WO2020223439A1 - Aurones et méthodes d'utilisation d'aurones pour traiter la tuberculose - Google Patents

Aurones et méthodes d'utilisation d'aurones pour traiter la tuberculose Download PDF

Info

Publication number
WO2020223439A1
WO2020223439A1 PCT/US2020/030623 US2020030623W WO2020223439A1 WO 2020223439 A1 WO2020223439 A1 WO 2020223439A1 US 2020030623 W US2020030623 W US 2020030623W WO 2020223439 A1 WO2020223439 A1 WO 2020223439A1
Authority
WO
WIPO (PCT)
Prior art keywords
aurone
group
mtb
aurones
infection
Prior art date
Application number
PCT/US2020/030623
Other languages
English (en)
Inventor
Ying KONG
Dong Yang
Zachary E. Taylor
Scott HANDY
Elliot Altman
Original Assignee
Middle Tennessee State University
University Of Tennessee Research Foundation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Middle Tennessee State University, University Of Tennessee Research Foundation filed Critical Middle Tennessee State University
Publication of WO2020223439A1 publication Critical patent/WO2020223439A1/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/335—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
    • A61K31/34—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having five-membered rings with one oxygen as the only ring hetero atom, e.g. isosorbide
    • A61K31/343—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having five-membered rings with one oxygen as the only ring hetero atom, e.g. isosorbide condensed with a carbocyclic ring, e.g. coumaran, bufuralol, befunolol, clobenfurol, amiodarone
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/40—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil
    • A61K31/403—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil condensed with carbocyclic rings, e.g. carbazole
    • A61K31/404—Indoles, e.g. pindolol
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D209/00—Heterocyclic compounds containing five-membered rings, condensed with other rings, with one nitrogen atom as the only ring hetero atom
    • C07D209/02—Heterocyclic compounds containing five-membered rings, condensed with other rings, with one nitrogen atom as the only ring hetero atom condensed with one carbocyclic ring
    • C07D209/04—Indoles; Hydrogenated indoles
    • C07D209/30—Indoles; Hydrogenated indoles with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, directly attached to carbon atoms of the hetero ring
    • C07D209/32—Oxygen atoms
    • C07D209/34—Oxygen atoms in position 2
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D307/00—Heterocyclic compounds containing five-membered rings having one oxygen atom as the only ring hetero atom
    • C07D307/77—Heterocyclic compounds containing five-membered rings having one oxygen atom as the only ring hetero atom ortho- or peri-condensed with carbocyclic rings or ring systems
    • C07D307/78—Benzo [b] furans; Hydrogenated benzo [b] furans
    • C07D307/82—Benzo [b] furans; Hydrogenated benzo [b] furans with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to carbon atoms of the hetero ring
    • C07D307/83—Oxygen atoms

