WO2020198706A1 - Compositions and methods for ttr gene editing and treating attr amyloidosis comprising a corticosteroid or use thereof - Google Patents

Compositions and methods for ttr gene editing and treating attr amyloidosis comprising a corticosteroid or use thereof Download PDF

Info

Publication number
WO2020198706A1
WO2020198706A1 PCT/US2020/025533 US2020025533W WO2020198706A1 WO 2020198706 A1 WO2020198706 A1 WO 2020198706A1 US 2020025533 W US2020025533 W US 2020025533W WO 2020198706 A1 WO2020198706 A1 WO 2020198706A1
Authority
WO
WIPO (PCT)
Prior art keywords
composition
lipid
seq
administered
subject
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2020/025533
Other languages
English (en)
French (fr)
Inventor
Yong Chang
Seth C. Alexander
Kristy M. WOOD
Arti Mahendra Prakash KANJOLIA
Shobu ODATE
Jessica Lynn SEITZER
Reynald Michael LESCARBEAU
Walter Strapps
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Intellia Therapeutics Inc
Original Assignee
Intellia Therapeutics Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to CA3134544A priority Critical patent/CA3134544A1/en
Priority to KR1020217035012A priority patent/KR20220004984A/ko
Priority to JP2021557650A priority patent/JP7636338B2/ja
Priority to CN202080039394.5A priority patent/CN113874004A/zh
Priority to AU2020248337A priority patent/AU2020248337A1/en
Application filed by Intellia Therapeutics Inc filed Critical Intellia Therapeutics Inc
Priority to EP20720676.4A priority patent/EP3946285A1/en
Priority to MX2021011690A priority patent/MX2021011690A/es
Publication of WO2020198706A1 publication Critical patent/WO2020198706A1/en
Priority to US17/486,758 priority patent/US20230035659A1/en
Anticipated expiration legal-status Critical
Priority to CONC2021/0014562A priority patent/CO2021014562A2/es
Priority to JP2025021006A priority patent/JP2025081416A/ja
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/56Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids
    • A61K31/57Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids substituted in position 17 beta by a chain of two carbon atoms, e.g. pregnane or progesterone
    • A61K31/573Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids substituted in position 17 beta by a chain of two carbon atoms, e.g. pregnane or progesterone substituted in position 21, e.g. cortisone, dexamethasone, prednisone or aldosterone
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/13Amines
    • A61K31/135Amines having aromatic rings, e.g. ketamine, nortriptyline
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/13Amines
    • A61K31/135Amines having aromatic rings, e.g. ketamine, nortriptyline
    • A61K31/138Aryloxyalkylamines, e.g. propranolol, tamoxifen, phenoxybenzamine
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/16Amides, e.g. hydroxamic acids
    • A61K31/165Amides, e.g. hydroxamic acids having aromatic rings, e.g. colchicine, atenolol, progabide
    • A61K31/167Amides, e.g. hydroxamic acids having aromatic rings, e.g. colchicine, atenolol, progabide having the nitrogen of a carboxamide group directly attached to the aromatic ring, e.g. lidocaine, paracetamol
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/335Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
    • A61K31/34Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having five-membered rings with one oxygen as the only ring hetero atom, e.g. isosorbide
    • A61K31/341Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having five-membered rings with one oxygen as the only ring hetero atom, e.g. isosorbide not condensed with another ring, e.g. ranitidine, furosemide, bufetolol, muscarine
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/7105Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/7115Nucleic acids or oligonucleotides having modified bases, i.e. other than adenine, guanine, cytosine, uracil or thymine
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/7125Nucleic acids or oligonucleotides having modified internucleoside linkage, i.e. other than 3'-5' phosphodiesters
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/713Double-stranded nucleic acids or oligonucleotides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/28Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/87Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/88Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation using microencapsulation, e.g. using amphiphile liposome vesicle
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/87Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90Stable introduction of foreign DNA into chromosome
    • C12N15/902Stable introduction of foreign DNA into chromosome using homologous recombination
    • C12N15/907Stable introduction of foreign DNA into chromosome using homologous recombination in mammalian cells
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/16Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22Ribonucleases [RNase]; Deoxyribonucleases [DNase]
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2207/00Modified animals
    • A01K2207/15Humanized animals
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00Genetically modified animals
    • A01K2217/05Animals comprising random inserted nucleic acids (transgenic)
    • A01K2217/052Animals comprising random inserted nucleic acids (transgenic) inducing gain of function
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2227/00Animals characterised by species
    • A01K2227/10Mammal
    • A01K2227/105Murine
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00Animals characterised by purpose
    • A01K2267/03Animal model, e.g. for test or diseases
    • A01K2267/0306Animal model for genetic diseases
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2300/00Mixtures or combinations of active ingredients, wherein at least one active ingredient is fully defined in groups A61K31/00 - A61K41/00
    • BPERFORMING OPERATIONS; TRANSPORTING
    • B82NANOTECHNOLOGY
    • B82YSPECIFIC USES OR APPLICATIONS OF NANOSTRUCTURES; MEASUREMENT OR ANALYSIS OF NANOSTRUCTURES; MANUFACTURE OR TREATMENT OF NANOSTRUCTURES
    • B82Y30/00Nanotechnology for materials or surface science, e.g. nanocomposites
    • BPERFORMING OPERATIONS; TRANSPORTING
    • B82NANOTECHNOLOGY
    • B82YSPECIFIC USES OR APPLICATIONS OF NANOSTRUCTURES; MEASUREMENT OR ANALYSIS OF NANOSTRUCTURES; MANUFACTURE OR TREATMENT OF NANOSTRUCTURES
    • B82Y5/00Nanobiotechnology or nanomedicine, e.g. protein engineering or drug delivery
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/20Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPR]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/315Phosphorothioates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/3212'-O-R Modification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/34Spatial arrangement of the modifications
    • C12N2310/344Position-specific modifications, e.g. on every purine, at the 3'-end
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/34Spatial arrangement of the modifications
    • C12N2310/346Spatial arrangement of the modifications having a combination of backbone and sugar modifications
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/35Nature of the modification
    • C12N2310/352Nature of the modification linked to the nucleic acid via a carbon atom
    • C12N2310/3521Methyl
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/10Applications; Uses in screening processes
    • C12N2320/11Applications; Uses in screening processes for the determination of target sites, i.e. of active nucleic acids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/30Special therapeutic applications
    • C12N2320/31Combination therapy
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/50Methods for regulating/modulating their activity
    • C12N2320/51Methods for regulating/modulating their activity modulating the chemical stability, e.g. nuclease-resistance

Definitions

  • Transthyretin is a protein produced by the TTR gene that normally functions to transport retinol and thyroxine throughout the body. TTR is predominantly synthesized in the liver, with small fractions being produced in the choroid plexus and retina. TTR normally circulates as a soluble tetrameric protein in the blood.
  • Pathogenic variants of TTR which may disrupt tetramer stability', can be encoded by mutant alleles of the TTR gene. Mutant TTR may result in misfolded TTR, which may generate amyloids (i.e., aggregates of misfolded TTR protein). In some cases, pathogenic variants of TTR can lead to amyloidosis, or disease resulting from build-up of amyloids.
  • misfolded TTR monomers can polymerize into amyloid fibrils within tissues, such as the peripheral nerves, heart, and gastrointestinal tract. Amyloid plaques can also comprise wild-type TTR that has deposited on misfolded TTR.
  • Amyloidosis characterized by deposition of TTR may be referred to as“ATTR,” “TTR-related amyloidosis,”“TTR amyloidosis,” or“ATTR amyloidosis,”“ATTR familial amyloidosis” (when associated with a genetic mutation in a family), or“ATTRwf’ or“wild- type ATTR” (when arising from misfolding and deposition of wild-type TTR).
  • ATTR can present with a wide spectrum of symptoms, and patients with different classes of ATTR may have different characteristics and prognoses.
  • Some classes of ATTR include familial amyloid polyneuropathy (FAP), familial amyloid cardiomyopathy (FAC), and wild-type TTR amy loidosis (wt-TTR amyloidosis).
  • FAP familial amyloid polyneuropathy
  • FAC familial amyloid cardiomyopathy
  • wt-TTR amyloidosis wild-type TTR amy loidosis
  • FAP and FAC are usually associated with a genetic mutation in the TTR gene, and more than 100 different mutations in the TTR gene have been associated with ATTR.
  • wt-TTR amyloidosis is associated with aging and not with a genetic mutation in TTR. It is estimated that approximately 50,000 patients worldwide may be affected by FAP and FAC.
  • TTR While more than 100 mutations in TTR are associated with ATTR, certain mutations have been more closely associated with neuropathy and/or cardiomyopathy. For example, mutations at T60 of TTR are associated with both cardiomyopathy and neuropathy; mutations at V30 are more associated with neuropathy; and mutations at V122 are more associated with cardiomyopathy.
  • a range of treatment approaches have been studied for treatment of ATTR, but there are no approved drugs that stop disease progression and improve quality of life. While liver transplant has been studied for treatment of ATTR, its use is declining as it involves significant risk and disease progression sometimes continues after transplantation. Small molecule stabilizers, such as diflumsal and tafamidis, appear to slow ATTR progression, but these agents do not halt disease progression.
  • compositions and methods for gene editing that may reduce inflammation or immune responses.
  • coadministration of corticosteroids to subjects receiving guide RNAs may reduce such inflammation or immune responses.
  • the present invention provides compositions and methods using a corticosteroid in combination with a guide RNA and optionally an RNA-guided DNA binding agent such as the
  • CRISPR/Cas system to substantially reduce or knockout expression of the TTR gene, thereby substantially reducing or eliminating the production of TTR protein associated with ATTR.
  • the substantial reduction or elimination of the production of TTR protein associated with ATTR through alteration of the TTR gene can be a long-term reduction or elimination.
  • Embodiment 1 is a method of treating amyloidosis associated with TTR (ATTR), comprising administering a corticosteroid and a composition to a subject in need thereof, wherein the composition comprises (l) an RNA-guided DNA binding agent or a nucleic acid encoding an RNA-guided DNA binding agent and (ii) a guide RNA comprising:
  • a guide sequence that is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to a sequence selected from SEQ ID NOs: 5-82, thereby treating ATTR.
  • Embodiment 2 is a method of reducing TTR serum concentration, comprising administering a corticosteroid and a composition to a subject in need thereof, wherein the composition comprises (i) an RNA-guided DNA binding agent or a nucleic acid encoding an RNA-guided DNA binding agent and (ii) a guide RNA comprising:
  • a guide sequence that is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to a sequence selected from SEQ ID NOs: 5-82, thereby reducing TTR serum concentration.
  • Embodiment 3 is a method for reducing or preventing the accumulation of amyloids or amyloid fibrils comprising TTR in a subject, comprising administering a corticosteroid and a composition to a subject in need thereof, wherein the composition comprises (i) an RNA-guided DNA binding agent or a nucleic acid encoding an RNA-guided DNA binding agent and (ii) a guide RNA comprising:
  • Embodiment 4 is a composition comprising a guide RNA comprising:
  • a guide sequence that is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to a sequence selected from SEQ ID NOs: 5-82, for use in combination with a corticosteroid in a method of inducing a double-stranded break (DSB) within the TTR gene in a subject, modifying the TTR gene in a cell or subject, treating amyloidosis associated with TTR (ATTR) in a subject, reducing TTR serum concentration in a subject, and/or reducing or preventing the accumulation of amyloids or amyloid fibrils in a subject.
  • DAB double-stranded break
  • Embodiment 5 is a composition comprising a vector encoding a guide RNA, wherein the guide RNA comprises:
  • a guide sequence that is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to a sequence selected from SEQ ID NOs: 5-82, for use in combination with a corticosteroid in a method of inducing a double-stranded break (DSB) within the TTR gene in a subject, modifying the TTR gene in a cell or subject, treating amyloidosis associated with TTR (ATTR) in a subject, reducing TTR serum concentration in a subject, and/or reducing or preventing the accumulation of amyloids or amyloid fibrils in a subject.
  • DAB double-stranded break
  • Embodiment 6 is a composition comprising:
  • RNA comprising:
  • a guide sequence that is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to a sequence selected from SEQ ID NOs: 5-82, and
  • the open reading frame comprises a sequence with at least 95% identity to SEQ ID NO: 311; the open reading frame has at least 95% identity to SEQ ID NO: 311 over at least its first 30, 50, 70, 100, 150, 200, 250, or 300 nucleotides; the open reading frame consists of a set of codons of which at least 75% of the codons are codons listed in Table 1;
  • the open reading frame has an adenine content ranging from its minimum adenine content to 150% of the minimum adenine content; and/or the open reading frame has an adenine dinucleotide content ranging from its minimum adenine dinucleotide content to 150% of the minimum adenine dinucleotide content;
  • DSB double-stranded break
  • modifying the TTR gene in a cell or subject treating amyloidosis associated with TTR (ATTR) in a subject, reducing TTR serum concentration in a subject, and/or reducing or preventing the accumulation of amyloids or amyloid fibrils in a subject.
