WO2020212650A1 - Procédé de prédiction de réponse à un traitement avec des inhibiteurs de tyrosine kinase et procédés associés - Google Patents

Procédé de prédiction de réponse à un traitement avec des inhibiteurs de tyrosine kinase et procédés associés Download PDF

Info

Publication number
WO2020212650A1
WO2020212650A1 PCT/FI2020/050257 FI2020050257W WO2020212650A1 WO 2020212650 A1 WO2020212650 A1 WO 2020212650A1 FI 2020050257 W FI2020050257 W FI 2020050257W WO 2020212650 A1 WO2020212650 A1 WO 2020212650A1
Authority
WO
WIPO (PCT)
Prior art keywords
subject
treatment
expression
arpp19
expression level
Prior art date
Application number
PCT/FI2020/050257
Other languages
English (en)
Inventor
Eleonora MÄKELÄ
Jukka Westermarck
Original Assignee
Turun Yliopisto
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Turun Yliopisto filed Critical Turun Yliopisto
Publication of WO2020212650A1 publication Critical patent/WO2020212650A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers

Definitions

  • the present invention belongs to the field of personalized medicine. More specifically, the invention relates to biomarkers, namely NOCIVA and optionally ARPP19, for use in a predicting response to treatment with tyrosine kinase inhibitors in subjects with haematological cancer, such as CML, ALL or AML. Use of said biomarkers for related purposes is also envisaged. Moreover, said biomarkers not only facilitate disease management of subjects with haematological cancers but could also be employed in clinical trials of drug candidates.
  • Chronic myeloid leukaemia also known as chronic myelogenous leukaemia, accounts for about 15-25% of all adult leukaemias.
  • CML is associated with a chromosomal translocation called the Philadelphia chromosome, and it is characterized by the increased and unregulated growth of myeloid cells in the bone marrow and the accumulation of these cells in the blood. The translocation is also found in acute lymphoid leukemia (ALL), as well as in rare cases of acute myeloid leukemias (AML).
  • ALL acute lymphoid leukemia
  • AML rare cases of acute myeloid leukemias
  • TKIs tyrosine-kinase inhibitors
  • first-generation TKI imatinib which is extremely safe and potentially quite cheap, has been reported to lead to long-term optimal response in approximately 60% of patients.
  • Second generation TKIs dasatinib and nilotinib are licensed for first-line therapy based on data from phase III clinical trials (DASISION and ENESTnd). These trials suggest that both dasatinib and nilotinib are superior drugs when compared with standard dose imatinib (Saglio et al. NEJM, 2010, 362: 2251-2259; Kantarjian et al. NEJM, 2010, 362: 2260-2270).
  • the survival advantage may largely depend on a particular TKI.
  • Acute myeloid leukaemia is the most common acute leukaemia affecting adults. Incidence of AML is 2 to 3 new cases per 100 000 inhabitants per year. AML is a heterogeneous clonal haematological malignancy that disrupts normal hematopoiesis and it is one of the most aggressively progressive cancer types.
  • First curative therapies for AML were developed in the 1970s-80s and before this, patients with AML had a dismal prognosis of only three months. In the 2010s, 50% of the patients with AML under age 60-65 can obtain a full remission.
  • Tyrosine kinases play a critical role also in AML. Indeed, TKls show an interesting clinical potential at least in certain subsets of AML patients. For example, imatinib shows interesting clinical activity in a subset of patients with c- kit-positive AML (Kindler et al. Blood, 2004, 103: 3644-3654), while dasatinib show clinical potential in a rare subtype of AML, namely BCR-ABL-positive AML (Xiaoyan Shao et al. Medicine, 2018, 97: 44).
  • Protein Phosphatase 2A is a trimeric (A-B-C subunits) tumor suppressor complex. In cancer cells, the tumor suppressor activity of PP2A is inhibited. However, the PP2A complex proteins are mutated with rather low frequency in all cancer types. Instead, the most prevalent mode of PP2A inhibition in cancer seems to be the overexpression of PP2A inhibitor proteins, such as cancerous inhibitor of PP2A (C1P2A or K1AA1524). C1P2A overexpression associates with poor patient prognosis in more than dozen human solid cancer types (Khanna and Pimanda, Int J Cancer, 2016, 138: 525-532).
  • ARPP19 cAMP-regulated phosphoprotein 19
  • ARPP- 19 a member of the alpha-endosulfine (ENSA) family
  • ENSA alpha-endosulfine
  • ARPP19 requires phosphorylation of a conserved serine residue (Ser-62) by the Greatwall kinase (mammalian Greatwall orthologue is MAST -like kinase) in order to bind PP2A and subsequently inhibit PP2A activity towards a physiological CDK1 substrate.
  • Ser-62 conserved serine residue
  • MAST -like kinase MAST -like kinase
  • An object of the present invention is to provide means and methods for predicting a response of a particular patient to TKls.
  • the invention is defined by the appended claims.
  • the invention provides an in vitro method of predicting whether a subject with haematological cancer is likely to have a positive response to a treatment with a first generation tyrosine kinase inhibitor (TK1), the method comprising: (a) determining a level of N0C1VA expression in a sample obtained from the subject;
  • low expression level of ARPP19 as compared to the control indicates that the subject is likely to have a positive response to the second generation TK1.