Definitions

  • Tuberculosis is an increasingly important worldwide public health concern due to its aerosol transmission and high morbidity and mortality. TB ranks as a leading cause of death worldwide due to a bacterial pathogen. The World Health Organization estimates that there are 10.4 million new cases and 1.7 million deaths due to TB annually worldwide.
  • Mycobacterium tuberculosis (Mtb) is the major etiologic agent of TB, which typically attacks the lungs and can be transmitted through aerosol. Approximately one-third of the world’s population is latently infected with Mtb, representing an enormous reservoir of active TB cases.
  • the recommended anti-TB regimen is a combination of at least four drugs.
  • the duration of the treatment is at least six months and may be up to two years for drug-resistant TB.
  • the complex and lengthy anti-TB regimens often result in inadequate adherence to treatment, which in turn provides a new opportunity for drug-resistant Mycobacterium tuberculosis (Mtb) strains to multiply.
  • Mcb Mycobacterium tuberculosis
  • MDR-TB multidrug-resistant TB
  • XDR-TB extensively drug-resistant TB
  • This disclosure describes compounds, compositions, and methods for treating or preventing infection or disease including, in some specific embodiments, treating or preventing tuberculosis and/or infection with Mycobacterium tuberculosis (Mtb).
  • Mcb Mycobacterium tuberculosis
  • this disclosure describes a compound including an aurone having the structure of Formula I:
  • this disclosure describes a compound comprising an aurone having the structure of Formula II:
  • R H or an acetyl (Ac) group
  • R' H, a halogen,–OH,–NO 2 , or an alkyl group
  • R H or an acetyl (Ac) group
  • R' a halogen,–OH,–NO2, or an alkyl group. That is, in some embodiments, R' does not include H alone.
  • this disclosure describes a compound including an aurone having the structure of Formula III:
  • a halogen for example, F, Cl, Br, I, or At
  • alkyl group —C n H 2n+1 , for example, a methyl group, an ethyl group, a propyl group, an isopropyl group, a pentyl group,
  • this disclosure describes a compound including
  • this disclosure describes a method for treating or preventing an infection, disease, or condition in a subject.
  • the method includes administering to the subject a composition including an effective amount of an aurone.
  • the aurone includes an aurone having the structure of Formula I, an aurone having the structure of Formula II, an aurone having the structure of Formula III, aurone 9504, aurone 9505, aurone 9501, aurone 9510, aurone AA2A, or aurone AA8, or a combination thereof.
  • this disclosure describes a composition including an aurone selected from an aurone having the structure of Formula I, an aurone having the structure of Formula II, an aurone having the structure of Formula III, aurone 9504, aurone 9505, aurone 9501, aurone 9510, aurone AA2A, or aurone AA8, or a combination thereof.
  • this disclosure describes a kit that includes an active agent comprising an aurone and instructions for use.
  • the aurone includes an aurone of Formula I, an aurone of Formula II, an aurone of Formula III, aurone 9504, aurone 9505, aurone 9501, aurone 9510, aurone AA2A, or aurone AA8 or a combination thereof.
  • alkenyl refers to an unsubstituted or substituted hydrocarbon chain radical having at least one carbon-carbon double bond and having from about 2 to about 15 carbon atoms; from 2 to about 10 carbon atoms; or from 2 to about 8 carbon atoms.
  • alkenyls include, for example, vinyl, allyl, and butenyl.
  • alkynyl refers to an unsubstituted or substituted hydrocarbon chain radical having at least one carbon-carbon triple bond and having from about 2 up to about 15 carbon atoms; from 2 to about 10 carbon atoms; or from about 2 to about 8 carbon atoms.
  • alkynyls include, for example ethynyl, propynyl, propargyl and butynyl.
  • aryl refers to an aromatic, carbocyclic or heterocyclic ring radical.
  • aryls include, for example, phenyl, tolyl, xylyl, cumenyl, naphtyl, biphenyl, thienyl, furyl, pyrrolyl, pyridinyl, pyrazinyl, thiazolyl, pyrimidinyl, quinolinyl, tetrazolyl, benzothiazolyl, benzofuryl, indolyl, and the like.
  • Aryls may be substituted or unsubstituted.
  • alkoxy refers to an alkyl, alkenyl, or alkynyl group, as defined herein, attached to an oxygen radical.
  • alkoxy also includes alkyl ether groups, where the term 'alkyl' is defined above, and 'ether' means two alkyl groups with an oxygen atom between them.
  • alkoxy groups include methoxy, ethoxy, n- propoxy, i-propoxy, n-butoxy, s-butoxy, t-butoxy, methoxymethane (also referred to as“dimethyl ether”), and methoxyethane (also referred to as“ethyl methyl ether”).
  • hydroxyl group or“hydroxyl” refers to a substituent group of formula ⁇ OH.
  • halogen or“halide” refers to fluoride, chloride, bromide or iodide.
  • the terms“fluoro”,“chloro”,“bromo”, and“iodo” may also be used when referring to halogenated substituents, for example,“trifluoromethyl.”
  • “amine group” has the general formula -NRR, where each R is independently hydrogen, or a hydrocarbon.
  • cyano group or“cyano” refers to a–CN group.
  • azido group or“azido”, refers to an -N3 group.
  • ether group or“ether” refers to radicals of the general formula -R'-O-R", where R and R" are independently substituted or unsubstituted hydrocarbyl.
  • nitro group or“nitro” refers to–NO 2 .
  • ester group or“ester” refers to a substituent of the general formula -C-O- O-R 1 where R 1 may be either aliphatic or aromatic.
  • substituted refers to the moiety (for example, alkyl, alkenyl, cycloalkyl, aryl, etc.) bearing one or more substituents.
  • substituents can include alkyl, alkenyl, alkynyl, hydroxyl, alkoxy, heterocyclic, aryl, heteroaryl, aryloxy, halogen, haloalkyl, cyano, nitro, amino, lower alkylamino, lower dialkylamino, amido, azido, acyl (—C(O)R 6 ), carboxyl (—
  • “a,”“an,”“the,” and“at least one” are used interchangeably and mean one or more than one.
  • FIG.1A shows the general structure of an aurone.
  • FIG.1B shows the benzofuran-3(2H)-one (3-coumaranone) and benzylidene (styrene) components of an aurone.
  • FIG.2 shows an aurone as depicted in Fig.1A as synthetically derived fragments: a benzofuranone-derived fragment (BDF) and an aldehyde-derived fragment (ADF).
  • BDF benzofuranone-derived fragment
  • ADF aldehyde-derived fragment
  • FIG.3 shows a standard aurone substituent ring numbering scheme.
  • FIG.4A– FIG.4D show aurone AA2A and aurone AA8 inhibit Mtb chorismate synthase activity.
  • FIG.4A Schematic of assays to measure aurone AA2A and aurone AA8 inhibition of chorismate synthase of Mtb.
  • FIG.4B SDS-PAGE analysis of recombinant proteins of Rv3227 (left) and Rv2540c (right) extracted from the E. coli Rossetta expressing these two proteins. Lane 1: protein molecular weight marker (PageRuler TM Unstained); Lane 2: crude protein extracts from the E.
  • FIG.4C Evaluation of Mtb chorismate synthase activity by measuring phosphate production.
  • FIG.4D Evaluation of Mtb chorismate synthase activity by measuring 5-enolpyruvylshikimate-3- phosphate synthase (EPSP) consumption. Data are means of three independent experiments ⁇ standard deviation (S.D.) * P ⁇ 0.05; ** P ⁇ 0.01; *** P ⁇ 0.001.
  • FIG.5A– FIG.5B show treatment with aurone AA2A or aurone AA8 reduces the bacterial load in lungs of Mtb infected mice.
  • FIG.5A In vivo imaging System (IVIS) study results of live mice and lungs before (Left) and after (Right) treatment with aurones AA8 and AA2A. Groups of mice were imaged in vivo by the IVIS system with tdTomato optimal excitation and emission wavelengths following the protocol of Kong et al. (PloS One.2016;11(3):e0149972). Lungs of the mice extracted after sacrificing the mice and imaged by IVIS ex vivo.
  • FIG.5B Colony forming unit (CFU) data of mouse lung tissues from different groups at various time points. ** P ⁇ 0.01.
  • FIG.6 shows schematic of structure activity relationship (SAR) analysis of aurones against Mtb.
  • Growth ratio of each sample fluorescence intensity (FI) of each sample at 48 hours / FI of the same sample at 0 hours.
  • Data are means of three independent experiments ⁇ S.D.
  • FIG.8A– FIG 8F shows the evaluation of efficacy of AA2A, AA8, 9501, and 9504 against Mtb in vivo.
  • FIG.9A– FIG.9B shows AA2A and 9504 inhibit Mtb-Cs activity.
  • FIG.9A Evaluation of AA2A and AA8 inhibitory effects on Mtb-Cs activity.
  • FIG.9B Evaluation of 9501, 9504, 9505, and 9510 inhibitory effects on Mtb-Cs activity.
  • Data are means of three independent experiments ⁇ S.D. DETAILED DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS
  • This disclosure describes compounds, compositions, and methods for treating or preventing infection or disease including, in some specific embodiments, treating or preventing tuberculosis (also referred to herein as TB) and/or infection with Mycobacterium tuberculosis (Mtb).
  • tuberculosis also referred to herein as TB
  • Mtb Mycobacterium tuberculosis
  • this disclosure describes aurones including, for example, aurone 9504, aurone 9505, aurone 9501, aurone 9510, aurone AA2A, and aurone AA8, compositions including aurones, and methods of using aurones for treating or preventing tuberculosis.
  • aurones including, for example, aurone 9504, aurone 9505, aurone 9501, aurone 9510, aurone AA2A, and aurone AA8, compositions including aurones, and methods of using aurones for treating or preventing tuberculosis.
  • Aurones are a heterocyclic chemical compound that are chemically defined as a
  • Aurones are flavonoids (from the Latin word flavus meaning yellow), and some aurones are naturally- occurring yellow pigments in vegetables and flowers. Additional non-naturally occurring aurones have been synthesized, with some of the non-naturally occurring aurones built on a scaffold of a naturally occurring aurone.
  • aurone analogues can act as antiparasistics, antivirals, antibacterials, and antifungals and as anti-cancer agents and anti-inflammatory agents.
  • Aurone derivatives or synthetic aurones have been demonstrated to have anti-bacterial activities, inhibiting, for example, the growth of Gram-positive bacteria and Gram-negative bacteria, including Staphylococcus aureus and Caulobacter crescentus (Pires et al. Journal of Medicinal Chemistry.2001;44(22):3673-81), Streptococcus pneumoniae (Thomas et al. Bioorganic & Medicinal Chemistry Letters. 2003;13(3):423-6), Klebsiella pneumonia (Hadj-esfandiari et al.
  • Aurones are characterized by a 15-carbon skeleton containing a coumaranone
  • aurones contain, as a first component, a coumaranone (benzofuranone) component (typically a 3-coumaranone, also known as benzofuran-3(2H)-one, or its aza- or thio- counterpart) and, as a second component, an aryl-containing component, for example a benzylidene (also known as a styrene) component, which contains the exocyclic alkene and an aryl group (FIG. 1B, reproduced below).
  • a coumaranone benzofuranone
  • a 3-coumaranone also known as benzofuran-3(2H)-one
  • an aryl-containing component for example a benzylidene (also known as a styrene) component, which contains the exocyclic alkene and an aryl group (FIG. 1B, reproduced below).
  • the second, aryl-containing component includes a 5-membered ring (for example, furyl) instead of a 6-membered ring (phenyl) as shown above.
  • the first component may be an oxindole or a benzothiophenone.
  • the first component of the substituted aurone (that is, the benzofuranone, oxindole or benzothiophenone) may be substituted or unsubstituted. However, at least one of the first and second components of the substituted aurone is substituted.