  • ATR amyloidosis associated with TTR
  • Embodiment 7 is a composition comprising:
  • RNA (i) a vector encoding a guide RNA, wherein the guide RNA comprises:
  • a guide sequence that is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to a sequence selected from SEQ ID NOs: 5-82, and
  • the open reading frame comprises a sequence with at least 95% identity to SEQ ID NO: 311 ;
  • the open reading frame has at least 95% identity to SEQ ID NO: 311 over at least its first 30, 50, 70, 100, 150, 200, 250, or 300 nucleotides;
  • the open reading frame consists of a set of codons of which at least 75% of the codons are codons listed in Table 1 ;
  • the open reading frame has an adenine content ranging from its minimum adenine content to 150% of the minimum adenine content; and/or the open reading frame has an adenine dinucleotide content ranging from its minimum adenine dinucleotide content to 150% of the minimum adenine dinucleotide content; for use in combination with a corticosteroid in a method of inducing a double-stranded break (DSB) within the TTR gene in a subject, modifying the TTR gene in a cell or subject, treating amyloidosis associated with TTR (ATTR) in a subject, reducing TTR serum concentration in a subject, and/or reducing or preventing the accumulation of amyloids or amyloid fibrils in a subject.
  • DSB double-stranded break
  • Embodiment 8 is the composition for use or method of any one of embodiments 1-3 or 5-7, wherein the method comprises administering the composition by infusion for more than 30 minutes, e.g. more than 60 minutes or more than 120 minutes.
  • Embodiment 9 is the composition or method of any one of the preceding
  • the guide RNA comprises a guide sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82.
  • Embodiment 10 is the composition or method of any one of the preceding embodiments, wherein the guide RNA comprises a guide sequence selected from SEQ ID NOs: 5, 6, 7, 8, 9, 12, 13, 14, 15, 16, 17, 22, 23, 27, 29, 30, 35, 36, 37, 38, 55, 61, 63, 65, 66, 68, or 69 .
  • Embodiment 11 is the composition of any one of embodiments 4-10, for use in inducing a double-stranded break (DSB) within the TTR gene in a cell or subject.
  • DSB double-stranded break
  • Embodiment 12 is the composition of any one of embodiments 4-11, for use in modifying the TTR gene in a cell or subject.
  • Embodiment 13 is the composition of any one of embodiments 4-12, for use in treating amyloidosis associated with TTR (ATTR) in a subject.
  • TTR amyloidosis associated with TTR
  • Embodiment 14 is the composition of any one of embodiments 4-13, for use in reducing TTR serum concentration in a subject.
  • Embodiment 15 is the composition of any one of embodiments 4-14, for use in reducing or preventing the accumulation of amyloids or amyloid fibrils in a subject.
  • Embodiment 16 is the method or composition for use of any one of the preceding embodiments, wherein the corticosteroid is dexamethasone, betamethasone, prednisone, prednisolone, methylprednisolone, cortisone, hydrocortisone, triamcinolone, or
  • Embodiment 17 is the method or composition for use of any one of the preceding embodiments, wherein the corticosteroid is dexamethasone.
  • Embodiment 18 is the method or composition for use of any one of the preceding embodiments, wherein the corticosteroid is administered before the composition.
  • Embodiment 19 is the method or composition for use of any one of the preceding embodiments, wherein the corticosteroid is administered after the composition.
  • Embodiment 20 is the method or composition for use of any one of the preceding embodiments, wherein the corticosteroid is administered simultaneously with the composition.
  • Embodiment 21 is the method or composition for use of any one of the preceding embodiments, wherein the corticosteroid is administered about 5 minutes to within about 168 hours before the composition is administered.
  • Embodiment 22 is the method or composition for use of any one of the preceding embodiments, wherein the corticosteroid is administered about 5 minutes to within about 168 hours after the composition is administered.
  • Embodiment 23 is the method or composition for use of any one of the preceding embodiments, wherein the corticosteroid is administered 5 minutes, 10 minutes, 15 minutes, 30 minutes, 1 hour, 2 hours, 3 hours, 4 hours, 6 hours, 12 hours, 18 hours, 1 day, 1.5 days, 2 days, 3 days, 4 days, 5 days, 6 days, or one week before the composition is administered.
  • Embodiment 24 is the method or composition for use of any one of the preceding embodiments, wherein the corticosteroid is administered 5 minutes, 10 minutes, 15 minutes, 30 minutes, 1 hour, 2 hours, 3 hours, 4 hours, 6 hours, 12 hours, 18 hours, 1 day, 1.5 days, 2 days, 3 days, 4 days, 5 days, 6 days, or one week after the composition is administered.
  • Embodiment 25 is the method or composition for use of any one of the preceding embodiments, wherein at least two doses of the corticosteroid are administered before or after the administration of the composition.
  • Embodiment 26 is the method or composition for use of any one of the preceding embodiments, wherein at least two doses of the corticosteroid and at least two doses of the composition are administered.
  • Embodiment 27 is the method or composition for use of any one of the preceding embodiments, wherein the corticosteroid is administered to the subject at a dose of 0.75 mg to 20 mg.
  • Embodiment 28 is the method or composition for use of embodiment 27, wherein the corticosteroid is administered to the subject at a dose of about 0.01 - 0.4 mg/kg, such as 0.1 - 0.35 mg/kg or 0.25 - 0.35 mg/kg.
  • Embodiment 29 is the method or composition for use of any one of the preceding embodiments, wherein the corticosteroid is administered to the subject parenterally or by injection.
  • Embodiment 30 is the method or composition for use of any one of the preceding embodiments, wherein the corticosteroid is administered to the subject via an intravenous injection.
  • Embodiment 31 is the method or composition for use of any one of the preceding embodiments, wherein the corticosteroid is administered to the subject intramuscularly or by infusion.
  • Embodiment 32 is the method or composition for use of any one of embodiments 1- 31, wherein the corticosteroid is administered to the subject orally.
  • Embodiment 33 is the method or composition for use of any one of embodiment 32, wherein the corticosteroid is administered to the subject orally before the composition is administered to the subject by intravenous injection.
  • Embodiment 34 is the method or composition for use of any one of embodiment 32, wherein the corticosteroid is administered to the subject orally after the composition is administered to the subject by intravenous injection.
  • Embodiment 35 is the method or composition for use of any one of embodiments 32 and 33, wherein the corticosteroid is dexamethasone, and the dexamethasone is administered to the subject orally in the amount of 20 mg 6 to 12 hour before the composition is administered to the subject.
  • Embodiment 36 is the method or composition for use of any one of embodiments 32, 33 or 35, wherein the corticosteroid is dexamethasone, and the dexamethasone is
  • composition administered to the subject intravenously in the amount of 20 mg for 30 minutes 6 to 12 hour before the composition is administered to the subject.
  • Embodiment 37 is the method or composition for use of any one of the preceding embodiments, wherein the composition is administered by infusion for about 45-75 minutes, 75-105 minutes, 105-135 minutes, 135-165 minutes, 165-195 minutes, 195-225 minutes, 225- 255 minutes, 255-285 minutes, 285-315 minutes, 315-345 minutes, or 345-375 minutes. In some embodiments, the composition is administered by infusion for about 1.5-6 hours.
  • Embodiment 38 is the method or composition for use of any one of the preceding embodiments, wherein the composition is administered by infusion for about 60 minutes, about 90 minutes, about 120 minutes, about 150 minutes, about 180 minutes, or about 240 minutes.
  • Embodiment 39 is the method or composition for use of any one of the preceding embodiments, wherein the composition is administered by infusion for about 120 minutes.
  • Embodiment 40 is the method or composition for use of any one of the preceding embodiments, wherein the corticosteroid is dexamethasone.
  • Embodiment 41 is the method or composition for use of any one of the preceding embodiments, wherein the method further comprises administering an infusion prophylaxis, wherein the infusion prophylaxis comprises one or more of acetaminophen, an HI blocker, or an H2 blocker, optionally wherein the one or more of the acetaminophen, HI blocker, or H2 blocker are concurrently administered with the corticosteroid and/or before the composition.
  • the infusion prophylaxis comprises one or more of acetaminophen, an HI blocker, or an H2 blocker, optionally wherein the one or more of the acetaminophen, HI blocker, or H2 blocker are concurrently administered with the corticosteroid and/or before the composition.
  • Embodiment 42 is the method or composition for use of embodiment 41, wherein each of the acetaminophen, HI blocker, and H2 blocker are administered.
  • Embodiment 42a is the method or composition for use of embodiment 41 or 42, wherein the HI blocker and/or the H2 blocker are administered orally.
  • Embodiment 42b is the method or composition for use of any one of embodiments 41 -42a, wherein the infusion prophylaxis comprises an intravenous corticosteroid (such as dexamethasone 8-12 mg, or 10 mg or equivalent) and acetaminophen (such as oral acetaminophen 500 mg).
  • an intravenous corticosteroid such as dexamethasone 8-12 mg, or 10 mg or equivalent
  • acetaminophen such as oral acetaminophen 500 mg.
  • Embodiment 42c is the method or composition for use of any one of embodiments 41-42b, wherein the infusion prophylaxis is administered as a required premedication prior to administering a guide RNA-containing composition, e.g. an LNP composition.
  • a guide RNA-containing composition e.g. an LNP composition.
  • Embodiment 43 is the method or composition for use of any one of embodiments 41-42c, wherein the HI blocker is diphenhydramine.
  • Embodiment 44 is the method or composition for use of any one of embodiments 41- 43, wherein the H2 blocker is ranitidine.
  • Embodiment 45 is the method or composition for use of any one of the preceding embodiments, wherein a first dose of the corticosteroid is administered at about 8-24 hours before the composition is administered and a second dose of the corticosteroid is
  • composition administered at about 1-2 hours before the composition is administered.
  • Embodiment 46 is the method or composition for use of any one of the preceding embodiments, wherein a first dose of the corticosteroid is administered orally and a second dose of the corticosteroid is administered intravenously before the composition is administered.
  • Embodiment 47 is the method or composition for use of any one of embodiments 45 and 46, wherein the method further comprises administering one or more of acetaminophen, an HI blocker, or an H2 blocker, optionally wherein the one or more of the acetaminophen, HI blocker, or H2 blocker are concurrently administered with the second dose of the corticosteroid.
  • Embodiment 48 is the method or composition for use of any one of the preceding embodiments, wherein a first dose of the corticosteroid is administered orally at about 8-24 hours before the composition is administered and a second dose of the corticosteroid is administered intravenously at about 1-2 hours before the composition is administered.
  • Embodiment 49 is the method or composition for use of any one of the preceding embodiments, wherein a first dose of the corticosteroid is administered orally at about 8-24 hours before the composition is administered and a second dose of the corticosteroid is administered intravenously concurrently with administration of acetaminophen, HI blocker and H2 blocker at about 1-2 hours before the composition is administered.
  • Embodiment 50 is the method or composition for use of any one of the preceding embodiments, wherein the corticosteroid is dexamethasone, and a first dose of
  • dexamethasone in the amount of about 6-10 mg is administered to the subject orally at about 8-24 hours before the composition is administered to the subject, and a second dose of dexamethasone in the amount of about 8-12 mg is intravenously administered to the subject concurrently with oral administration of acetaminophen and intravenous administration of an HI blocker and an H2 blocker, at about 1-2 hours before the composition is administered to the subject, optionally wherein the HI blocker is diphenhydramine and the H2 blocker is ranitidine, and/or optionally wherein the subject is human.
  • Embodiment 51 is the method or composition for use of any one of the preceding embodiments, wherein the corticosteroid is dexamethasone, and a first dose of
  • dexamethasone in the amount of 8 mg is administered to the subject orally at about 8-24 hours before the composition is administered to the subject, and a second dose of dexamethasone in the amount of 10 mg is intravenously administered to the subject concurrently with oral administration of acetaminophen and intravenous administration of an HI blocker and an H2 blocker, at about 1-2 hours before the composition is administered to the subject, optionally wherein the HI blocker is diphenhydramine and the H2 blocker is ranitidine.
  • Embodiment 52 is the method or composition for use of any one of the preceding embodiments, wherein the composition is administered in the amount of 3 mg/kg by infusion for about 1.5-6 hours; a first dose of the corticosteroid is administered orally at about 8-24 hours before infusion of the composition; and a second dose of the corticosteroid is administered intravenously at about 1-2 hours before infusion of the composition.
  • Embodiment 53 is the method or composition for use of any one of the preceding embodiments, wherein administering the corticosteroid improves tolerability of the composition comprising the guide RNA.