  • high expression level of ARPP19 as compared to the control indicates that the subject is not likely to have a positive response to the second generation TK1.
  • FIG. 1C Imatinib treated CML patients with low NOCIVA expression had a higher rate of early molecular response (EMR), although this did not reach statistical significance (p>0.05).
  • FIG. 2B ARPP19 protein expression across indicated AML human cell lines. Based on results MOLM-14 and Kasumil are considered as low ARPP19 expressing cell lines whereas HL-60 and KG1 are considered as high ARPP19 expressing cell lines.
  • FIG. 2C Validation of resistance to 2nd generation tyrosine kinase inhibitor (2G TKI) Dasatinib in high ARPP19 expressing AML cell lines (HL-60 and KG1) in MCM medium. Other tested drugs did not show exclusive correlation between drug response and ARPP19 protein levels.
  • FIG. 2D High ARPP19 expressing AML cell lines (HL-60 and KG1) show resistance to 2G TKI drug, Dasatinib, in MCM medium.
  • Figure 4A A schematic presentation of the present method of predicting response to treatment and/or selecting or recommending an effective treatment to subjects with haematological cancer.
  • Figure 4B A schematic presentation of an embodiment of the present method of predicting response to treatment and/or selecting or recommending an effective treatment to subjects with haematological cancer.
  • FIG. 5A NOCIVA expression in 158 CML patients stratified by whether the patient subsequently progressed to blast crisis.
  • RQ relative quantification.
  • FIG. 7A FFP for 158 CML patients stratified into quartiles based on NOCIVA expression. Quartile 1 had the lowest NOCIVA expression and quartile 4 had the highest NOCIVA expression. A trend not reaching statistical significance is shown that patients with high NOCIVA expression (4th quartile) at diagnosis had inferior FFP.
  • the methods provided herein are based, at least in part, on the surprising discovery that the expression level of NOCIVA or NOCIVA and ARPP19 can be used to predict whether a subject with a myeloid disease is likely or unlikely to respond to a specific type or class of tyrosine kinase inhibitors (TKIs). Accordingly, the determined expression level of NOCIVA or NOCIVA and ARPP19 can accurately determine, discriminate between and/or stratify which type or class of TKIs should be selected or recommended for the treatment of a haematological cancer and/or administered to subject for the treatment of a haematological cancer.
  • TKIs tyrosine kinase inhibitors
  • the term "subject” refers to an animal, preferably to a mammal, more preferably to a human.
  • the term includes, but is not limited to, mammalian animals such as domestic animals such as livestock, pets and sporting animals. Examples of such animals include without limitation carnivores such as cats and dogs and ungulates such as horses.
  • the present invention may be applied in both human and veterinary medicine.
  • the terms "subject”, “patient” and “individual” are interchangeable.
  • the term "apparently healthy” refers to a subject or a pool of subjects who show no signs of a haematological cancer or its subtype in question, and thus are believed not to be affected by said cancer or its subtype in question and/or who are predicted not to develop said cancer or its subtype in question.
  • tyrosine kinase inhibitor refers to a pharmaceutical drug that inhibits tyrosine kinases, which are enzymes that are responsible for the activation of many proteins by signal transduction cascades. Tyrosine kinases activate their target proteins by adding a phosphate group to the protein, a step that TKIs inhibit.
  • first-generation BCR-ABL1 TKI (1G TKI) refers to the original BCR-ABL1 TKI imatinib.
  • second-generation BCR-ABL1 TKI refers to BCR-ABL1 TKIs developed with the aim to override the BCR-ABL1- dependent resistance by loosening conformational and binding requirements without loosing specificity.
  • 2G TKIs solve almost the entirety of BCR-ABL1 mutations except for T351I.
  • 2G TKIs show decreased resistance and intolerance as compare to imatinib.
  • Currently available clinically approved 2G TKIs include nilotinib, dasatinib, and bosutinib.
  • the term 2G TKI is not limited to the TKIs listed herein.
  • the term "effective amount” refers to an amount of pharmaceutical drug, such as TKI, by which harmful effects of the haematological cancer are, at a minimum, ameliorated.
  • the term "likely to respond” refers to an above-average likelihood, chance or probability that a subject will have a positive response to treatment.
  • a subject having a positive response to treatment can be regarded as a subject who is sensitive to said treatment.
  • OS all survival
  • EFS event free survival
  • EMR early molecular response
  • time to complete cytogenetic response refers to the length of time required for achieving 0% Ph+ metaphases by conventional cytogenetics or BCR-ABL1/ABL1 ratio of 1%.
  • time to major molecular response refers to the length of time required for achieving a BCR-ABL1/ABL ratio of 0.1% or less. This may also be described as a 3 log reduction from baseline/ diagnosis.
  • time to complete molecular response refers to the length of time required for achieving no detectable BCR-ABL1 transcripts in two consecutive samples with good quality control values.
