WO2021015218A1 - Prévention ou traitement d'une fibrose ciblant le facteur associé à la transcription - Google Patents

Prévention ou traitement d'une fibrose ciblant le facteur associé à la transcription Download PDF

Info

Publication number
WO2021015218A1
WO2021015218A1 PCT/JP2020/028361 JP2020028361W WO2021015218A1 WO 2021015218 A1 WO2021015218 A1 WO 2021015218A1 JP 2020028361 W JP2020028361 W JP 2020028361W WO 2021015218 A1 WO2021015218 A1 WO 2021015218A1
Authority
WO
WIPO (PCT)
Prior art keywords
vgll3
myofibroblasts
expression
seq
fibrosis
Prior art date
Application number
PCT/JP2020/028361
Other languages
English (en)
Japanese (ja)
Inventor
道雄 仲矢
Original Assignee
国立大学法人九州大学
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 国立大学法人九州大学 filed Critical 国立大学法人九州大学
Publication of WO2021015218A1 publication Critical patent/WO2021015218A1/fr

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/7105—Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/10—Cells modified by introduction of foreign genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes

Definitions

  • the present invention relates to a pharmaceutical composition for preventing or treating fibrotic diseases.
  • the present invention relates to substances and nucleic acid molecules that prevent or treat fibrotic diseases, methods for screening them, and kits for them.
  • Fibrosis is a condition in which extracellular matrix proteins such as collagen are excessively accumulated in the interstitium of tissues, and is induced in almost all organs such as the heart, liver, lungs, intestines, and kidneys due to inflammation and aging.
  • parenchymal cells such as myocardial cells and hepatocytes undergo cell death, and extracellular matrix such as collagen accumulates to compensate for the loss of the parenchymal cells.
  • a characteristic of fibrotic organs is the accumulation of non-stretchable extracellular matrix, which makes the tissue extremely stiff.
  • Non-Patent Document 3 Excessive fibrosis causes organ dysfunction and can lead to death if left untreated. It has also been reported that fibrosis is involved in about 45% of all causes of death.
  • Organ fibrosis is carried out by a group of cells called myofibroblasts that produce collagen and the like. Myofibroblasts are rarely present when the tissue is normal. However, it is known that when inflammation occurs, humoral factors such as TGF- ⁇ secreted from immune cells are stimulated to differentiate resident fibroblasts into myofibroblasts ( Non-Patent Document 4). On the other hand, in recent years, it has been reported that not only cytokines such as TGF- ⁇ , but also pericellular hardness and mechanical stress play important roles in differentiation into myofibroblasts. (Non-Patent Document 5-8).
  • MRTF Myocardin-related transcription factor
  • YAP Yes-associated protein
  • Myofibroblasts trust your heart and let fate decide. Journal of molecular and cellular cardiology 70, 9-18, doi: 10.1016 / j.yjmcc.2013.10.019 (2014). Schroer, A. K. & Merryman, W. D. Mechanobiology of myofibroblast adhesion in fibrotic cardiac disease. Journal of cell science 128, 1865-1875, doi: 10.1242 / jcs.162891 (2015). Hinz, B. Mechanical aspects of lung fibrosis: a spotlight on the myofibroblast. Proceedings of the American Thoracic Society 9, 137-147, doi: 10.1513 / pats.201202-017AW (2012). Tomasek, J.
  • Pirfenidone has been clinically shown to suppress the decline in vital capacity by its antifibrotic effect in patients with idiopathic pulmonary fibrosis (Margaritopoulos, G.A., Vasarmidi, E. & Antoniou, K. M. Pirfenidone in the treatment of idiopathic pulmonary fibrosis: an evidence-based review of its place in therapy.
  • Nintedanib inhibits platelet-derived growth factor receptor (PDGFR), fibroblast growth factor receptor (FGFR) and vascular endothelial growth factor receptor (EGFR), and is involved in the pathogenesis of idiopathic pulmonary fibrosis. It is thought to be a mechanism of action that suppresses cell proliferation and migration (Wollin, L. et al. Mode of action of nintedanib in the treatment of idiopathic pulmonary fibrosis.
  • PDGFR platelet-derived growth factor receptor
  • FGFR fibroblast growth factor receptor
  • EGFR vascular endothelial growth factor receptor
  • An object of the present invention is to provide an epoch-making and effective pharmaceutical composition for fibrosis targeting VGLL3. Another object of the present invention is to provide a method for screening candidate substances effective for the prevention or treatment of fibrotic diseases targeting VGLL3.
  • the present inventor seeks transcription-related factors involved in fibrosis expressed in myofibroblasts, aiming at the development of innovative therapeutic methods and agents for fibrotic pathologies for which sufficient therapeutic methods have not yet been established. I found VGLL3, whose function is almost unknown. Further research revealed for the first time that VGLL3 translocates into the nucleus in a mechanical stimulus-dependent manner and regulates the expression of fibrosis-related factors, and the present invention was completed based on this finding. is there.
  • the present invention includes the following aspects.
  • the inhibitor of VGLL3 is an inhibitor of VGLL3 expression, an inhibitor of nuclear translocation of VGLL3, or an inhibitor of binding between VGLL3 and DDX5.
  • nucleic acid having a base sequence of 90% or more identity with the base sequence of the VGLL3 gene shown in SEQ ID NO: 2, 4 or 6 in the sequence listing (d) Represented by SEQ ID NO: 2, 4 or 6 in the sequence listing A nucleic acid that hybridizes with a base sequence complementary to the VGLL3 gene under stringent conditions.
  • the pharmaceutical composition according to [3], wherein the substance that inhibits the expression of a gene or nucleic acid is at least one selected from the group consisting of siRNA, shRNA, miRNA, antisense and ribozyme.
  • ⁇ Screening method> [9] The step of measuring the expression level of VGLL3 in cells in the presence of the test substance, When the expression level is lower than the expression level in the absence of the test substance, the step of determining that the test substance is an effective candidate substance for the prevention or treatment of fibrotic disease. Prepare, prepare A screening method for candidate substances that are effective in the prevention or treatment of fibrotic diseases.
  • a method of determining the degree of fibrosis (a10) Step of measuring the amount of VGLL3 (test biomarker amount) in myofibroblasts of a subject, (b10) A step of comparing the amount of the test biomarker with the amount of VGLL3 in the reference myofibroblast (control biomarker amount), and (c10) when the test biomarker amount is larger than the control biomarker amount.
  • a method for determining a subject to have a high degree of fibrosis [11] The method according to [10], wherein the reference amount of VGLL3 in myofibroblasts is the amount of VGLL3 in myofibroblasts of the same subject measured prior to step (a10).
  • VGLL3 in myofibroblasts is the amount of VGLL3 in healthy subjects.
  • a kit for detecting myofibroblasts which comprises a primer set for amplifying VGLL3 cDNA, a probe that specifically hybridizes to VGLL3 mRNA, or a specific binding agent for VGLL3 protein.
  • VGLL3 is a factor that promotes fibrosis because the expression of extracellular matrix proteins such as collagen is suppressed when VGLL3 is knocked down. According to the present invention, it is possible to provide various techniques for preventing or treating fibrotic diseases related to inhibitors of VGLL3.
  • FIG. 1 is a schematic diagram showing that the expression of VGLL3 is related to fibrosis as a whole.
  • FIG. 1A is a schematic diagram of an MI (myocardial infarction) surgical heart. The procedure for MI surgery is occlusion of the left anterior descending coronary artery. In an infarcted heart, the ischemic necrotic region is recognized as the "infarcted” region and the rest of the infarcted region is recognized as the "non-infarcted” region.
  • FIG. 1B shows the procedure for identifying VGLL3 that may be associated with fibrosis. Gene expression in the hearts of sham and MI operated mice was comprehensively detected using microarray analysis.
  • FIG. 1C shows VGLL3 and fibrosis-related genes ( ⁇ SMA ( ⁇ -Smooth Muscle)) in the non-infarcted region (rem) and infarcted region (inf) of the sham-operated mouse heart (sham) and the MI-operated mouse heart.
  • ⁇ SMA ⁇ -Smooth Muscle
  • the mRNA expression is normalized to the expression of GAPDH and is intact. It is shown as a multiple change with respect to the mouse (day 0).
  • N 3 (0 days), 3 (sham 3 days), 5 (inf 3 days), 5 (rem 3 days), 4 (sham 7 days), 5 (inf 7 days), 5 (rem 7 days), 3-4 (sham 28 days), 6 (inf 28 days), and 6 (rem 28 days).
  • Group comparisons are on both sides without correspondence at each time point. Performed by Student's t-test. #P ⁇ 0.05, ### P ⁇ 0.001 (inf vs. sham); * P ⁇ 0.05, *** P ⁇ 0.001 (inf vs. rem).
  • FIG. 1D outlines a protocol for the regulation of myofibroblast differentiation by mechanical stimulation.
  • Myocardial fibroblasts were cultured on an adhesive dish for 7 days, some of them were separated and plated on a non-adhesive dish for an additional 7 days (dedifferentiation), and then some cells were recultured on an adhesive dish for 7 days. (Redifferentiation). Protein and RNA were collected from myofibroblasts at each time point.
  • FIG. 1F shows the collection of high-purity myocardial fibroblasts and the expression of fibrosis-related genes in myocardial fibroblasts cultured on a plate or suspension, and CD45 ⁇ +) cells by MACS (Magnetic cell sorting).
  • MACS Magnetic cell sorting
  • Histograms labeled with blue or red arrows represent heart cells stained with PE-conjugated anti-CD45 antibody or FITC-conjugated anti- ⁇ SMA antibody, respectively. Histograms without arrows represent unstained controls.
  • FIG. 1H shows fibrosis-related genes (ACTA2, COL1A1, COL1A2, COL3A1, FN1, LOX and CTGF) in cardiac fibroblasts of “adhesive”, “non-adherent” and “re-adherent” (Re). )
  • Is a graph showing mRNA expression. mRNA expression was normalized to that of GAPDH. Each n 5.
  • FIG. 1J shows differentiated or redifferentiated myofibroblasts up-regulated (16-fold or more) compared to undifferentiated myofibroblasts or infarcted mouse hearts compared to non-infarcted mouse hearts. It is a Ben diagram showing eight duplicate transcripts up-regulated (2 to the 1.5th power or higher) in.
  • FIG. 1K shows the protein expression distribution of VGLL3 in each human organ.
  • FIG. 1M shows the results of electrophoresis showing the expression levels of the VGLL families VGLL1, VGLL2, VGLL3 and VGLL4 in muscle fibroblasts isolated from the heart as PCR amplification.
  • FIG. 1N is a graph showing the results of absolute quantification of the expression levels of VGLL family VGLL1, VGLL2, VGLL3 and VGLL4 in muscle fibroblasts isolated from the heart.
  • FIG. 2A-G are photographs that replace the drawings, showing that VGLL3 is generally specifically expressed in fibrotic cardiac myofibroblasts.
  • the square in the leftmost photo shows the enlarged area in the right panel.
  • Arrows ( ⁇ ) indicate where the signals overlap in the overlay.
  • the scale bar indicates 30 ⁇ m.
  • FIG. 2A shows the results of co-staining a section of the left ventricle (LV) of the heart on day 3 MI stained with an antibody against VGLL3 with an antibody against the myofibroblast marker ⁇ SMA (A).
  • FIG. 2B shows the results of co-staining a section of the left ventricle (LV) of the heart on day 3 MI stained with an antibody against VGLL3 with an antibody against the macrophage marker CD68 (B).
  • FIG. 2C shows the results of co-staining a section of the left ventricle (LV) of the heart on day 3 MI stained with an antibody against VGLL3 with an antibody against the cardiomyocyte marker TNNI3 (C).
  • FIG. 2D is a representative image of an in situ hybridization (RNA scope) experiment evaluating VGLL3 mRNA expression in LV of mouse heart on day 7 MI. Heart sections were co-stained with anti- ⁇ SMA antibody (D). Nuclei were stained with DAPI. The gray squares indicate the enlarged area in the right panel. Arrows ( ⁇ ) indicate where the signals overlap in the overlay. The scale bar indicates 30 ⁇ m.
  • FIG. 2E is a representative image of an in situ hybridization (RNA scope) experiment evaluating VGLL3 mRNA expression in LV of mouse heart on day 7 of MI. Cardiac sections were co-hybridized with RNA scope probes for periostin mRNA (E). Nuclei were stained with DAPI. The gray squares indicate the enlarged area in the right panel. Arrows ( ⁇ ) indicate where the signals overlap in the overlay. The scale bar indicates 30 ⁇ m.
  • FIG. 2F is a representative image of an in situ hybridization experiment in which VGLL3 mRNA and periostin mRNA expression in LV of day 7 sham mice was evaluated. Cardiac sections were co-stained with anti- ⁇ SMA antibody.