  • Embodiment 54 is the method or composition for use of any one of the preceding embodiments, wherein administering the corticosteroid reduces the incidence or severity of one or more of inflammation, nausea, vomiting, elevated ALT concentration in blood, hyperthermia, and/or hyperalgesia in response to the composition comprising the guide RNA.
  • Embodiment 55 is the method or composition for use of any one of the preceding embodiments, wherein administering the corticosteroid reduces or inhibits production or activity of one or more interferons and/or inflammatory cytokines in response to the composition comprising the guide RNA.
  • Embodiment 56 is the method or composition for use of any one of the preceding embodiments, wherein the composition reduces semm TTR levels.
  • Embodiment 57 is the method or composition for use of embodiment 56, wherein the serum TTR levels are reduced by at least 50% as compared to serum TTR levels before administration of the composition.
  • Embodiment 58 is the method or composition for use of embodiment 56, wherein the serum TTR levels are reduced by 50-60%, 60-70%, 70-80%, 80-90%, 90-95%, 95-98%, 98- 99%, or 99-100% as compared to serum TTR levels before administration of the composition.
  • Embodiment 59 is the method or composition for use of any one of the preceding embodiments, wherein the composition results in editing of the TTR gene.
  • Embodiment 60 is the method or composition for use of embodiment 59, wherein the editing is calculated as a percentage of the population that is edited (percent editing).
  • Embodiment 61 is the method or composition for use of embodiment 60, wherein the percent editing is between 30 and 99% of the population.
  • Embodiment 62 is the method or composition for use of embodiment 61, wherein the percent editing is between 30 and 35%, 35 and 40%, 40 and 45%, 45 and 50%, 50 and 55%, 55 and 60%, 60 and 65%, 65 and 70%, 70 and 75%, 75 and 80%, 80 and 85%, 85 and 90%, 90 and 95%, or 95 and 99% of the population.
  • Embodiment 63 is the method or composition for use of any one of the preceding embodiments, wherein the composition reduces amyloid deposition in at least one tissue.
  • Embodiment 64 is the method or composition for use of embodiment 63, wherein the at least one tissue comprises one or more of stomach, colon, sciatic nerve, or dorsal root ganglion.
  • Embodiment 65 is the method or composition for use of any one of embodiments 63 and 64, wherein amyloid deposition is measured 8 weeks after administration of the composition.
  • Embodiment 66 is the method or composition for use of any one of embodiments 63-
  • amyloid deposition is compared to a negative control or a level measured before administration of the composition.
  • Embodiment 67 is the method or composition for use of any one of embodiments 63-
  • amyloid deposition is measured in a biopsy sample and/or by immunostainmg.
  • Embodiment 68 is the method or composition for use of any one of embodiments 63-
  • amyloid deposition is reduced by between 30 and 35%, 35 and 40%, 40 and 45%, 45 and 50%, 50 and 55%, 55 and 60%, 60 and 65%, 65 and 70%, 70 and 75%, 75 and 80%, 80 and 85%, 85 and 90%, 90 and 95%, or 95 and 99% of the amyloid deposition seen in a negative control.
  • Embodiment 69 is the method or composition for use of any one of embodiments 63-
  • amyloid deposition is reduced by between 30 and 35%, 35 and 40%, 40 and 45%, 45 and 50%, 50 and 55%, 55 and 60%, 60 and 65%, 65 and 70%, 70 and 75%, 75 and 80%, 80 and 85%, 85 and 90%, 90 and 95%, or 95 and 99% of the amyloid deposition seen before administration of the composition.
  • Embodiment 70 is the method or composition for use of any one of the preceding embodiments, wherein the composition is administered or delivered at least two times.
  • Embodiment 71 is the method or composition for use of embodiment 70, wherein the composition is administered or delivered at least three times.
  • Embodiment 72 is the method or composition for use of embodiment 70, wherein the composition is administered or delivered at least four times.
  • Embodiment 73 is the method or composition for use of embodiment 70, wherein the composition is administered or delivered up to five, six, seven, eight, nine, or ten times.
  • Embodiment 74 is the method or composition for use of any one of embodiments 70- 73, wherein the administration or delivery occurs at an interval of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 days.
  • Embodiment 75 is the method or composition for use of any one of embodiments 70- 73, wherein the administration or delivery occurs at an interval of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 weeks.
  • Embodiment 76 is the method or composition for use of any one of embodiments 70- 73, wherein the administration or delivery occurs at an interval of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 months.
  • Embodiment 77 is the method or composition of any one of the preceding embodiments, wherein the guide sequence is selected from SEQ ID NOs: 5-82.
  • Embodiment 78 is the method or composition of any one of the preceding embodiments, wherein the guide RNA is at least partially complementary to a target sequence present in the human TTR gene.
  • Embodiment 79 is the method or composition of embodiment 78, wherein the target sequence is in exon 1, 2, 3, or 4 of the human TTR gene.
  • Embodiment 80 is the method or composition of embodiment 78, wherein the target sequence is in exon 1 of the human TTR gene.
  • Embodiment 81 is the method or composition of embodiment 78, wherein the target sequence is in exon 2 of the human TTR gene.
  • Embodiment 82 is the method or composition of embodiment 78, wherein the target sequence is in exon 3 of the human TTR gene.
  • Embodiment 83 is the method or composition of embodiment 78, wherein the target sequence is in exon 4 of the human TTR gene.
  • Embodiment 84 is the method or composition for use of any one of the preceding embodiments, wherein the guide sequence is complementary to a target sequence in the positive strand of TTR.
  • Embodiment 85 is the method or composition of any one of embodiments 1-83, wherein the guide sequence is complementary to a target sequence in the negative strand of TTR.
  • Embodiment 86 is the method or composition of any one of embodiments 1-83, wherein the first guide sequence is complementary to a first target sequence in the positive strand of the TTR gene, and wherein the composition further comprises a second guide sequence that is complementary to a second target sequence in the negative strand of the TTR gene.
  • Embodiment 87 is the method or composition of any one of the preceding embodiments, wherein the guide RNA is a dual guide (dgRNA).
  • Embodiment 88 is the method or composition of any one of embodiments 1-86, wherein the guide RNA is a single guide (sgRNA).
  • Embodiment 89 is the method or composition of embodiment 88, wherein the sgRNA comprises any one of the guide sequences of SEQ ID NOs: 5-82 and nucleotides 21- 100 of SEQ ID NO: 3.
  • Embodiment 90 is the method or composition of any one of embodiments 88 and 89, wherein the sgRNA comprises a guide sequence that is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to a sequence selected from SEQ ID Nos: 87- 124.
  • Embodiment 91 is the method or composition of embodiment 88, wherein the sgRNA comprises a sequence selected from SEQ ID Nos: 87-124.
  • Embodiment 92 is the method or composition of any one of the preceding embodiments, wherein the guide RNA comprises at least one modification.
  • Embodiment 93 is the method or composition of embodiment 92, wherein the at least one modification includes a -O-methyl (2’-0-Me) modified nucleotide.
  • Embodiment 94 is the method or composition of embodiment 92 or 93, wherein the at least one modification includes a phosphorothioate (PS) bond between nucleotides.
  • PS phosphorothioate
  • Embodiment 95 is the method or composition of any one of embodiments 92-94, wherein the at least one modification includes a 2’-fluoro (2’-F) modified nucleotide.
  • Embodiment 96 is the method or composition of any one of embodiments 92-95, wherein the at least one modification includes a 5’ end modification, a 3’ end modification, or 5 and 3’ end modifications.
  • Embodiment 97 is the method or composition of any one of embodiments 92-96, wherein the at least one modification includes a modification at one or more of the first five nucleotides at the 5’ end.
  • Embodiment 98 is the method or composition of any one of embodiments 92-97, wherein the at least one modification includes a modification at one or more of the last five nucleotides at the 3’ end.
  • Embodiment 99 is the method or composition of any one of embodiments 92-98, wherein the at least one modification includes PS bonds between the first four nucleotides.
  • Embodiment 100 is the method or composition of any one of embodiments 92-99, wherein the at least one modification includes PS bonds between the last four nucleotides.
  • Embodiment 101 is the method or composition of any one of embodiments 92-
  • the at least one modification includes 2’-0-Me modified nucleotides at the first three nucleotides at the 5’ end.
  • Embodiment 102 is the the method or composition of any one of embodiments 92-
  • the at least one modification includes 2’-0-Me modified nucleotides at the last three nucleotides at the 3’ end.
  • Embodiment 103 is the method or composition of any one of embodiments 92-
  • the guide RNA comprises the modified nucleotides of SEQ ID NO: 3.
  • Embodiment 104 is the method or composition of any one of the preceding embodiments, wherein the composition further comprises a pharmaceutically acceptable excipient.
  • Embodiment 105 is the method or composition of any one of the preceding embodiments, wherein the guide RNA is associated with a lipid nanoparticle (LNP).
  • LNP lipid nanoparticle
  • Embodiment 106 is the method or composition of embodiment 105, wherein the LNP comprises an ionizable lipid.
  • Embodiment 107 is the method or composition of embodiment 106, wherein the LNP comprises a biodegradable ionizable lipid.
  • Embodiment 108 is the method or composition of any one of embodiments 105- 017, wherein the LNP comprises an amine lipid, e.g., a CCD lipid.
  • Embodiment 109 is the method or composition of any one of embodiments 105-
  • the LNP comprises a helper lipid.
  • Embodiment 110 is the method or composition of any one of embodiments 105-
  • the LNP comprises a stealth lipid, optionally wherein:
  • the LNP comprises a lipid component and the lipid component comprises: about 50-60 mol-% amine lipid such as Lipid A, about 8-10 mol-% neutral lipid; and about 2.5-4 mol-% stealth lipid (e.g., a PEG lipid), wherein the remainder of the lipid component is helper lipid, and wherein the N/P ratio of the LNP composition is about 6;
  • the LNP comprises about 50-60 mol-% amine lipid such as Lipid A; about 27-39.5 mol-% helper lipid; about 8-10 mol-% neutral lipid; and about 2.5-4 mol-% stealth lipid (e.g., a PEG lipid), wherein the N/P ratio of the LNP composition is about 5-7 (e.g., about 6);
  • the LNP comprises a lipid component and the lipid component comprises: about 50-60 mol-% amine lipid such as Lipid A; about 5-15 mol-% neutral lipid; and about 2.5-4 mol-% Stealth lipid (e.g., a PEG lipid), wherein the remainder of the lipid component is helper lipid, and wherein the N/P ratio of the LNP composition is about 3-10;
  • the LNP comprises a lipid component and the lipid component comprises: about 40-60 mol-% amine lipid such as Lipid A; about 5-15 mol-% neutral lipid; and about 2.5-4 mol-% Stealth lipid (e.g., a PEG lipid), wherein the remainder of the lipid component is helper lipid, and wherein the N/P ratio of the LNP composition is about 6;
  • the LNP comprises a lipid component and the lipid component comprises: about 50-60 mol-% amine lipid such as Lipid A; about 5-15 mol-% neutral lipid; and about 1.5-10 mol-% Stealth lipid (e.g., a PEG lipid), wherein the remainder of the lipid component is helper lipid, and wherein the N/P ratio of the LNP composition is about 6;
  • the LNP comprises a lipid component and the lipid component comprises: about 40-60 mol-% amine lipid such as Lipid A; about 0-10 mol-% neutral lipid; and about 1.5-10 mol-% Stealth lipid (e.g., a PEG lipid), wherein the remainder of the lipid component is helper lipid, and wherein the N/P ratio of the LNP composition is about 3-10;
  • the LNP comprises a lipid component and the lipid component comprises: about 40-60 mol-% amine lipid such as Lipid A; less than about 1 mol-% neutral lipid; and about 1.5-10 mol-% Stealth lipid (e.g., a PEG lipid), wherein the remainder of the lipid component is helper lipid, and wherein the N/P ratio of the LNP composition is about 3-10;
  • the LNP comprises a lipid component and the lipid component comprises: about 40-60 mol-% amine lipid such as Lipid A; and about 1.5-10 mol-% Stealth lipid (e.g., a PEG lipid), wherein the remainder of the lipid component is helper lipid, wherein the N/P ratio of the LNP composition is about 3-10, and wherein the LNP composition is essentially free of or free of neutral phospholipid; or
  • the LNP comprises a lipid component and the lipid component comprises: about 50-60 mol-% amine lipid such as Lipid A; about 8-10 mol-% neutral lipid; and about 2.5-4 mol-% Stealth lipid (e.g., a PEG lipid), wherein the remainder of the lipid component is helper lipid, and wherein the N/P ratio of the LNP composition is about 3-7.
  • Embodiment 111 is the method or composition of any one of embodiments 105-
  • the LNP comprises a neutral lipid
  • Embodiment 112 is the method or composition of any one of embodiments 105-
  • Embodiment 113 is the method or composition of any one of embodiments 105-
  • Embodiment 114 is the method or composition of any one of embodiments 105-
  • Embodiment 115 is the method or composition of any one of embodiments 105-
  • helper lipid is present at about 38 mol-%.