  • remission refers to the disappearance of the signs and symptoms of a disease.
  • a remission can be temporary or permanent.
  • FFP freedom from progression
  • NOCIVA refers to a variant of cancerous inhibitor of PP2A (CIP2A or KIAA1524). At mRNA level, the variant comprises exons 1-13 of CIP2A fused C-terminally to a part of the intron between exons 13 and 14 in KIAA1524 gene. NOCIVA transcript thus formed is a unique and previously unknown sequence, wherein the intronic sequence is in a coding frame with a preceding CIP2A mRNA sequence, and after 40 nucleotides, corresponding to 13 amino acids, is followed by classical stop codon (translation termination) TAA.
  • the NOCIVA gene product codes for a truncated CIP2A protein with 13 new amino acids (NNKNTQEAFQVTS; SEQ ID NO: 3) at the C-terminal end.
  • this 13 aa peptide sequence does not match with any known protein sequence in the human proteome based on a Blast homology search.
  • the nucleic acid sequence set forth in SEQ ID NO: 1 represents the complementary DNA (cDNA) sequence of NOCIVA mRNA, while the amino acid sequence of NOCIVA polypeptide is set forth in SEQ ID NO: 2.
  • SEQ ID NO: 3 corresponds to amino acids 546-558 of SEQ ID NO: 2.
  • the term “high expression” refers to an expression level of a biomarker that is higher in a sample under analysis than in a relevant control sample, or exceeds a control value. High expression level can be determined qualitatively and/or quantitatively according to standard methods known in the art. In some embodiments, the term “high expression” refers to a statistically significantly higher level or amount of the biomarker as compared with that of a relevant control.
  • the term “low expression” refers to an expression level of a biomarker that is lower in a sample under analysis than in a relevant control sample, or is below a control value. Low expression level can be determined qualitatively and/or quantitatively according to standard methods known in the art. In some embodiments, the term “low expression” refers to a statistically significantly lower level or amount of the biomarker as compared with that of a relevant control.
  • the term “relevant control” refers to a mean expression level of a biomarker in question in a sample obtained from apparently healthy subjects. In some other embodiments, the term “relevant control” refers to a mean expression level of a biomarker in question in subjects with the haematological cancer in question. Accordingly, the term “relevant control” may refer not only to a control sample but also to a control value obtained from a control sample.
  • low expression level of ARPP19 indicates that the subject is likely to respond to a second generation TK1
  • high expression level of ARPP19 indicates that the subject is not likely to respond to a second generation TK1.
  • subjects with high NOC1VA expression should be assigned to or recommended or selected a treatment with a second or third generation TKIs
  • subjects with low NOC1VA expression should be assigned to or recommended or selected a treatment with first generation TKIs.
  • a treatment with 2G TKIs is sufficient for subjects with high NOC1VA expression.
  • subjects with high ARPP19 expression are at high relapse risk and should be assigned to or recommended or selected a treatment with third- or further generation TKIs, subjected to investigational protocols and/or monitored carefully for disease progression.
  • subjects with high NOC1VA and high ARPP19 expression should be assigned to or recommended or selected a treatment with third or further generation TKIs, and/or enhanced monitoring for disease progression.
  • Subjects with high NOC1VA and low ARPP19 expression should be assigned to or recommended or selected a treatment with second generation TKIs.
  • results set forth above may be used to formulate a prognostic scheme described in Figure 4A, wherein subjects with low expression level of NOC1VA are likely to respond to a 1G TK1 (imatinib) whereas subjects with high expression level of NOC1VA are likely not to respond to a 1G TK1 (imatinib) but are likely to respond to a 2G or 3G TK1, preferably to a 2G TK1.
  • the patients are analysed also for ARPP19 in order to distinguish subjects who are likely to respond to a 2G TK1 from those subjects who are not ( Figure 4B).
  • low expression level of ARPP19 indicates that the subject is likely to respond to a 2G TK1
  • high expression level of ARPP19 indicates that the subject is not likely to respond to a 2G TK1 and should therefore be assigned to treatment with more potent TKIs or investigational protocols and/or be monitored carefully for disease progression.
  • both the NOC1VA and ARPP19 assay or test are to be carried out.
  • NOC1VA surpasses the performance of C1P2A in all aspects of the invention including methods of predicting the response to treatment with a TKI, treatment selection or recommendation, or assigning treatment, or treatment efficiency assessment.
  • the present invention provides an in vitro method of predicting response to a TKI in a subject with haematological cancer, based on the determination of the expression level of NOCIVA in a sample obtained from said subject as set forth above.
  • the present invention provides an in vitro method of predicting response to a TKI in a subject with haematological cancer, based on the determination of the expression level of NOCIVA and ARPP19 in a sample obtained from said subject as set forth above.
