발현하는 HEK293T 세포에서 beta-카테닌 p-S47 에피토프의 존재를 확인했지만, 인산화-결핍 S47A 돌연변이를 발현하는 HEK293T 세포에서는 그렇지 않았다(도 6b). 내인성 p-S47 에피토프는 대조군 (shGL) 또는 beta-카테닌 (shbeta-카테닌)-결손된 HeLa CCL2 및 hTERT-RPE 세포에서 확인되었다. p-S47 특이적 항체를 사용한 면역블롯팅 분석 결과, 대조군 결손 세포에서는 내인성 beta-카테닌 p-S47 에피토프의 존재가 확인되었지만, beta-카테닌 결손 세포에서는 그렇지 않았다(도 6c).
다음으로, 본 발명자는 생체 내에서 CK1δ가 내인성 beta-카테닌 p-S47 에피토프를 유도함을 확인하였다 (도 6d). Myc-CK1δ WT의 과발현은 벡터만의 발현 또는 Myc-CK1ε WT와 비교하여 항-p-S47-특이적 항체를 사용한 면역블롯팅 분석에서 내인성 beta-카테닌 p-S47 에피토프를 현저하게 증가시켰다 (도 6d). 특히, CK1δ와 유사한 키나제인 CK1ε의 과발현은 빈 벡터 또는 CK1δ 발현과 비교하여 p-S47 신호를 향상시키지 않았다.
그 다음으로, Wnt3a의 자극이 섬모발생 조건에서 beta-카테닌 p-S47 에피토프의 생성을 촉진하는지 여부를 확인했다. 이를 위해, 본 발명자들은 먼저 일차섬모발생 조건에서 Wnt3a 자극에 의해 CK1δ의 활성화를 확인하였다. hTERT-RPE 세포에서 Myc-태그된 CK1δ를 사용한 IP-키나제 분석 결과, CK1δ의 활성이 Wnt3a 처리에 의해 현저하게 증가되는 것으로 확인되었다(도 6e). 이러한 결과와 마찬가지로, Wnt3a 처리 후 beta-카테닌 p-S47 에피토프의 증가가 혈청 결핍 hTERT-RPE(도 6f)에서 관찰되었다.
일차섬모발생에 beta-카테닌 인산화-S47의 효과를 확인하기 위해 빈 벡터, beta-카테닌 WT, S47A 또는 S47D를 안정적으로 발현하는 hTERT-RPE 세포를 사용하여 일차섬모발생을 추가로 분석하였다. 내인성 beta-카테닌의 부가 효과를 피하기 위해, 면역블롯팅 분석을 통해 내인성 beta-카테닌의 결핍을 확인하고 이 세포주를 분석에 사용하였다(도 7a). 혈청 결핍 기반의 섬모발생 어세이를 통해 일차섬모발생을 나타내는 이들 세포주의 능력을 조사하였다. beta-카테닌 S47 잔기의 인산화-결핍(S47A) 및 인산화-모방체(S47D) 돌연변이 사이에서 명백히 반대의 결과가 관찰되었다. beta-카테닌 S47A를 발현하는 세포에서는 일차섬모발생이 감소하였고 S47D를 발현하는 세포에서는 일차섬모발생이 증가하였다(도 7b 및 7c).
그 다음으로, Wnt3a의 자극이 어떻게 섬모발생을 유도하는지 확인하기 위해, hTERT-RPE 세포에서 Wnt3a 자극 후 beta-카테닌 p-S47의 세포 내 위치 변화를 모니터링 하였다. beta-카테닌 p-S47의 중심체(centrosome)로의 위치 변화는 hTERT-RPE 세포에서 항-p-S47 항체를 사용한 면역형광분석을 통해 확인되었다.
그 결과, Wnt3a의 자극이 중심체에서 beta-카테닌 p-S47의 신호를 향상시킨다는 것이 확인되었다(도 7d 및 7e).
중심체에서 beta-카테닌 p-S47의 정확한 국소화를 확인하기 위해, beta- 카테닌 p-S47을 모중심소체의 마커인 CEP170과 공동면역화 시켰다. 이들 단백질의 공동-국소화는 초해상도 현미경을 사용하여 모니터링 되었다(도 7f). 공초점 현미경 이미지에서 두 단백질의 공동-국소화가 확인되었고, 두 단백질의 고리-유사 구조가 초해상도 이미지에서 관찰되었다. 흥미롭게도, 고리형 beta-카테닌 p-S47 구조는 CEP170 고리로 둘러싸여 있고 두 단백질은 부분적으로 공동-국소화되었다(도 4F). 이 데이터는 beta-카테닌 p-S47이 섬모발생 동안 모중심소체의 subdistal appendages에 국한되어 있음을 나타낸다.