  • Embodiment 116 is the method or composition of any one of embodiments 105-
  • Embodiment 117 is the method or composition of any one of embodiments 105-
  • the LNP comprises a lipid component and the lipid component comprises: about 50 mol-% amine lipid such as Lipid A; about 9 mol-% neutral lipid such as DSPC; about 3 mol-% of stealth lipid such as a PEG lipid, such as PEG2k-DMG, and the remainder of the lipid component is helper lipid such as cholesterol wherein the N/P ratio of the LNP composition is about 6.
  • Embodiment 118 is the method or composition of any one of embodiments 105-
  • Embodiment 119 is the method or composition of any one of embodiments 105-
  • Embodiment 120 is the method or composition of any one of embodiments 105-
  • the stealth lipid is PEG2k-DMG.
  • Embodiment 121 is the method or composition of any one of embodiments 105-
  • helper lipid is cholesterol
  • Embodiment 122 is the method or composition of any one of embodiments 105-
  • the LNP comprises a lipid component and the lipid component comprises: about 50 mol-% Lipid A; about 9 mol-% DSPC; about 3 mol-% of PEG2k-DMG, and the remainder of the lipid component is cholesterol wherein the N/P ratio of the LNP
  • composition is about 6.
  • Embodiment 123 is the method or composition of any one of the preceding embodiments, wherein the composition further comprises an RNA-guided DNA binding agent.
  • Embodiment 124 is the method or composition of any one of the preceding embodiments, wherein the composition further comprises a polynucleotide that encodes an RNA-guided DNA binding agent.
  • Embodiment 125 is the method or composition of embodiment 124, wherein the polynucleotide is an mRNA.
  • Embodiment 126 is the method or composition of any one of embodiments 123- 125, wherein the RNA-guided DNA binding agent is a Cas cleavase.
  • Embodiment 127 is the method or composition of any one of embodiments 123-
  • RNA-guided DNA binding agent is a Cas from a Type-II CRISPR/Cas system.
  • Embodiment 128 is the method or composition of any one of embodiments 123-
  • RNA-guided DNA binding agent is a Cas9.
  • Embodiment 129 is the method or composition of embodiment 128, wherein the RNA-guided DNA binding agent is an S. pyogenes Cas9 nuclease.
  • Embodiment 130 is the method or composition of any one of embodiments 124- 129, wherein the polynucleotide comprises an open reading frame encoding an RNA-guided DNA binding agent, wherein:
  • the open reading frame comprises a sequence with at least 95% identity to SEQ ID NO: 311;
  • the open reading frame has at least 95% identity to SEQ ID NO: 311 over at least its first 30, 50, 70, 100, 150, 200, 250, or 300 nucleotides;
  • the open reading frame consists of a set of codons of which at least 75% of the codons are codons listed in Table 4;
  • the open reading frame has an adenine content ranging from its minimum adenine content to 150% of the minimum adenine content;
  • the open reading frame has an adenine dinucleotide content ranging from its minimum adenine dinucleotide content to 150% of the minimum adenine dinucleotide content.
  • Embodiment 131 is the composition or method of embodiment 130, wherein the open reading frame has at least 95% identity to SEQ ID NO: 311 over at least its first 10%, 12%, 15%, 20%, 25%, 30%, or 35% of its sequence.
  • Embodiment 132 is the composition or method of embodiment 130 or 131, wherein the open reading frame comprises a sequence with at least 95%, 96%, 97%, 98%, 99%, 99.5%, or 100% identity to SEQ ID NO: 311.
  • Embodiment 133 is the composition or method of any one of embodiments 130- 132, wherein at least 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% of the codons of the open reading frame are codons listed in Table 4.
  • Embodiment 134 is the composition or method of any one of embodiments 1 SO S, wherein the open reading frame has an adenine content ranging from its minimum adenine content to 101%, 102%, 103%, 105%, 110%, 115%, 120%, 125%, 130%, 135%, 140%, 145%, or 150% of the minimum adenine content.
  • Embodiment 135 is the composition or method of any one of embodiments ISO-
  • the open reading frame has an adenine dinucleotide content ranging from its minimum adenine dinucleotide content to 101%, 102%, 103%, 105%, 110%, 115%, 120%, 125%, 130%, 135%, 140%, 145%, or 150% of the minimum adenine dinucleotide content.
  • Embodiment 136 is the composition or method of any one of embodiments 124-
  • polynucleotide comprises a 5’ UTR with at least 90% identity to any one of SEQ ID NOs: 232, 234, 236, 238, 241, or 275-277.
  • Embodiment 137 is the composition or method of any one of embodiments 124-
  • polynucleotide comprises a 3’ UTR with at least 90% identity to any one of SEQ ID NOs: 233, 235, 237, 239, or 240.
  • Embodiment 138 is the composition or method of any one of embodiments 124-
  • polynucleotide comprises a 5’ UTR and a 3’ UTR from the same source.
  • Embodiment 139 is the composition or method of any one of embodiments 124-
  • polynucleotide comprises a 5’ cap selected from CapO, Capl, and Cap2.
  • Embodiment 140 is the composition or method of any one of embodiments 124-
  • the open reading frame comprises a sequence with at least 95%, 96%, 97%, 98%, 99%, 99.5%, or 100% identity to SEQ ID NO: 311.
  • Embodiment 141 is the composition or method of any of embodiments 125-140, wherein at least 10% of the uridine in the mRNA is substituted with a modified uridine.
  • Embodiment 142 is the composition or method of embodiment 141, wherein the modified uridine is one or more of N1 -methyl-pseudouridine, pseudouridine, 5- methoxy uridine, or 5-iodouridine.
  • Embodiment 143 is the composition or method of embodiment 141, wherein the modified uridine is one or both of N1 -methyl-pseudouridine or 5-methoxyuridine.
  • Embodiment 144 is the composition or method of embodiment 141, wherein the modified uridine is N1 -methyl-pseudouridine.
  • Embodiment 145 is the composition or method of embodiment 141, wherein the modified uridine is 5-methoxyuridine.
  • Embodiment 146 is the composition or method of any one of embodiments I MS, wherein 15% to 45% of the uridine is substituted with the modified uridine.
  • Embodiment 147 is the composition or method of any one of embodiments 141- 146, wherein at least 20% or at least 30% of the undine is substituted with the modified undine.
  • Embodiment 148 is the composition or method of embodiment 147, wherein at least 80% or at least 90% of the uridine is substituted with the modified uridine.
  • Embodiment 149 is the composition or method of embodiment 147, wherein 100% of the uridine is substituted with the modified uridine.
  • Embodiment 150 is the method or composition of any one of embodiments 123- 149, wherein the RNA-guided DNA binding agent is modified.
  • Embodiment 151 is the method or composition of embodiment 150, wherein the modified RNA-guided DNA binding agent comprises a nuclear localization signal (NLS).
  • NLS nuclear localization signal
  • Embodiment 152 is the method or composition of any one of the preceding embodiments, wherein the composition is a pharmaceutical formulation and further comprises a pharmaceutically acceptable carrier.
  • Embodiment 153 is the method or composition for use of any one of the preceding embodiments, wherein the composition reduces or prevents amyloids or amyloid fibrils comprising TTR.
  • Embodiment 154 is the method or composition for use of embodiment 153, wherein the amyloids or amyloid fibrils are in the nerves, heart, or gastrointestinal track.
  • Embodiment 155 is the method or composition for use of any one of the preceding embodiments, wherein non-homologous ending joining (NHEJ) leads to a mutation during repair of a DSB in the TTR gene.
  • NHEJ non-homologous ending joining
  • Embodiment 156 is the method or composition for use of embodiment 155, wherein NHEJ leads to a deletion or insertion of a nucleotide(s) during repair of a DSB in the TTR gene.
  • Embodiment 157 is the method or composition for use of embodiment 156, wherein the deletion or insertion of a nucleotide(s) induces a frame shift or nonsense mutation in the TTR gene.
  • Embodiment 158 is the method or composition for use of embodiment 155 or 156, wherein a frame shift or nonsense mutation is induced in the TTR gene of at least 50% of liver cells.
  • Embodiment 159 is the method or composition for use of embodiment 158, wherein a frame shift or nonsense mutation is induced in the TTR gene of 50%-60%, 60%- 70%, 70% or 80%, 80%-90%, 90-95%, 95%-99%, or 99%-100% of liver cells.
  • Embodiment 160 is the method or composition for use of any one of embodiments 156-159, wherein a deletion or insertion of a nucleotide(s) occurs in the TTR gene at least 50- fold or more than in off-target sites.
  • Embodiment 161 is the method or composition for use of embodiment 160, wherein the deletion or insertion of a nucleotide(s) occurs in the TTR gene 50-fold to 150- fold, 150-fold to 500-fold, 500-fold to 1500-fold, 1500-fold to 5000-fold, 5000-fold to 15000-fold, 15000-fold to 30000-fold, or 30000-fold to 60000-fold more than in off-target sites.
  • Embodiment 162 is the method or composition for use of any one of embodiments 156-161, wherein the deletion or insertion of a nucleotide(s) occurs at less than or equal to 3, 2, 1, or 0 off-target site(s) in primary human hepatocytes, optionally wherein the off-target site(s) does (do) not occur in a protein coding region in the genome of the primary human hepatocytes.
  • Embodiment 163 is the method or composition for use of embodiment 162, wherein the deletion or insertion of a nucleotide(s) occurs at a number of off-target sites in primary human hepatocytes that is less than the number of off-target sites at which a deletion or insertion of a nucleotide(s) occurs in Cas9-overexpressing cells, optionally wherein the off-target site(s) does (do) not occur in a protein coding region in the genome of the primary human hepatocytes.
  • Embodiment 164 is the method or composition for use of embodiment 163, wherein the Cas9-overexpressing cells are HEK293 cells stably expressing Cas9.
  • Embodiment 165 is the method or composition for use of any one of embodiments 162-164, wherein the number of off-target sites in primary human hepatocytes is determined by analyzing genomic DNA from primary human hepatocytes transfected in vitro with Cas9 mRNA and the guide RNA, optionally wherein the off-target site(s) does (do) not occur in a protein coding region in the genome of the primary human hepatocytes.
  • Embodiment 166 is the method or composition for use of any one of embodiments 162-164, wherein the number of off-target sites in primary human hepatocytes is determined by an oligonucleotide insertion assay comprising analyzing genomic DNA from primary human hepatocytes transfected in vitro with Cas9 mRNA, the guide RNA, and a donor oligonucleotide, optionally wherein the off-target site(s) does (do) not occur in a protein coding region in the genome of the primary human hepatocytes.
  • an oligonucleotide insertion assay comprising analyzing genomic DNA from primary human hepatocytes transfected in vitro with Cas9 mRNA, the guide RNA, and a donor oligonucleotide, optionally wherein the off-target site(s) does (do) not occur in a protein coding region in the genome of the primary human hepatocytes.
  • Embodiment 167 is the method or composition of any one of the preceding embodiments, wherein the sequence of the guide RNA is:
  • the guide RNA does not produce indels at off-target site(s) that occur in a protein coding region in the genome of primary human hepatocytes.
  • Embodiment 168 is the method or composition for use of any one of the preceding embodiments, wherein administering the composition reduces levels of TTR in the subject.
  • Embodiment 169 is the method or composition for use of embodiment 168, wherein the levels of TTR are reduced by at least 50%.
  • Embodiment 170 is the method or composition for use of embodiment 169, wherein the levels of TTR are reduced by 50%-60%, 60%-70%, 70% or 80%, 80%-90%, 90- 95%, 95%-99%, or 99%-100%.
  • Embodiment 171 is the method or composition for use of embodiment 168 or 169, wherein the levels of TTR are measured in serum, plasma, blood, cerebral spinal fluid, or sputum.
  • Embodiment 172 is the method or composition for use of embodiment 168 or 169, wherein the levels of TTR are measured in liver, choroid plexus, and/or retina.
  • Embodiment 173 is the method or composition for use of any one of embodiments 168-172, wherein the levels of TTR are measured via enzyme-linked immunosorbent assay (ELISA).
  • ELISA enzyme-linked immunosorbent assay
  • Embodiment 174 is the method or composition for use of any one of the preceding embodiments, wherein the subject has ATTR.
  • Embodiment 175 is the method or composition for use of any one of the preceding embodiments, wherein the subject is human.
  • Embodiment 176 is the method or composition for use of embodiment 174 or 175, wherein the subject has ATTRwt.
  • Embodiment 177 is the method or composition for use of embodiment 174 or 175, wherein the subject has hereditary ATTR.
  • Embodiment 178 is the method or composition for use of any one of the preceding embodiments, wherein the subject has a family history of ATTR.
  • Embodiment 179 is the method or composition for use of any one of the preceding embodiments , wherein the subject has familial amyloid polyneuropathy.