  • an aurone may include a nitrogen or sulfur substitution in the five membered ring.
  • the coumaranone component may be an oxindole or a benzothiophenone.
  • the aryl-containing (for example, benzylidene) component of the aurone designated herein as the second component of the aurone, is frequently derived from an aldehyde; thus, this second component of the aurone is also referred to herein as an“aldehyde- derived” component or fragment (ADF).
  • ADF aldehyde- derived component or fragment
  • the coumaranone (benzofuranone) component (typically a 3-coumaranone, also known as benzofuran-3(2H)-one, or its aza- or thio- counterpart) of the aurone, designated herein as the first component of the aurone, is analogously also referred to herein as the“benzofuranone-derived” component or fragment (BDF) (FIG.2, reproduced below).
  • BDF benzofuranone-derived component or fragment
  • a substituted aurone is an aurone that contains one or more substituents positioned at one or more positions on either or both of the first or second components of the 15-carbon skeleton, and/or that includes a ring substitution.
  • this disclosure describes a compound which may be suitable for inclusion in one or more compositions described herein or for us in one or more methods described herein.
  • Compounds described herein include both newly discovered compounds as well as compounds that may be known to the art, but not heretofore known to possess the activity or activities described herein.
  • a representative compound suitable for use in the compositions and methods of the disclosure is a compound comprising an aurone having the structure of Formula I:
  • the aurones of Formula I include a benzylidene with dimethylamino substitutions linked to benzofuranone with chlorine, bromine, and/or methyl substitutions. In some embodiments, more than one carbon of the benzofuranone may include a Cl, Br, and/or Me.
  • Exemplary aurones having the structure of Formula I include aurone 9499, aurone 9501, aurone 9503, aurone 9504, aurone 9505, or aurone 9510 (see Table 1).
  • a representative compound suitable for use in the compositions and methods of the disclosure is a compound comprising an aurone having the structure of Formula II:
  • a halogen for example, F, Cl, Br, I, or At
  • alkyl group —C n H 2n +1, for example, a methyl group, an ethyl group, a propyl group, an isopropyl group, a pentyl group, a hexyl group, a hepty
  • the acetylated or non-acetylated azaaurones of Formula II include a benzylidene linked to indolin-3-one.
  • the halogen preferably includes Cl and/or Br.
  • the acetylated or non-acetylated azaaurones of Formula II include a bromobenzylidene linked to indolin-3-one.
  • Exemplary aurones having the structure of Formula II include aurone AA2, aurone AA2A aurone AA3, aurone AA3A, aurone AA6, aurone AA7, and aurone AA8 (see Table 1).
  • R' does not include H alone.
  • Formula II does not include aurone AA8.
  • a representative compound suitable for use in the compositions and methods of the disclosure is a compound comprising an aurone having the structure of Formula III:
  • a halogen for example, F, Cl, Br, I, or At
  • alkyl group —C n H 2n +1, for example, a methyl group, an ethyl group, a propyl group, an isopropyl group, a pentyl group, a
  • the aurones of Formula III include a heteroaromatic group (for example, a furan, a pyrrolidine, or a thiophene) linked to indolin-3-one.
  • exemplary aurones having the structure of Formula III include aurone AA4A, aurone AA5, and aurone AA5A, and aurone AA9 (see Table 1).
  • a compound includes a compound selected from:
  • a compound includes a combination of compounds selected from aurone 9504, aurone 9505, aurone 9501, aurone 9510, aurone AA2A, and aurone AA8. In some embodiments, a compound includes a compound or combination of compounds selected from aurone 9504, aurone 9505, aurone 9501, aurone 9510, and aurone AA2A. In some embodiments, a compound includes a combination of compounds selected from an aurone of Formula I, an aurone of Formula II, and/or and an aurone of Formula III.
  • a compound includes a combination of compounds selected from an aurone of Formula I, an aurone of Formula II, an aurone of Formula III, aurone 9504, aurone 9505, aurone 9501, aurone 9510, aurone AA2A, and aurone AA8.
  • Example 1 As further described in Example 1, an iterative three round strategy was utilized to generate and identify aurones 9504, 9505, 9501, 9510, AA2A and AA8, that could effectively inhibit the growth of Mtb in culture and intracellularly in human cells. Although the structure of the AA8 aurone was previously reported (see, for example, WO 2017/180644), its effect on Mtb was previously unknown. The other 5 aurones discussed in Example 1 (9504, 9505, 9501, 9510, and AA2A) are newly generated, non-naturally occurring aurones.
  • aurone scaffolds may provide platforms for the development of future anti-TB compounds.6- chloro, 6-bromo, 7-bromo, and 5,6-dimethyl appeared to be the optimal substitution patterns on the benzofuranone portion while the modification of the dimethylamino group was not well tolerated. Aurone synthesis
  • aurones may be synthesized using any suitable method.
  • aurones may be synthesized using a method described by Varma et al. (Tetrahedron Letters 1992;33(40):5937- 40) or a method described by Hawkins and Handy (Tetrahedron 2013;69(44):9200-4).
  • Azaaurones may be synthesized using any suitable method.
  • azaaurones may be synthesized using a modification of the method reported by Carrasco et al. (Chem Med Chem.2016;11(19):2194-204).
  • Carrasco et al. Chem Med Chem.2016;11(19):2194-204.
  • 1-acetylindolin-3-one for example, 0.5 mmol
  • the appropriate aldehyde for example, 0.5 mmol
  • piperidine may be added to a solution of 1-acetylindolin-3-one (for example, 0.5 mmol) in toluene.
  • the mixture may be heated to reflux (for example, for 12 hours), cooled to room temperature, and then purified. Purification may be, for example, by flash column chromatography using ethyl acetate/hexanes mixtures.
  • the acetylated product may be dissolved in methanol and treated with 50% aqueous KOH.
  • the reaction mixture may be acidified and extracted with ethyl acetate and/or concentrated in vacuo.
  • the resulting residue may be purified including, for example, by flash column chromatography using toluene/ethanol mixtures.
  • the present disclosure provides a composition that includes the aurone.
  • the composition is a pharmaceutical composition that includes, as an active agent, an aurone, and a pharmaceutically acceptable carrier.
  • the aurone includes an aurone according to Formula I, Formula II, Formula III, 9504, 9505, 9501, 9510, AA2A, or AA8, or a combination thereof.
  • the aurone preferably exhibits at least 40 percent inhibition of the growth of the tdTomato-labeled Mtb CDC1551 strain.
  • the percent inhibition of the growth of the tdTomato-labeled Mtb CDC1551 strain may be measured using 100 mL of the aurone, as described in Example 1.
  • the active agent may be formulated in a pharmaceutical composition to be administered to a subject in a formulation adapted to the chosen route of administration.
  • the formulation may include one suitable for oral, rectal, vaginal, topical, nasal, ophthalmic, or parenteral (including
  • the pharmaceutically acceptable carrier may include, for example, an excipient, a diluent, a solvent, an accessory ingredient, a stabilizer, a protein carrier, or a biological compound.
  • a protein carrier includes keyhole limpet hemocyanin (KLH), bovine serum albumin (BSA), ovalbumin, or the like.
  • BSA bovine serum albumin
  • a biological compound which may serve as a carrier include a glycosaminoglycan, a proteoglycan, and albumin.
  • the carrier may be a synthetic compound, such as dimethyl sulfoxide or a synthetic polymer, such as a
  • the pharmaceutically acceptable carrier preferably includes at least one compound that is not naturally occurring or a product of nature. In a some embodiments, the pharmaceutically acceptable carrier results in a compositions including an aurone that is not naturally occurring or a product of nature.
  • the aurone is formulated in combination with one or more additional (for example,“second”) active agent(s).
  • additional (for example,“second”) active agent(s) for example, an aurone with anti-Mycobacterium tuberculosis (Mtb) activity may be formulated in combination with another anti-tuberculosis compound.
  • An anti-tuberculosis compound may include for example, one of the most utilized anti- TB drugs, Amikacin (AMI), Ethambutol (ETH), Isoniazid (INH), and Rifampin (RIF).
  • Additional exemplary anti-tuberculosis compounds include Pyrazinamide (PZA), Streptomycin (SM), Levofloxacin, Moxifloxacin, Ethionamide, Prothionamide, Cycloserine, p-aminosalicylic acid, Bedaquiline, Clofazimine, Linezolid, Amoxicillin, clavulanic acid, Imipenem, Cilastatin,
  • such a combination therapy includes at least one compound that is not naturally occurring or a product of nature.
  • the pharmaceutical composition includes at least one non-naturally occurring therapeutic or prophylactic agent.
  • composition may be conveniently presented in unit dosage form and may be prepared by any of the methods well-known in the art of pharmacy. All methods include the step of bringing the active agent into association with a pharmaceutical carrier. In some embodiments, the composition may be prepared by uniformly and intimately bringing the active compound into association with a liquid carrier, a finely divided solid carrier, or both, and then, if necessary, shaping the product into the desired formulations.
  • a composition including an aurone suitable for oral administration may be presented as discrete units such as tablets, troches, capsules, lozenges, wafers, or cachets, each containing a predetermined amount of the active agent as a powder or granules, as liposomes, or as a solution or suspension in an aqueous liquor or non-aqueous liquid such as a syrup, an elixir, an emulsion, or a draught.
  • the tablets, troches, pills, capsules, and the like may also contain one or more of the following: a binder such as gum tragacanth, acacia, corn starch, or gelatin; an excipient such as dicalcium phosphate; a disintegrating agent such as corn starch, potato starch, alginic acid, and the like; a lubricant such as magnesium stearate; a sweetening agent such as sucrose, fructose, lactose, or aspartame; and a natural or artificial flavoring agent.
  • a binder such as gum tragacanth, acacia, corn starch, or gelatin
  • an excipient such as dicalcium phosphate
  • a disintegrating agent such as corn starch, potato starch, alginic acid, and the like
  • a lubricant such as magnesium stearate
  • a sweetening agent such as sucrose, fructose, lactose, or aspartame
  • Various other materials may be present as coatings or to otherwise modify the physical form of the solid unit dosage form.
  • tablets, pills, or capsules may be coated with gelatin, wax, shellac, sugar, and the like.
  • a syrup or elixir may contain one or more of a sweetening agent, a preservative such as methyl- or propylparaben, an agent to retard crystallization of the sugar, an agent to increase the solubility of any other ingredient, such as a polyhydric alcohol, for example glycerol or sorbitol, a dye, and flavoring agent.
  • the material used in preparing any unit dosage form is substantially nontoxic in the amounts employed.
  • the active agent may be incorporated into preparations and devices in formulations that may, or may not, be designed for sustained release or controlled release.