  • NOCIVA or NOCIVA and ARPP19 determinations may provide substantial help in clinical decision making in choosing appropriate treatment procedures.
  • NOCIVA or NOCIVA and ARPP19 determination may be used for stratifying subjects for different treatment modalities.
  • the present invention also provides an in vitro method of selecting or recommending a type or a class of TKIs for the treatment of a haematological cancer in a subject in need thereof, based on the determination of the expression level of NOCIVA or optionally NOCIVA and ARPP19 in a sample obtained from said subject.
  • a 1G TKI imatinib
  • a 2G or 3G TKI should be selected for or recommended to those subjects whose NOCIVA expression level is high.
  • a 2G TKI should be selected for or recommended to those subjects whose NOCIVA expression level is high but ARPP19 expression is low.
  • Third or further generation TKI should be selected for or recommended to those subjects with high expression levels of both NOCIVA and ARPP19.
  • the present invention provides an in vitro method for monitoring treatment response predictions, treatment efficacy assessments, assigning treatments, and treatment selections or recommendations in a subject with haematological cancer, based on the determination of the expression level of NOCIVA or optionally NOCIVA and ARPP19 in a sample obtained from said subject.
  • a monitoring method involves analysing one or more serial samples obtained from the subject at different time points. The number and interval of the serial samples may vary as desired. The difference between the obtained determination results serves as an indicator of the course of the haematological cancer.
  • biomarker mRNA may be first converted into its complementary cDNA with the aid of a reverse transcriptase, followed by DNA amplification, e.g. by reverse transcriptase PCR (RT-PCR) including but not limited to quantitative PCR (qPCR), also known as real-time PCR.
  • RT-PCR reverse transcriptase PCR
  • qPCR quantitative PCR
  • the presence, absence or concentration of the expressed biomarker mRNA polynucleotide or an amplification product thereof may be assessed according to methods available in the art, for example by using a biomarker-specific capture or detection probe.
  • Intercalating dyes can be used to detect the amplification of the DNA fragment of interest during a nucleic acid amplification reaction such as PCR. Intercalation occurs when ligands of an appropriate size and chemical nature position between the planar base pairs of DNA. These ligands are mostly polycyclic, aromatic, and planar, and therefore often make suitable nucleic acid stains. The intensity of fluorescence increases respectively during the amplification and it can be measured in real-time without the need of separate oligo-nucleotide probes.
  • determining the expression of a biomarker is performed by sequencing techniques. Numerous methods suitable for this purpose have been described in the art and include, but are not limited to, traditional Sanger sequencing and next-generation sequencing (NGS) techniques. The pre-sent embodiments are not limited to any branded technique.
  • a representative commercial platform suitable for use in accordance with some embodiments of the invention, wherein the presence or quantity of a biomarker, if any, is detected by sequencing is Illumina’s sequencing by synthesis (SBS) technology, particularly TruSeq® technology.
  • SBS sequencing by synthesis
  • TruSeq® technology requires that two oligonucleotide probes, which hybridize upstream and downstream of the region of interest, are designed and synthetized. Each probe contains a unique, target specific sequence and a universal adapter sequence.
  • An extension-ligation reaction is used to unite the two probes and create a library of new template molecules with common ends.
  • Adapter-ligated DNA is then subjected to PCR amplification, which adds indexes and sequencing primers to both ends.
  • Sequencing may then be performed by any suitable equipment, such as MiSeq® sequencer, utilizing a reversible terminator-based method enabling detection of single bases as they are incorporated into growing DNA strands.
  • Non-limiting examples of suitable equipment for sequencing purposes include Illumina® Sequencers, such as MiSeqTM, NExtSeq500TM, and HiSeqTM (e.g. HiSeqTM 2000 and HiSeqTM 3000), and Life Technologies’ Sequencers, such as Ion TorrentTM Sequencer and Ion ProtonTM Sequencer. It should be understood that utilizing any of these equipment requires that appropriate sequencing technique and chemistry be used.
  • detection of a biomarker mRNA is possible with deep sequencing such as a one performed with Illumina HiSeqTM 3000 platform, 150 bp reading length and paired-end library.
  • Regions especially suitable for determining the expression of NOCIVA at nucleic acid level include the NOCIVA-specific sequence without the poly-A tail (nucleotides 1635-1983 of SEQ ID NO: 1); the sequence encoding the novel NOCIVA peptide (nucleotides 1636-1674 of SEQ ID NO: 1); and the 3’UTR without the poly-A tail (nucleotides 1675-1983 of SEQ ID NO: 1).
  • the detection antibody is detectably labelled.
  • the detection antibody is recognized by a further antibody comprising a detectable label.
  • the detection antibody comprises a tag that is recognizable by a further antibody comprising a detectable label.