  • Embodiment 180 is the method or composition for use of any one of the preceding embodiments , wherein the subject has only or predominantly nerve symptoms of ATTR.
  • Embodiment 181 is the method or composition for use of any one of embodiments 1-179, wherein the subject has familial amyloid cardiomyopathy.
  • Embodiment 182 is the method or composition for use of any one of embodiments 1-179 or 181, wherein the subject has only or predominantly cardiac symptoms of ATTR.
  • Embodiment 183 is the method or composition for use of any one of the preceding embodiments, wherein the subject expresses TTR having a V30 mutation.
  • Embodiment 184 is the method or composition for use of embodiment 183, wherein the V30 mutation is V30A, V30G, V30L, or V30M.
  • Embodiment 185 is the method or composition for use of embodiment any one of the preceding embodiments, wherein the subject expresses TTR having a T60 mutation.
  • Embodiment 186 is the method or composition for use of embodiment 185, wherein the T60 mutation is T60A.
  • Embodiment 187 is the method or composition for use of embodiment any one of the preceding embodiments, wherein the subject expresses TTR having a VI 22 mutation.
  • Embodiment 188 is the method or composition for use of embodiment 187, wherein the V122 mutation is V122A, V122I, or V122(-).
  • Embodiment 189 is the method or composition for use of any one of the preceding embodiments, wherein the subject expresses wild-type TTR.
  • Embodiment 190 is the method or composition for use of any one of embodiments 1-182 or 189, wherein the subject does not express TTR having a V30, T60, or V122 mutation.
  • Embodiment 191 is the method or composition for use of any one of embodiments 1-182 or 189-190, wherein the subject does not express TTR having a pathological mutation.
  • Embodiment 192 is the method or composition for use of any one of embodiments 190-192, wherein the subject is homozygous for wild-type TTR.
  • Embodiment 193 is the method or composition for use of any one of the preceding embodiments, wherein after administration the subject has an improvement, stabilization, or slowing of change in symptoms of sensorimotor neuropathy.
  • Embodiment 194 is the method or composition for use of embodiment 193, wherein the improvement, stabilization, or slowing of change in sensory neuropathy is measured using electromyogram, nerve conduction tests, or patient-reported outcomes.
  • Embodiment 195 is the method or composition for use of any one of the preceding embodiments, wherein the subject has an improvement, stabilization, or slowing of change in symptoms of congestive heart failure.
  • Embodiment 196 is the method or composition for use of embodiment 195, wherein the improvement, stabilization, or slowing of change in congestive heart failure is measured using cardiac biomarker tests, lung function tests, chest x-rays, or
  • Embodiment 197 is the method or composition for use of any one of the preceding embodiments, wherein the composition or pharmaceutical formulation is administered via a viral vector.
  • Embodiment 198 is the method or composition for use of any one of the preceding embodiments, wherein the composition or pharmaceutical formulation is administered via lipid nanoparticles.
  • Embodiment 199 is the method or composition for use of any one of the preceding embodiments, wherein the subject is tested for specific mutations in the TTR gene before administering the composition or formulation.
  • Embodiment 200 is the method or composition of any one of embodiments 1-199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 5.
  • Embodiment 201 is the method or composition of any one of embodiments 1-199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 6.
  • Embodiment 202 is the method or composition of any one of embodiments 1-199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 7.
  • Embodiment 203 is the method or composition of any one of embodiments 1-199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 8.
  • Embodiment 204 is the method or composition of any one of embodiments 1-199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 9.
  • Embodiment 205 is the method or composition of any one of embodiments 1-199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 10.
  • Embodiment 206 is the method or composition of any one of embodiments 1-199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 11.
  • Embodiment 207 is the method or composition of any one of embodiments 1-199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 12.
  • Embodiment 208 is the method or composition of any one of embodiments 1-199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 13.
  • Embodiment 209 is the method or composition of any one of embodiments 1-199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 14.
  • Embodiment 210 is the method or composition of any one of embodiments 1-199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 15.
  • Embodiment 211 is the method or composition of any one of embodiments 1-199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 16.
  • Embodiment 212 is the method or composition of any one of embodiments 1-199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 17.
  • Embodiment 213 is the method or composition of any one of embodiments 1-199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 18.
  • Embodiment 214 is the method or composition of any one of embodiments 1-199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 19.
  • Embodiment 215 is the method or composition of any one of embodiments 1-199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 20.
  • Embodiment 216 is the method or composition of any one of embodiments 1-199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 21.
  • Embodiment 217 is the method or composition of any one of embodiments 1-199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 22.
  • Embodiment 218 is the method or composition of any one of embodiments 1-199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 23.
  • Embodiment 219 is the method or composition of any one of embodiments 1-199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 24.
  • Embodiment 220 is the method or composition of any one of embodiments 1-199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 25.
  • Embodiment 221 is the method or composition of any one of embodiments 1-199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 26.
  • Embodiment 222 is the method or composition of any one of embodiments 1-199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 27.
  • Embodiment 223 is the method or composition of any one of embodiments 1-199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 28.
  • Embodiment 224 is the method or composition of any one of embodiments 1-199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 29.
  • Embodiment 225 is the method or composition of any one of embodiments 1-199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 30.
  • Embodiment 226 is the method or composition of any one of embodiments 1-199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 31.
  • Embodiment 227 is the method or composition of any one of embodiments 1-199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 32.
  • Embodiment 228 is the method or composition of any one of embodiments 1-199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 33.
  • Embodiment 229 is the method or composition of any one of embodiments 1-199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 34.
  • Embodiment 230 is the method or composition of any one of embodiments 1-199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 35.
  • Embodiment 231 is the method or composition of any one of embodiments 1-199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 36.
  • Embodiment 232 is the method or composition of any one of embodiments 1-199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 37.
  • Embodiment 233 is the method or composition of any one of embodiments 1-199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 38.
  • Embodiment 234 is the method or composition of any one of embodiments 1-199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 39.
  • Embodiment 235 is the method or composition of any one of embodiments 1-199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 40.
  • Embodiment 236 is the method or composition of any one of embodiments 1-199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 41.
  • Embodiment 237 is the method or composition of any one of embodiments 1-199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 42.
  • Embodiment 238 is the method or composition of any one of embodiments 1-199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 43.
  • Embodiment 239 is the method or composition of any one of embodiments 1-199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 44.
  • Embodiment 240 is the method or composition of any one of embodiments 1-199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 45.
  • Embodiment 241 is the method or composition of any one of embodiments 1-199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 46.
  • Embodiment 242 is the method or composition of any one of embodiments 1-199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 47.
  • Embodiment 243 is the method or composition of any one of embodiments 1-199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 48.
  • Embodiment 244 is the method or composition of any one of embodiments 1-199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 49.
  • Embodiment 245 is the method or composition of any one of embodiments 1-199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 50.
  • Embodiment 246 is the method or composition of any one of embodiments 1-199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 51.
  • Embodiment 247 is the method or composition of any one of embodiments 1-199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 52.
  • Embodiment 248 is the method or composition of any one of embodiments 1-199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 53.
  • Embodiment 249 is the method or composition of any one of embodiments 1-199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 54.
  • Embodiment 250 is the method or composition of any one of embodiments 1-199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 55.
  • Embodiment 251 is the method or composition of any one of embodiments 1-199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 56.
  • Embodiment 252 is the method or composition of any one of embodiments 1-199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 57.
  • Embodiment 253 is the method or composition of any one of embodiments 1-199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 58.
  • Embodiment 254 is the method or composition of any one of embodiments 1-199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 59.
  • Embodiment 255 is the method or composition of any one of embodiments 1-199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 60.
  • Embodiment 256 is the method or composition of any one of embodiments 1-199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 61.
  • Embodiment 257 is the method or composition of any one of embodiments 1-199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 62.
  • Embodiment 258 is the method or composition of any one of embodiments 1-199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 63.
  • Embodiment 259 is the method or composition of any one of embodiments 1-199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 64.
  • Embodiment 260 is the method or composition of any one of embodiments 1-199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 65.
  • Embodiment 261 is the method or composition of any one of embodiments 1-199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 66.
  • Embodiment 262 is the method or composition of any one of embodiments 1-199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 67.
  • Embodiment 263 is the method or composition of any one of embodiments 1-199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 68.
  • Embodiment 264 is the method or composition of any one of embodiments 1-199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 69.
  • Embodiment 265 is the method or composition of any one of embodiments 1-199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 70.
  • Embodiment 266 is the method or composition of any one of embodiments 1-199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 71.
  • Embodiment 267 is the method or composition of any one of embodiments 1-199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 72.
  • Embodiment 268 is the method or composition of any one of embodiments 1-199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 73.
  • Embodiment 269 is the method or composition of any one of embodiments 1-199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 74.
  • Embodiment 270 is the method or composition of any one of embodiments 1-199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 75.
  • Embodiment 271 is the method or composition of any one of embodiments 1-199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 76.
  • Embodiment 272 is the method or composition of any one of embodiments 1-199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 77.
  • Embodiment 273 is the method or composition of any one of embodiments 1-199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 78.
  • Embodiment 274 is the method or composition of any one of embodiments 1-199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 79.
  • Embodiment 275 is the method or composition of any one of embodiments 1-199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 80.
  • Embodiment 276 is the method or composition of any one of embodiments 1-199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 81.
  • Embodiment 277 is the method or composition of any one of embodiments 1-199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 82.
  • Embodiment 278 is a use of a composition or formulation of any of the preceding embodiments for the preparation of a medicament for treating a human subject having ATTR.
  • FIG. 1 shows a schematic of chromosome 18 with the regions of the TTR gene that are targeted by the guide sequences provided in Table 1.
  • FIG. 2 shows off-target analysis in HEK293_Cas9 cells of certain dual guide RNAs targeting TTR.
  • the on-target site is designated by a filled square for each dual guide RNA tested, whereas closed circles represent a potential off-target site.
  • FIG. 3 shows off-target analysis in HEK_Cas9 cells of certain single guide RNAs targeting TTR.
  • the on-target site is designated by a filled square for each single guide RNA tested, whereas open circles represent a potential off-target site.
  • FIG. 4 shows dose response curves of lipid nanoparticle formulated human TTR specific sgRNAs on primary human hepatocytes.
  • FIG. 5 shows dose response curves of lipid nanoparticle formulated human TTR specific sgRNAs on primary cyno hepatocytes.
  • FIG. 6 shows dose response curves of lipid nanoparticle formulated cyno TTR specific sgRNAs on primary cyno hepatocytes.
  • FIG. 7 shows percent editing (% edit) of TTR and reduction of secreted TTR following administration of the guide in HUH7 cells sequences provided on the x-axis. The values are normalized to the amount of alpha- 1 -antitrypsin (AAT) protein.
  • AAT alpha- 1 -antitrypsin
  • FIG. 8 shows western blot analysis of intracellular TTR following administration of targeted guides (listed in Table 1) in HUH7 cells.
  • FIG. 9 shows percentage liver editing of TTR observed following administration of LNP formulations to mice with humanized (G481-G499) or murine (G282) TTR. Note: the first three‘0’s in each Guide ID is omitted from the Figure, for example G481 is “G000481” in Tables 2 and 3.
  • FIGS. 10A-B show serum TTR levels observed following the dosing regimens indicated on the horizontal axis as pg/ml (FIG. 10A) or percentage of TSS control (FIG.
  • FIGS. 11 A-B show serum TTR levels observed following the dosing regimens indicated on the horizontal axis for 1 mg/kg (FIG. 11 A) or 0.5 mg/kg dosages (FIG. 1 IB). Data for a single 2 mg/kg dose is included as the right column in both panels.
  • FIGS. 12A-B show percentage liver editing observed following the dosing regimens indicated on the horizontal axis for 1 mg/'kg (FIG. 12 A) or 0.5 mg/kg dosages (FIG. 12B).
  • FIG. 12C shows percentage liver editing observed following a single dose at 0.5, 1, or 2 mg/kg.
  • FIG. 13 shows percent liver editing observed following administration of LNP formulations to mice humanized with respect to the TTR gene. Note: the first three O s in each Guide ID is omitted from the Figure, for example G481 is“G000481” in Tables 2 and 3.
  • FIGS. 14A-B show that there is correlation between liver editing (FIG. 14 A) and serum human TTR levels (FIG. 14B) following administration of LNP formulations to mice humanized with respect to the TTR gene.
  • FIGS. 14A-B show that there is correlation between liver editing (FIG. 14 A) and serum human TTR levels (FIG. 14B) following administration of LNP formulations to mice humanized with respect to the TTR gene.
  • the first three‘0’s in each Guide ID is omitted from the Figure, for example“G481” is“G000481” in Tables 2 and 3.
  • FIGS. 15A-B show that there is a dose response with respect to percent editing (FIG. 15 A) and serum TTR levels (FIG. 15B) in wild type mice following administration of LNP formulations comprising guide G502, which is cross homologous between mouse and cyno.