  • a formulation suitable for parenteral administration may include a sterile aqueous preparation of the active agent, or a dispersion of a sterile powder of the active agent, which is preferably isotonic with the blood of the subject.
  • Parenteral administration of an aurone is one form of administration.
  • An isotonic agent may be included in the liquid preparation including, for example, a sugar; a buffer; and/or a salt including, for example, sodium chloride.
  • a solution of the active agent may be prepared in water, optionally mixed with a nontoxic surfactant.
  • a dispersion of the active agent may be prepared in water, ethanol, a polyol (such as glycerol, propylene glycol, liquid polyethylene glycols, and the like), a vegetable oil, or a glycerol ester, or a mixture thereof.
  • the ultimate dosage form may be sterile, fluid, and stable under the conditions of manufacture and storage.
  • the necessary fluidity may be achieved, for example, by using liposomes, by employing the appropriate particle size in the case of dispersions, or by using surfactants.
  • Sterilization of a liquid preparation may be achieved by any convenient method that preserves the bioactivity of the active agent, preferably by filter sterilization. Methods for preparing a powder include vacuum drying and freeze drying of the sterile injectable solutions.
  • Nasal spray formulations include purified aqueous solutions of the active agent with a preservative agent and/or an isotonic agents. Such formulations may be adjusted to a pH and isotonic state compatible with the nasal mucous membranes.
  • Formulations for rectal or vaginal administration may be presented as a suppository with a suitable carrier such as cocoa butter, or hydrogenated fats, or hydrogenated fatty carboxylic acids.
  • Ophthalmic formulations are prepared by a similar method to the nasal spray, except that the pH and isotonic factors are preferably adjusted to match that of the eye.
  • Topical formulations include the active agent dissolved or suspended in one or more media such as mineral oil, petroleum, polyhydroxy alcohols, or other bases used for topical pharmaceutical formulations. Topical formulations may be provided in the form of a bandage, wherein the formulation is incorporated into a gauze or other structure and brought into contact with the skin.
  • this disclosure provides methods of using the compounds and
  • a method includes administering an aurone to a subject. In some embodiments, the method includes using the compounds and compositions to treat, prevent, inhibit, or control an infection, disease, or condition in a subject. In some embodiments, the infection, disease, or condition includes tuberculosis and/or Mycobacterium tuberculosis (Mtb) infection.
  • Administration includes administering an aurone to a subject. In some embodiments, the method includes using the compounds and compositions to treat, prevent, inhibit, or control an infection, disease, or condition in a subject. In some embodiments, the infection, disease, or condition includes tuberculosis and/or Mycobacterium tuberculosis (Mtb) infection.
  • an aurone (including for example, an aurone having the structure of Formula I, Formula II, Formula III, aurone 9504, aurone 9505, aurone 9501, aurone 9510, aurone AA2A, or aurone AA8, or a combination thereof), as the active agent, may be administered to a subject alone or in a pharmaceutical composition that includes the active agent and a
  • administered encompasses administration of a prophylactically and/or therapeutically effective dose or amount of the active agent to a subject.
  • the active agent may be administered to a subject in an effective amount to produce the desired effect.
  • effective dose or“effective amount” refers to a dose or amount that produces the effects for which it is administered, especially an intended effect such as an anti-tuberculosis effect.
  • An aurone may be introduced into the subject systemically or locally, for example at the site of infection or inflammation.
  • the active agent may be administered to the subject in an amount effective to produce the desired effect.
  • An aurone may be administered in a variety of routes, including orally, parenterally, intraperitoneally, intravenously, intraarterially, transdermally, sublingually, intramuscularly, rectally, transbuccally, intranasally, liposomally, via inhalation, vaginally, intraoccularly, via local delivery by catheter or stent, subcutaneously, intraadiposally, intraarticularly, intrathecally, or in a slow release dosage form.
  • Local administration may include topical administration, administration by injection, or perfusion or bathing of an organ or tissue, for example.
  • a formulation may be administered as a single dose or in multiple doses.
  • a formulation may be administered once per day or more than once per day including, for example, twice per day, three times per day, or four times per day.
  • Useful dosages of the active agent may be determined by comparing their in vitro activity and the in vivo activity in animal models. Methods for extrapolation of effective dosages in mice, and other animals, to humans are known in the art.
  • examples of anti-tuberculosis therapies which can form the basis for determining dosages and dosing regiments for an aurone may be found in the Companion
  • Tuberculosis (available on the world wide web at www.ncbi.nlm.nih.gov/books/NBK247416/) or on the world wide web at aidsinfo.nih.gov/guidelines/html/4/adult-and-adolescent-opportunistic- infection/356/tb-drug-dosing.
  • Dosage levels of the active agent in the pharmaceutical compositions may be varied to obtain an amount of the active agent which is effective to achieve the desired therapeutic response for a particular subject, composition, and mode of administration, without being toxic to the subject.
  • the selected dosage level will depend upon a variety of factors including the activity of the particular compound employed, or the ester, salt or amide thereof, the route of administration, the time of administration, the rate of excretion of the particular compound being employed, the duration of the treatment, other drugs, compounds and/or materials used in combination with the aurone, the age, sex, weight, condition, general health and prior medical history of the subject being treated, and like factors well known in the medical arts.
  • an aurone may be administered to a subject in an amount of at least 5 mg, at least 10 mg, at least 20 mg, at least 30 mg, at least 40 mg, at least 50 mg, or at least 5 g.
  • an aurone may be administered to a subject in an amount of up to 40 mg, up to 50 mg, up to 60 mg, up to 70 mg, up to 80 mg, up to 90 mg, up to 100 mg, or up to 1000 mg.
  • an aurone may be administered orally at least once per day including, for example, as a medication, nutritional supplement, or food additive.
  • an aurone may be administered to a subject intravenously or
  • an aurone may be administered to a subject in an amount effect to provide a daily dosage of at least 0.01 mg/kg body weight, at last 0.3 mg/kg body weight, at least 0.1 mg/kg body weight, or at least 1 mg/kg body weight. In another exemplary embodiment, an aurone may be administered to a subject in an amount effect to provide a daily dosage of up to 1 mg/kg body weight, up to 5 mg/kg body weight, up to 10 mg/kg body weight, or up to 20 mg/kg body weight.
  • a physician or veterinarian having ordinary skill in the art may determine and prescribe the effective amount of the pharmaceutical composition required. For example, a physician could start doses of the aurone employed in the pharmaceutical composition at levels lower than that required in order to achieve the desired therapeutic effect and gradually increase the dosage until the desired effect is achieved.
  • Methods to treat or prevent tuberculosis or Mycobacterium tuberculosis (Mtb) infection may be determined and prescribe the effective amount of the pharmaceutical composition required. For example, a physician could start doses of the aurone employed in the pharmaceutical composition at levels lower than that required in order to achieve the desired therapeutic effect and gradually increase the dosage until the desired effect is achieved.
  • an aurone (including for example, an aurone having the structure of Formula I, Formula II, Formula III, aurone 9504, aurone 9505, aurone 9501, aurone 9510, aurone AA2A, or aurone AA8, or a combination thereof) may be used to treat, prevent, inhibit, or control tuberculosis or Mycobacterium tuberculosis (Mtb) infection.
  • an aurone including for example, an aurone having the structure of Formula I, Formula II, Formula III, aurone 9504, aurone 9505, aurone 9501, aurone 9510, aurone AA2A, or aurone AA8, or a combination thereof
  • Mtb Mycobacterium tuberculosis
  • aurones 9504, 9505, 9501, 9510, AA2A, and AA8 performed as well or better than the four most utilized anti-TB drugs, Amikacin (AMI), Ethambutol (ETH), Isoniazid (INH), and Rifampin (RIF) in preventing, inhibiting, or controlling Mycobacterium tuberculosis (Mtb) infection.
  • AMI Amikacin
  • ETH Ethambutol
  • Rifampin Rifampin
  • Mtb Mycobacterium tuberculosis
  • the high selectivity of the top six aurones identified in Example 1 one or more of these aurones could be used as a replacement for one or more of a more toxic anti-TB drugs that is currently in use.
  • an aurone may be used in combination with another anti-TB drug or drug cocktail.
  • an aurone is administered in an amount effective to treat or prevent tuberculosis and/or Mycobacterium tuberculosis (Mtb) infection.
  • Administration of the aurone may be performed before, during, or after a subject develops tuberculosis and/or Mycobacterium tuberculosis (Mtb) infection, or manifests symptoms of tuberculosis and/or Mycobacterium tuberculosis (Mtb) infection.
  • Therapeutic treatment is initiated after the development of tuberculosis and/or Mycobacterium tuberculosis (Mtb) infection. Treatment initiated after the development of tuberculosis and/or Mycobacterium tuberculosis (Mtb) infection, or after manifestation of tuberculosis and/or
  • Mycobacterium tuberculosis (Mtb) infection may result in decreasing the severity of a symptom, or completely removing a symptom.
  • an aurone may be administered prophylactically in an amount effective to prevent or delay the development of tuberculosis and/or Mycobacterium tuberculosis (Mtb) infection in a subject.
  • Treatment that is prophylactic may be initiated before a subject develops tuberculosis and/or Mycobacterium tuberculosis (Mtb) infection, or manifests symptoms of tuberculosis and/or Mycobacterium tuberculosis (Mtb) infection.
  • An example of a subject who is at particular risk of developing tuberculosis and/or Mycobacterium tuberculosis (Mtb) infection is a person with a medical condition that weakens the immune system, including, for example a person with an HIV infection; a person who work or reside with a person who is at high risk for TB in a facilities or an institutions such as a hospital, a homeless shelter, a correctional facility, a nursing home, or a residential home for those with HIV; an IV drug user; etc.
  • an aurone may occur before, during, and/or after other treatments including, for example, additional active agent(s).
  • combination therapy may involve the administration of an aurone before, during and/or after the use of other anti-tuberculosis agents.