  • the detection antibody and said further antibodies are la-belled with the same label, e.g. for improving sensitivity.
  • the detection antibody and said further antibodies are labelled with different labels.
  • Immunoassays suitable for carrying out the methods of the present invention include solid-phase immunoassays, such as lateral flow assays and conventional sandwich assays carried out on a solid surface such as glass, plastic, ceramic, metal or a fibrous or porous material such as paper, in the form of e.g. a microtiter plate, a stick, a card, an array, a sensor, a bead, or a microbead.
  • Said solid-phase immunoassay may be either heterogeneous or homogeneous. In heterogeneous assays, any free antigens or antibodies are physically separated from immunocomplexes formed, e.g. by washings, while no such separation is necessary in homogeneous assays including the many forms of biosensors.
  • Suitable homogeneous immunoassays are not limited to solid-phase assay formats but encompass also homogeneous immunoassays carried out in solution. Such in-solution immunoassays are particularly advantageous because neither immobilization nor washing steps are required, making them simple and easy to perform.
  • the immunoassay is liquid-based homogeneous immunoassay.
  • the present invention provides a kit and use thereof for detecting the expression level of NOC1VA or NOC1VA and ARPP19 in a clinical sample, for any purpose set forth above.
  • the kit comprises at least one NOClVA-specific oligonucleotide or at least one NOClVA-specific oligonucleotide and at least one ARPP19-specific oligonucleotide, such as a probe and/or a primer pair.
  • a person skilled in the art can easily determine any further reagents to be included in the kit depending on the desired technique for carrying out determination of the expression level of NOC1VA or NOC1VA and ARPP19.
  • an appropriate control reagent or sample or a threshold value may be comprised in the kit.
  • the kit may also comprise a computer readable medium, comprising computer-executable instructions for performing any of the methods of the present disclosure.
  • mRNA expression levels of N0C1VA and ARPP19 were analysed by real-time quantitative PCR (RQ-PCR) and mRNA expression was calculated using the 2 A -ddCt -method.
  • RQ-PCR real-time quantitative PCR
  • mRNA expression was calculated using the 2 A -ddCt -method.
  • the expression of each gene was normalized to the expression level in a commercial normal pooled (from 56 males and females) bone marrow control sample (636591, lot 1002008, Clontech Laboratories, Fremont, CA, USA). B-actin and GAPDH were used as calibrators.
  • the median NOC1VA or ARPP19 mRNA expression was determined and patients where stratified as high and low expressing groups. Also overexpression (RQ>1) was used for cut off value for analysis.
  • Primers for each gene specific assay were designed to be located to different exonic sequences to avoid amplification of genomic DNA.
  • Primer concentration in each reaction was 300 nM and probe concentration 200nM.
  • Specificity of qPCR reactions was verified by agarose gel electrophoresis and melting curve analysis. One band of the expected size and a single peak, respectively, were required.
  • Amplification of target cDNAs was performed using KAPA PROBE FAST qPCR Kit (Kapa Biosystems) and 7900 HT Fast Real-Time PCR System (Thermo Fisher) according to the manufacturers’ instructions. Quantitative real-time PCR was executed under the following conditions: 95°C for 10 min followed by 45 cycles of 95°C for 15 s and 60°C for lmin.
  • Relative gene expression data was normalized to expression level of endogenous house-keeping genes Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and beta acting using 2 A -AAC(t) method with Thermo Fisher Cloud Real-time qPCR Relative Quantification application. Results were derived from the average of at least two independent experiments and two technical replicates.
  • Glyceraldehyde-3-phosphate dehydrogenase Glyceraldehyde-3-phosphate dehydrogenase
  • beta acting using 2 A -AAC(t) method with Thermo Fisher Cloud Real-time qPCR Relative Quantification application. Results were derived from the average of at least two independent experiments and two technical replicates.
  • Primer and probe sequences for NOC1VA assay were: forward cagtctggactgagaatattattgga (SEQ ID NO: 4), reverse ggcattgtttgctgctatacttt (SEQ ID NO: 5), probe tccactgc (SEQ ID NO: 6).
  • Primer and probe sequences for b-actin assay were: forward tcacccacacrgtgcccatctacgc (SEQ ID NO: 7), reverse cagcggaaccgctcattgccaatgg (SEQ ID NO: 8), probe atgccctcccccatgccatcctgcgt (SEQ ID NO: 9).
  • Primer and probe sequences for GAPDH assay were: forward acccactcctccacctttga (SEQ ID NO: 10), reverse ttgctgtagccaaattcgttgt (SEQ ID NO: 11), probe acgaccactttgtcaagctcatttcctggt (SEQ ID NO: 12).
  • Primer and probe sequences for ARPP19 assay were: forward cagagggagcactatgtctgc (SEQ ID NO: 13), reverse gctttaattttgcttcttctgct (SEQ ID NO: 14), probe universal probe library (UPL) #68.
  • the entire CML cohort was split depending on whether patients received 1G TK1 (Imatinib) or 2G TK1 (Dasatinib or Nilotinib). Imatinib treated patients
  • NOC1VA expression levels did not correlate with either time to CMR ( Figure IE) or degree of EMR ( Figure IF) among 2G TKI treated patients.