  • FIG. 2G is a representative image of an in situ hybridization experiment evaluating VGLL3 mRNA expression in an infarcted heart of a human patient. Cardiac sections were co-stained with anti- ⁇ SMA antibody. Nuclei were stained with DAPI. The gray squares indicate the enlarged area in the right panel. Arrows ( ⁇ ) indicate where the signals overlap in the overlay. The scale bar indicates 30 ⁇ m.
  • FIG. 3A-D are photographs that replace the drawings, showing that the intranuclear translocation of VGLL3 is generally induced by mechanical stimulation. It is a representative confocal immunocytochemical image of VGLL3 and nucleus (DAPI) in myocardial fibroblasts isolated from the heart on the third day of MI. The cells were stained with Cell Trace to observe the overall picture of the cells.
  • FIG. 3A is an immunocytochemical image of VGLL3 (A). The upper panel shows suspended cultured myofibroblasts and the lower panel shows adherent cultured myofibroblasts.
  • FIG. 3B is an immunocytochemical image of YAP1 (B). The upper panel shows suspended cultured myofibroblasts and the lower panel shows adherent cultured myofibroblasts. The graph shows the ratio of nuclei to cytoplasmic VGLL3 or YAP1 strength in myofibroblasts cultured in the floating state (Float) and the adhesive state (Adherent) (n> 100 cells in each group). Scale bar: 20 ⁇ m.
  • FIG. 3C is an image of myofibroblasts overexpressing FLAG-tagged VGLL3.
  • FLAG-tagged VGLL3 was stained with anti-FLAG antibody.
  • the graph shows the ratio of nuclei to cytoplasmic FLAG-tagged VGLL3 strength in myofibroblasts cultured in the floating state (Float) and the adhesive state (Adherent) (n> 100 cells in each group). Scale bar: 20 ⁇ m.
  • FIG. 3D is an image of myofibroblasts adhering to a poly-L-lysine coated glass bottom dish at each time shown in the bar graph.
  • FIG. 4 is an alternative photograph showing that the intranuclear translocation of VGLL3 is regulated by the hardness of the extracellular matrix.
  • FIG. 4A is a schematic diagram showing the hardness of normal tissue and fibrous tissue. Elastic modulus is the hardness of an organ or cell.
  • FIG. 4B is a representative confocal immunocytochemical image of VGLL3 and nucleus (DAPI) in myocardial fibroblasts seeded on hydrogel plates with different hardnesses (moduli of 1, 8, 25, and 50 kPa). Is. The cells were stained with Cell Trace to observe the overall picture of the cells.
  • DAPI nucleus
  • the graph shows the ratio of nuclei to VGLL3 intensity of cytoplasm in myofibroblasts seeded on hydrogel plates with different hardness (n> 100 cells in each group). Intergroup comparisons were calculated by 1-way ANOVA followed by Newman-Keuls analysis; *** P ⁇ 0.001. Scale bar: 20 ⁇ m.
  • FIG. 5 is an alternative photograph showing that the nuclear translocation of VGLL3 is regulated by actin polymerization.
  • FIG. 5A is a schematic diagram of cytoskeleton formation in response to mechanical stimuli such as the hardness of the extracellular environment. Mechanical stimulation induced G-actin polymerization and F-actin formation.
  • FIG. 5B is a representative confocal image of myofibroblasts plated on a soft hydrogel (modulus of elasticity 1 kPa) and a hard hydrogel (modulus of elasticity 50 kPa). The nuclei were stained with DAPI and the cells were stained with Cell Trace to observe the whole picture of the cells. Scale bar: 20 ⁇ m.
  • FIG. 5C shows DMSO (control, 0.5%), F-actin inhibitor latrunculin A (Lat.A, 2 ⁇ M), non-muscle myosin inhibitor blebbistatin (Blebbist., 50 ⁇ M), ROCK inhibitor.
  • Rho is a member of the Ras homologue family of low molecular weight G proteins.
  • the cells were stained with Cell Trace to observe the overall picture of the cells. Scale bar: 20 ⁇ m.
  • the graph shows the ratio of nuclei to VGLL3 intensity in the cytoplasm of myofibroblasts (each group: n> 100 cells). Intergroup comparisons were calculated by 1-way ANOVA followed by Newman-Keuls analysis; *** P ⁇ 0.001.
  • FIG. 6 is an alternative photograph showing that intranuclear translocation of VGLL3 is regulated by activation of focal adhesions.
  • Figures 6A-B show VGLL3 in myocardial fibroblasts treated with DMSO (control, 0.5%), integrin ⁇ 1 inhibitor BTT-3033 (30 ⁇ M) (A), and FAK inhibitor VS-4718 (50 ⁇ M) (B). And is a typical confocal immunocytochemical image of the nucleus (DAPI). The cells were stained with Cell Trace to observe the overall picture of the cells. Scale bar: 20 ⁇ m. The graph shows the ratio of nuclei to VGLL3 intensity in the cytoplasm of myofibroblasts (each group: n> 100 cells). Intergroup comparisons were calculated by unpaired two-sided student's t-test; *** P ⁇ 0.001.
  • FIG. 7 is a graph showing that VGLL3 regulates the expression of fibrosis-related factors in myofibroblasts.
  • FIG. 7A shows the mRNA expression of VGLL3 and fibrosis-related genes (COL1A1, COL1A2, COL3A1) in myocardial fibroblasts transfected with control siRNA (siCtrl) or siRNA targeting VGLL
  • FIG. 8A shows VGLL3 binding protein candidates identified using a mass spectrometer.
  • the horizontal axis of the graph shows the amount of sediment of various proteins, and the vertical axis shows the reliability.
  • FIG. 8B is an alternative photograph showing the interaction of FLAG-VGLL3 and DDX5 in mouse myofibroblasts. FLAG-VGLL3 was immunoprecipitated from cell lysates from mouse myofibroblasts expressed using a retrovirus. DDX5 was detected by anti-DDX5 antibody.
  • FIG. 8C is an alternative photograph showing the in vitro binding assay between recombinant GST-VGLL3 and recombinant His-DDX5. GST-VGLL3 was precipitated with glutathione sepharose beads.
  • FIG. 8D is a schematic representation of wild-type DDX5 and deletion mutants of DDX5.
  • FIG. 8E lysed NIH3T3 cells expressed using the FLAG-VGLL3 and HA-tagged DDX5 wild-type or DDX5 deletion mutant retroviruses shown in FIG. 8D and subjected to immunoprecipitation with anti-FLAG antibody. It is a photograph that replaces the drawing showing the result. Immunoprecipitates and inputs were immunoblotted with anti-HA and anti-FLAG antibodies.
  • FIG. 8E is a schematic representation of wild-type DDX5 and deletion mutants of DDX5.
  • FIG. 8E lysed NIH3T3 cells expressed using the FLAG-VGLL3 and HA-tagged DDX5 wild-type or DDX5 deletion mutant retroviruses shown in FIG. 8D and subjected to immunoprecipitation with anti-FLAG antibody. It is a photograph that replaces the drawing showing the result. Immunoprecipitate
  • FIG. 8F is a schematic diagram of a mutant having only the N-terminal or a mutant having only the C-terminal of VGLL3.
  • FIG. 8G shows the results of overexpressing the N-terminal only mutant or C-terminal only mutant of VGLL3 and HA-DDX5 shown in FIG. 8F in NIH3T3 cells using a retrovirus and subjecting them to immunoprecipitation with an anti-FLAG antibody. It is a photograph that replaces the drawing showing. Immunoprecipitates and inputs were immunoblotted with anti-HA and anti-FLAG antibodies.
  • FIG. 10B is a graph showing the expression level of miR-29b (SEQ ID NO: 66: uagcaccauuugaaaucaguguu) in myocardial fibroblasts isolated from fibrotic hearts transfected with siRNA targeting DDX5.
  • FIG. 10D RNA immunoprecipitation using a DDX5 antibody was performed on myofibroblasts isolated from a fibrotic heart, and a primer set specific for Pri-miR29b-1 or Pri-miR29b-2 was used. It is a photograph instead of a drawing which shows the result of performing PCR. RT is reverse transcriptase, and (-) and (+) indicate its presence or absence.
  • FIG. 12B is a representative image of a unilateral ureteral obstruction (UUO) model-treated mouse kidney in which VGLL3 mRNA was in situ hybridized, myofibroblast marker ⁇ SMA was stained with an antibody against it, and further stained with DAPI. Arrows ( ⁇ ) indicate the respective signals in myofibroblasts expressing VGLL3. The scale bar is 30 ⁇ m.
  • FIG. 12A shows the results of unilateral ureteral obstruction (UUO) model treatment of wild-type (WT) mice, recovery of kidneys 10 days after treatment, and evaluation of VGLL3 mRNA expression level by real-time RT-PCR. It is a graph
  • FIG. 12C is a graph showing the results of unilateral ureteral obstruction (UUO) model treatment of WT and VGLL3KO mice, recovery of the kidney 10 days after the treatment, and evaluation of collagen expression level by real-time RT-PCR.
  • UUO unilateral ureteral obstruction
  • liver damage was caused by administration of CCl4 (carbon tetrachloride) for 4 weeks, and fibrosis was induced by administration of fibrotic liver (CCl4) and CCl4 for 4 weeks, and then 4 weeks had passed since the administration was stopped.
  • CCl4 carbon tetrachloride
  • fibrosis was induced by administration of fibrotic liver (CCl4) and CCl4 for 4 weeks, and then 4 weeks had passed since the administration was stopped.
  • CCl4 fibrotic liver
  • CCl4 fibrotic liver
  • FIG. 13C shows centrifuge hepatocytes (HC) and F4 / 80-positive Kupffer cells (KC) and F4 / 80-negative stars in non-precipitated cells after constant treatment of fibrotic-induced mouse liver by administration of CCL4. It is a graph which shows the result of having measured the mRNA of Cyp7a1, Cd68, and Acta2 which are marker molecules of hepatocyte, Kupffer cell, and activated stellate cell in each cell fraction of a cell (HSC).
  • FIG. 13D is a graph showing the results of measuring the expression level of VGLL3 mRNA in each cell fraction collected in FIG. 13C by real-time RT-PCR.
  • the present invention provides, in one embodiment, a composition comprising an inhibitor of VGLL3, specifically an inhibitor of VGLL3 expression, an inhibitor of nuclear translocation of VGLL3, or an inhibitor of binding of VGLL3 to DDX5. .
  • the composition includes a pharmaceutical composition or a food composition.
  • the pharmaceutical composition contains an inhibitor of VGLL3, specifically, an inhibitor of VGLL3 expression, an inhibitor of nuclear translocation of VGLL3, or an inhibitor of binding between VGLL3 and DDX5 as an active ingredient. It is a pharmaceutical composition for preventing or treating.
  • the food composition contains an inhibitor of VGLL3 expression, an inhibitor of nuclear translocation of VGLL3, or an inhibitor of binding between VGLL3 and DDX5, and assists in the treatment of fibrotic diseases, alleviates or prevents symptoms.
  • Food composition for use is an inhibitor of VGLL3 expression, an inhibitor of nuclear translocation of VGLL3, or an inhibitor of binding between VGLL3 and DDX5, and assists in the treatment of fibrotic diseases, alleviates or prevents symptoms.
  • Food composition for use.
  • VGLL3 whose expression level is increased in the heart at the time of myocardial infarction, is a factor that changes intracellular localization depending on extracellular hardness and regulates fibrosis.
  • the infarction causes cardiomyocyte necrosis.
  • cardiomyocytes are necrotic, myofibroblasts rapidly produce extracellular matrix proteins such as collagen to prevent cardiac rupture. That is, the infarcted region is excessively replaced with extracellular matrix protein, and as a result, fibrosis is strongly induced (Fig. 1A).
  • VGLL3 is cytoplasmic by allowing myofibroblasts to receive mechanical stimuli such as the hardness of the extracellular environment by aggregates called focal adhesion spots and promote cytoskeleton formation by activating Rho / ROCK. It was clarified that it shifts from to into the nucleus. We also found that knockdown of VGLL3 reduced the expression of extracellular matrix proteins such as collagen, indicating that VGLL3 is a factor that promotes fibrosis. According to the present invention, it is possible to provide various techniques for preventing or treating fibrotic diseases related to inhibitors of VGLL3.
  • VGLL3 is a molecule similar to the gene Vgl involved in the formation of Drosophila wings, and is one of the four VGLL (Vestigial-like) family proteins in mammals (Williams et al., 1991, Genes Dev). . 5: 2481-95). VGLL family proteins are known to bind to the transcription factor TEAD (TEA domain family member). As for the function of VGLL3, it has been reported that the difference in the expression of VGLL3 between men and women may determine the difference in the incidence of autoimmune diseases (JCI Insight.2019 Apr 18; 4 (8). Pii: 127291.
  • TEAD and YAP / TAZ are known to promote fibrosis in myofibroblasts.
  • TEAD and YAP / TAZ are expressed not only in myofibroblasts but also in cells of various tissues during normal times, and are closely involved in cell functions during normal times. This is considered to be an obstacle to targeting TEAD and YAP / TAZ for drug discovery.
  • the protein expression distribution of VGLL3 found by the present invention in each human organ was investigated from The Human Protein ATLAS (http://www.proteinatlas.org/).