  • an aurone may be separated in time from the administration of another active agent by hours, days, or even weeks; alternatively, the other active agent(s) may be administered concurrently, either together in the same composition or in separate compositions. Additionally or alternatively, the administration of an aurone may be combined with another active agent or modality such as, for example, non-drug therapies, such as, but not limited to, radiotherapy, heat therapy, cryotherapy, electrical therapy, massage, and acupuncture.
  • non-drug therapies such as, but not limited to, radiotherapy, heat therapy, cryotherapy, electrical therapy, massage, and acupuncture.
  • T cell cytokines The activation of macrophages by T cell cytokines are a critical defense mechanism against intracellular bacterial pathogens including Mtb (Jayaswal et al. PLoS pathogens.
  • Mtb has strategies to survive inside macrophages to avoid being eliminated by drugs. Because Mtb primarily stays in the macrophage after infection, new treatments for Mtb will preferably be active against intracellular Mtb.
  • aurones 9504, 9505, 9501, 9510, AA2A, and AA8 were found to significantly inhibit intracellular Mtb replication at two different concentrations that had no or minimal cytotoxic effects. These data indicate that these aurones may effectively penetrate into macrophage phagosome to inhibit Mtb replication.
  • aurones 9504, 9501, AA2A and AA8 could rapidly reduce the bacterial load in mouse lungs. These results further suggest these aurones may be effect anti-TB drugs.
  • Multi-drug resistant Mtb MDR-Mtb
  • XDR-Mtb extensively drug-resistant Mtb
  • aurones had never been applied to treat TB patients and/or other mycobacterium infections.
  • the results of Example 1 further demonstrated that the AA2A and AA8 aurones are effective at treating an MDR Mtb strain as well as a drug-susceptible Mtb strain.
  • First-line anti-TB drugs contribute to diverse pathological complications, including hepatotoxicity.
  • Current first-line anti-TB drugs are among the most reported anti-microbial drugs incriminated to be potential causes of drug-induced liver injury (Pugh et al. Clin Liver Dis.
  • aurones 9504, 9505, 9501, 9510, AA2A, and AA8 aurones had lower cytotoxic effects compared to the first-line anti-TB drug Rifampin (RIF).
  • Aurones 9504, 9505 and 9501 had low cytotoxic effects on the human liver cell line HepG-2 and the primate kidney cell Vero.
  • Aurone 9504 exhibited the highest selectivity index on both cells, significantly better than RIF.
  • a subject may include, for example, a mammal including humans and animals.
  • animals may include companion animals, domesticated animals such as farm animals, animals used for research, or animals in the wild.
  • Companion animals include, but are not limited to, dogs, cats, hamsters, gerbils, and guinea pigs.
  • domesticated animals include, but are not limited to, cattle, horses, pigs, goats, and llamas.
  • Research animals include, but are not limited to, mice, rats, dogs, apes, and monkeys.
  • the compound is administered to an animal, such as a companion animal or domesticated animal, that has been diagnosed with, or is exhibiting symptoms of, or is at risk of developing, tuberculosis or Mycobacterium tuberculosis (Mtb) infection.
  • the compound is administered in an animal or animal population that serves, may serve, or is suspected of serving as a tuberculosis and/or Mycobacterium tuberculosis (Mtb) infection reservoir, regardless of the presence of symptoms. Administration may be, for example, part of a small or large scale public health infection control program.
  • the compound may, for example, be added to animal feed as a prophylactic measure for reducing, controlling or eliminating infection in a wild or domestic animal population.
  • the compound may, for example, be
  • administering may be effective to reduce or eliminate tuberculosis and/or Mycobacterium tuberculosis (Mtb) infection or the symptoms associated therewith; to halt or slow the progression of infection or symptoms within a subject; and/or to control, limit or prevent the spread of infection within a population, or movement of infection to another population.
  • Mtb Mycobacterium tuberculosis
  • Veterinary uses of the compounds in domestic or domesticated animals including small animals such as cats, dogs, and other pets, as well as large animals such as cows, horses, pigs, and other livestock), as well as wild animals (for example, animals housed in zoos) to treat or prevent tuberculosis and/or Mycobacterium tuberculosis (Mtb) infection.
  • domestic or domesticated animals including small animals such as cats, dogs, and other pets, as well as large animals such as cows, horses, pigs, and other livestock
  • wild animals for example, animals housed in zoos
  • a derivative of benzofuran-3[2H]-one reported to inhibit the chorismate synthase (Cs) of S. pneumonia has a similar chemical structure to aurones 9504, 9505, 9501, 9510, AA2A, and AA8.
  • the Mtb Cs is the key enzyme for the last step of the shikimate pathway.
  • Chorismate, the final product of the shikimate pathway is essential for the synthesis of aromatic amino acids, folate, naphthoquinones, menaquinones and mycobactins (Parish et al. Microbiology.2002;148(Pt 10):3069-77).
  • Mtb Cs is an attractive drug target since inhibition of Cs is unlikely to have a toxic side effect on the host.
  • Example 1 The data from Example 1 demonstrated that AA2A and AA8 aurones may significantly inhibit Mtb Cs. Due to the low cytotoxicity of AA2A and AA8 and their ability to inhibit Mtb Cs, in theory, a high dose of AA2A or AA8 could be used to treat Mtb infection in mammals, which would potentially shorten the period of treatment and reduce risk of drug resistance development. As further described in Example 1, an in vivo study of AA2A and AA8 demonstrated that these two aurones could rapidly reduce the bacterial load in mouse lungs, demonstrating the promise of AA2A and AA8 as new anti-TB drugs in mammals. Moreover, the Examples demonstrate that aurones 9504, 9505, 9501, 9510, AA2A, and AA8 can significantly inhibit Mtb-Cs. Kits
  • kits that contains at least one compound or composition described herein, together with instructions for use.
  • the instructions for use provide instructions for use in the treatment or prevention of tuberculosis and/or infection with Mycobacterium tuberculosis (Mtb).
  • the kit includes a pharmaceutically acceptable carrier.
  • the carrier may be separately provided, or it may be present in a composition that includes the compound.
  • the kit may further include one or more additional active agents which may be co-administered with the aurone.
  • the one or more active agent(s) may have cumulative or complementary activities, as described in more detail elsewhere herein.
  • the present invention is illustrated by the following examples.
  • This Example describes screening and optimization of aurones to find compounds that effectively inhibit/eliminate Mycobacterium tuberculosis (Mtb) growth. This Example further describes the determination of the effective concentrations of the aurones identified and the result of using the aurones to treat Mtb infection in vivo.
  • Mtb Mycobacterium tuberculosis
  • the aurones inhibited the growth of Mtb with minimal inhibitory concentrations (MICs) of 6.25 PM, 12.5 PM, 25 PM, 25 PM, 25 PM and 50 PM, respectively. All six aurones were equally or more effective at inhibiting the intracellular growth of Mtb than the top four drugs currently used to treat TB, Amikacin (AMI), Ethambutol (ETH), Isoniazid (INH), and Rifampin (RIF).
  • AMI Amikacin
  • ETH Ethambutol
  • Isoniazid Isoniazid
  • Rifampin Rifampin
  • AA8A To a solution of 0.5 mmol of 1-acetylindolin-3-one in 1 mL of toluene was added a slight excess (1.2 equivalents) of benzaldehyde and one drop of piperidine. The mixture was heated to 100 °C for 12 hours, then cooled to room temperature and purified via flash column
  • the Mtb CDC1551 strain carries a plasmid constitutively expressing a fluorescent protein, tdTomato, under a phage L5 promoter (Kong et al. PLoS One 2016; 11:e0149972).
  • the Mtb CDC1551 strain was grown in 7H9 broth (Difco, Detroit, MI) supplemented with 0.5% glycerol, 10% OADC (oleic acid dextrose complex without catalase) and 0.05% Tween 80 (M-OADC-TW broth), or Middlebrook 7H9 supplemented with 10% OADC and 15 g/L Bacto agar (M-OADC agar, BD DIFCO), or on 7H11 selective agar (Difco).
  • 7H9 broth Difco, Detroit, MI
  • OADC-TW broth Middlebrook 7H9 supplemented with 10% OADC and 15 g/L Bacto agar
  • BD DIFCO 7H11 selective agar
  • MDR-Mtb strain BEI Resources, Manassas, VA; the strain was originally isolated from a South African source
  • M-OADC-TW broth was supplemented with 0.1 mg/mL isoniazid (INH) and 0.5 mg/mL rifampicin (RIF). Determining the minimum inhibitory concentrations (MICs) of the aurones to Mtb:
  • Vero cells were maintained in DMEM medium supplemented with 10% heat-inactivated FBS at 37°C with 5% CO 2 .
  • HepG2 cells were maintained in DMEM medium supplemented with 20% heat-inactivated FBS at 37°C with 5% CO2.
  • Cells were seeded into a 96-well plate. A series of two-fold dilutions of aurones, Isoniazid (INH), or Rifampin (RIF) were added into the cell culture media in microplates to determine the concentration that eliminates 50% of eukaryotic cell growth in a two-day incubation. Cells without drug treatment were incubated with the vehicle buffer and served as negative controls (100% viable).
  • L6 rat skeletal myoblasts were maintained in DMEM medium supplemented with 10% heat- inactivated FBS, 45 mg/L glucose and sodium pyruvate, 4 mM L-glutamine, 50 IU/mL penicillin, 50 ug/mL streptomycin (HyClone, Logan, UT) at 37°C with 5% CO2.
  • THP-1 human monocyte cells were maintained in RPMI 1640 medium supplemented with 10% heat-inactivated FBS and 1% penicillin/streptomycin (complete culture medium) at 37°C with 5% CO 2 .
  • Log phage cells were trypsinized, adjusted in fresh media to deliver 5,000 cells/well in a 96-well tissue culture plate (BD Falcon, Franklin Lakes, New Jersey), treated with 300 mM, 100 mM, 30 mM, 10 mM, 3 mM and 1 mM concentrations of the aurones and incubated for 48 hours.
  • Alamar Blue dye (Invitrogen, Carlsbad, CA) was used to assess the viability of cells according to the manufacturer's instructions and the fluorescent intensity was read on a SpectraMax M2e micro- plate reader (Molecular Devices, LLC, San Jose, CA) using excitation and emission wavelengths of 560 and 590 nm, respectively. Determining the efficacy of aurones against intracellular Mtb infection
  • the intracellular activity of the aurones were evaluated in human monocyte THP-1 cell line.
  • the cells were seeded at 5 ⁇ 10 4 cells per well in 96-well tissue culture black plates with clear bottoms. Phorbol-12-myristate-13-acetate (PMA) was used to induce the monocytes to develop into macrophages for three days before infection.
  • PMA Phorbol-12-myristate-13-acetate
  • the negative controls were the infected cells treated with the vehicle buffer.
  • Amikacin (AMI) (1 mg/mL), Ethambutol (ETH) (0.5 mg/mL), Rifampin (RIF) (0.4 mg/mL) and Isoniazid (INH) (0.5 mg/mL) were used as positive controls.
  • Mtb EPSP synthase and Cs were over-expressed in E. coli with a vector pET28a(+) and purified from the soluble components of the lysates by affinity chromatography on a HisTrap column eluted with a series of concentrations of imidazole.