  • FIG. 16 shows dose response curves of lipid nanoparticle formulated human TTR specific sgRNAs on primary cyno hepatocytes.
  • FIG. 17 shows dose response curves of lipid nanoparticle formulated cyno TTR specific sgRNAs on primary human hepatocytes.
  • FIG. 18 shows dose response curves of lipid nanoparticle formulated cyno TTR specific sgRNAs on primary cyno hepatocytes.
  • FIGS. 19A-D show serum TTR (% TSS; FIGs. 19A and 19C) and editing results following dosing of LNP formulations at the indicated ratios and amounts (FIGs. 19B and 19D).
  • FIG. 20 shows off-target analysis of certain single guide RNAs in Primary Human Hepatocytes (PHH) targeting TTR.
  • PHL Primary Human Hepatocytes
  • FIGS. 21A-B show percent editing on-target (ONT, FIG. 21A) and at two off- target sites (OT2 and OT4) in primary human hepatocytes following administration of lipid nanoparticle formulated G000480.
  • FIG. 21B is a re-scaled version of the OT2, OT4, and negative control (Neg Cont) data in FIG. 21 A.
  • FIGS. 22A-B show percent editing on-target (ONT, FIG. 22 A) and at an off-target site (OT4) in primary human hepatocytes following administration of lipid nanoparticle formulated G000486.
  • FIG. 22B is a re-scaled version of the OT4 and negative control (Neg Cont) data in FIG. 22A.
  • FIGS. 23A-B show percent editing (FIG. 23 A) and number of insertion and deletion events at the TTR locus (FIG. 23B).
  • FIG. 23A shows percent editing at the TTR locus in control and treatment (dosed with lipid nanoparticle formulated TTR specific sgRNA) groups.
  • FIG. 23B shows the number of insertion and deletion events at the TTR locus when editing was observed in the treatment group of FIG. 23 A.
  • FIGS. 24A-B show TTR levels in circulating serum (FIG. 24A) and cerebrospinal fluid (CSF) (FIG. 24B), respectively, in pg/mL for control and treatment (dosed with lipid nanoparticle formulated TTR specific sgRNA) groups. Treatment resulted in >99% knockdown of TTR levels in serum.
  • FIGS. 25A-D show immunohistochemistry images with staining for TTR in stomach (FIG. 25 A), colon (FIG. 25B), sciatic nerve (FIG. 25C), and dorsal root ganglion (DRG) (FIG. 25D) from control and treatment (dosed with lipid nanoparticle formulated TTR specific sgRNA) mice.
  • bar graphs show reduction in TTR staining 8 weeks after treatment in treated mice as measured by percent occupied area for each tissue type.
  • FIGS. 26A-C show liver TTR editing (FIG. 26A) and serum TTR results (in pg/mL (FIG. 26B) and as percentage of TSS-treated control (FIG. 26C)), respectively, from humanized TTR mice dosed with LNP formulations across a range of doses with guides G000480, G000488, G000489 and G000502 and containing Cas9 mRNA (SEQ ID NO: 1) in a 1 : 1 ratio by weight to the guide.
  • SEQ ID NO: 1 Cas9 mRNA
  • FIGS. 27A-C show liver TTR editing (FIG. 27 A) and serum TTR results (in pg/mL (FIG. 27B) and as percentage of TSS-treated control (FIG. 27 C)), respectively, from humanized TTR mice dosed with LNP formulations across a range of doses with guides G000481, G000482, G000486 and G000499 and containing Cas9 mRNA (SEQ ID NO: 1) in a 1 : 1 ratio by weight to the guide.
  • SEQ ID NO: 1 Cas9 mRNA
  • FIGS. 28A-C show liver TTR editing (FIG. 28A) and serum TTR results (in pg/mL (FIG. 28B) and as percentage of TSS-treated control (FIG. 28C)), respectively, from humanized TTR mice dosed with LNP formulations across a range of doses with guides G000480, G000481, G000486, G000499 and G000502 and containing Cas9 mRNA (SEQ ID NO: 1) in a 1 :2 ratio by weight to the guide.
  • FIG. 29 shows relative expression of TTR mRNA in primary human hepatocytes (PHH) after treatment with LNPs comprising Cas9 mRNA and a gRNA as indicated, as compared to negative (untreated) controls.
  • FIG. 30 shows relative expression of TTR mRNA in primary human hepatocytes (PHH) after treatment with LNPs comprising Cas9 mRNA and a gRNA as indicated, as compared to negative (untreated) controls.
  • FIGS. 31A-C show serum TTR levels (FIG. 31A), liver TTR editing (FIG 31B), and circulating ALT levels (FIG. 31C) in an in vivo study in nonhuman primates comparing 30’ administration of LNPs to a long dosing protocol.
  • nucleic acid and“nucleic acid” are used herein to refer to a multimeric compound comprising nucleosides or nucleoside analogs which have nitrogenous heterocyclic bases or base analogs linked together along a backbone, including conventional RNA, DNA, mixed RNA-DNA, and polymers that are analogs thereof.
  • a nucleic acid “backbone” can be made up of a variety of linkages, including one or more of sugar- phosphodiester linkages, peptide-nucleic acid bonds (“peptide nucleic acids” or PNA; PCT No. WO 95/32305), phosphorothioate linkages, methylphosphonate linkages, or
  • Sugar moieties of a nucleic acid can be ribose, deoxyribose, or similar compounds with substitutions, e.g., 2’ methoxy or 2’ halide substitutions.
  • Nitrogenous bases can be conventional bases (A, G, C, T, U), analogs thereof (e.g., modified uridines such as 5- methoxyuridine, pseudouridine, or Nl-methylpseudouridine, or others); inosine; derivatives of purines or pyrimidines (e.g., N 4 -methyl deoxyguanosine, deaza- or aza-purines, deaza- or aza-pyrimidines, pyrimidine bases with substituent groups at the 5 or 6 position (e.g., 5- methylcytosine), purine bases with a substituent at the 2, 6, or 8 positions, 2-amino-6- methylaminopurine, 0 6 -methylguanine, 4-thio-pyrimidines, 4-amino
  • Nucleic acids can include one or more“abasic” residues where the backbone includes no nitrogenous base for position(s) of the polymer (US Pat. No. 5,585,481).
  • a nucleic acid can comprise only conventional RNA or DNA sugars, bases and linkages, or can include both conventional components and substitutions (e.g., conventional bases with 2’ methoxy linkages, or polymers containing both conventional bases and one or more base analogs).
  • Nucleic acid includes“locked nucleic acid” (LNA), an analogue containing one or more LNA nucleotide monomers with a bicyclic furanose unit locked in an RNA mimicking sugar conformation, which enhance hybridization affinity toward complementary RNA and DNA sequences (Vester and Wengel, 2004, Biochemistry
  • RNA and DNA have different sugar moieties and can differ by the presence of uracil or analogs thereof in RNA and thymine or analogs thereof in DNA.
  • Polypeptide refers to a multimeric compound comprising amino acid residues that can adopt a three-dimensional conformation.
  • Polypeptides include but are not limited to enzymes, enzyme precursor proteins, regulatory proteins, structural proteins, receptors, nucleic acid binding proteins, antibodies, etc. Polypeptides may, but do not necessarily, comprise post-translational modifications, non-natural amino acids, prosthetic groups, and the like.
  • “Guide RNA”,“gRNA”, and“guide” are used herein interchangeably to refer to either a crRNA (also known as CRISPR RNA), or the combination of a crRNA and atrRNA (also known as tracrRNA).
  • the crRNA and trRNA may be associated as a single RNA molecule (single guide RNA, sgRNA) or in two separate RNA molecules (dual guide RNA, dgRNA).“Guide RNA” or“gRNA” refers to each type.
  • the trRNA may be a naturally- occurring sequence, or a trRNA sequence with modifications or variations compared to naturally-occurring sequences.
  • Guide RNAs can include modified RNAs as described herein.
  • a“guide sequence” refers to a sequence within a guide RNA that is complementary to a target sequence and functions to direct a guide RNA to a target sequence for binding or modification (e.g., cleavage) by an RNA-guided DNA binding agent.
  • A“guide sequence” may also be referred to as a“targeting sequence,” or a“spacer sequence.”
  • a guide sequence can be 20 base pairs in length, e.g., in the case of
  • Streptococcus pyogenes i.e., Spy Cas9 and related Cas9 homologs/orthologs.
  • Shorter or longer sequences can also be used as guides, e.g., 15-, 16-, 17-, 18-, 19-, 21-, 22-, 23-, 24-, or 25-nucleotides in length.
  • the guide sequence comprises at least 17, 18, 19, or 20 contiguous nucleotides of a sequence selected from SEQ ID NOs: 5- 82.
  • the target sequence is in a gene or on a chromosome, for example, and is complementary to the guide sequence.
  • the degree of complementarity or identity between a guide sequence and its corresponding target sequence may be about 75%, 80%, 85%, 88%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%.
  • the guide sequence comprises a sequence with about 75%, 80%, 85%, 88%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to at least 17, 18, 19, or 20 contiguous nucleotides of a sequence selected from SEQ ID NOs: 5-82.
  • the guide sequence and the target region may be 100% complementary or identical. In other embodiments, the guide sequence and the target region may contain at least one mismatch.
  • the guide sequence and the target sequence may contain 1, 2, 3, or 4 mismatches, where the total length of the target sequence is at least 17, 18, 19, 20 or more base pairs.
  • the guide sequence and the target region may contain 1-4 mismatches where the guide sequence comprises at least 17, 18, 19, 20 or more nucleotides.
  • the guide sequence and the target region may contain 1,
  • Target sequences for Cas proteins include both the positive and negative strands of genomic DNA (i.e., the sequence given and the sequence’s reverse compliment), as a nucleic acid substrate for a Cas protein is a double stranded nucleic acid. Accordingly, where a guide sequence is said to be“complementary to a target sequence”, it is to be understood that the guide sequence may direct a guide RNA to bind to the reverse complement of a target sequence. Thus, in some embodiments, where the guide sequence binds the reverse complement of a target sequence, the guide sequence is identical to certain nucleotides of the target sequence (e.g., the target sequence not including the PAM) except for the substitution of U for T in the guide sequence.
  • an“RNA-guided DNA binding agent” means a polypeptide or complex of polypeptides having RNA and DNA binding activity , or a DNA-binding subunit of such a complex, wherein the DNA binding activity is sequence-specific and depends on the sequence of the RNA.
  • Exemplary RNA-guided DNA binding agents include Cas cleavases/nickases and inactivated forms thereof (“dCas DNA binding agents”).
  • Cas cleavases/nickases and dCas DNA binding agents include a Csm or Cmr complex of a ty pe III CRISPR system, the Cas 10, Csml, or Cmr2 subunit thereof, a Cascade complex of a type I CRISPR system, the Cas3 subunit thereof, and Class 2 Cas nucleases.
  • a“Class 2 Cas nuclease” is a single-chain polypeptide with RNA-guided DNA binding activity, such as a Cas9 nuclease or a Cpfl nuclease.
  • Class 2 Cas nucleases include Class 2 Cas cleavases and Class 2 Cas nickases (e.g., H840A, D10A, or N863A variants), which further have RNA-guided DNA cleavases or nickase activity, and Class 2 dCas DNA binding agents, in which cleavase/nickase activity is inactivated.
  • Class 2 Cas nucleases include, for example, Cas9, Cpfl, C2cl, C2c2, C2c3, HF Cas9 (e.g., N497A, R661A, Q695A, Q926A variants), HypaCas9 (e g., N692A, M694A, Q695A, H698A variants), eSPCas9(1.0) (e.g, K810A, K1003A, R1060A variants), and eSPCas9(l. l) (e.g., K848A, K1003A, R1060A variants) proteins and modifications thereof.
  • Cas9, Cpfl, C2cl, C2c2, C2c3, HF Cas9 e.g., N497A, R661A, Q695A, Q926A variants
  • HypaCas9 e.g., N692A, M694A,
  • Cpfl protein Zetsche et ak, Cell , 163: 1-13 (2015), is homologous to Cas9, and contains a RuvC-like nuclease domain.
  • Cpfl sequences of Zetsche are incorporated by reference in their entirety. See, e.g., Zetsche, Tables SI and S3.
  • “Cas9” encompasses Spy Cas9, the variants of Cas9 listed herein, and equivalents thereof. See, e.g., Makarova et ak, Nat Rev Microbiol, 13(11): 722-36 (2015); Shmakov et ak, Molecular Cell, 60:385-397 (2015).
  • Modified uridine is used herein to refer to a nucleoside other than thymidine with the same hydrogen bond acceptors as uridine and one or more structural differences from uridine.
  • a modified uridine is a substituted undine, i.e., a uridine in which one or more non-proton substituents (e.g., alkoxy, such as methoxy) takes the place of a proton.