  • VGLL3 is highly expressed only in the placenta during pregnancy in normal tissues in vivo (Fig. 1K). This suggests that VGLL3 may be a target molecule for the development of innovative fibrotic therapies.
  • VGLL3 is described as an example of a classification marker for prostate cancer in Special Table 2015-501151, there is no specific description regarding myofibroblasts and fibrotic diseases.
  • VGLL is described as a transcription factor in Japanese Patent Application Laid-Open No. 2011-019520, there is no specific description regarding myofibroblasts and fibrotic diseases.
  • VGLL3 includes human VGLL3 and mouse VGLL3. It also includes those variants.
  • the amino acid and nucleic acid sequences of variants 1, variant 2 and variant 3 of human VGLL3 are shown in SEQ ID NOs: 1 and 2 of the Sequence Listing for variant 1, SEQ ID NOs: 3 and 4 of the sequence listing for variant 2, and for variant 3, respectively. It is shown in SEQ ID NOs: 5 and 6 of the sequence listing.
  • the amino acid and nucleic acid sequences of Variants 1, Variant 2 and Variant 3 of mouse VGLL3 are shown in SEQ ID NOs: 7 and 8 of the Sequence Listing for Variant 1, SEQ ID NOs: 9 and 10 of the Sequence Listing for Variant 2, and for Variant 3, respectively.
  • VGLL3 is specifically expressed in myofibroblasts and is associated with fibrosis-related factors such as ⁇ SMA, periostin, COL1A1 (collagen 1 ⁇ 1), COL1A2 (collagen 1 ⁇ 2) and COL3A1 (collagen 3 ⁇ 1). It promotes expression and has the property of translocating to the nucleus when the surroundings become hard. Therefore, inhibitors of VGLL3 can be used for the prevention or treatment of fibrotic diseases.
  • fibrosis refers to a phenomenon in which substances called extracellular matrix such as collagen fibers increase in the skin and internal organs, and as a result, the skin and internal organs become hard, and is also called "hardening".
  • the fibrotic disease in the present invention is due to fibrosis such as heart fibrosis, liver fibrosis, kidney fibrosis, pulmonary fibrosis, systemic scleroderma, skin sclerosis, and intractable cancer such as pancreatic cancer. Means disease.
  • inhibitortion of an “inhibitor” means inhibiting or suppressing VGLL3 expression, VGLL3 activity, nuclear translocation of VGLL3 or binding of VGLL3 to DDX5.
  • examples of the VGLL3 expression inhibitor include substances that inhibit the expression of the gene or nucleic acid shown in any of the following (a) to (d): (a) The VGLL3 gene shown in SEQ ID NO: 2, 4 or 6 in the Sequence Listing, (b) Nucleic acid containing a base sequence in which one or several bases are deleted, substituted or added in the VGLL3 gene shown in SEQ ID NO: 2, 4 or 6 in the sequence listing.
  • the gene or nucleic acid in the embodiment of inhibiting the expression of a gene or nucleic acid, is a myofibroblast-specific marker molecule and a molecule that promotes fibrosis.
  • the VGLL3 gene represented by the nucleotide sequence of SEQ ID NO: 2, 4 or 6 discovered by the present inventors, or the nucleotide sequence shown in SEQ ID NO: 2, 4 or 6 of the sequence listing. Nucleic acid containing a base sequence in which one or several bases are deleted, substituted or added, or a base sequence having 90% or more identity with the base sequence shown in SEQ ID NO: 2, 4 or 6 in the sequence listing.
  • nucleic acid that hybridizes under stringent conditions with a base sequence complementary to the nucleic acid containing the base sequence shown in SEQ ID NO: 2, 4 or 6 of the sequence listing, according to SEQ ID NO: 1, 3 or 5.
  • Any nucleic acid may be used as long as it has a protein represented by an amino acid sequence or a nucleic acid having a base sequence encoding a protein having the same function as the protein.
  • it is the VGLL3 gene represented by SEQ ID NO: 2, 4 or 6 in the sequence listing.
  • one or several may be, for example, a range in which the gene of the above (b) encodes a substance having a VGLL3 function.
  • “1 or several” is, for example, 1 to 10, preferably 1 to 7, more preferably 1 to 5, still more preferably 1 to 3, particularly preferably 1 or 2 in the VGLL3 gene. is there.
  • identity is synonymous with homology or similarity.
  • “90% or more” is preferably 93% or more, more preferably 95% or more, still more preferably 98% or more.
  • the "stringent condition” may be, for example, any of a low stringent condition, a medium stringent condition, and a high stringent condition.
  • “Low stringent conditions” are, for example, 5 ⁇ SSC, 5 ⁇ Denhardt solution, 0.5% SDS, 50% formamide, 32 ° C.
  • “Medium stringent conditions” are, for example, 5 ⁇ SSC, 5 ⁇ Denhardt solution, 0.5% SDS, 50% formamide, 42 ° C.
  • “High stringent conditions” are, for example, 5 ⁇ SSC, 5 ⁇ Denhardt solution, 0.5% SDS, 50% formamide, 50 ° C.
  • the degree of stringency can be set by those skilled in the art by appropriately selecting conditions such as temperature, salt concentration, probe concentration and length, ionic strength, and time.
  • “Stringent conditions” are, for example, "Molecular Cloning: A Laboratory Manual 2nd Ed.” Edited by Sambrook et al. [Cold Spring Harbor Laboratory Press (1989). )] Etc. can also be adopted.
  • the mRNA may be any mRNA encoded by the target nucleic acid or any one encoding a protein encoded by the target nucleic acid. It is preferably an mRNA encoded by the VGLL3 gene.
  • examples of the inhibitor of VGLL3 expression include siRNA, shRNA, miRNA, antisense, ribozyme, and compounds.
  • SiRNA small interfering RNA
  • RISC RNA-induced silencing complex
  • sense strand and antisense strand oligonucleotides are synthesized by a DNA / RNA automatic synthesizer, respectively, and denatured in an appropriate annealing buffer at 90 to 95 ° C. for about 1 minute, and then 30 to 70 ° C. It can be prepared by annealing in 1 to 8 hours.
  • ShRNA short hairpin RNA
  • the shRNA may be introduced into cells by a vector and expressed by the U6 promoter or the H1 promoter, or an oligonucleotide having the shRNA sequence may be synthesized by a DNA / RNA automatic synthesizer and self-annealed by the same method as siRNA. May be prepared by.
  • the hairpin structure of the shRNA introduced into the cell is cleaved into siRNA and binds to RNA-induced silencing complex (RISC). This complex binds to and cleaves mRNA that has a sequence complementary to siRNA. As a result, gene expression is suppressed in a sequence-specific manner.
  • RISC RNA-induced silencing complex
  • MiRNA is a functional nucleic acid that is encoded on the genome and finally becomes a microRNA of about 20 bases through a multi-step production process. miRNAs are classified as functional ncRNAs (non-coding RNAs, a general term for RNAs that are not translated into proteins), and play an important role in life phenomena by regulating the expression of other genes. There is. The expression of VGLL3 can be inhibited by administering a miRNA having a specific base sequence to a living body.
  • the ribozyme of the present invention means an RNA molecule that specifically cleaves another single-stranded RNA molecule by a mechanism similar to that of a DNA-restricted endonuclease.
  • Antisense nucleic acid is a nucleic acid complementary to the target sequence. Antisense nucleic acids inhibit transcription initiation by triple-strand formation, transcription inhibition by hybrid formation with a site where an open loop structure is locally formed by RNA polymerase, and transcription inhibition by hybrid formation with RNA whose synthesis is progressing.
  • the siRNA of the present invention refers to a double-stranded RNA that suppresses the expression of a target nucleic acid, and means "RNAi agent”, “short-chain interfering RNA”, “short-chain interfering nucleic acid”, “siRNA”, and is sequence-specific.
  • RNAi agent means "short-chain interfering RNA”, “short-chain interfering nucleic acid”, “siRNA”, and is sequence-specific.
  • a nucleic acid molecule capable of inhibiting or downwardly regulating gene expression or viral replication through RNA interference (RNAi) or gene silencing. It may consist only of RNA or it may be a fusion of DNA and RNA.
  • SiRNAs, shRNAs, miRNAs, ribozymes and antisense nucleic acids may contain various chemical modifications to improve stability and activity.
  • the phosphate residue may be replaced with a chemically modified phosphate residue such as phosphorothioate (PS), methylphosphonate, or phosphorodithionate.
  • PS phosphorothioate
  • methylphosphonate methylphosphonate
  • phosphorodithionate phosphorodithionate
  • at least a part thereof may be composed of nucleic acid analogs such as peptide nucleic acid (PNA).
  • PNA peptide nucleic acid
  • siRNA, shRNA, miRNA, ribozyme and antisense nucleic acid of the present invention inhibit the expression of the target nucleic acid (VGLL3 gene), they prevent fibrosis inhibitors and thus fibrotic diseases as substances that regulate the expression of the target nucleic acid.
  • VGLL3 gene target nucleic acid
  • examples of such siRNA include siRNA having an RNA sequence shown in any of SEQ ID NOs: 40 to 51 in the sequence listing.
  • the nucleic acid having the antisense sequence of the present invention inhibits the expression of the target nucleic acid (VGLL3 gene), as a substance that regulates the expression of the target nucleic acid, a fibrosis inhibitor, and thus a pharmaceutical composition for preventing or treating a fibrotic disease. It can be used as a thing.
  • the compound or the like as an inhibitor of VGLL3 expression may be a compound or the like that inhibits or suppresses the expression of the VGLL3 gene, or may be a compound or the like that inhibits or suppresses the expression of the VGLL3 protein. However, it may be a compound or the like that inhibits or suppresses the activity of VGLL3.
  • the compounds include VGLL3 transcription factor inhibitors, VGLL3 protein translation factor inhibitors, VGLL3 proteolysis promoters, and specific binding substances for VGLL3 proteins (antibodies, antibody fragments, peptides, aptamers, low molecular weight compounds, etc.). ..
  • an antibody can be produced by immunizing an animal such as a mouse with the VGLL3 protein or a fragment thereof as an antigen. It may be a commercially available product. The antibody is preferably a monoclonal antibody.
  • the inhibitor of VGLL3 may be, for example, a substance that suppresses the expression of VGLL3 at the mRNA level or the protein level, an antagonist against VGLL3, or the like, or a substance that inhibits the activity of VGLL3. It may be.
  • antagonists to VGLL3 include substances that do not activate VGLL3 and substances that inhibit the binding of ligands to VGLL3 among specific binding substances to VGLL3.
  • the VGLL3 inhibitor in the present invention can broadly include a substance that inhibits the VGLL3-mediated fibrosis pathway and, as a result, suppresses fibrosis, and in that sense, as an inhibitor of VGLL3, G-actin Latrinclin A, which inhibits polymerization, blevisstatin, which inhibits the association of non-muscle myosin II, which is a constituent of the cytoskeleton, and actin, and kinase, which controls the phosphorylation of the myosin light chain required for cytoskeletal movement.
  • Y27632 an inhibitor of ROCK, C3 transferase (39), which inhibits the low molecular weight G protein Rho that activates ROCK, BTT-303343, an inhibitor of integrin ⁇ 1, and FAK (focal adhesion group kinase).
  • C3 transferase 39
  • FAK finacal adhesion group kinase
  • the pharmaceutical composition of the present invention contains an inhibitor of VGLL3 translocation into the nucleus.
  • VGLL3 like the transcriptional conjugation factor YAP / TAZ, migrates from extranuclear to intranuclear by mechanical stimulation, which is dependent on actin polymerization and contributes to excessive fibrosis. doing. Therefore, it is expected that inhibition of nuclear translocation of VGLL3 can inhibit, suppress, or reduce fibrosis.
  • the pharmaceutical composition of the present invention contains an inhibitor of the binding of VGLL3 and DDX5.
  • VGLL3 translocates via Rho / ROCK activity and contributes to excessive fibrosis. Therefore, it is expected that inhibition of the binding between VGLL3 and DDX5 can inhibit, suppress, and reduce fibrosis.
  • Specific examples of the inhibitor of the binding between VGLL3 and DDX5 include a peptide corresponding to the binding domain of VGLL3 with DDX5 and an inhibitory peptide corresponding to the binding domain of DDX5 with VGLL3.
  • treatment refers to (1) delaying the onset of fibrotic disease or fibrotic state; (2) slowing or stopping the progression, exacerbation or exacerbation of symptoms of fibrotic disease or fibrotic state. (3) Brings remission of the symptoms of fibrotic disease or fibrotic state; or (4) means a method or process aimed at curing fibrotic disease or fibrotic state. Treatment may be given as a precautionary measure before the onset of the disease or condition, or treatment may be given after the onset of the disease.