4. Wnt3a-유도-beta-카테닌 S47의 인산화는 중심소체위성(centriolar satellites)의 중심체(centrosome) 주변으로의 재구성을 촉진함
중심소체위성은 중심체 주위에서 일정한 움직임을 보이고 이들 입자의 재구성은 일차섬모발생과 밀접한 관련이 있기 때문에, 본 발명자는 Wnt3a 자극에 따라 이의 위치를 주의깊게 모니터링했다. PCM1은 중심소체위성의 형성 및 유지에 필요한 플랫폼인 것으로 알려져 있다. 따라서 PCM1, AZI1/CEP131, CEP290, BBS4 및 OFD1과 같은 PCM1 종속 및 섬모발생 관련 중심소체위성을 관찰했다.
본 발명자는 Wnt3a의 자극이 선택된 중심소체위성의 세포하 국소화(subcellular localization) 변화 여부를 조사했다. 면역형광분석 결과, 대조군 CM-처리 세포에서 분산되어 있던 PCM1 스팟이 Wnt3a 자극에 의해 γ- 튜불린(도 8a, 상부 패널) 및 섬모의 기저 몸체(도 8a, 하부 패널) 주변으로 현저히 모집/축적되었다는 것이 확인되었다(도 8a 및 8b). 다른 선택된 중심소체위성을 모니터링하기 위해, 세포를 PCM1과 동일한 방식으로 처리하고 면역염색하고 관찰하였다. 테스트된 중심소체위성들 중에서, AZI1/CEP131 및 CEP290은 PCM1과 유사한 결과를 보인 반면, BBS4 및 OFD1은 그렇지 않았다. AZI1/CEP131 및 CEP290의 주변중심소체 신호(pericentriolar)는 대조군 CM 처리 세포와 비교하여 Wnt3a CM 처리 세포에서 유의하게 증가하였지만, BBS4 및 OFD1의 주변중심소체 신호는 대조군과 Wnt3a CM 처리 세포 사이에 유의한 차이를 나타내지 않았다(도 8c 및 8d).
다음으로 중심소체위성이 beta-카테닌 S47의 인산화에 의해 재구성 될 수 있는지 조사하였다. 예상한 바와 같이, 빈 벡터(+Vec)를 발현하는 shbeta-카테닌 세포는 PCM1 주변중심소체 신호 강도의 현저한 감소를 나타낸 반면에, beta-카테닌 WT(+WTR) 또는 인산화 모방 S47D 돌연변이체(+S47DR)의 경우에는 중심체 주변에 PCM1의 축적을 크게 증가시켰다. 또한, 인산화-결핍 S47A 돌연변이체(+S47AR)는 중심체 주위에서 PCM1의 가장 낮은 축적을 나타냈다(도 9a 및 9b). 테스트된 다른 중심소체위성의 경우, AZI1/CEP131 및 CEP290은 PCM1과 비슷한 결과를 보인 반면 BBS4 및 OFD1은 그렇지 않았다(도 9c 내지 9f).
상기 결과들과 마찬가지로, PCM1, AZI1/CEP131 또는 CEP290이 결손되면 일차섬모발생이 크게 감소했다(도 9g 내지 9j). 24 시간 혈청 결핍 후에 대조군 siRNA-감염된 hTERT-RPE 세포의 30% 이상에서 섬모가 관찰된 반면, 각각의 모집된 인자에 대한 siRNA로 형질감염된 세포에서는 15% 미만으로 섬모가 관찰되었다 (도 9i).
또한, 대조군 siRNA-형질 감염된 세포와 비교하여 각각의 모집된 인자가 결손된 세포에서 더 짧은 일차섬모가 관찰되었다. 일차섬모의 평균 길이는 대조군 siRNA-형질감염된 세포에서 약 3μm 인 반면, siPCM1-, siAZI1- 또는 siCEP290- 형질감염된 세포에서 각각 약 2.1, 2.1 또는 1.9μm였다(도 9j).
다음으로, 섬모발생 조건하에서 beta-카테닌과 모집 인자 및 subdistal appendage 단백질과의 관계를 분석하기 위해, beta-카테닌 p-S47을 항-beta-카테닌 p-S47 항체를 사용하여 24 시간 동안 혈청이 결핍된 hTERT-RPE 세포에서 면역 침전을 수행했다. 흥미롭게도, beta-카테닌 p-S47과 PCM1/AZI1/CEP290/CEP170의 물리적 상호 작용이 면역 침전 분석에서 확인되었다 (도 9k).