  • PCR was conducted using the primers Rv2540c-F tatacatatggtgttgcgctggatcacc (SEQ ID NO:1) and Rv2540c-R: tataggatccttaaccggagacccgc (SEQ ID NO:2) to amplify Rv2540c (aroF), which encodes chorismate synthase from genomic DNA of Mtb CDC1551, using the following amplification parameters: denaturation for 5 minutes at 95°C, then 34 cycles consisting of 45 seconds at 95°C, 45 seconds at annealing temperature (56°C), and 3 minutes at 72°C, and then 10 minutes at 72°C for final extension.
  • Rv2540c-F tatacatatggtgttgcgctggatcacc
  • Rv2540c-R tataggatccttaaccggagacccgc
  • Rv3227 which encodes 5- Enolpyruvylshikimate-3-phosphate synthase (EPSP) from genomic DNA of Mtb CDC1551
  • PCR was conducted using the primers Rv3227-F tatacatatggtgaagacatggccagcc (SEQ ID NO:3) and Rv3227-R tataggatccactcgtcgtagtcgccgg (SEQ ID NO:4) using the following amplification parameters: denaturation for 5 minutes at 95°C, then 34 cycles consisting of 45 seconds at 95°C, 45 sec at annealing temperature (62°C), and 3 minutes at 72°C, and then 10 minutes at 72°C for final extension.
  • PCR-amplified products of Rv2540c and Rv3227 were analyzed on 0.8% agarose gel and purified with DNA clean & concentrator kit (Zymo Research, Irvine, CA). Eluted purified PCR products and expression vector pET-28a(+) were digested with NdeI and BamHI, respectively. The pET-28a(+) vector was also dephosphorylated by phosphatase. After electrophoresis, bands were cut, and then Rv2540c, Rv3227 and pET-28a(+) vector were extracted using Agarose
  • Mtb needs both Mtb EPSP synthase for the biosynthesis of 5-enol-pyruvyl shikimate-3- phosphate (EPSP), which is the substrate for chorismate synthase (Cs), and Mtb-Cs for the formation of chorismate.
  • ESP 5-enol-pyruvyl shikimate-3- phosphate
  • Cs chorismate synthase
  • Mtb-Cs chorismate synthase
  • the EPSP synthesis reaction consisted of shikimate-3-phosphate (S3P), phosphoenolpyruvate (PEP), and EPSP synthase.
  • S3P shikimate-3-phosphate
  • PEP phosphoenolpyruvate
  • EPSP 2-amino-6-mercapto-7-methylpurine ribonucleoside
  • EPSP synthesis was monitored by measuring A360 using a spectrophotometer. After EPSP synthesis, the reaction mix was used directly as a source of EPSP for the chorismate synthesis reaction after ultrafiltration using an AMICON Ultra-15 Centrifugal Filter Unit with a 10 kDa cutoff (Millipore Sigma) to remove enzymes.
  • the Mtb-Cs enzyme reaction consisted of Mtb-Cs, EPSP, Flavin mononucleotide (FMN), and reduced nicotinamide adenine dinucleotide (NADH). After a 30- minute incubation at 30qC, the reaction mixture was filtered through an AMICON Ultra-15
  • the mass spectrometry (MS) detector began to record the ion signals at the time point of 0.35 minutes, and both positive and negative ions were collected. It was found that EPSP was eluted out at 1.3 minute retention time and characteristic peak of EPSP was ESI m/z 323.2 [M-1]- under the negative ESI mode. The peak areas (AUC) of EPSP were calculated from extracted ion chromatograms (EIC) of ESI- m/z 323.2 [M-1]-. Determining the potencies of aurones against Mtb infection in mice
  • MTD median tolerated dose
  • a pilot drug tolerance test was conducted with these four concentrations of aurones that were intraperitoneally (i.p.) injected into 6-week BALB/c female mice daily for seven days. Mice were weighed daily and examined twice daily for any adverse effects. No any adverse effects were identified at all tested doses.5 mg/kg of AA2A and AA8 was determined to be a safe dose for mice and used this dose to treat infected mice thereafter.
  • mice were aerosol infected using the Bio-Aerosol Nebulizing Generator in the University of Tennessee Health Science Center Regional Biocontainment Laboratory, with 5X10 5 colony forming units (CFU) per milliliter (CFU/mL) of Mtb in PBS to deliver 20-80 CFU/lung.
  • CFU colony forming units
  • mice were randomly grouped into control, AA2A, or AA8 treated group, five mice per group per time point.
  • 5 mg/kg of AA2A or AA8 was i.p. injected daily.
  • the mice in the control group were injected with the vehicle buffer (10 mM phosphate buffer + 2.5% Tween 80 + 2.5% DMSO).
  • IVIS In vivo imaging System
  • mice were anesthetized with isofluorane and imaged in an IVIS Spectrum (Caliper Life Sciences) with tdTomato filters for fluorescence. Photographic images were directly overlaid with matching fluorescent images for all mice. Wavelength-resolved spectral imaging was carried out to image tdTomato-expressing Mtb infection in live mice. The excitation wavelength was 535 nm and emission was collected in 20 nm increments from 580 nm to 660 nm.
  • the tdTomato-labeled Mtb CDC1551 strain was employed to determine the anti-TB efficacies of 148 aurone analogues against actively replicating Mtb.
  • the multi-copy tdTomato expressing Mtb strain was co-incubated with the aurones at a concentration of 100 mM for three days.
  • the tdTomato specific fluorescence intensity (FI) was measured daily using the same strain without treatment as a control.
  • the inhibitory rate was calculated as: .
  • the 148 aurones that were synthesized and tested in this study are shown in Table 1.
  • the first round of screening used a diverse library of 87 aurones that consisted of a benzylidene, furanylidene, pyrrolylidene or thiophenylidene linked to benzofuranone with various bromine, chlorine, cyano, dimethylamino, fluorine, hydroxyl, iodine, methoxy, methyl, nitro, pyridyl or trifluoromethyl substitutions in benzylidene, furanylidene, pyrrolylidene or thiophenylidene.
  • Some of the aurones also included bromine, hydroxyl, methoxy or methyl substitutions in benzofuranone.
  • aurones had been screened in previous studies to identify potent antifungal agents (Sutton et al. Bioorganic & Medicinal Chemistry Letters.2017; 27(4):901-3), an immunosuppressant (Park et al. Int Immunopharmacol.2017; 43:116-28) and potential anti-cancer agents (18) (Alsaif et al. Curr Pharm Biotechnol.2017; 18(5):384-90).
  • Table 2 shows the inhibition rates of the first round of aurones that were synthesized at a concentration of 100 PM against Mtb. In general, these aurones were not effective inhibitors of Mtb growth.
  • Inhibitory rate 100- (fluorescence intensity (F.I.) of treated Mtb at day 3 - F.I. of treated Mtb at day 0) / (F.I. of untreated Mtb at day 3 - F.I. of untreated Mtb at day 0) C 100.
  • Aurones 9053 and 9087 were highly fluorescent at the wavelength used to detect the tdTomato protein. For these aurones the percent inhibition was determined using cellular absorbance.
  • Inhibitory rate 100- (fluorescence intensity (F.I.) of treated Mtb at day 3 - F.I. of treated Mtb at day 0) / (F.I. of untreated Mtb at day 3 - F.I. of untreated Mtb at day 0) C 100.
  • Aurones 3012, AA5 and AA5A were highly fluorescent at the wavelength used to detect the tdTomato protein. For these aurones the percent inhibition was determined using cellular absorbance.
  • aurones were synthesized to investigate additional substitutions of benzylidene in aurones.
  • benzylidene was linked to benzofuranone as well as alternative benzofuranone groups, where the internal single bonded oxygen of benzofuranone, which constitutes an aurone, was replaced with a secondary amine to generate azaaurones, a tertiary acetylated amine to generate acetylated azaarones, a sulfur to generate thioaurones, or a carbonyl group to generate indanediones.
  • Table 3 shows the inhibition rates of the second round of aurones that were synthesized at a concentration of 100 mM against Mtb.
  • aurones 9504, 9505, 9501, 9510, AA2A, and AA8 were selected for further testing.
  • the minimal inhibitory concentration (MIC) of each aurone was determined in 7H9 broth culture.
  • the bacterial fluorescence was measured over the time of treatment and the growth ratios of the samples were calculated as: Fluorescence of the sample at day 3 divided by the fluorescence of the sample at day 0.
  • the MIC of aurones 9504, 9505, 9501, 9510, AA2A, and AA8 were determined to be 6.25 mM, 12.5 mM, 25 mM, 25 mM, 25 mM and 50 mM, respectively.
  • the MICs of AA2A and AA8 against a MDR-Mtb strain originally isolated from a pulmonary TB patient in South Africa was also evaluated.
  • the MICs for AA2A and AA8 against this MDR-Mtb strain in 7H9 broth culture was determined by measuring bacterial optical density (OD) at 600 nm over time of treatment.
  • the growth ratios of samples was calculated as follows: OD600 of the sample at day 3 divided by OD600 of the sample at day 0. 25 mM of aurone AA2A and 12.5 mM of aurone AA8 completely inhibited growth of the MDR-Mtb strain within the 3-day treatment (growth ratio ⁇ 1).
  • IC 50 half maximal inhibitory concentration
  • the selectivity of 9501, 9504, 9510 and AA8 are 32-fold, 64-fold, 16-fold and 8-fold, respectively, and were identified as excellent candidates for development as therapeutic agents.
  • the top six aurones can significantly inhibit the replication of intracellular Mtb in macrophage- like cells
  • Amikacin (AMI), Ethambutol (ETH), Isoniazid (INH), and Rifampin (RIF) were used at their suggested doses against intracellular Mtb (1 mg/mL, 0.5 mg/mL, 0.5 mg/mL and 0.4 mg/mL, respectively (Development GAfTD. Handbook of anti-tuberculosis agents. Tuberculosis.
  • Mtb the shikimate pathway is essential and leads to the biosynthesis of a wide range of primary and secondary metabolites, including aromatic amino acids, folate, naphthoquinones, menaquinones and mycobactins (Parish et al. Microbiology.2002; 148(Pt 10):3069-77)
  • Mtb-Cs converts 5-enol-pyruvyl shikimate-3-phosphate (EPSP) to chorismate via a 1,4- trans elimination of phosphate (Macheroux et al. Planta 1999; 207:325-34).
  • the reaction requires a reduced flavin mononucleotide (FMNred) and NADH (FIG.4A).
  • the Mtb-Cs also functions as a NADH:FMN oxidoreductase in this reaction (Ely et al. BMC Biochem.2008; 9:13).
  • Two plasmids were constructed the first expressing the Mtb EPSP synthase (EPSPs, Rv3227) and the second expressing Mtb Cs (Rv2540c), and Mtb EPSPs and Cs from the soluble components of the lysates of the E. coli strains expressing them were purified by His-Trap Affinity Chromatography.
  • Aurones AA2A and AA8 significantly reduced both phosphate production and the consumption of ESPS, which are key to Mtb chorismate synthase activity; thus aurones AA2A and AA8 significantly reduced Mtb chorismate synthase activity.
  • Aurones AA2A and AA8 can significantly reduce the bacterial load in lungs of Mtb infected mice The in vivo efficacies of aurones AA2A and AA8 against Mtb in BALB/c mice was determined. First a pilot drug-tolerance-test was conducted before evaluating the efficacies of the aurones in vivo.
  • the aurone AA2A and aurone AA8 stocks in DMSO were first 1:1 mixed with Tween 80 to improve aqueous solubility, and then added to phosphate buffer at four final concentrations for delivering 1 mg/kg, 2 mg/kg, 5 mg/kg, or 10 mg/kg into mice. These four concentrations were intraperitoneally (i.p.) injected into 6-wk BALB/c female mice daily for seven days. Mice were weighed daily and examined twice daily for adverse effects. No weight loss or other adverse effects were identified.5 mg/kg of aurone AA2A and aurone AA8 was determined to be a safe dose for mice, and this dose was used to treat infected mice thereafter.
  • mice were aerosol infected by the tdTomato labeled Mtb CDC1551 strain at a low dose (20 cfu - 80 cfu).
  • mice were randomly separated into a control group and AA2A or AA8 treatment groups.
  • For the treatment groups 5 mg/kg of AA2A or AA8 was injected i.p. daily.
  • the mice in the control group were injected with the vehicle buffer (10 mM phosphate buffer + 2.5% Tween80 + 2.5% DMSO).
  • IVIS data were collected for the live mice and ex vivo for the harvested lungs using tdTomato excitation and emission wavelengths at the day before treatment started and on day 12 post-treatment (FIG.5A).