  • a modified uridine is pseudouridine.
  • a modified uridine is a substituted pseudouridine, i.e., a pseudouridine in which one or more non-proton substituents (e.g., alkyl, such as methyl) takes the place of a proton, e.g., N1 -methyl pseudouridine.
  • a modified uridine is any of a substituted uridine, pseudouridine, or a substituted pseudouridine.
  • Uridine position refers to a position in a polynucleotide occupied by a uridine or a modified uridine.
  • a polynucleotide in which“100% of the uridine positions are modified uridines” contains a modified uridine at every position that would be a uridine in a conventional RNA (where all bases are standard A, U, C, or G bases) of the same sequence.
  • a U in a polynucleotide sequence of a sequence table or sequence listing in, or accompanying, this disclosure can be a uridine or a modified uridine.
  • a first sequence is considered to“comprise a sequence with at least X% identity to” a second sequence if an alignment of the first sequence to the second sequence shows that X% or more of the positions of the second sequence in its entirety are matched by the first sequence.
  • the sequence AAGA comprises a sequence with 100% identity to the sequence AAG because an alignment would give 100% identity in that there are matches to all three positions of the second sequence.
  • RNA and DNA generally the exchange of uridine for thymidine or vice versa
  • nucleoside analogs such as modified uridines
  • adenosine for all of thymidine, uridine, or modified uridine another example is cytosine and 5-methylcytosine, both of which have guanosine or modified guanosine as a complement.
  • sequence 5’-AXG where X is any modified uridine, such as pseudouridine, N1 -methyl pseudouridine, or 5-methoxyuridine, is considered 100% identical to AUG in that both are perfectly complementary to the same sequence (5’-CAU).
  • exemplary alignment algorithms are the Smith-Waterman and Needleman-Wunsch algorithms, which are well-known in the art.
  • Needleman- Wunsch algorithm with default settings of the Needleman-Wunsch algorithm interface provided by the EBI at the www.ebi.ac.uk web server is generally appropriate.
  • mRNA is used herein to refer to a polynucleotide that is RNA or modified RNA and comprises an open reading frame that can be translated into a polypeptide (i.e., can serve as a substrate for translation by a ribosome and amino-acylated tRNAs).
  • mRNA can comprise a phosphate-sugar backbone including ribose residues or analogs thereof, e.g., 2’-methoxy ribose residues.
  • the sugars of a nucleic acid phosphate-sugar backbone consist essentially of ribose residues, 2’-methoxy ribose residues, or a combination thereof.
  • mRNAs do not contain a substantial quantity of thymidine residues (e.g., 0 residues or fewer than 30, 20, 10, 5, 4, 3, or 2 thymidine residues; or less than 10%, 9%, 8%, 7%, 6%, 5%, 4%, 4%, 3%, 2%, 1%, 0.5%, 0.2%, or 0.1% thymidine content).
  • An mRNA can contain modified uridines at some or all of its uridine positions.
  • the“minimum uridine content’' of a given ORF is the undine content of an ORF that (a) uses a minimal uridine codon at every position and (b) encodes the same amino acid sequence as the given ORF.
  • the minimal uridine codon(s) for a given amino acid is the codon(s) with the fewest uridines (usually 0 or 1 except for a codon for phenylalanine, where the minimal uridine codon has 2 uridines). Modified uridine residues are considered equivalent to uridines for the purpose of evaluating minimum uridine content.
  • the“minimum uridine dinucleotide content” of a given ORF is the lowest possible uridine dinucleotide (UU) content of an ORF that (a) uses a minimal uridine codon (as discussed above) at every position and (b) encodes the same amino acid sequence as the given ORF.
  • the uridine dinucleotide (UU) content can be expressed in absolute terms as the enumeration of UU dinucleotides in an ORF or on a rate basis as the percentage of positions occupied by the uridines of uridine dinucleotides (for example, AUUAU would have a uridine dinucleotide content of 40% because 2 of 5 positions are occupied by the uridines of a uridine dinucleotide).
  • Modified uridine residues are considered equivalent to uridines for the purpose of evaluating minimum uridine dinucleotide content.
  • the“minimum adenine content” of a given open reading frame (ORF) is the adenine content of an ORF that (a) uses a minimal adenine codon at every position and (b) encodes the same amino acid sequence as the given ORF.
  • the minimal adenine codon(s) for a given amino acid is the codon(s) with the fewest adenines (usually 0 or 1 except for a codon for lysine and asparagine, where the minimal adenine codon has 2 adenines). Modified adenine residues are considered equivalent to adenines for the purpose of evaluating minimum adenine content.
  • the“minimum adenine dinucleotide content” of a given open reading frame (ORF) is the lowest possible adenine dinucleotide (AA) content of an ORF that (a) uses a minimal adenine codon (as discussed above) at every position and (b) encodes the same amino acid sequence as the given ORF.
  • adenine dinucleotide (AA) content can be expressed in absolute terms as the enumeration of AA dinucleotides in an ORF or on a rate basis as the percentage of positions occupied by the adenines of adenine dinucleotides (for example, UAAUA would have an adenine dinucleotide content of 40% because 2 of 5 positions are occupied by the adenines of an adenine dinucleotide).
  • Modified adenine residues are considered equivalent to adenines for the purpose of evaluating minimum adenine dinucleotide content.
  • TTR refers to transthyretin, which is the gene product of a TTR gene.
  • “amyloid” refers to abnormal aggregates of proteins or peptides that are normally soluble. Amyloids are insoluble, and amyloids can create proteinaceous deposits in organs and tissues. Proteins or peptides in amyloids may be misfolded into a form that allows many copies of the protein to stick together to form fibrils. While some forms of amyloid may have normal functions in the human body,“amyloids” as used herein refers to abnormal or pathologic aggregates of protein. Amyloids may comprise a single protein or peptide, such as TTR, or they may comprise multiple proteins or peptides, such as TTR and additional proteins.
  • Amyloid fibrils refers to insoluble fibers of amyloid that are resistant to degradation. Amyloid fibrils can produce symptoms based on the specific protein or peptide and the tissue and cell type in which it has aggregated.
  • Amyloidosis refers to a disease characterized by symptoms caused by deposition of amyloid or amyloid fibrils. Amyloidosis can affect numerous organs including the heart, kidney, liver, spleen, nervous system, and digestive track.
  • TTR amyloidosis or“amyloidosis associated with TTR” refers to amyloidosis associated with deposition of TTR.
  • “familial amyloid cardiomyopathy” or“FAC” refers to a hereditary transthyretin amyloidosis (ATTR) characterized primarily by restrictive cardiomyopathy. Congestive heart failure is common in FAC. Average age of onset is approximately 60-70 years of age, with an estimated life expectancy of 4-5 years after diagnosis.
  • FAP hereditary transthyretin amyloidosis
  • ARR hereditary transthyretin amyloidosis
  • FAP may also include cachexia, renal failure, and cardiac disease.
  • Average age of onset of FAP is approximately 30-50 years of age, with an estimated life expectancy of 5-15 after diagnosis.
  • “wild-type ATTR” and“ATTRwt” refer to ATTR not associated with a pathological TTR mutation such as T60A, V30M, V30A, V30G, V30L, VI 221, V122A, or V122(-).
  • ATTRwt has also been referred to as senile systemic amyloidosis. Onset typically occurs in men aged 60 or higher with the most common symptoms being congestive heart failure and abnormal heart rhythm such as atrial fibrillation. Additional symptoms include consequences of poor heart function such as shortness of breath, fatigue, dizziness, swelling (especially in the legs), nausea, angina, disrupted sleep, and weight loss.
  • ATTRwt A history of carpal tunnel syndrome indicates increased risk for ATTRwt and may in some cases be indicative of early-stage disease.
  • ATTRwt generally leads to decreasing heart function over time but can have a better prognosis than hereditary ATTR because wild-type TTR deposits accumulate more slowly.
  • Existing treatments are similar to other forms of ATTR (other than liver transplantation) and are generally directed to supporting or improving heart function, ranging from diuretics and limited fluid and salt intake to anticoagulants, and in severe cases, heart transplants. Nonetheless, like FAC, ATTRwt can result in death from heart failure, sometimes within 3-5 years of diagnosis.
  • ‘hereditary ATTR” refers to ATTR that is associated with a mutation in the sequence of the TTR gene.
  • Known mutations in the TTR gene associated with ATTR include those resulting in TTR with substitutions of T60A, V30M, V30A, V30G, V30L, VI 221, VI 22 A, or V122(-).
  • “indels” refer to insertion/deletion mutations consisting of a number of nucleotides that are either inserted or deleted at the site of double-stranded breaks (DSBs) in a target nucleic acid.
  • knockdown refers to a decrease in expression of a particular gene product (e.g., protein, mRNA, or both). Knockdown of a protein can be measured either by detecting protein secreted by tissue or population of cells (e.g., in serum or cell media) or by detecting total cellular amount of the protein from a tissue or cell population of interest. Methods for measuring knockdown of mRNA are known, and include sequencing of mRNA isolated from a tissue or cell population of interest.
  • “knockdown” may refer to some loss of expression of a particular gene product, for example a decrease in the amount of of mRNA transcribed or a decrease in the amount of protein expressed or secreted by a population of cells (including in vivo populations such as those found in tissues).
  • “knockout” refers to a loss of expression of a particular protein in a cell. Knockout can be measured either by detecting the amount of protein secretion from a tissue or population of cells (e.g., in serum or cell media) or by detecting total cellular amount of a protein a tissue or a population of cells. In some embodiments, methods are provided to“knockout” TTR in one or more cells (e.g., in a population of cells including in vivo populations such as those found in tissues). In some embodiments, a knockout is not the formation of mutant TTR protein, for example, created by indels, but rather the complete loss of expression of TTR protein in a cell.
  • mutant TTR refers to a gene product of TTR (i.e., the TTR protein) having a change in the amino acid sequence of TTR compared to the wildtype amino acid sequence of TTR.
  • the human wild-type TTR sequence is available at NCBI Gene ID: 7276; Ensembl: Ensembl: ENSG00000118271.
  • Mutants forms of TTR associated with ATTR include T60A, V30M, V30A, V30G, V30L, V122I, V122A, or V122(-).
  • “mutant 77// or“mutant TTR allele” refers to a TTR sequence having a change in the nucleotide sequence of TTR compared to the wildtype sequence (NCBI Gene ID: 7276; Ensembl: ENSG00000118271).
  • “ribonucleoprotein” (RNP) or“RNP complex” refers to a guide RNA together with an RNA-guided DNA binding agent, such as a Cas nuclease, e.g., a Cas cleavase, Cas nickase, or dCas DNA binding agent (e.g., Cas9).
  • the guide RNA guides the RNA-guided DNA binding agent such as Cas9 to a target sequence, and the guide RNA hybridizes with and the agent binds to the target sequence; in cases where the agent is a cleavase or nickase, binding can be followed by cleaving or nicking.
  • a“target sequence” refers to a sequence of nucleic acid in a target gene that has complementarity to the guide sequence of the gRNA. The interaction of the target sequence and the guide sequence directs an RNA-guided DNA binding agent to bind, and potentially nick or cleave (depending on the activity of the agent), within the target sequence.
  • treatment refers to any administration or application of a therapeutic for disease or disorder in a subject, and includes inhibiting the disease, arresting its development, relieving one or more symptoms of the disease, curing the disease, or preventing reoccurrence of one or more symptoms of the disease.
  • treatment of ATTR may comprise alleviating symptoms of ATTR.
  • pathological mutation refers to a mutation that renders a gene product, such as TTR, more likely to cause, promote, contribute to, or fail to inhibit the development of a disease, such as ATTR.
  • the term“lipid nanoparticle” refers to a particle that comprises a plurality of (i.e., more than one) lipid molecules physically associated with each other by intermolecular forces.
  • the LNPs may be, e.g., microspheres (including unilamellar and multilamellar vesicles, e.g.,“liposomes”— lamellar phase lipid bilayers that, in some embodiments, are substantially spherical— and, in more particular embodiments, can comprise an aqueous core, e.g., comprising a substantial portion of RNA molecules), a dispersed phase in an emulsion, micelles, or an internal phase in a suspension.
  • Emulsions, micelles, and suspensions may be suitable compositions for local and/or topical delivery. See also, e.g., WO2017173054A1 and WO2019067992A1, the contents of which are hereby incorporated by reference in their entirety. Any LNP known to those of skill in the art to be capable of delivering nucleotides to subjects may be utilized with the guide RNAs and the nucleic acid encoding an RNA-guided DNA binding agent described herein.
  • the terms“donor oligonucleotide” or“donor template” refers to a oligonucleotide that includes a desired nucleic acid sequence to be inserted into a target site (e.g., a target sit of a genomic DNA).