5. 다약제-내성 종양 세포 모델에서 Wnt3a-의존성 일차섬모발생
최근 연구에 따르면, 암 세포에서 일차섬모와 약물 내성 사이의 밀접한 상관관계가 확인되었다. 즉, 일차섬모는 키나제 억제제에 대한 내성을 촉진하고 약물 내성은 일차섬모의 길이가 더 긴 암 세포에서 더 크게 나타났다. 따라서, 약물 내성 암 세포에서 일차섬모발생 신호 전달의 이해가 약물 내성을 극복하기 위한 전략으로 이어질 수 있다. 이 가설을 테스트하고 임상 적용 가능성을 탐색하기 위해, 본 발명자들은 다약제 내성 유방 종양 세포주 MCF-7/ADR에서 실험을 수행하였다.
예상한 바와 같이, MCF-7/ADR 세포주는 아드리아마이신(Adriamycin)-민감성 MCF-7 세포와 비교하여 약물 내성의 마커 단백질인 MDR1를 고발현하는 것으로 확인되었다(도 10a). Wnt3a의 자극은 MCF-7/ADR 세포주에서 섬모를 발현하는 세포 집단을 더 많이 유도했고, 섬모 길이도 더 길게 유도하였다. 특히, Wnt3a 자극 후 MCF-7/ADR 세포에서 매우 긴 일차섬모가 관찰되었다(도 10b 내지 10e). Wnt3a-처리된 MCF-7/ADR 세포에서 일차섬모의 평균 길이는 약 11μm이었고, 이는 Wnt3a-처리된 hTERT-RPE 세포의 약 2배(약 5μm)였다. hTERT-RPE 세포와 달리, MCF-7/ADR 세포는 Wnt3a 자극 후 길이가 20μm 이상인 일차섬모를 빈번하게 나타내었다. 이는 Wnt3a 자극에 의한 hTERT-RPE 세포에서 길이가 가장 긴 일차섬모가 약 10μm인 것을 고려하면 놀라운 결과이다.
다음으로, 본 발명자들은 hTERT-RPE 세포에서와 같이 MCF-7/ADR 세포에서 beta-카테닌 p-S47 및 PCM1의 중심체 위치에 대한 Wnt3a의 효과를 분석하였다. hTERT-RPE 세포의 결과와 마찬가지로, Wnt3a의 자극은 중심체에서 beta-카테닌 p-S47의 증가 및 주변중심소체 주위의 PCM1의 축적을 유발하였다(도 10f 내지 10i). 요약하면, 일차섬모 생성, beta-카테닌 p-S47의 중심소체 위치화 및 PCM1의 모집에 대한 Wnt3a의 효과는 hTERT-RPE 세포에서 보다 MCF-7/ADR 세포에서 더 큰 것으로 판단되었다.
따라서, 표준 Wnt 리간드인 Wnt3a는 CK1δ-의존적 beta-카테닌 S47 잔기 인산화를 유발하고 그것의 중심체로의 위치화를 유도한다. 이러한 일련의 사건은 PCM1, AZI1/CEP131 및 CEP290과 같은 중심소체위성을 중심체/기저체로 모집하여 궁극적으로 일차섬모발생을 유도한다.
그 다음으로, 유방암 유래 항암제 내성 세포인 MCF7/ADR 세포에 독소루비신(doxorubicin)을 처리한 결과, Wnt3a 자극을 준 세포들은 대조군 자극을 준 세포들 보다 생존률이 높았다(도 11a 및 11b). FACS 분석을 통해 확인한 결과 Wnt3a 자극을 받은 세포는 대조군 자극세포보다 독소루비신 처리에 저항성을 보여 더 적은 세포들이 사멸한 것으로 확인되었다(도 11c).
6. beta-카테닌 p-S47에 특이적으로 결합하는 항체 서열분석
beta-카테닌 p-S47에 특이적으로 결합하는 단일클론항체의 서열을 분석하였고, 이를 하기 표 1에 나타내었다.
Figure PCTKR2020007855-appb-img-000001
본 발명은 세포에서 일차섬모발생에 직접적으로 관여하는, 베타-카테닌(beta-catenin)의 47번 세린(Ser47)의 인산화 수준을 측정할 수 있는 신규한 항체 및 이의 용도를 제공하며, 또한 본 발명은 베타-카테닌(beta-catenin)의 47번 세린(Ser47)의 인산화 수준을 측정함으로써 일차섬모에 의한 암 세포의 항암제 내성을 진단하거나, 항암제 내성 억제제를 스크리닝 하는 방법을 제공할 수 있어 산업상 이용가능성이 매우 높다.