  • the IVIS data showed that the tdTomato specific fluorescence intensity of the two aurone treated groups of mice were significantly lower than the untreated mice after the 12-day treatment.
  • Bacterial cfu counts in the lungs of each group of mice were also collected using homogenized lungs that were cultured on agar plates. Bacterial cfu in the lungs of treated mice reduced 1.45 log (AA2A) and 1.18 log (AA8) cfu/lung compared to untreated mice, respectively (FIG.5B). Demonstrating the safety of aurones as potential therapeutic agents
  • Serum was prepared from each sample and a blood chemistry profile was conducted to assess enzyme levels associated with the liver and kidney as well as electrolyte levels.
  • Table 9 shows the codes for the blood chemistry analysis that were performed as well as the expected ranges and Table 10 shows the results. Compared to the controls and vehicles, none of the aurones caused any toxicological problems at any concentration, indicating the potential of the aurones as safe therapeutic agents.
  • This Example shows further screening of aurones 9504, 9505, 9501, 9510, AA2A and AA8 identified in Example 1.
  • Aurones 9504, 9505, 9501, 9510, AA2A and AA8 inhibited the growth of Mtb with minimal inhibitory concentrations of 6.25 mM, 12.5 mM, 25 mM, 25 mM, 25 mM, and 50 mM, respectively.
  • Aurones 9504, 9501, AA2A, or AA8 significantly reduced the Mtb load in the lungs of infected mice after a 12-day treatment.
  • Three of the aurones (aurones 9504, 9501, and 9510) showed lower cytotoxic effects on human liver cells than rifampicin.
  • Example 1 Aurones were synthesized as disclosed in Example 1. Mtb strains were cultured as described in Example 1. Efficacies of aurones against intracellular Mtb infection were determined as described in Example 1. Minimum Inhibitory Concentrations (MICs) of aurones
  • a resazurin microtiter assay (REMA) was used to determine MICs of the six aurone leads (aurones AA2A, AA8, 9501, 9504, 9505, and 9510). This assay assesses activity of a compound against Mtb growth by measuring resazurin color change (reduction of resazurin) after adding it into bacterial culture (Zwergel et al. Nat Prod Commun.2012; 7:389-94).
  • Black 96-well microplates were preloaded with 100 mL of 2-fold serial dilutions of aurones (1.56 mM - 100 mM) or RIF (0.0625 - 4 mM) in MOAD-Tw with 3 replicates for each concentration. After adjusting absorbance of bacterial culture to a McFarland tube No.1, the bacteria were diluted 1:20 by the medium, and 100 mL was used as an inoculum to load into each well. The plates were covered, sealed in plastic bags, and incubated at 37°C in the normal atmosphere. After 7 days of incubation, 30 mL of resazurin solution (0.02%) was added to each well, incubated overnight at 37°C, and assessed for color development. A change from blue to pink indicates reduction of resazurin and therefore bacterial growth. All MICs were performed in duplicate on at least two independent cultures. Cytotoxicity assay
  • mice Five to seven week old female BALB/c mice were obtained from Jackson Laboratories. All animals were housed in UTHSC Regional Biocontainment Laboratory (RBL) in a controlled environment with 12 hour light / 12 hour dark cycle, at a temperature in a range of approximately 18-23°C, and with 40-60% humidity.
  • RBL UTHSC Regional Biocontainment Laboratory
  • Pilot drug-tolerance-test Prior to testing in vivo efficacies of the aurones, the drug- tolerance of the aurones in BALB/c mice were determined using a single dose range-finding study. AA2A, AA8, 9501, and 9504 stock solutions (40 mg/mL) dissolved in DMSO were mixed 1:1 with Tween 80 to improve aqueous solubility, and then added into phosphate buffer to four final concentrations for delivering 1 mg/kg, 2 mg/kg, 5 mg/kg, or 10 mg/kg into mice. Aurones were intraperitoneally (i.p.) injected into 6-week-old BALB/c female mice daily for seven days. Mice were weighed daily and examined twice per day for adverse effects and were monitored by veterinarians and specialized technicians.
  • mice were aerosol infected using the Bio- Aerosol Nebulizing Generator in UTHSC RBL, with 5 X 10 5 cfu/mL of Mtb in PBS to deliver approximately 10-20 cfu/lung.
  • mice were randomly grouped into the vehicle treated, AA2A-, or AA8-, or 9501, or 9504 treated groups, six mice per group per time point.
  • For the treated groups 5 mg/kg of AA2A, AA8, 9504, or 9501 was i.p. injected daily.
  • the control group of mice were injected with the vehicle buffer (10 mM phosphate buffer + 2.5% Tween 80 + 2.5% DMSO).
  • IVIS Spectrum in vivo imaging system (PerkinElmer, Inc., Waltham, MA) was used to collect ex vivo images for the harvested lungs one day before the treatment started and on day 12 post-treatment, following the protocol described previously with tdTomato excitation and emission wavelengths (Kong et al. PLoS One 2016; 11:e0149972.).
  • Mice were euthanized by inhalation of an overdose of isoflurane (>5%) followed by cervical dislocation at the designed time points or when significant illness was observed to prevent undue suffering.
  • Bacterial CFU counts in lungs of each group of mice were also collected by plating homogenized lungs on 7H11 agar plates at day 1, day 21, day 28, and day 40.
  • Mtb chorismate synthase activity assay
  • Mtb-Cs Mtb chorismate synthase
  • the reaction uses Mtb EPSP synthase (EPSPs) for biosynthesis of 5-enol- pyruvyl shikimate-3-phosphate (EPSP), the substrate forchorismate synthase, and Mtb-Cs for the formation of chorismate.
  • ESPs Mtb EPSP synthase
  • the methods for making purified recombinant Mtb EPSPs and Cs are described in Example 1.
  • EPSP synthesis The synthesis of EPSP was carried out in a vial containing EPSPs (0.7U), shikimate (9.6 mM), and phosphoenolpyruvate (PEP; 3 mM) at 25 °C for 30 minutes. The equilibrium of the forward reaction was displaced using purine nucleoside phosphorylase (PNP, 2U) and 2-amino-6-mercapto-7-methylpurine ribonucleoside (MESG, 0.4 mM), which consumes Pi, increasing the final concentration of EPSP in the reaction mixture. The cleaved MESG changed absorbance from 330 nm to 360 nm. Thus, EPSP synthesis was monitored by measuring A 360 using a spectrophotometer. The enzymes were removed by ultrafiltration (3 kD cut-off Centricon).
  • Mtb-Cs activity After EPSP synthesis, the reaction mix was directly used as a source of EPSP for chorismate synthesis reaction after ultrafiltration using a centricon 3 kDa cutoff to remove enzymes.
  • the reaction of converting EPSP to chorismate and Pi by Cs comprised Mtb- Cs, EPSP (15 uL), FMN (0.04 mM), and NADH (0.3 mM).
  • the production of chorismate from the enzymatic reaction was determined by measuring Pi production using MESG (0.2 mM) and PNP (1 U). To assess aurone effect on Cs, Cs was incubated with various concentrations of the aurone leads in a vial preloaded with EPSP and FMN.
  • the standard resazurin microtiter assay (REMA) was conducted.
  • the MIC was defined as the lowest drug concentration that prevented the color change of resazurin from blue to pink.
  • the 9504, 9505, 9501, 9510, AA2A and AA8 aurones inhibited the growth of Mtb with MICs of 6.25, 12.5, 25, 25, 25, and 50 mM, respectively. Results are shown in Table 11.
  • the cytotoxic effects of aurones to the human liver cell line HepG2 and primate kidney Vero cell were evaluated after a 2-day incubation using the microculture tetrazolium (MTT) cell viability assay.
  • Concentration gradients of the selected aurones and RIF (as a control) were incubated with the two cell lines.
  • Half maximal inhibitory concentration (IC50) of aurones on these two cell lines were calculated.
  • IC50 Half maximal inhibitory concentration
  • SI selectivity index
  • Aurone 9504 has a SI higher than that of RIF on both cell lines.
  • Aurones 9501 and 9510 have SIs > 10 on HepG2 and Vero cells, which are comparable to the SI of RIF on these two cell lines. Results are shown in Table 11.
  • the intracellular activities of aurones AA2A, AA8, 9501, 9504, 9505, and 9510 were evaluated in the human macrophage THP-1 cell line.
  • Amikacin, ethambutol, INH, and RIF were employed as positive controls at their in vitro MICs against intracellular Mtb (Brennan et al. Tuberculosis 88:85-170).
  • the six aurones completely inhibited intracellular Mtb replication after 48 hours of treatment (FIG.7).
  • the CFUs of intracellular Mtb treated by the six aurones were all significantly lower than the untreated control (P ⁇ 0.0001).
  • aurone 9505 had higher activity against intracellular Mtb than ETH or INH, and it reduced intracellular CFU compared to the initially infected intracellular bacterial number (Ctrl 0-h). At 25 mM and 50 mM, aurone 9505 had a higher activity than RIF (Table 12). Table 12. Comparison of potencies against intracellular Mtb between aurone leads and the recommended anti-TB drugs
  • Aurones AA2A, AA8, 9501, and 9504 can significantly reduce bacterial load in the lungs of Mtb- infected mice.
  • mice have been widely used to evaluate efficacy of anti-TB drugs (Vandamme. J Pharm Bioallied Sci 2014; 6:2-9). Mouse strains with different genotypes vary in susceptibility to virulent Mtb (Medina et al..1998. Immunology 93:270-4). BALB/c mice are more susceptible to Mtb infection than other mice with increasing bacterial load and shorter survival time post-infection (Franzblau et al. Tuberculosis (Edinb) 2012; 92:453-88)(18). Aerosol infection of Mtb is a widely accepted route of infection in the evaluation of candidate anti-TB drugs in mice (Orme, Am Rev Respir Dis 1988; 137:716-8).
  • mice were randomly grouped into the vehicle-, AA2A-, AA8-, 9501-, or 9504-treated groups.
  • the vehicle-treated group of mice were injected with the vehicle buffer (10 mM phosphate buffer + 2.5% Tween 80 + 2.5% DMSO).
  • IVIS Spectrum in vivo imaging system (PerkinElmer, Inc., Waltham, MA) was used to collected ex vivo images for the harvested lungs one day before the treatment started and on day 12 post-treatment, following the protocol described previously (Kong et al. PLoS One 2016; 11:e0149972) (FIG.8C & FIG.8D).
  • the reaction requires a reduced flavin mononucleotide (FMNred) and NADH (FIG.4A).
  • the Mtb-Cs serves as a NADH:FMN oxidoreductase in this reaction (Ely et al. BMC Biochem 2008; 9:13).
  • Mtb-EPSPs and -Cs were extracted from the soluble components of the lysates of the E. coli strains expressing them by affinity chromatography on a HisTrap HP Ni2+ IMAC column eluted with concentration gradient of imidazole.
  • the samples were analyzed by SDS-PAGE, and the results showed that rRv2540c and rRv3227 had molecular masses as predicted (42.9 kD and 46.3 kD) based on their amino acid sequences (FIG.4B).
  • the inhibitory effects of the aurone leads on Mtb-Cs activity was analyzed by comparing Pi released from the chorismate synthesis reaction between samples treated with and without aurones.
  • the production of chorismate from the enzymatic reaction was determined by measuring Pi production using the purine nucleoside phosphorylase (PNP) and 2-amino-6-mercapto-7-methylpurine ribonucleoside (MESG).
  • the untreated sample was added the aurone dilution buffer containing the same concentration of DMSO as those of the aurone-treated samples and was set as a positive control (activity 100%).
  • the samples co-incubated with the aurone leads showed significant Pi reduction compared to the untreated control with a dose-response effect, indicating that the aurone leads can inhibit Mtb-Cs activity (FIG.9A & FIG. 9B).