  • prevention means preventing the onset of fibrotic disease or fibrotic state.
  • the pharmaceutical composition usually means a drug for treating or preventing a disease, or for testing / diagnosis.
  • the pharmaceutical composition of the present invention can be formulated by a method known to those skilled in the art.
  • it can be used parenterally in the form of a sterile solution with water or other pharmaceutically acceptable liquid, or an injectable suspension.
  • pharmacologically acceptable carriers or vehicles specifically sterile water or saline, vegetable oils, emulsifiers, suspensions, surfactants, stabilizers, flavors, excipients, vehicles, preservatives.
  • the sterile composition for injection can be formulated according to the usual preparation using a vehicle such as distilled water for injection.
  • aqueous solution for injection examples include isotonic solutions containing physiological saline, glucose and other auxiliary agents (eg, D-sorbitol, D-mannose, D-mannitol, sodium chloride).
  • auxiliary agents eg, D-sorbitol, D-mannose, D-mannitol, sodium chloride.
  • Appropriate solubilizing agents such as alcohols (ethanol, etc.), polyalcohols (propylene glycol, polyethylene glycol, etc.), nonionic surfactants (polysorbate 80 (TM), HCO-50, etc.) may be used in combination.
  • oily liquid examples include sesame oil and soybean oil, and benzyl benzoate and / or benzyl alcohol may be used in combination as a solubilizing agent. It may also be blended with a buffer (eg, phosphate buffer and sodium acetate buffer), a soothing agent (eg, procaine hydrochloride), a stabilizer (eg, benzyl alcohol and phenol), and an antioxidant.
  • a buffer eg, phosphate buffer and sodium acetate buffer
  • a soothing agent eg, procaine hydrochloride
  • a stabilizer eg, benzyl alcohol and phenol
  • antioxidant e.g, benzyl alcohol and phenol
  • the pharmaceutical composition of the present invention is preferably administered by parenteral administration.
  • parenteral administration can be an injection type, a nasal administration type, a pulmonary administration type, or a transdermal administration type composition.
  • it can be administered systemically or locally by intravenous injection, intramuscular injection, intraperitoneal injection, subcutaneous injection, or the like.
  • the administration method can be appropriately selected depending on the patient's age and symptoms.
  • the dose of the pharmaceutical composition containing the polypeptide can be set, for example, in the range of 0.0001 mg to 1000 mg per kg of body weight at a time. Alternatively, for example, the dose may be 0.001 to 100,000 mg per patient, but the present invention is not necessarily limited to these values.
  • the dose and administration method vary depending on the weight, age, symptom and the like of the patient, but those skilled in the art can set an appropriate dose and administration method in consideration of these conditions.
  • the present invention in another aspect, relates to a method for preventing or treating a fibrotic disease, comprising administering an inhibitor of VGLL3 to a patient in need of such treatment or prevention.
  • the inhibitor of VGLL3 is a method for preventing or treating fibrotic disease, which is an inhibitor of VGLL3 expression, an inhibitor of nuclear translocation of VGLL3, or an inhibitor of binding of VGLL3 to DDX5. ..
  • the present invention relates to, in another aspect, an inhibitor of VGLL3 for preventing or treating fibrotic diseases.
  • the inhibitor of VGLL3 is an inhibitor of VGLL3 expression, an inhibitor of nuclear translocation of VGLL3, or an inhibitor of the binding of VGLL3 to DDX5.
  • the invention relates to the use of an inhibitor of VGLL3 to produce a medicament for preventing or treating fibrotic disease.
  • the inhibitor of VGLL3 is an inhibitor of VGLL3 expression, an inhibitor of nuclear translocation of VGLL3, or an inhibitor of binding of VGLL3 to DDX5.
  • the VGLL3 inhibitor includes an inhibitor of VGLL3 expression, an inhibitor of nuclear translocation of VGLL3 and an inhibitor of binding between VGLL3 and DDX5, and specific compounds, genes or nucleic acids thereof. Is included.
  • the present invention as another embodiment, (a) The VGLL3 gene shown in SEQ ID NO: 2, 4 or 6 in the Sequence Listing, (b) Nucleic acid containing a base sequence in which one or several bases are deleted, substituted or added in the VGLL3 gene shown in SEQ ID NO: 2, 4 or 6 in the sequence listing.
  • At least one nucleic acid molecule selected from the group consisting of siRNA, shRNA, miRNA, antisense and ribozyme of the present invention inhibits the expression of the target nucleic acid (VGLL3 gene), thus regulating the expression of the target nucleic acid.
  • VGLL3 gene target nucleic acid
  • it can be used as a fibrosis inhibitor, and thus as a pharmaceutical composition for preventing or treating a fibrosis disease.
  • the nucleic acid molecule of the present invention is expressed in a vector.
  • gene therapy often refers to treatment for a genetic disorder, but in the present invention, in order to prevent or treat a fibrotic disease or suppress the progression of the fibrotic disease. Means the treatment of.
  • gene therapy may include in vivo copy insertion of a gene into the cell of a patient with a fibrotic disease. Gene therapy may also include stopping the gene. Genetic recombination may also be used in exobibo gene therapy.
  • human stem cells, immune cells or cancer cells may be genetically modified for a variety of uses. Cells are modified to induce differentiation, transdifferentiation or reprogramming. The cells may also be modified to serve as vehicles that deliver therapeutic proteins.
  • the present invention further provides a cell containing the vector expressing the nucleic acid molecule of the present invention.
  • the cells of the present invention can be used for cell therapy for preventing or treating fibrotic diseases or suppressing the progression of fibrotic diseases.
  • the cells of the invention are myofibroblasts from the heart, lung, kidney, liver or intestine containing the vectors of the invention.
  • Example 10 of the present specification demonstrates the attenuation of cardiac fibrosis after MI in VGLL3 knockout mice, and
  • Example 11 demonstrates the attenuation of renal fibrosis after unilateral ureteral obstruction in VGLL3 knockout mice. The effect of inhibiting the expression of is confirmed.
  • the present invention provides, in another embodiment, a method of screening for candidate substances for inhibitors of VGLL3. More specifically, the step of measuring the expression level of VGLL3 in cells in the presence of the test substance, and the case where the expression level is lower than the expression level in the absence of the test substance.
  • the present invention provides a method for screening a candidate substance for a VGLL3 inhibitor, which comprises a step of determining that the test substance is a candidate substance having a VGLL3 inhibitory action. Further, as described above or described later in Examples, since an inhibitor of VGLL3 is effective in preventing or treating fibrotic diseases, a screening method for candidate substances effective in preventing or treating fibrotic diseases is provided.
  • a method for screening a candidate substance effective for prevention or treatment of fibrotic disease which comprises a step of determining that the test substance is an effective candidate substance for prevention or treatment of fibrotic disease.
  • the cells are not limited as long as they are cultured cells.
  • the cells are preferably myofibroblasts, human myofibroblasts, and more preferably heart, lung, kidney, liver or intestinal myofibroblasts.
  • the cell passage conditions can be appropriately selected depending on the cell type.
  • the test substance is a substance that can be evaluated as to whether or not it is a candidate substance having an inhibitory effect on VGLL3, and is not particularly limited.
  • compounds, proteins, peptides, nucleic acids, lipids, sugars, glycolipids, glycoproteins, metals and the like can be mentioned.
  • the method of administering the test substance is also not particularly limited.
  • the measured value that reflects the expression level of VGLL3 is not particularly limited.
  • it may be a measured value of the amount of mRNA expressed from the VGLL3 gene (number of copies, number of reads, etc.), a measured value of a protein, and chemiluminescence intensity by a reporter assay.
  • the measured value of mRNA can be obtained by using a known method such as microarray, quantitative RT-PCR method, or RNA-Seq method.
  • the measured value of protein can be measured by protein chip, ELISA method, Western blotting method, etc.
  • reporter assay activation or inactivation of the transcriptional regulatory region can be detected by a reporter assay.
  • the reporter include unstable spiny oyster shrimp luciferase, firefly luciferase, sea urchin shiitake mushroom, GFP (Green Fluorescent Protein), ⁇ -galactosidase and the like.
  • the reporter assay can be performed according to a known method. When performing a reporter assay, for example, a reporter plasmid in which a transcriptional regulatory region of the VGLL3 gene is inserted is constructed upstream of the reporter gene, this reporter plasmid is introduced into the cell, and a reporter assay cell carrying the reporter plasmid is carried out. To make.
  • the reporter plasmid can be introduced into cells by lipofection, electroporation, calcium phosphate method or the like.
  • the introduction of the reporter plasmid into the cells may be transient or stable.
  • the reporter gene When the reporter gene is luciferase, a measured value that reflects the expression of the VGLL3 gene can be obtained by measuring the chemiluminescence from the substrate by luciferase.
  • the reporter gene When the reporter gene is GFP, a measured value that reflects the expression of the VGLL3 gene can be obtained by measuring the fluorescence intensity.
  • the reporter gene When the reporter gene is ⁇ -galactosidase, a measured value reflecting the expression of the VGLL3 gene can be obtained by measuring the fluorescence intensity derived from the substrate fluorescein di- ⁇ -D-glucopyranoside.
  • the reporter assay is preferably a luciferase assay using luciferase.
  • Inhibitors of VGLL3 are effective preventive or therapeutic agents for fibrotic diseases.
  • the VGLL3 protein having the amino acid sequence set forth in SEQ ID NO: 1, 3, 5, 7, 9 or 11 of the Sequence Listing, or SEQ ID NO: 1, 3, 5, 7, of the Sequence Listing, A mutant VGLL3 protein having the substitution, deletion, or addition of one or several amino acid residues in the VGLL3 protein having the amino acid sequence shown in 9 or 11, and having the same activity as the VGLL3 protein.
  • a method for screening a substance that inhibits the function of VGLL3 protein using a protein more specifically, (1) Substitution, deletion, or addition of one or several amino acid residues in the VGLL3 protein having the amino acid sequence shown in SEQ ID NO: 1, 3, 5, 7, 9 or 11 in the sequence listing, or in the VGLL3 protein.
  • the test substance is brought into contact with the mutant VGLL3 protein having the same activity as the VGLL3 protein, or the VGLL3 protein or cells expressing the mutant VGLL3 protein.
  • a method for screening a substance that inhibits the function of the VGLL3 protein which comprises determining whether or not the test substance inhibits the function of the VGLL3 protein or the mutant VGLL3 protein.
  • SEQ ID NOs: 1, 3 and 5 in the Sequence Listing are amino acid sequences of human VGLL3 protein, and SEQ ID NOs: 7, 9 and 11 are amino acid sequences of mouse VGLL3 protein.
  • both human VGLL3 protein and mouse VGLL3 protein can be used.
  • it is a human VGLL3 protein.
  • the marker protein By fusing the target protein with the marker protein in frame and expressing it, it is possible to confirm the expression, confirm the intracellular localization, purify, etc.
  • the marker protein include FLAG epitope, hexahistidine tag (Hexa-Histidine tag), hemagglutinin tag, myc epitope and the like.
  • a protease such as enterokinase, factor Xa, and thrombin
  • the screening method of the present invention quantifies the step of culturing myofibroblasts in the presence of a test substance and the expression level of VGLL3 gene mRNA or VGLL3 protein in the cultured myofibroblasts.
  • the test substance is used for the prevention or treatment of fibrotic disease when the step and the quantified expression level of the VGLL3 gene mRNA or the VGLL3 protein are reduced as compared with the expression level in the absence of the test substance.