Claims (26)

  1. 47번 세린(Ser47)이 인산화된 베타-카테닌(beta-catenin)에 특이적으로 결합하는 항체 또는 이의 항원 결합 단편.
  2. 제1항에 있어서, 상기 베타-카테닌은 서열번호 1의 아미노산 서열로 이루어진 것을 특징으로 하는 항체 또는 이의 항원 결합 단편.
  3. 제1항에 있어서, 상기 항체 또는 이의 항원 결합 단편은 서열번호 2로 표시되는 항원결정부(epitope)에 특이적으로 결합하는 것을 특징으로 하는 항체 또는 이의 항원 결합 단편.
  4. 제1항에 있어서, 상기 항체 또는 이의 항원 결합 단편은 서열번호 3으로 표시되는 아미노산 서열을 포함하는 중쇄 상보성 결정부위(CDR)1, 서열번호 4 표시되는 아미노산 서열을 포함하는 중쇄 CDR2 및 서열번호 5로 표시되는 아미노산 서열을 포함하는 중쇄 CDR3을 포함하는 중쇄가변영역; 및 서열번호 6으로 표시되는 아미노산 서열을 포함하는 경쇄 CDR1, 서열번호 7로 표시되는 아미노산 서열을 포함하는 경쇄 CDR2 및 서열번호 8로 표시되는 아미노산 서열을 포함하는 경쇄 CDR3을 포함하는 경쇄가변영역을 포함하는 것을 특징으로 하는 항체 또는 이의 항원 결합 단편.
  5. 제1항에 있어서, 상기 항체 또는 이의 항원 결합 단편은 서열번호 9로 표시되는 아미노산 서열을 포함하는 중쇄가변영역; 및 서열번호 10으로 표시되는 아미노산 서열을 포함하는 경쇄가변영역을 포함하는 것을 특징으로 하는 항체 또는 이의 항원 결합 단편.
  6. 제1항에 있어서, 상기 항체는 IgG, IgA, IgM, IgE 및 IgD로 이루어진 군에서 선택되는 것을 특징으로 하는 항체 또는 이의 항원 결합 단편.
  7. 제1항에 있어서, 상기 항체의 항원 결합 단편은 디아바디, Fab, Fab', F(ab)2, F(ab')2, Fv 및 scFv로 이루어진 군에서 선택되는 것을 특징으로 하는 항체 또는 이의 항원 결합 단편.
  8. 제1항 내지 제7항 중 어느 한 항의 항체 또는 이의 항원 결합 단편을 암호화하는 폴리뉴클레오티드.
  9. 제8항에 있어서, 상기 폴리뉴클레오티드는 서열번호 17 또는 서열번호 18로 표시되는 염기서열을 포함하는 것을 특징으로 하는 폴리뉴클레오티드.
  10. 제8항의 폴리뉴클레오티드를 포함하는 재조합 발현벡터.
  11. 제10항의 재조합 발현벡터로 형질전환된 숙주세포.
  12. Wnt3a의 발현 또는 활성을 억제하는 물질; 또는 베타-카테닌(beta-catenin)의 47번 세린(Ser47)의 인산화를 억제하는 물질을 유효성분으로 포함하는 항암제 내성 억제용 약학적 조성물.
  13. 제12항에 있어서, 상기 항암제는 알킬화 약물(Alkylating agents), 항대사물질(Antimetabolites), 천연물질, 호르몬, 호르몬의 길항 약물, 표적 치료제, 또는 이들의 조합인 것을 특징으로 하는 약학적 조성물.
  14. 제13항에 있어서, 상기 천연물질은 빈블라스틴(Vinblastine), 빈크리스틴(Vincristine), 비노렐빈(Vinorelvine), 파클리탁셀(Paclitaxel), 도세탁셀(Docetaxel), 에토포사이드(Etoposide), 토포테칸(Topotecan), 이리노테칸(Irinotecan), 닥티노마이신(Dactinomycin), 독소루비신(Doxorubicin), 다우노루비신(Daunorubicin), 미토마이신(Mitomycin), 블레오마이신(Bleomycin), 아스파라기나제(L-Asparaginase), 또는 이들의 조합인 것을 특징으로 하는 약학적 조성물.
  15. 베타-카테닌(beta-catenin)의 47번 세린(Ser47)의 인산화 수준을 측정하는 제제를 포함하는 항암제 내성 진단용 조성물.
  16. 제15항에 있어서, 상기 제제는 47번 세린이 인산화된 베타-카테닌에 특이적으로 결합하는 항체, 이의 항원 결합 단편, 또는 압타머인 것을 특징으로 하는 진단용 조성물.