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

La présente divulgation concerne des composés, des compositions et des méthodes de traitement ou de prévention d'une infection ou d'une maladie comprenant, dans certains modes de réalisation spécifiques, le traitement ou la prévention de la tuberculose et/ou d'une infection par Mycobacterium tuberculosis (Mtb). Dans un aspect, la présente divulgation concerne des aurones comprenant, par exemple, l'aurone 9504, l'aurone 9505, L'aurone 9501, l'aurone 9510, l'aurone AA2A, et l'aurone AA8, des compositions comprenant des aurones, et des méthodes d'utilisation d'aurones pour traiter ou prévenir la tuberculose.
PCT/US2020/030623 2019-04-30 2020-04-30 Aurones et méthodes d'utilisation d'aurones pour traiter la tuberculose WO2020223439A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201962840788P 2019-04-30 2019-04-30
US62/840,788 2019-04-30

Publications (1)

Publication Number Publication Date
WO2020223439A1 true WO2020223439A1 (fr) 2020-11-05

Family

ID=70861540

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2020/030623 WO2020223439A1 (fr) 2019-04-30 2020-04-30 Aurones et méthodes d'utilisation d'aurones pour traiter la tuberculose

Country Status (1)

Country Link
WO (1) WO2020223439A1 (fr)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114349743A (zh) * 2022-01-15 2022-04-15 中国科学院新疆理化技术研究所 一种含杂环橙酮类衍生物及抗菌用途
KR20220124557A (ko) * 2021-03-03 2022-09-14 경북대학교 산학협력단 Cyp1a 억제용 화합물 및 이를 포함한 cyp1a 억제용 조성물
EP4296674A1 (fr) 2022-06-20 2023-12-27 Université Toulouse III - Paul Sabatier Molécules innovantes réduisant la virulence des mycobactéries pour le traitement de la tuberculose

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2017149551A1 (fr) * 2016-03-03 2017-09-08 Council Of Scientific & Industrial Research Alcaloïdes d'aurone substitués en tant qu'agents anti-mycobactériens
WO2017180644A1 (fr) 2016-04-11 2017-10-19 Middle Tennessee State University Aurones thérapeutiques

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2017149551A1 (fr) * 2016-03-03 2017-09-08 Council Of Scientific & Industrial Research Alcaloïdes d'aurone substitués en tant qu'agents anti-mycobactériens
WO2017180644A1 (fr) 2016-04-11 2017-10-19 Middle Tennessee State University Aurones thérapeutiques

Non-Patent Citations (36)

* Cited by examiner, † Cited by third party
Title
ALSAIF ET AL., CURR PHARM BIOTECHNOL., vol. 18, no. 5, 2017, pages 3 84 - 90
ANDRÉ CAMPANIÇO ET AL: "Azaaurones as Potent Antimycobacterial Agents Active against MDR- and XDR-TB", CHEMMEDCHEM, vol. 14, no. 16, 20 August 2019 (2019-08-20), pages 1537 - 1546, XP055714623 *
BANDGAR ET AL., EUR J MED CHEM., vol. 45, no. 7, 2010, pages 3223 - 7
BRENNAN ET AL., TUBERCULOSIS, vol. 88, pages 85 - 170
CARRASCO ET AL., CHEM MED CHEM, vol. 11, no. 19, 2016, pages 2194 - 204
CARRASCO ET AL., CHEM MED CHEM., vol. 11, no. 19, 2016, pages 2194 - 204
DONG YANG ET AL: "Identification of Anti-tuberculosis Compounds From Aurone Analogs", FRONTIERS IN MICROBIOLOGY, vol. 11, 20 May 2020 (2020-05-20), XP055714908 *
ELY ET AL., BMC BIOCHEM, vol. 9, 2008, pages 13
ELY ET AL., BMC BIOCHEM., vol. 9, 2008, pages 13
FRANZBLAU ET AL., TUBERCULOSIS (EDINB, vol. 92, 2012, pages 453 - 88
G. A. YUGAI ET AL: "Absorption spectra of photoinduced E isomers of aurones, thioindogenides, and selenoindogenides", THEORETICAL AND EXPERIMENTAL CHEMISTRY, vol. 12, no. 5, 1977, pages 549 - 551, XP055715231 *
HADJ-ESFANDIARI ET AL., BIOORGANIC & MEDICINAL CHEMISTRY LETTERS, vol. 17, no. 22, 2007, pages 6354 - 63
HAUDECOEUR ET AL., CURR MED CHEM., vol. 19, no. 18, 2012, pages 2861 - 75
HAWKINSHANDY, TETRAHEDRON, vol. 69, no. 44, 2013, pages 9200 - 4
HUANG ET AL., J CHIN MED ASSOC., vol. 77, no. 4, 2014, pages 169 - 7
JAYASWAL ET AL., PLOS PATHOGENS, vol. 6, no. 4, 2010, pages e 1 000839
KONG ET AL., METH. MOL. BIOL., vol. 1790, 2018, pages 75 - 8
KONG ET AL., PLOS ONE, vol. 11, 2016, pages eO 149972
MACHEROUX ET AL., PLANTA, vol. 207, 1999, pages 325 - 34
MEDINA ET AL., IMMUNOLOGY, vol. 93, 1998, pages 270 - 4
ONO ET AL: "Aurones serve as probes of @b-amyloid plaques in Alzheimer's disease", BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS, vol. 361, no. 1, 2007, pages 116 - 121, XP022176156 *
ORME, AM REV RESPIR DIS, vol. 137, 1988, pages 716 - 8
PARISH ET AL., MICROBIOLOGY, vol. 148, 2002, pages 3069 - 77
PARK ET AL., INT IMMUNOPHARMACOL., vol. 43, 2017, pages 116 - 28
PARK ET AL., INTIMMUNOPHARMACOL., vol. 43, 2017, pages 116 - 28
PIRES ET AL., JOURNAL OF MEDICINAL CHEMISTRY, vol. 44, no. 22, 2001, pages 3673 - 81
PUGH ET AL., CLIN LIVER DIS., vol. 13, no. 2, 2009, pages 277 - 94
ROUSSAKI ET AL.: "have described the numbering scheme for substituent position for aurone derivatives (FIG. 3), which is reproduced below to assist in identifying substituent positions", INT. J. MED. CHEM., 2012
SCHMID ET AL., TRANSPLANTATION PROCEEDING, vol. 37, no. 1, 2005, pages 110
SUTTON ET AL., BIOORGANIC & MEDICINAL CHEMISTRY LETTERS, vol. 27, no. 4, 2017, pages 901 - 3
THOMAS ET AL., BIOORGANIC & MEDICINAL CHEMISTRY LETTERS, vol. 13, no. 3, 2003, pages 423 - 6
THOMAS ET AL., BIOORGMED CHEM LETT, vol. 13, 2003, pages 423 - 6
TUBERCULOSIS, vol. 88, no. 2, 2008, pages 85 - 169
VANDAMME, J PHARM BIOALLIED SCI, vol. 6, 2014, pages 2 - 9
VARMA ET AL., TETRAHEDRON LETTERS, vol. 33, no. 40, 1992, pages 5937 - 40
ZWERGEL ET AL., NAT PROD COMMUN., vol. 7, 2012, pages 389 - 94

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20220124557A (ko) * 2021-03-03 2022-09-14 경북대학교 산학협력단 Cyp1a 억제용 화합물 및 이를 포함한 cyp1a 억제용 조성물
KR102609686B1 (ko) * 2021-03-03 2023-12-06 경북대학교 산학협력단 Cyp1a 억제용 화합물 및 이를 포함한 cyp1a 억제용 조성물
CN114349743A (zh) * 2022-01-15 2022-04-15 中国科学院新疆理化技术研究所 一种含杂环橙酮类衍生物及抗菌用途
CN114349743B (zh) * 2022-01-15 2024-01-26 中国科学院新疆理化技术研究所 一种含杂环橙酮类衍生物及抗菌用途
EP4296674A1 (fr) 2022-06-20 2023-12-27 Université Toulouse III - Paul Sabatier Molécules innovantes réduisant la virulence des mycobactéries pour le traitement de la tuberculose

Similar Documents

Publication Publication Date Title
US10717739B2 (en) Methods and compositions for inhibition of bromodomain-containing proteins
WO2020223439A1 (fr) Aurones et méthodes d'utilisation d'aurones pour traiter la tuberculose
AU2012301953C1 (en) Antibacterial compounds and methods for use
JP2010508343A (ja) 薬理学的に活性なｎ，ｎ’−置換型３，７−ジアザビシクロ［３．３．１］ノナン類、それらに基づく医薬組成物、及びそれらの使用方法
KR20240053077A (ko) 병용 요법
US20170071940A1 (en) Methionine Aminopeptidase Inhibitors for Treating Infectious Diseases
Ashok et al. Synthesis and in-vitro anti-leishmanial activity of (4-arylpiperazin-1-yl)(1-(thiophen-2-yl)-9H-pyrido [3, 4-b] indol-3-yl) methanone derivatives
CN103221399A (zh) 2-哌嗪-1-基-4h-1,3-苯并噻嗪-4-酮衍生物及其用于治疗哺乳动物感染的用途
Carta et al. Design, synthesis and antitubercular activity of 4-alkoxy-triazoloquinolones able to inhibit the M. tuberculosis DNA gyrase
KR101419320B1 (ko) 2-(치환된-아미노)-벤조티아졸 설폰아미드 ｈｉｖ 프로테아제 저해제
JP2018138609A (ja) ナフチリジンジオン誘導体
WO2022198003A1 (fr) Modulateurs allostériques négatifs du récepteur 2 du glutamate métabotropique
Silva et al. Synthesis and medicinal chemistry of tetronamides: Promising agrochemicals and antitumoral compounds
Shejale et al. Synthesis, characterization and evaluation of antitubercular and analgesic activity of some novel pyrazolopyrimidine and pyrazolopyridine derivatives
Al-Matarneh et al. New Library of Iodo-Quinoline Derivatives Obtained by an Alternative Synthetic Pathway and Their Antimicrobial Activity
Agre et al. Synthesis and mycobacterial evaluation of 5‐substituted‐6‐acetyl‐2‐amino‐7‐methyl‐5, 8‐dihydropyrido‐[2, 3‐d] pyrimidin‐4 (3H)‐one derivatives
KR101696352B1 (ko) 다제 내성 결핵균 억제용 조성물
WO2017046603A1 (fr) Composés antibactériens et nouvelles utilisations de ceux-ci
WO2012101388A1 (fr) Nouveaux derives d'azacoumarines presentant une activite inhibitrice des pompes mdr
WO2022254464A1 (fr) Composés hétérocycliques tricycliques substitués utilisés en tant qu'inhibiteurs de métallo-bêta-lactamase
IL44124A (en) Compositions containing 2-amino-4-hydroxy-7,8-dihydro pteridine derivatives for treating microbial infections
WO2023128786A1 (fr) Nouveaux dérivés de triazole antiviraux, leur synthèse et leur utilisation pour le traitement d'infections virales de mammifères
Abdel-Karim et al. Impeding efflux-mediated resistance in Staphylococcus aureus
US20230295095A1 (en) Novel fused-heterocyclyl-carbonohydrazonoyl dicyanide compounds and use thereof
WO2023225043A1 (fr) Modulateurs tricycliques et tétracycliques du récepteur de la sérotonine et leurs procédés de fabrication et d'utilisation

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20728844

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 20728844

Country of ref document: EP

Kind code of ref document: A1