  • a method for screening a prophylactic or therapeutic agent for a fibrotic disease which comprises a step of determining that the agent is an agent.
  • Myofibroblasts are preferably human myofibroblasts, more preferably human heart, human lung, human kidney, human liver or human intestinal myofibroblasts.
  • Another aspect of the present invention is a method for determining the degree of fibrosis.
  • the reference amount of VGLL3 in myofibroblasts may be the amount of VGLL3 in myofibroblasts of the same subject measured prior to step (a10), and VGLL3 in healthy subjects. May be the amount of.
  • the present invention provides, in yet another aspect, a biomarker that is VGLL3 of myofibroblasts, which can determine the degree of fibrosis progression.
  • the present invention provides the use of myofibroblast VGLL3 as a biomarker capable of determining the degree of fibrosis progression.
  • VGLL3 is a myofibroblast-specific marker molecule and a molecule that promotes fibrosis, which is associated with fibrotic diseases, especially severe fibrotic diseases. It was.
  • the use of the methods, biomarkers and VGLL3 of the present invention makes it possible to predict the progression of fibrosis and is beneficial for the prevention or treatment of fibrotic diseases.
  • substances called extracellular matrix such as collagen fibers are highly increased in the skin and internal organs, and as a result, the skin and internal organs become hard, which leads to a risk of fibrotic disease. ..
  • the amount of VGLL3 in myofibroblasts may be the amount of mRNA or the amount of protein. If there is an antibody against VGLL3, it can be measured by immunological methods. For example, it can be measured by an ELISA method well known to those skilled in the art.
  • the detection of mRNA for VGLL3 can be performed, for example, by the RNA scoop method, which is a kind of super-sensitive in situ hybridization. In the RNAscope method, if the mRNA of the target molecule is expressed, it can be detected in dots by using a probe specific to that molecule. RNA can also be recovered from myofibroblasts and measured by real-time RT-PCR.
  • the myofibroblasts of the subject can be collected by biopsy and the amount of VGLL3 can be measured.
  • Myofibroblasts are preferably human myofibroblasts, more preferably human heart, human lung, human kidney, human liver or human intestinal myofibroblasts.
  • the present invention comprises a primer set for amplifying VGLL3 cDNA, a probe that specifically hybridizes to VGLL3 mRNA, or a specific binding agent for VGLL3 protein for detection of myofibroblasts.
  • a primer set for amplifying VGLL3 cDNA a probe that specifically hybridizes to VGLL3 mRNA, or a specific binding agent for VGLL3 protein for detection of myofibroblasts.
  • VGLL3 is highly expressed only in the placenta during pregnancy in normal tissues in the living body, that is, hardly expressed in the heart, liver and kidney of the living body in the normal state. , It was clarified that the expression is significantly increased only when each organ is fibrotic. We also found that VGLL3 expression is specific for myofibroblasts that perform fibrosis. Therefore, VGLL3 is a novel myofibroblast-specific marker protein.
  • the primer set is not particularly limited as long as it can amplify the cDNA of the VGLL3 gene of the animal species to be detected.
  • the probe that specifically hybridizes to VGLL3 mRNA is not particularly limited as long as it specifically hybridizes to VGLL3 gene mRNA.
  • the probe may be immobilized on a carrier to form a DNA microarray or the like.
  • the specific binding substance is the same as that described above.
  • the specific binding substance may be immobilized on a carrier to form a protein chip or the like.
  • proteins such as ⁇ -SMA and periostin have been used as markers for myofibroblasts, which are cells that execute fibrosis. However, these were all intracellular proteins. That is, conventionally, a cell membrane protein specifically expressed in myofibroblasts has not been known.
  • VGLL3 is a cell membrane protein that is not expressed in the originating cell but whose expression increases when it differentiates into myofibroblasts. Since it is a cell membrane protein, for example, by labeling an antibody specific for VGLL3 with a fluorescent or radioisotope, myofibroblasts can be visualized invasively or non-invasively.
  • Myofibroblasts are preferably human myofibroblasts, more preferably human heart, human lung, human kidney, human liver or human intestinal myofibroblasts.
  • VGLL3 is a molecule that promotes fibrosis and is associated with fibrotic diseases, especially severe fibrotic diseases. Since VGLL3 is not expressed in normal cells other than placenta, it is considered possible to prevent, prevent, and avoid fibrosis by knocking out its expression.
  • the present invention relates to cells, organs and / or tissues carrying a disrupted gene of VGLL3. For example, disruption is expected to be a gene that exhibits at least about 50%, 60%, 70%, 80%, 90%, 99% or 100% homology (at the nucleic acid or protein level). Gene suppression is also possible.
  • gene expression can be reduced by knockout, promoter modification of the gene, and / or administration of interfering RNA (knockdown).
  • knockdown it is preferable to knock out VGLL3 expression in myofibroblasts.
  • Myofibroblasts are preferably human myofibroblasts, more preferably human heart, human lung, human kidney, human liver or human intestinal myofibroblasts.
  • One or more genes in non-human animals can be knocked out using any method known in the art. For example, it involves deleting the gene for VGLL3 from the genome of a non-human animal. Knockout can also include removing all or part of the VGLL3 gene sequence from non-human animals. Knockout can be performed in any cell, organ and / or tissue in a non-human animal. For example, the knockout can be a whole body knockout. For example, the expression of the VGLL3 gene is reduced in all cells of non-human animals. Knockouts can also be specific for one or more cells, tissues and / or organs of non-human animals.
  • Knockout technology can also include gene editing.
  • gene editing can be performed using nucleases that include CRISPR-related proteins (Cas proteins such as Cas9), zinc finger nucleases (ZFNs), transcriptional activator-like effector nucleases (TALENs), and meganucleases.
  • the nuclease can be a naturally occurring nuclease, genetically modified, and / or recombinant.
  • the CRISPR / cas system may be suitable as a gene editing system.
  • the reagents used in this example were purchased from the following companies. Somnopentil (Kyoritsu Seiyaku Co., Ltd.) 10% Neutral Buffered Formalin Solution (Wako Pure Chemical Industries, Ltd.) Tissue-Tek TM OCTTM Compound (Sakura Finetek) FluorSave TM Reagent (Calbiochem) Red Blood Cell Lysis Buffer (Roche) Type II collagenase (Worthington Biochemical) Elastase (Worthington Biochemical) Isogen (Nippon Gene) RNeasy Plus Mini Kit (Qiagen) High Capacity cDNA Reverse Transcription Kit (Applied Biosystems) Luna Universal qPCR Master Mix (New England BioLabs) Paraformaldehyde (nacalai tesque) Trypsin (Sigma-Aldrich) EDTA (Wako Pure Chemical Industries, Ltd.) Dulbecco's Modified Eagle's Medium (Gibco) Fetal bovine serum (Tissue Culture
  • Example 1 Search for transcription-related factors involved in fibrosis 1-1 Preparation of experimental animals and myocardial infarction model mice 8-10 week old C57BL / 6J wild male mice were purchased from Nippon SLC Co., Ltd. Mice were weighed and anesthetized with Somnopentyl injection (50 mg / kg pentobarbital sodium) intraperitoneally and then fixed on the operating table in the supine position. The neck and chest were shaved and an incision was made in the midline of the neck under surgical microscopy to expose the trachea.
  • Somnopentyl injection 50 mg / kg pentobarbital sodium
  • a cannula was inserted into the trachea, and artificial respiration was performed with a single respiration volume of 0.5 cc and a respiration rate of 120 times / minute.
  • the heart was then exposed by an incision in the second intercostal space on the left side of the ribs.
  • Myocardial infarction was performed by ligating the anterior descending branch of the left coronary artery of the heart with a 6 mm silk blade suture. Then, the incision was sutured with a suture.
  • Mice that underwent the above treatment were included in the myocardial infarction (MI) group, and mice that underwent the same treatment except for ligation of the coronary arteries were included in the pseudo-treatment (sham) group (Fig. 1A).
  • DNA synthase is activated at 95 ° C for 60 seconds according to the protocol of Luna Universal qPCR Master Mix (New England BioLabs), and cDNA denaturation at 95 ° C for 15 seconds and elongation reaction at 60 ° C for 60 seconds are performed. 45 cycles were performed. Analysis was performed using GAPDH (glyceraldehyde-3-phosphate dehydrogenase) or 18S rRNA as an internal standard.
  • primers and TaqMan probe were purchased from Sigma-Aldrich.
  • the sequence of primers and probes is as follows; Fw: Forward, Rv: Reverse: Mouse ⁇ -smooth muscle actin ( ⁇ SMA, mouse ACTA2) Fw: 5'-GTTCTCTTCAAGGGACAAGGCTG -3'(SEQ ID NO: 13) Rv: 5'-TCCTGGTATGAGATAGCAAATCGG -3'(SEQ ID NO: 14) Probe: 5'-TACGTGCTCCTCACCCACACCGTCA -3' (SEQ ID NO: 15)
  • Human type III collagen, alpha 1 (Collagen 3 ⁇ 1, human COL3A1)
  • Fw 5'-AATTCCTGGCGTTACCTTGGT-3'(SEQ ID NO: 31)
  • Rv 5'-TGTATTCCGTCTCCTTGGTTCA -3'(SEQ ID NO: 32)
  • GPDH Mouse glyceraldehyde-3-phosphate dehydrogenase
  • Fw 5'-AATTCCTGGCGTTACCTTGGT-3'(SEQ ID NO: 34)
  • Rv 5'-TGTATTCCGTCTCCTTGGTTCA -3'(SEQ ID NO: 35)
  • Probe 5'-CCGGCTGCTGACCCCCCACTGATA -3' (SEQ ID NO: 36)
  • 18S ribosomal RNA (18S rRNA, eukaryote 18S rRNA) Fw: 5'-AATTCCTGGCGTTACCTTGGT-3'(SEQ ID NO: 37) Rv: 5'-TGTATTCCGTCTCCTTGGTTCA -3'(SEQ ID NO: 38) Probe: 5'-CCGGCTGCTGACCCCCCACTGATA -3' (SEQ ID NO: 39)
  • VGLL3 with unknown function was found by sorting based on (Fig. 1B).
  • Myofibroblasts isolated from mouse hearts after myocardial infarction model treatment were cultured on cultured polystyrene plates, transferred to low-protein adsorption-treated plates, and cultured in suspension for 7 days.
  • SMA and periostin SMA and periostin
  • the expression of myofibroblast marker proteins such as FIG. 1D, E, F
  • the expression of the stem cell marker Oct-4 Fig. 1G
  • FIG. 1G the expression of the stem cell marker Oct-4
  • DNA microarray analysis was used to select genes that were significantly down-regulated (less than 1/16) in dedifferentiated myofibroblasts and significantly increased (> 16-fold) with redifferentiation (FIG. 1J).
  • genes whose expression levels were significantly increased in mouse hearts (2 to the 1.5th power or higher) by treatment for inducing myocardial infarction were further selected.
  • VGLL3 a molecule involved in transcription.
  • VGLL3 Expression distribution of VGLL3 found by search
  • the protein expression distribution of VGLL3 found by search in each human organ was investigated from The Human Protein ATLAS (http://www.proteinatlas.org/). ..
  • VGLL3 is highly expressed only in the placenta during pregnancy in normal tissues in vivo (Fig. 1K). This suggests that VGLL3 may be a target molecule for the development of innovative fibrotic therapies.
  • VGLL3 Changes in VGLL3 expression level in response to mechanical stimulation VGLL3 is similar to myofibroblast marker proteins SMA and periostin (Fig. 1D, E, F), myofibroblasts and redifferentiated myofibroblasts. It was investigated whether it was expressed in. As a result, the mRNA level of VGLL3 was reduced in myofibroblasts dedifferentiated by the disappearance of mechanical stimulation after being suspended and cultured for 7 days, and the cells were cultured again on a polystyrene plate and redifferentiated by mechanical stimulation. The expression level of myofibroblasts was significantly increased (Fig. 1L). This indicates that the expression level of VGLL3 is increased by mechanical stimulation.
  • VGLL1 5'-CTCTTCTTGGACAATTGCACAGCCAGCAGC-3' (SEQ ID NO: 52) and 5'-CTTTGGAGATGGGCTTCTTTCATCATCAAG-3' (SEQ ID NO: 53);
  • VGLL2 5'-CAAAGCACACAGAAGCTCTGGACCCTGGAG-3' (SEQ ID NO: 54) and 5'-CTGCATTCCCTCCTCCGCTTACCTGAGTCC-3' (SEQ ID NO: 55);
  • VGLL3 5'-GACATTGGGTCAGTAGTGGATGAACACTTC-3'(SEQ ID NO: 56) and 5'-GACT
  • VGLL4 is expressed in addition to VGLL3 in muscle fibroblasts isolated from the heart (Fig. 1M). Based on this result, the expression levels of VGLL3 and VGLL4 in myofibroblasts isolated from the heart were absolutely quantified (Fig. 1N).
  • VGLL3 Fw5'-TGCCCTACAGCCTGCTATCA-3'(SEQ ID NO: 60), Rv5 '-CTCCTCCTCCTCCTCCTCTTG-3' (SEQ ID NO: 61), Probe 5'-CTTGCTGTATACCGCTAACTTCTGCTGGC-3' (SEQ ID NO: 62); (SEQ ID NO: 64), probe 5'-CCTGTACGCATCTCTCCCCAGCCTCAT-3' (SEQ ID NO: 65)) was used to draw a standard curve.
  • CCD-18Co Changes in fibrosis-related factors and VGLL3 expression levels in response to mechanical stimulation in human intestinal myofibroblasts