  17. 제15항에 있어서, 상기 제제는 청구항 제1항 내지 제7항 중 어느 한 항에 따른 항체인 것을 특징으로 하는 진단용 조성물.
  18. 베타-카테닌(beta-catenin)의 47번 세린(Ser47)의 인산화 수준을 측정하는 제제를 포함하는 항암제 내성 진단용 키트.
  19. (a) 암 환자로부터 제공된 생물학적 시료에서 베타-카테닌(beta-catenin)의 47번 세린(Ser47)의 인산화 수준을 측정하는 단계;
    (b) 상기 베타-카테닌의 47번 세린의 인산화 수준이 정상 대조군보다 높을 경우 항암제 내성으로 진단하는 단계를 포함하는,
    항암제 내성 진단을 위한 정보를 제공하는 방법.
  20. 제19항에 있어서, 상기 베타-카테닌의 47번 세린의 인산화 수준을 측정하는 방법은 방사선자동사진법, 액체섬광계수(liquid scintillation counting)법, 분자량 분석법, 액체 색층 분석 매스 분석법, 웨스턴 블롯, ELISA, 방사선면역분석법, 방사면역확산법, 오우크레로니(Ouchterlony) 면역확산법, 로케트 면역전기영동, 면역형광염색법, 면역조직화학염색, 면역침전분석, 보체고정분석, FACS 및 단백질 칩으로 이루어진 군에서 선택된 1종 이상인 것을 특징으로 하는 방법.
  21. 제19항에 있어서, 상기 생물학적 시료는 전혈, 혈장, 혈구, 혈청, 혈관 내피세포, 신경세포, 뇌척수액, 타액, 비액, 객담, 관절낭액, 양수, 복수, 자궁경부 분비물, 질 분비물 및 소변으로 이루어진 군에서 선택되는 것을 특징으로 하는 방법.
  22. (a) 시험물질을 베타-카테닌(beta-catenin)을 발현하는 세포 또는 조직과 접촉시키는 단계;
    (b) 상기 시험물질이 접촉된 세포 또는 조직에서 베타-카테닌의 47번 세린(Ser47)의 인산화 수준을 측정하는 단계; 및
    (c) 상기 시험물질이 접촉되지 않은 세포 또는 조직에서의 베타-카테닌의 47번 세린의 인산화 수준을 측정하여, 상기 (b) 단계에서 측정된 베타-카테닌의 47번 세린의 인산화 수준이 감소된 시험물질을 선별하는 단계를 포함하는, 항암제 내성 억제제 스크리닝 방법.
  23. 항암제 내성 억제를 위한 약학적 제제를 제조하기 위한 Wnt3a의 발현 또는 활성을 억제하는 물질; 또는 베타-카테닌(beta-catenin)의 47번 세린(Ser47)의 인산화를 억제하는 물질의 용도.
  24. Wnt3a의 발현 또는 활성을 억제하는 물질; 또는 베타-카테닌(beta-catenin)의 47번 세린(Ser47)의 인산화를 억제하는 물질을 유효성분으로 포함하는 조성물의 유효량을 이를 필요로 하는 개체에 투여하는 것을 포함하는 항암제 내성 억제 방법.
  25. 항암제 내성 진단용 제제를 제조하기 위한 베타-카테닌(beta-catenin)의 47번 세린(Ser47)의 인산화 수준을 측정하는 제제의 용도.
  26. (a) 암 환자로부터 제공된 생물학적 시료에서 베타-카테닌(beta-catenin)의 47번 세린(Ser47)의 인산화 수준을 측정하는 단계;
    (b) 상기 베타-카테닌의 47번 세린의 인산화 수준이 정상 대조군보다 높을 경우 항암제 내성으로 진단하는 단계를 포함하는, 항암제 내성 진단 방법.
PCT/KR2020/007855 2019-07-23 2020-06-17 인산화된 베타-카테닌에 특이적으로 결합하는 항체 및 이의 용도 WO2021015419A1 (ko)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR10-2019-0089078 2019-07-23
KR20190089078 2019-07-23
KR20200012754 2020-02-03
KR10-2020-0012754 2020-02-03