  • NOCIVA gene expression was assessed in samples from a cohort of 814 patients in a laboratory-based study with no clinical intervention. The study was carried out on diagnostic blood samples obtained in the United Kingdom at original CML diagnosis between August 2008 and March 2013.
  • the 814 patients were randomly allocated either Imatinib 400mg or Dasatinib lOOmg each once daily.
  • Follow-up was monthly for 3 months, 3- monthly until 12 months, then 6-monthly. Patients were followed until the sooner of 5 years or a change of therapy due to either intolerance or resistance.
  • a total of 158 patient samples were used.
  • the 158 samples were the first 140 samples in the cohort with material biobanked and 18 patients who progressed to blast crisis. Of the 158 patients, 80 received Imatinib and 78 received Dasatinib.
  • NOCIVA gene expression was assayed as mRNA expression level by TaqMan quantitative real-time PCR.
  • Each assay consisted of cDNA, a forward and reverse primer and a 6-FAM dye-labelled probe.
  • the real time PCR amplifications were undertaken using a Step One Real-time PCR system (Applied Biosystems) with the following conditions: 50°C for 2 min, 95°C for 10 min followed by 40 cycles of denaturation at 95°C for 15 secs and annealing/extension at 60°C for 1 min.
  • Primer and probe sequences for NOCIVA assay were: forward atgccaagacacagtcaaaatg (SEQ ID NO: 15), reverse cctgcttgcataaactggtaatc (SEQ ID NO: 16), probe cagaggcagaggataa (SEQ ID NO: 17).
  • Primer and probe sequences for GAPDH assay were: forward acccactcctccacctttga (SEQ ID NO: 10), reverse ttgctgtagccaaattcgttgt (SEQ ID NO: 11), probe acgaccactttgtcaagctcatttcctggt (SEQ ID NO: 12).
  • NOCIVA gene expression was calculated using the 2 A -ddCt -method to achieve results for relative quantification (RQ) where ddCt is the normalised signal level in a sample relative to the normalised signal level in the calibrator sample.
  • RQ relative quantification
  • ddCt is the normalised signal level in a sample relative to the normalised signal level in the calibrator sample.
  • a pool of cDNA from 4 normal (apparently healthy) individuals was used as calibrator and all the samples were normalised to GAPDH as an endogenous control.
  • p values were determined using the log-rank (Mantel-Cox) test, where significant p values are shown. All analyses were undertaken in R 3.5.0 and GraphPad prism v8.1.
  • High NOCIVA expression in the CML patient samples was defined as a value above the mean RQ value for all samples.
  • Dasatinib-treated patients who subsequently progressed to blast crisis did not have a significant difference in NOCIVA expression at diagnosis to those Dasatinib-treated patients who did not progress.
  • high NOCIVA expression at CML diagnosis is associated with disease progression for Imatinib-treated patients. Accordingly, low expression level of NOCIVA indicates that the subject is likely to respond to a first generation TKI, whereas high expression level of NOC1VA indicates that the subject is not likely to respond to a first generation TKI.
  • Figure 6A-C shows freedom from progression (FFP) i.e. the number (percentage) of patients who progressed to blast crisis over time.
  • high NOC1VA expression at CML diagnosis shows a trend (although not statistically significant) towards being associated with an inferior FFP for Imatinib-treated patients but not for Dasatinib-treated patients.
  • high NOCIVA expression (4 th quartile) at CML diagnosis is associated with an inferior FFP for Imatinib-treated patients but not for Dasatinib-treated patients. Accordingly, low expression level of NOCIVA indicates that the subject is likely to respond to a first generation TKI, whereas high expression level of NOCIVA indicates that the subject is not likely to respond to a first generation TKI.
  • Example 3 C1P2A gene expression was assessed in the same 158 samples as in Example 3 hereinabove.
  • the 158 samples were the first 140 samples in the cohort of 814 patients with material biobanked and 18 patients who progressed to blast crisis. Of the 158 patients, 80 received Imatinib and 78 received Dasatinib treatment.
  • C1P2A gene expression was assayed as mRNA expression level by TaqMan quantitative real-time PCR using the same methods as in Example 3.
  • Primers and probe for CIP2A assay were TaqMan predesigned forward and reverse primers and probe for CIP2A gene KIAA1524 (Fisher Scientific).
  • Figure 8A-C shows Kaplan-Meier curves for freedom from progression (FFP) for CML patients stratified into quartiles based on diagnostic CIP2A expression. Quartile 1 had the lowest C1P2A expression and quartile 4 had the highest C1P2A expression.
  • high C1P2A gene expression (4 th quartile) at CML diagnosis is not associated with an inferior FFP for Imatinib-treated patients or Dasatinib-treated patients.
  • This is different from NOC1VA expression, where high NOC1VA expression (4th quartile) at CML diagnosis is associated with an inferior FFP for Imatinib-treated patients but not for Dasatinib-treated patients (Example 3; Figure 7A-C).
  • NOC1VA gene expression has an improved value as compared to C1P2A in predicting response to treatment with a 1 st generation TKI.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Hospice & Palliative Care (AREA)
  • Biophysics (AREA)
  • Oncology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