  • CCD-18Co which is the cell line of human intestinal myofibroblasts instead of heart myofibroblasts Except for using cells (ATCC), the expression levels of ACTA2, various collagens, fibrillin-1 and VGLL3 mRNAs are measured in real time by substantially following the method described in 1-3: Search for transcription-related factors. Measured by (Fig. 1O).
  • Fig. 1O Search for transcription-related factors.
  • Example 2 Specific expression of VGLL3 in myofibroblasts during myocardial infarction
  • VGLL3 Using cardiac sections 3 days after MI treatment, co-staining of an antibody against VGLL3 and an antibody against ⁇ SMA, which is a marker molecule of myofibroblasts, was performed. As a result, it was found that the stained image of VGLL3 almost overlapped with the stained image of ⁇ SMA (Fig. 2A).
  • VGLL3 is specifically expressed in myofibroblasts, not in macrophages or cardiomyocytes, during myocardial infarction.
  • the immunohistochemical staining was performed as follows. The heart removed from the mice after MI treatment was fixed overnight with 4% PFA solution, the PFA solution was replaced with a sucrose solution, and then embedded with Tissue-Tek TM OCTTM Compound (Sakura Finetek) in liquid nitrogen. The frozen sample was used as a frozen sample. Frozen specimens were sliced into 6 ⁇ m with Cryostat CM1100 (Leica Biosystems) and air-dried for 1 hour. Frozen sections were subjected to membrane permeation treatment with 0.1% Triton X-100 / PBS for 5 minutes, blocked in 5% BSA / PBS for 1 hour at room temperature, and diluted with 5% BSA / PBS.
  • RNAscope is a type of highly sensitive in situ hybridization (28). RNAscope followed the protocol of Advanced Cell Diagnostics. First, the heart was removed from the mice treated with myocardial infarction (MI), the atrium was removed, and the mice were immediately immersed in 10% neutral buffered formalin solution and fixed at room temperature for 16 to 32 hours. Then, it was embedded in paraffin to prepare a tissue section of 5 ⁇ m. The staining of heart specimens of human myocardial infarction patients was conducted as a joint research with the cooperation of Professor Toru Tanaka of Jichi Medical University.
  • the tissue section was incubated at 60 ° C. for 1 hour, and then paraffin was removed using xylene and 100% ethanol. Then, a hydrogen peroxide solution was added dropwise to the tissue section and reacted at room temperature for 10 minutes to inactivate the endogenous peroxidase. After washing with distilled water, an antigen activation solution is further added dropwise, reacted at 98 to 102 ° C. for 30 minutes using a hot plate, washed with distilled water, then the protease solution is added dropwise, and the HybEZTM oven (Advanced Cell Diagnostics) is used. ) The reaction was carried out at 40 ° C. for 30 minutes.
  • a probe for VGLL3 was added dropwise to the tissue section, and the reaction was carried out in a HybEZTM oven at 40 ° C. for 2 hours, and then a signal amplification reaction was carried out with an Amp solution. Subsequently, the reaction was carried out with a Fast Red mixture or a fluorescently labeled Tyramide to detect a signal of VGLL3 mRNA.
  • 10% BSA / PBS was reacted at room temperature for 1 hour (blocking), and the primary antibody was reacted at 4 ° C. overnight.
  • the fluorescently labeled secondary antibody was reacted at room temperature for 1 hour, stained with DAPI nuclei, and then incubated at 60 ° C. for at least 15 minutes and dried.
  • the sections enclosed with EcoMount were imaged with a confocal microscope (Zeiss, LSM700).
  • VGLL3 mRNA detection of VGLL3 and immunostaining with ⁇ SMA antibody were performed on the same section.
  • co-detection of periostin mRNA and VGLL3 mRNA, which are famous as marker molecules for myofibroblasts other than ⁇ SMA was also performed.
  • periostin mRNA and VGLL3 mRNA which are famous as marker molecules for myofibroblasts other than ⁇ SMA
  • VGLL3 mRNA was found in both ⁇ SMA-positive and periostin-positive myofibroblasts present in the infarcted region (Fig. 2D, 2E).
  • VGLL3 mRNA expression was scarcely observed in the sham-treated (sham) group of hearts (Fig. 2F).
  • VGLL3 is hardly expressed in the normal heart, but is specifically expressed in myofibroblasts that appear during myocardial infarction. Furthermore, in the heart specimens of human myocardial infarction patients, VGLL3 mRNA signals were also observed in ⁇ SMA-positive myofibroblasts (Fig. 2G).
  • Example 3 Mechanical stimulus-dependent cytoplasmic to nuclear transfer ability in VGLL3
  • the infarcted area is 3 compared to the non-infarcted area due to the excessive accumulation of extracellular matrix such as collagen in the infarcted area of the heart that has undergone myocardial infarction. It has been reported to be twice to seven times as hard.
  • transcription-coupled factors such as MRTF (myocardin-related transcription factor) and YAP1 (Yes-associated protein 1) migrate from the cytoplasm into the nucleus in response to changes in pericellular hardness (mechanical stimulation) and are downstream. By regulating the activity of transcription factors, it promotes the expression of fibrosis-related factors such as collagen and CTGF (connective tissue growth factor) (Non-Patent Document 9).
  • VGLL3 is specifically expressed in myofibroblasts that appear in the fibrotic region of the infarcted region, and the expression transition of VGLL3 in the mouse heart after myocardial infarction is very similar to that of fibrosis-related factors. (Figs. 1 and 2). From these facts, like MRTF and YAP1, VGLL3 senses the hardness of the infarcted area, that is, the change in extracellular mechanical stimulus, transfers from the cytoplasm to the nucleus, and regulates the expression of fibrosis-related factors. I thought it might be.
  • Example 3-1 Localization of VGLL3 in the cytoplasm and nucleus First, it was examined in vitro whether the intracellular localization of VGLL3 was changed by mechanical stimulation. Myofibroblasts were isolated from the heart 3 days after MI treatment, and cultured in an adherent state and in a floating state. Isolation of myofibroblasts was performed as follows. On the 3rd day after MI treatment, the heart was removed from the mouse, the atrium was removed, and then the ventricles were divided into 15-20 pieces.
  • the heart pieces were shaken 10 times at 37 ° C for 10 minutes in a type II collagenase solution (0.1% type II collagenase / 0.01% elastase / PBS) to recover the extracellular fluid containing myofibroblasts.
  • a type II collagenase solution (0.1% type II collagenase / 0.01% elastase / PBS)
  • the erythrocyte component was removed by Red Blood Cell Lysis Buffer (Roche), the cells were suspended in 10% FBS / 1% penicillin / streptomycin / DMEM, and then the cells were seeded on a culture plate. After culturing in a CO 2 incubator overnight, non-adhesive cells were removed by PBS washing and trypsin-EDTA-adhered cells were collected.
  • the cells were reacted with a magnetic bead-labeled CD45 antibody for 30 minutes, and CD45-positive blood cells were removed by MACS magnetic cell separation using an MS column, and CD45 (-) cells were recovered.
  • the CD45 (-) cells were reacted with APC-labeled PDGFR ⁇ (myofibroblast membrane surface marker) antibody, then reacted with magnetic bead-labeled anti-APC antibody for 30 minutes, and by MACS magnetic cell separation method. , PDGFR ⁇ (+) myofibroblasts were collected.
  • Myofibroblasts isolated from the heart 3 days after MI treatment were cultured under the following conditions with different mechanical stimuli, and used as samples for immune cell staining.
  • Myofibroblasts were seeded on a 35-cm diameter glass bottom dish (IWAKI) coated with poly-L-lysine (Sigma-Aldrich), cultured overnight in a CO 2 incubator, and adhered to the dish. Used as a sample of.
  • myofibroblasts cultured in a low-adsorption culture dish (Sumitomo Bakelite) in a CO 2 incubator for 2 hours in a floating state were used as samples under floating conditions.
  • immune cell staining was performed as follows.
  • Myofibroblasts cultured by the above method were fixed in 1% PFA / PBS for 15 minutes, washed with PBS, added with 6 ⁇ M CellTrace Far Red solution (Thermo Fisher Scientific), and incubated in a CO 2 incubator for 30 minutes. .. After that, membrane permeation treatment was performed using 0.5% saponin / PBS (sample of condition 1) or 0.1% Triton X-100 / PBS (sample of conditions 2 to 4), and 1 in 5% BSA / PBS at room temperature. After blocking for hours, it was allowed to stand overnight at 4 ° C. in a primary antibody solution diluted with 5% BSA / PBS.
  • the image was taken with a confocal microscope (LSM700, Carl Zeiss).
  • the nuclear / cytoplasmic ratio (Nuc / Cyt ratio), which is a parameter of nuclear localization of VGLL3 and YAP1, was calculated from the average brightness of each factor in the nucleus and cytoplasm by image analysis using ImageJ software (NIH). ..
  • VGLL3 was strongly localized in the nucleus in myofibroblasts cultured under the adhesive state, that is, under the condition of mechanical stimulation (Fig. 3A).
  • Fig. 3A myofibroblasts cultured in a floating state, that is, under conditions without mechanical stimulation
  • VGLL3 was strongly localized in the cytoplasm (Fig. 3A).
  • the abundance ratio (Nuc / Cyt ratio) of VGLL3 in the nucleus and cytoplasm was calculated.
  • the value of the Nuc / Cyt ratio approaches 1, and the more it is localized in the nucleus, the larger the value (29-31).
  • the Nuc / Cyt ratio of VGLL3 was significantly increased in the adhered state as compared with the floating state (Fig. 3A). From this, it was considered that VGLL3 was transferred into the nucleus by the adhesive stimulation.
  • myofibroblast YAP1 also migrated to the outside of the nucleus in a floating state and into the nucleus in an adherent state, similar to VGLL3 (Fig. 3B).
  • Example 3-2 Localization of VGLL3 in overexpression system
  • FLAG-labeled VGLL3 using a retrovirus was used. Overexpressed myofibroblasts were stained with anti-FLAG antibody and examined for intracellular localization in the floating and adherent states.
  • Gene transfer into myofibroblasts using a retrovirus is as follows. FLAG-tag-labeled VGLL3 / pMXs-puro or pMXs-puro as a control was gene-transduced into PLAT-E cells, which are retrovirus packaging cells, using X-treme GENE9 (Roche).
  • the cells were cultured for 24 hours and the medium was exchanged. After further culturing for 24 hours, the culture supernatant was centrifuged (1500 ⁇ rpm, 5 min, 4 ° C twice) to remove impurities, and used as a retrovirus solution.
  • a retrovirus solution and 10 ⁇ g / mL polybrene were added to myofibroblasts isolated from the heart 3 days after MI treatment, and gene transfer was performed. After 6 hours, an equal volume of 10% FBS / 1% penicillin / streptomycin / DMEM was added to the retrovirus solution, and the cells were cultured for another 18 hours.
  • the transcription factor VGLL3 changes the intracellular localization depending on the presence or absence of the adhesive state, as in the case of the endogenous case (Fig. 3C).
  • Example 3-3 Changes in localization of VGLL3 over time during adhesion time
  • Myofibroblasts cultured for 2 hours under floating conditions were seeded on a 35-cm diameter glass bottom dish coated with poly-L-lysine. , 30 minutes after seeding and 1 hour, 2 hours, 4 hours cells were used as samples.
  • the immune cell staining described in Example 3-1 was performed in the same manner. It was found that when myofibroblasts cultured in a floating state were reattached to the culture dish, VGLL3 localized in the cytoplasm was transferred into the nucleus (Fig. 3D). When this localization change was examined over time, the intranuclear translocation of VGLL3 increased significantly as the adhesion time increased (Fig. 3D). From the above results, it was clarified that VGLL3 is a factor that translocates from the cytoplasm to the nucleus depending on mechanical stimulation.
  • Example 4 Intranuclear migration of VGLL3, which depends on pericellular hardness In fibrotic organs, tissue becomes stiff due to excessive accumulation of extracellular matrix.
  • the elastic modulus (kPa) is widely used as an index of the hardness of an organ. For example, it has been reported that the elastic modulus of the heart under normal conditions is about 10 kPa, whereas the elastic modulus increases to about 35 to 70 kPa when myocardial infarction occurs (Fig. 4A).
  • the elastic modulus of plastic or glass culture dishes used for cell culture is 2 to 4 ⁇ 10 6 kPa, which is extremely hard compared to living organisms (Fig. 4A). Therefore, in order to clarify the physiological function of VGLL3, it is necessary to analyze the behavior of VGLL3 in an environment with hardness close to that of a living body.