Publications (1)

Publication Number Publication Date
WO2021015419A1 true WO2021015419A1 (ko) 2021-01-28

Family

ID=74193541

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2020/007855 WO2021015419A1 (ko) 2019-07-23 2020-06-17 인산화된 베타-카테닌에 특이적으로 결합하는 항체 및 이의 용도

Country Status (2)

Country Link
KR (1) KR102264305B1 (ko)
WO (1) WO2021015419A1 (ko)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2024105204A1 (en) 2022-11-18 2024-05-23 UCB Biopharma SRL Anti-beta-catenin antibodies

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003092719A2 (en) * 2002-04-29 2003-11-13 Yissum Research Development Company Of The Hebrew University Of Jerusalem Methods and compositions for modulating beta-catenin phosphorylation
JP2005089354A (ja) * 2003-09-16 2005-04-07 Kyowa Hakko Kogyo Co Ltd リン酸化されたβカテニンを選択的に認識する抗体
US8106166B2 (en) * 2007-03-16 2012-01-31 Stowers Institute For Medical Research Antibodies that bind specifically to phosphorylated β-catenin

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003092719A2 (en) * 2002-04-29 2003-11-13 Yissum Research Development Company Of The Hebrew University Of Jerusalem Methods and compositions for modulating beta-catenin phosphorylation
JP2005089354A (ja) * 2003-09-16 2005-04-07 Kyowa Hakko Kogyo Co Ltd リン酸化されたβカテニンを選択的に認識する抗体
US8106166B2 (en) * 2007-03-16 2012-01-31 Stowers Institute For Medical Research Antibodies that bind specifically to phosphorylated β-catenin