La présente invention concerne des biomarqueurs, à savoir NOCIVA Et ARPP19, destinés à être utilisés dans la prédiction d'une réponse à un traitement par des inhibiteurs de tyrosine kinase chez des sujets atteints de cancers hématologiques, tels que la LMC ou la LAM. L'invention concerne également l'utilisation desdits biomarqueurs à des fins connexes. De plus, lesdits biomarqueurs non seulement facilitent la gestion de maladies de sujets atteints de cancers hématologiques mais pourraient également être utilisés dans des essais cliniques de médicaments candidats.
PCT/FI2020/050257 2019-04-18 2020-04-17 Procédé de prédiction de réponse à un traitement avec des inhibiteurs de tyrosine kinase et procédés associés WO2020212650A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
FI20195315 2019-04-18
FI20195315 2019-04-18

Publications (1)

Publication Number Publication Date
WO2020212650A1 true WO2020212650A1 (fr) 2020-10-22

Family

ID=70476247

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/FI2020/050257 WO2020212650A1 (fr) 2019-04-18 2020-04-17 Procédé de prédiction de réponse à un traitement avec des inhibiteurs de tyrosine kinase et procédés associés

Country Status (1)

Country Link
WO (1) WO2020212650A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2024084458A1 (fr) * 2022-10-20 2024-04-25 Cbci Society For Medical Education (Cbci) Méthodes d'évaluation d'observance ou de non-observance de traitement et de progression ou de non-progression de leucémie myéloïde chronique

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011066660A1 (fr) 2009-12-04 2011-06-09 University Health Network Signatures lsc et hsc pour prédire la survie de patients atteints d'un cancer hématologique
EP3375887A1 (fr) * 2015-11-10 2018-09-19 SD Genomics Co., Ltd. Procédés pour déterminer la résistance à une thérapie anticancéreuse et composition utilisée à cet effet
WO2019097122A1 (fr) * 2017-11-20 2019-05-23 Turun Yliopisto Nouveau variant de cip2a et ses utilisations

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011066660A1 (fr) 2009-12-04 2011-06-09 University Health Network Signatures lsc et hsc pour prédire la survie de patients atteints d'un cancer hématologique
EP3375887A1 (fr) * 2015-11-10 2018-09-19 SD Genomics Co., Ltd. Procédés pour déterminer la résistance à une thérapie anticancéreuse et composition utilisée à cet effet
WO2019097122A1 (fr) * 2017-11-20 2019-05-23 Turun Yliopisto Nouveau variant de cip2a et ses utilisations

Non-Patent Citations (9)