  • myofibroblasts were cultured on a hydrogel plate of 1 kPa to 50 kPa that mimics the hardness of organs during normal or fibrosis, and how the localization of VGLL3 changes was investigated.
  • Myofibroblasts isolated from the heart 3 days after MI treatment were cultured under the following conditions with different mechanical stimuli, and used as samples for immune cell staining.
  • Myofibroblasts were seeded on a 35-cm diameter Softview Easy coat hydrogel glass bottom dish (Matrigen) coated with poly-L-lysine, cultured overnight in a CO 2 incubator, and adhered to the dish as a sample. used.
  • the immune cell staining described in Example 3-1 was performed in the same manner.
  • VGLL3 was widely localized in the whole cell in the 1 kPa hide gel plate, whereas it was more localized in the nucleus in the 50 kPa hydrogel (Fig. 4B).
  • Fig. 4B From the quantitative results of the Nuc / Cyt ratio, it was clarified that the intranuclear translocation of VGLL3 is promoted as the elastic modulus of Hydegel increases (Fig. 4B). From the above results, it was clarified that VGLL3 is a factor that changes the intracellular localization even in an environment close to a living body and translocates into the nucleus depending on the hardness around the cell.
  • Example 5 Control by Cytoskeleton Polymerization in Cytoskeleton Translocation of VGLL3
  • Rho a low molecular weight G protein
  • spherical actin Globular, G-actin
  • filamentous actin filamentous, F
  • myofibroblasts were treated with an inhibitor of cytoskeleton formation and the localization of VGLL3 was observed.
  • Myofibroblasts isolated from the heart 3 days after MI treatment were cultured under the following conditions with different mechanical stimuli, and used as samples for immune cell staining.
  • Myofibroblasts were seeded on a 35-cm diameter glass bottom dish coated with poly-L-lysine and cultured overnight in a CO 2 incubator. The following inhibitors were then added (inhibitor concentration indicates final concentration): Latrunculin A, Lat. A (2 ⁇ M, abcam), Blebbistatin, Blebbist.
  • Example 3-1 The stimulation time was 24 hours only for VS-4718, and 4 hours for the others.
  • the immune cell staining described in Example 3-1 was performed in the same manner.
  • Latrunculin A (Lat. A), which inhibits the polymerization of G-actin, and Blebbist. (37), which inhibits the association of actin with non-muscle myosin II, which is a constituent molecule of the cytoskeleton.
  • Y27632 (38), which is an inhibitor of ROCK, which is a kinase that controls phosphorylation of the myosin light chain required for cytoskeletal motility, and C3 transfer enzyme, which inhibits the low-molecular-weight G protein Rho that activates ROCK.
  • Example 6 Regulation of VGLL3 translocation into the nucleus by activation of focal adhesion spots
  • the Rho / ROCK pathway that regulates cytoskeleton formation and cell motility is controlled by various upstreams such as tyrosine kinase type receptors, G protein-coupled receptors, and focal adhesion spots. It is known that activity is regulated (40).
  • focal adhesion is an aggregate of adhesion proteins such as integrins, and by binding to extracellular matrix such as collagen and actin filaments, which are the cytoskeleton, the hardness of the extracellular environment and other factors are mechanical. It is thought to play a role in transmitting various stimuli into the cell (41, 42).
  • Example 7 Increased expression of fibrosis-related factors in myofibroblasts by VGLL3 From the results so far, VGLL3 is a molecule that is strongly expressed in myofibroblasts, accepts the hardness of extracellular matrix, and translocates into the nucleus. Became clear. It is known that myofibroblasts are activated by hardening the extracellular matrix during fibrosis, and the fibrotic ability is increased (Non-Patent Document 5). Therefore, in order to clarify whether VGLL3 translocated into the nucleus is involved in the production of fibrosis-related factors in myofibroblasts, siRNA was used to knock down VGLL3 in myofibroblasts, and a real-time RT-PCR method was performed. The mRNA expression level of fibrosis-related factors was measured by.
  • siRNAs used are:
  • siRNA into myofibroblasts was performed according to the protocol of lipofectamine RNAiMAX (invitrogen). Specifically, the optimal amount of siRNA and lipofectamine RNA iMAX when introducing siRNA into myofibroblasts isolated from the heart 3 days after MI treatment, or the human colon-derived myofibroblast line CCD-18co (ATCC). Evaluated and determined the amount of FAM-labeled siRNA introduced using FACS. SiRNA (Ambion) against VGLL3 or Silencer Select Negative Control no. 1 siRNA (Ambion) was introduced into myofibroblasts cultured in 10% FBS / 1% penicillin / streptomycin / DMEM using lipofectamine RNAiMAX. Four hours later, medium exchange (10% FBS / 1% penicillin / streptomycin / DMEM) was performed. 96 hours after siRNA introduction, total RNA was recovered from each cell using RNeasyPlusMiniKit.
  • VGLL3 is a factor that promotes fibrosis by controlling extracellular matrix production from myofibroblasts.
  • VGLL3 is a factor that promotes fibrosis by controlling extracellular matrix production not only in heart but also in mouse myofibroblasts in liver.
  • Example 8 Search for proteins that interact directly with VGLL3 FLAF-VGLL3 was forcibly expressed in muscle fibroblasts isolated from the heart, and immunoprecipitation was performed with an anti-FLAG antibody. The immunoprecipitate was then analyzed using mass spectrometry to identify VGLL3 binding protein candidates (FIG. 8A).
  • a binding protein candidate Tead3, which is a member of the Tead family protein, was discovered (Fig. 8A). It has been reported to interact with VGLL family proteins (Dev Genes Evol (2016) 226: 297-315 DOI 10.1007 / s00427-016-0546-3). Therefore, we investigated the effect of Tead3 on the expression of fibrosis-related genes. However, siRNA treatment of Tead3 did not affect the expression of fibrosis-related genes in myocardial fibroblasts (Fig. 9), which is related to Tead3's VGLL3-mediated fibrosis-related pathway. It suggests not.
  • DDX5 which is known to be involved in RNA editing and transcription of various genes
  • DDX17 which has an amino acid sequence similar to DDX5
  • DDX5A FLAG-VGLL3 was overexpressed in myofibroblasts and the cells were immunoprecipitated with anti-FLAG antibody. Immunoprecipitation experiments showed that VGLL3 forms a complex with DDX5 (Fig. 8B).
  • DDX5 interacts directly with VGLL3.
  • a GST pull-down assay using recombinant GST-VGLL3 and His-DDX5 proteins revealed that DDX5 is a protein that binds directly to VGLL3 (Fig. 8C).
  • the N-terminal only mutant or C-terminal only mutant and HA-DDX5 shown in FIG. 8F were overexpressed in NIH3T3 cells using a retrovirus, and immunoprecipitation was performed with an anti-FLAG antibody. Then, Western blotting was performed with an anti-HA antibody. As a result, it was found that the domain of VGLL3 required for interaction with DDX5 is the C-terminal (124 to 325) (Fig. 8G).
  • Example 9 Regulation of DDX5 on Fibrotic Gene Expression in Myofibroblasts
  • DDX5 was knocked down in myocardial fibroblasts and the expression levels of intracellular collagen, periostin, fibrillin-1 and other fibrous genes were evaluated by real-time RT-PCR, these fibrous genes were evaluated. It was found that the expression level was significantly reduced (Fig. 10A). That is, DDX5 promotes the expression of these genes.
  • miR-29b (SEQ ID NO: 66: uagcaccauuugaaaucaguguu) is known to bind to various collagen mRNAs including Col1a1 and lead to degradation of the mRNA (Van Rooij, E. et al. Dysregulation). of microRNAs after myocardial infarction reveals a role of miR-29 in cardiac fibrosis. Proc. Natl. Acad. Sci. USA, 13027-13032 (2008)), expression of this miR29b in myocardial fibrosis cells knocked down by DDX5 It was examined by real-time RT-PCR (Fig. 10B).
  • RNA immunoprecipitation using DDX5 antibody was performed on myofibroblasts isolated from fibrotic heart, and a primer specific to Pri-miR29b-1 (ABI Mm03306189_pri) or Pri-miR29b-2 (ABI Mm03307196_pri). PCR was performed using the set (Fig. 10D). As a result, it was clarified that DDX5 binds to Pri-miR29b-1 and Pri-miR29b-2. This indicates that DDX5 may bind to Pri-miR29b-1, Pri-miR29b-2 and suppress the production of miR-29b, resulting in an increase in collagen content.
  • Example 10 Attenuation of cardiac fibrosis after MI in VGLL3 knockout mice The contribution of VGLL3 to fibrosis was investigated in vivo.
  • VGLL3 KO mice were established and underwent MI surgery (permanent occlusion of the left anterior descending artery) to induce cardiomyocyte death and subsequent fibrosis by myofibroblasts to replace the injured area.
  • MI surgery permanent occlusion of the left anterior descending artery
  • the infarcted heart was removed from the mouse and divided into an infarcted part and a non-infarcted part.
  • Total RNA was collected from each region and the mRNA expression level of fibrosis-related genes in each region was measured.
  • VGLL3 undergoes unilateral ureteral obstruction (UUO) model treatment in wild-type (WT) mice specifically expressed in fibrotic kidney myofibroblasts, and renal recovery 10 days after treatment is performed in real-time RT.
  • UUO unilateral ureteral obstruction
  • Fig. 12A The expression level of VGLL3 mRNA was evaluated by PCR (Fig. 12A). As a result, it was clarified that the expression level of VGLL3 mRNA is also increased in the kidney by fibrosis.
  • unilateral ureteral obstruction (UUO) model treatment was performed, and immunostaining with ⁇ SMA antibody and in situ hybridization to VGLL3 were simultaneously performed on wild-type mouse kidney sections in which fibrosis was induced (Fig. 12B). As a result, it was clarified that the VGLL3 signal appears in ⁇ SMA-positive cells.
  • Example 12 Evaluation of VGLL3 mRNA expression in liver disease
  • Wild-type (WT) mice were fed a choline-deficient high-fat diet, methionine weight loss, and 0.1% methionine addition for 10 weeks to induce non-alcoholic steatohepatitis (NASH).
  • NASH non-alcoholic steatohepatitis
  • the liver was collected and the expression level of VGLL3 mRNA was evaluated by real-time RT-PCR (Fig. 13A). As a result, it was clarified that the expression level of VGLL3 mRNA is also increased in the liver by fibrosis.
  • mRNAs of Cyp7a1, Cd68, and ACTA2 which are marker molecules of activated stellate cells in the regenerated liver.
  • the mouse liver in which fibrosis was induced by administration of CCL4 (carbon tetrachloride) was enzymatically treated, centrifuged at 50 g, and the precipitated cells were collected as hepatocytes (HC).
  • CCL4 carbon tetrachloride
  • HC hepatocytes
  • magnetic cell separation was performed on non-precipitated cells using anti-F4 / 80 antibody, and F4 / 80 positive cells were activated as Kupffer cells (KC) and F4 / 80 negative cells were activated.
  • Collected as cells (HSC) myofibroblasts in the liver).
  • Example 13 Evaluation of VGLL3 mRNA expression in pulmonary fibrosis A 6-8 week old female mouse was cannulated under somnopentyl anesthesia and a single dose of bleomycin solution (1.5 ⁇ g / g) or saline was injected into the trachea using a syringe. It was administered. Mice treated as described above were classified into a bleomycin (BLM) -administered group and a saline (Saline) -administered group, respectively. On the 14th day after BLM administration, the abdomen was opened under anesthesia by intraperitoneal administration of somnopentyl injection, blood was removed by amputation of the abdominal aorta, and the lungs were removed. RNA was recovered from the removed lung and the expression level of collagen was evaluated by real-time RT-PCR (Fig. 14). As a result, it was clarified that the expression level of VGLL3 mRNA is also increased in the lung by fibrosis.
  • Rho kinases critical mediators of multiple profibrotic processes and rational targets for new therapies for pulmonary fibrosis. Pharmacological reviews 67, 103-117, doi: 10.1124 / pr.114.009381 (2015) ). 34. Vitriol, E. A. et al. Two functionally distinct sources of actin communicating supply the leading edge of lamellipodia. Cell reports 11, 433-445, doi: 10.1016 / j.celrep. 2015.03.033 (2015). 35. Vishavkarma, R. et al. Role of actin filaments in correlating nuclear shape and cell spreading.
  • the present invention it is possible to identify a marker protein of myofibroblasts and provide a technique for preventing or treating fibrotic diseases.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Physics & Mathematics (AREA)
  • Epidemiology (AREA)
  • Analytical Chemistry (AREA)
  • Immunology (AREA)
  • Plant Pathology (AREA)
  • Cell Biology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Toxicology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