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
DATABASE NCBI 26 June 2019 (2019-06-26), XP055786763, Database accession no. NP 001091679.1 *
FU, J.: "Wnt/ beta -catenin inhibition reverses multidrug resistance in pediatric acute lymphoblastic leukemia", ONCOLOGY REPORTS, 4 December 2018 (2018-12-04) *
JIANG, X.: "Targeting 13-catenin signaling for therapeutic intervention in MEN1-deficient pancreatic neuroendocrine tumours", NATURE COMMUNICATIONS, 17 December 2014 (2014-12-17), XP055786752 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2024105204A1 (en) 2022-11-18 2024-05-23 UCB Biopharma SRL Anti-beta-catenin antibodies

Also Published As

Publication number Publication date
KR20210011876A (ko) 2021-02-02
KR102264305B1 (ko) 2021-06-14

Similar Documents

Publication Publication Date Title
WO2021010712A1 (ko) 항-타우 항체 및 이의 용도
WO2019124951A9 (en) Gpcr heteromer inhibitors and uses thereof
WO2019107812A1 (ko) 세포의 세포질에 침투하여 세포내 활성화된 ras를 억제하는 항체 및 이의 용도
WO2014158001A1 (ko) 2 이상의 인플루엔자 ａ 바이러스 중화 결합 분자를 포함하는 조성물
WO2018194381A1 (ko) Lrig-1 단백질에 특이적인 결합 분자 및 이의 용도
WO2013187724A1 (en) Novel antibody specific for clec14a and uses thereof
WO2017030292A1 (ko) P62 zz 도메인에 결합하는 리간드 또는 아르기닌화된 bip에 의해 매개되는 오토파지 활성을 통한 신경변성 질환 예방 및 치료
WO2016153276A1 (ko) 뉴로필린1 특이적 결합 펩타이드 및 이 펩타이드가 융합된 융합 단백질, 및 이의 용도
WO2014077648A1 (ko) 인간 및 마우스 ｌ１ｃａｍ 단백질에 특이적으로 결합하는 항체 및 이의 용도
WO2016013870A1 (ko) 완전한 이뮤노글로불린 형태의 항체를 세포막을 투과하여 세포질에 위치시키는 방법 및 그의 이용
WO2018174544A2 (ko) Muc1에 특이적으로 결합하는 항체 및 그의 용도
WO2017204606A1 (ko) 세포질 침투 항체 및 이의 용도
WO2018026248A1 (ko) 프로그램화된 세포 사멸 단백질(pd-1)에 대한 신규 항체 및 이의 용도
WO2021015419A1 (ko) 인산화된 베타-카테닌에 특이적으로 결합하는 항체 및 이의 용도
WO2016013871A1 (ko) 완전한 이뮤노글로불린 형태의 세포질 침투능을 갖는 항체를 이용하여 세포내 활성화된 ras를 억제하는 방법 및 그의 이용
WO2019190206A1 (ko) 클라우딘 3의 ecl-2에 특이적으로 결합하는 항체, 이의 단편 및 이들의 용도
WO2022085905A1 (ko) SARS-CoV-2 스파이크 단백질에 특이적으로 결합하는 항체 및 이의 용도
WO2021101346A1 (en) Anti-ror1/anti-4-1bb bispecific antibodies and uses thereof
WO2021010800A1 (ko) Wrs 단백질에 특이적으로 결합하는 항체 및 이의 용도
WO2019045477A1 (ko) 비멘틴 유래 펩타이드에 특이적으로 결합하는 물질을 포함하는 피부질환 예방 및 치료용 조성물
WO2020251316A1 (ko) α-SYN/IGF1R에 대한 이중 특이 항체 및 그 용도
WO2017171373A2 (ko) Egfr 표적 제제에 대한 저항성을 억제하기 위한 조성물
WO2015130115A1 (en) Novel antibody specific for tspan8 and uses thereof
WO2020117017A1 (ko) 항 c-met 아고니스트 항체 및 이의 용도
WO2020117019A1 (ko) 항 c-met 아고니스트 항체 및 이의 용도

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20843160

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 20843160

Country of ref document: EP

Kind code of ref document: A1