* Cited by examiner, † Cited by third party
Title
CLAIRE M. LUCAS ET AL: "Cancerous inhibitor of PP2A (CIP2A) at diagnosis of chronic myeloid leukemia is a critical determinant of disease progression", BLOOD, vol. 117, no. 24, 16 June 2011 (2011-06-16), US, pages 6660 - 6668, XP055712164, ISSN: 0006-4971, DOI: 10.1182/blood-2010-08-304477 *
KANTARJIAN ET AL., NEJM, vol. 362, 2010, pages 2260 - 2270
KHANNAPIMANDA, INT J CANCER, vol. 138, 2016, pages 525 - 532
KINDLER ET AL., BLOOD, vol. 103, 2004, pages 3644 - 3654
LUCAS C M ET AL: "Second generation tyrosine kinase inhibitors prevent disease progression in high-risk (high CIP2A) chronic myeloid leukaemia patients", BLOOD CANCER JOURNAL, NATURE PUBLISHING GROUP UK, LONDON, vol. 29, no. 7, 13 March 2015 (2015-03-13), pages 1514 - 1523, XP036972537, ISSN: 0887-6924, [retrieved on 20150313], DOI: 10.1038/LEU.2015.71 *
LUCAS ET AL., BLOOD ADVANCES, vol. 2, 2018, pages 964 - 968
LUCAS ET AL., BLOOD, vol. 117, 2011, pages 6660 - 6668
TAO WANG ET AL: "Combination of arsenic trioxide and Dasatinib: a new strategy to treat Philadelphia chromosome-positive acute lymphoblastic leukaemia", JOURNAL OF CELLULAR AND MOLECULAR MEDICINE, vol. 22, no. 3, 1 March 2018 (2018-03-01), RO, pages 1614 - 1626, XP055611789, ISSN: 1582-1838, DOI: 10.1111/jcmm.13436 *
XIAOYAN SHAO ET AL., MEDICINE, vol. 97, 2018, pages 44

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2024084458A1 (fr) * 2022-10-20 2024-04-25 Cbci Society For Medical Education (Cbci) Méthodes d'évaluation d'observance ou de non-observance de traitement et de progression ou de non-progression de leucémie myéloïde chronique

Similar Documents

Publication Publication Date Title
Guarini et al. ATM gene alterations in chronic lymphocytic leukemia patients induce a distinct gene expression profile and predict disease progression
EP3198026B1 (fr) Procédé de détermination de l'état de mutation de pik3ca dans un échantillon
EP2257810B1 (fr) Diagnostic moléculaire et classification de mélanomes malins
US20100111944A1 (en) Method of diagnosing, classifying and treating endometrial cancer and precancer
EP2589961A2 (fr) Diagnostic et classification moléculaires de mélanome malin
JP2015512630A (ja) 急性骨髄性白血病の診断、予後、及び治療用の方法及び組成物
AU2005327929A1 (en) Identification of molecular diagnostic markers for endometriosis in blood lymphocytes
JP6622722B2 (ja) 肺高血圧症バイオマーカー
KR20160057416A (ko) 식도암에 대한 분자적 진단 검사
US20150038351A1 (en) Gene Signatures That Predispose Or Protect Individuals From Low-Dose Radiation Induced Breast Cancer Or Are Associated with Disease-Free Survival
CN113774140A (zh) 一种预测结直肠癌对奥沙利铂治疗敏感性的产品
US20160010157A1 (en) Methods and compositions relating to proliferative disorders of the prostate
US20150159225A1 (en) Uveal melanoma prognosis
WO2020212650A1 (fr) Procédé de prédiction de réponse à un traitement avec des inhibiteurs de tyrosine kinase et procédés associés
EP3252165A1 (fr) Procédé pour le pronostic d'un myélome multiple
CN113817829A (zh) 生物标志物在制备预测结直肠癌对奥沙利铂治疗敏感性的产品中的用途
KR20200031088A (ko) 전립선암 환자의 예후 진단 및 치료 전략 결정용 재발 특이적 마커
EP2728015A1 (fr) Procédé pour le diagnostic du syndrome de Sézary
KR20200104106A (ko) 신장암 환자의 치료 전략 결정 및 예후 진단용 재발 특이적 마커
WO2014173986A2 (fr) Procédés pour diagnostiquer et surveiller la réponse à un traitement de carcinome hépatocellulaire
EP2596126B1 (fr) Méthodes de détermination d'un pronostic de survie pour un patient atteint de leucémie
KR20120089838A (ko) 암 위험성 평가에 사용되는 방법 및 키트
CN111315897B (zh) 用于黑素瘤检测的方法
WO2011012763A2 (fr) Procédé et trousse pour le pronostic d'un lymphome des cellules du manteau
WO2019215394A1 (fr) Arpp19 en tant que biomarqueur pour des cancers hématologiques

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20722627

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 20722627

Country of ref document: EP

Kind code of ref document: A1