Le but de la présente invention est d'identifier une protéine marqueur pour un myofibroblaste et de fournir une technique de prévention ou de traitement d'une fibrose.　L'invention concerne également une composition pharmaceutique destinée à prévenir ou à traiter une fibrose, qui contient une substance inhibitrice de VGLL3.
PCT/JP2020/028361 2019-07-24 2020-07-22 Prévention ou traitement d'une fibrose ciblant le facteur associé à la transcription WO2021015218A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
JP2019-136101 2019-07-24
JP2019136101 2019-07-24

Publications (1)

Publication Number Publication Date
WO2021015218A1 true WO2021015218A1 (fr) 2021-01-28

Family

ID=74194220

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/JP2020/028361 WO2021015218A1 (fr) 2019-07-24 2020-07-22 Prévention ou traitement d'une fibrose ciblant le facteur associé à la transcription

Country Status (1)

Country Link
WO (1) WO2021015218A1 (fr)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2013502435A (ja) * 2009-08-21 2013-01-24 ギリアド バイオロジクス，インク． 線維性肺疾患の処置のための方法および組成物
JP2016510769A (ja) * 2013-03-15 2016-04-11 プロメティック・バイオサイエンシーズ・インコーポレイテッドＰｒｏＭｅｔｉｃ ＢｉｏＳｃｉｅｎｃｅｓ Ｉｎｃ． 肺線維症、肝線維症、皮膚線維症、及び心線維症の治療のための置換芳香族化合物
JP2019508398A (ja) * 2016-02-22 2019-03-28 オステオニューロゲン インコーポレイテッドＯｓｔｅｏｎｅｕｒｏｇｅｎ Ｉｎｃ． クロモン誘導体の上皮間葉移行抑制活性を利用した線維症予防及び治療用医薬組成物としての新規用途

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2013502435A (ja) * 2009-08-21 2013-01-24 ギリアド バイオロジクス，インク． 線維性肺疾患の処置のための方法および組成物
JP2016510769A (ja) * 2013-03-15 2016-04-11 プロメティック・バイオサイエンシーズ・インコーポレイテッドＰｒｏＭｅｔｉｃ ＢｉｏＳｃｉｅｎｃｅｓ Ｉｎｃ． 肺線維症、肝線維症、皮膚線維症、及び心線維症の治療のための置換芳香族化合物
JP2019508398A (ja) * 2016-02-22 2019-03-28 オステオニューロゲン インコーポレイテッドＯｓｔｅｏｎｅｕｒｏｇｅｎ Ｉｎｃ． クロモン誘導体の上皮間葉移行抑制活性を利用した線維症予防及び治療用医薬組成物としての新規用途

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
FIGEAC, N. ET AL.: "VGLL3 operates via TEAD1, TEAD3 and TEAD4 to influence myogenesis in skeletal muscle", J CELL SCI, vol. 132, no. 13, 5 July 2019 (2019-07-05), pages jcs225946, XP055786047, ISSN: 0021- 9533 *
SUGINO, AYUMI ET AL.: "Enhancement of epithelial-mesenchymal transition by TGF-beta signal downstream gene", THE 62ND KANTO BRANCH CONFERENCE OF THE PHARMACEUTICAL SOCIETY OF JAPAN, 10 September 2018 (2018-09-10), pages 113 *

Similar Documents

Publication Publication Date Title
Fang et al. MicroRNA‐29b suppresses tumor angiogenesis, invasion, and metastasis by regulating matrix metalloproteinase 2 expression
Cao et al. Neuropilin-2 promotes extravasation and metastasis by interacting with endothelial α5 integrin
Seaman et al. Genes that distinguish physiological and pathological angiogenesis
Khan et al. EDB fibronectin and angiogenesis–a novel mechanistic pathway
Zhang et al. Targeting KDM4A epigenetically activates tumor-cell-intrinsic immunity by inducing DNA replication stress
US9610332B2 (en) Compositions and methods for modulating BRD4 bioactivity
Trimmer et al. CAV1 inhibits metastatic potential in melanomas through suppression of the integrin/Src/FAK signaling pathway
US20210380712A1 (en) Targeting metastasis stem cells through a fatty acid receptor (cd36)
Lamour et al. Selective osteopontin knockdown exerts anti‐tumoral activity in a human glioblastoma model
JP6437467B2 (ja) 線維化疾患治療において有用な分子標的及び化合物、並びにこれらの同定方法
Santra et al. Ectopic decorin expression up‐regulates VEGF expression in mouse cerebral endothelial cells via activation of the transcription factors Sp1, HIF1α, and Stat3
US20170202910A1 (en) Differentiation marker and differentiation control of eye cell
Vu-Phan et al. The thyroid cancer PAX8–PPARG fusion protein activates Wnt/TCF-responsive cells that have a transformed phenotype
CN111655724A (zh) Smc介导的疾病的治疗
Li et al. MicroRNA‐129‐1‐3p regulates cyclic stretch–induced endothelial progenitor cell differentiation by targeting Runx2
CN112011614A (zh) Kmt5a在调控胶质瘤干细胞特性及胶质瘤诊治中的应用
CA3146962A1 (fr) Traitement de troubles d'angiogenese
WO2021015218A1 (fr) Prévention ou traitement d'une fibrose ciblant le facteur associé à la transcription
KR101974509B1 (ko) 보체 단백질의 간암 진단 용도
US20210164982A1 (en) Pharmaceutical use of actinin-4 involved in induction of cervical cancer
US20220135983A1 (en) Prevention or treatment of fibrotic disease
WO2014034798A1 (fr) Méthode de détection d'un cancer, médicament à usage diagnostique et nécessaire de diagnostic d'un cancer, et composition pharmaceutique utilisable en vue du traitement d'un cancer
KR101666598B1 (ko) Ndrg2 발현 음성 담낭암 환자에서 mmp-19를 타겟으로 한 담낭암 치료용 약학적 조성물 및 이를 이용한 담낭암의 성장 억제, 전이 억제 및 치료방법
CN117106894A (zh) Nkrf在病理性心脏重构诊治中的应用
Shi et al. MicroRNA-19a-3p augments TGF-β1-induced cardiac fibroblast activation via targeting BAMBI

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20844929

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 20844929

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: JP