  • a donor oligonucleotide may be a single-strand oligonucleotide or a double-strand oligonucleotide.
  • a donor oligonucleotide may be delivered with a guide RNA and a nucleic acid sequence encoding an RNA-guided DNA binding agent (e.g., Cas9) via use of LNP or transfection.
  • NLS nuclear localization signal
  • nuclear localization sequence refers to an amino acid sequence which induces transport of molecules comprising such sequences or linked to such sequences into the nucleus of eukaryotic cells.
  • the nuclear localization signal may form part of the molecule to be transported.
  • the NLS may be linked to the remaining parts of the molecule by covalent bonds, hydrogen bonds or ionic interactions.
  • the phrase“pharmaceutically acceptable” means that which is useful in preparing a pharmaceutical composition that is generally non-toxic and is not biologically undesirable and that are not otherwise unacceptable for pharmaceutical use.
  • “infusion” refers to an active administration of one or more agents with an infusion time of, for example, between approximately 30 minutes and 12 hours.
  • the one or more agents comprise an LNP, e.g., comprising an mRNA encoding an RNA-guided DNA binding agent (such as Cas9) described herein and a gRNA described herein.
  • infusion prophylaxis refers to a regimen administered to a subject before treatment (e.g., comprising administration of an LNP) comprising one or more, or all, of an intravenous corticosteroid (e.g., dexamethasone 10 mg or equivalent), an antipyretic (e.g. oral acetaminophen or paracetamol 500 mg), an intravenous HI blocker (e.g., diphenhydramine 50 mg or equivalent), and an intravenous H2 blocker (e.g., ranitidine 50 mg or equivalent).
  • an oral corticosteroid e.g., dexamethasone 8 mg or equivalent.
  • the oral corticosteroid is administered 8-24 hours prior to treatment.
  • one or more, or all, of an intravenous corticosteroid e.g., dexamethasone 10 mg or equivalent
  • oral acetaminophen 500 mg e.g., an intravenous HI blocker (e.g., diphenhydramine 50 mg or equivalent)
  • an intravenous H2 blocker e.g., ranitidine 50 mg or equivalent
  • an HI blocker and/or an H2 blocker are administered orally.
  • RNA-guided DNA binding agent RNA-guided DNA binding agent
  • a corticosteroid, guide RNA, RNA-guided DNA binding agent, or polynucleotide encoding an RNA-guided DNA binding agent, such as any of those described herein, is also provided for use in a method disclosed herein.
  • the disclosed compositions such as LNP compositions comprise a guide RNA targeting TTR and, optionally, an RNA-guided DNA binding agent or a nucleic acid comprising an open reading frame encoding such an RNA- guided DNA binding agent (e.g., a CRISPR/Cas system).
  • the subjects treated with such methods and compositions may have wild-type or non-wild type TTR gene sequences, such as, for example, subjects with ATTR, which may be ATTR wt or a hereditary or familial form of ATTR.
  • the dosage, frequency and mode of administration of the corticosteroid, infusion prophylaxis, and the guide-RNA containing composition described herein can be controlled independently.
  • the corticosteroid is administered before the guide RNA- containing composition described herein. In some embodiments, the corticosteroid is administered after the guide RNA-containing composition described herein. In some embodiments, the corticosteroid is administered simultaneously with the guide RNA- containing composition described herein. In some embodiments, multiple doses of the corticosteroid are administered before or after the administration of the guide RNA- containing composition. In some embodiments, multiple doses of the guide RNA-containing composition are administered before or after the administration of the corticosteroid. In some embodiments, multiple doses of the corticosteroid and multiple doses of the the guide RNA- containing composition are administered.
  • the guide RNA-containing composition e.g. an LNP composition comprising a guide RNA and optionally a polynucleotide encoding an RNA-guided DNA binding agent, may be administered by infusion.
  • the composition is administered by infusion for longer than 30 minutes. In some embodiments, the composition is administered by 30 minute infusion. In some embodiments, the composition is administered by infusion for longer than 60 minutes. In some embodiments, the composition is administered by infusion for longer than 90 minutes. In some embodiments, the composition is administered by infusion for longer than 120 minutes, longer than 150 minutes, longer than 180 minutes, longer than 240 minutes, longer than 300 minutes, or longer than 360 minutes.
  • the composition is administered by infusion for at least 1 hour, at least 2 hours, at least 4 hours, at least 6 hours, at least 7 hours, at least 8 hours, at least 9 hours, at least 10 hours, at least 11 hours or at least 12 hours. In some embodiments, the composition is administered by infusion for 0.5-1.5 hours, 1.5-2.5 hours, 2.5-3.5 hours, 3.5-4.5 hours, 4.5- 5.5 hours, 5.5-6.5 hours, 6.5-7.5 hours, 7.5-8 5 hours, 8.5-9.5 hours, 9.5-10.5 hours, 10.5-11.5 hours, or 11.5-12.5 hours.
  • the composition is administered by infusion for about 60 minutes, about 90 minutes, about 120 minutes, about 150 minutes, about 180 minutes, about 240 minutes, about 300 minutes, or about 360 minutes. In some embodiments, the composition is administered by infusion for about 45-75 minutes, 75-105 minutes, 105- 135 minutes, 135-165 minutes, 165-195 minutes, 195-225 minutes, 225-255 minutes, 255- 285 minutes, 285-315 minutes, 315-345 minutes, or 345-375 minutes. In some embodiments, the composition is administered by infusion for about 1.5-6 hours.
  • the corticosteroid is administered about 5 minutes to within about 168 hours before the administration of the guide RNA-containing composition described herein. In some embodiments, the corticosteroid is administered about 5 minutes to within about 168 hours after the administration of the guide RNA-containing composition described herein. In some embodiments, the corticosteroid is administered 5 minutes, 10 minutes, 15 minutes, 30 minutes, 1 hour, 2 hours, 3 hours, 4 hours, 6 hours, 12 hours, 18 hours, 24 hours, 36 hours, 48 hours, 72 hours, 96 hours, 120 hours, 144 hours, 168 hours, or an amount of time in a range bounded by any two of the preceding values before the administration of the guide RNA-containing composition described herein.
  • the corticosteroid is administered 1 hour, 2 hours, 3 hours, 4 hours, 6 hours, 12 hours, 18 hours, 24 hours, 36 hours, 48 hours, 72 hours, 96 hours, 120 hours, 144 hours 168 hours, or an amount of time in a range bounded by any two of the preceding values after the administration of the guide RNA-containing composition described herein.
  • a corticosteroid is delivered about 8-24 hours before administration of the guide RNA-containing composition and an infusion prophylaxis is administered 1-2 hours prior to administration of the guide RNA-containing composition.
  • the corticosteroid may be administered with or at about the same time as the administration of the guide RNA- containing composition described herein.
  • a dose of corticosteroid may be administered as at least two subdoses administered separately at appropriate intervals.
  • the corticosteroid is administered at least two times before the administration of the guide RNA- containing composition described herein.
  • a dose of corticosteroid is administered at least two times after the administration of the guide RNA-containing composition described herein.
  • the corticosteroid is administered (e.g., before, with, and/or after the administration of the guide RNA-containing composition described herein) at an interval of 1 hour, 2 hours, 3 hours, 4 hours, 6 hours, 12 hours, 18 hours; 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 days; 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 weeks; or an amount of time in a range bounded by any two of the preceding values.
  • the corticosteroid is administered before the administration of the guide RNA-containing composition described herein at an interval of 1 hour, 2 hours, 3 hours, 4 hours, 6 hours, 12 hours, 18 hours; 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 days; 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 weeks; or an amount of time in a range bounded by any two of the preceding values.
  • the corticosteroid is administered after the administration of the guide RNA-containing composition described herein at an interval of 1 hour, 2 hours, 3 hours, 4 hours, 6 hours, 12 hours, 18 hours; 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 days; 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 weeks; or an amount of time in a range bounded by any two of the preceding values.
  • the corticosteroid is administered at least two times. In some embodiments, the corticosteroid is administered is administered at least three times. In some embodiments, the corticosteroid is administered at least four times. In some embodiments, the corticosteroid is administered is up to five, six, seven, eight, nine, or ten times.
  • a first dose may be oral and a second or subsequent dose may be by parenteral administration, e.g. infusion. Alternatively, a first dose may be parenteral and a second or subsequent dose may be by oral administration.
  • the corticosteroid is administered orally before intravenous administration of a guide RNA-containing composition described herein. In some embodiments, the corticosteroid is administered orally at or after intravenous administration of a guide RNA-containing composition described herein.
  • corticosteroid used in the disclosed methods and compositions is useful for treating subjects undergoing gene editing and/or therapy with gene editing compositions.
  • corticosteroids may be useful for reducing inflammation or immune responses to foreign RNAs (guide RNA or mRNAs encoding RNA-guided DNA binding agent).
  • the corticosteroid used in the disclosed methods and compositions may be any of those known in the art and/or commercially available from a number of sources.
  • an infusion prophylaxis is administered to a subject before the gene editing composition, e g., at a time 1-2 hours prior to the administration of the gene editing composition.
  • the infusion prophylaxis comprises one or more, or all, of an intravenous corticosteroid (e.g., dexamethasone 8-12 mg, such as 10 mg or equivalent, or any of the other corticosteroids described elsewhere herein), an antipyretic (e.g. oral acetaminophen (also called paracetamol) 500 mg), an HI blocker (e.g., diphenhydramine 50 mg or equivalent), an H2 blocker (e.g., ranitidine 50 mg or equivalent).
  • an intravenous corticosteroid e.g., dexamethasone 8-12 mg, such as 10 mg or equivalent, or any of the other corticosteroids described elsewhere herein
  • an antipyretic e.g. oral acetaminophen (also called paracetamol) 500 mg
  • the infusion prophylaxis comprises an intravenous corticosteroid (e.g., dexamethasone 8-12 mg, such as 10 mg or equivalent) and an antipyretic (e.g. oral acetaminophen or paracetamol 500 mg).
  • an intravenous corticosteroid e.g., dexamethasone 8-12 mg, such as 10 mg or equivalent
  • an antipyretic e.g. oral acetaminophen or paracetamol 500 mg.
  • the HI blocker e.g., diphenhydramine 50 mg or equivalent
  • H2 blocker e.g., ranitidine 50 mg or equivalent
  • the HI blocker e.g.,
  • diphenhydramine 50 mg or equivalent and/or H2 blocker (e.g., ranitidine 50 mg or equivalent) are administered intravenously.
  • H2 blocker e.g., ranitidine 50 mg or equivalent
  • an intravenous HI blocker and/or an intravenous H2 blocker is substituted with an equivalent, e.g., an orally
  • an oral corticosteroid e.g., dexamethasone 6-10 mg, such as 8 mg or equivalent, or any of the other corticosteroids described elsewhere herein
  • these dosages may be used, e.g., when the subject is a human, e.g., an adult human.
  • the infusion prophylaxis consists of the following: an intravenous
  • corticosteroid e.g., dexamethasone 10 mg or equivalent
  • oral acetaminophen 500 mg which may reduce pain and fever and/or inhibit COX enzymes and/or prostaglandins
  • intravenous HI blocker e.g., diphenhydramine 50 mg or equivalent
  • intravenous H2 blocker e.g., ranitidine 50 mg, or equivalent
  • oral dexamethasone such as in the amount of 8 mg or equivalent
  • the infusion prophylaxis may function to reduce adverse reactions associated with administering a guide RNA-containing composition, e.g. an LNP composition.
  • a guide RNA-containing composition e.g. an LNP composition.
  • the corticosteroid and/or infusion prophylaxis is administered as a required premedication prior to administering a guide RNA-containing composition, e.g. an LNP composition.
  • the corticosteroid is concurrently administered with one or more of acetaminophen, HI blocker, or H2 blocker. In some embodiments, the corticosteroid is concurrently administered with acetaminophen and HI blocker. In some embodiments, the the corticosteroid is concurrently administered with acetaminophen and H2 blocker. In some embodiments, the the corticosteroid is concurrently administered with HI blocker and H2 blocker. In some embodiments, an HI blocker and/or an H2 blocker are administered orally. In some embodiments, the composition is concurrently administered with acetaminophen, HI blocker, and H2 blocker.
  • the HI blocker is diphenhydramine, clemastine, cetirizine, terfenadine, doxylamine, mirtazapine, dexbrompheniramine, triprolidine, cyproheptadine, loratadine, hydroxyzine, cinnarizine, astemizole, azatadine, meclizine, carbinoxamine, epinastine, olopatadine, tripelennamine, brompheniramine, ketotifen, fexofenadine, desloratadine, azelastine, dimenhydrinate, promethazine, mequitazine, emedastine, levocabastine, chlorpheniramine, cyclizine, alimemazine, phenindamine, pheniramme, methapyrilene, flunarizine
  • the H2 blocker is ranitidine, nizatidine, cimetidine, or famotidine.
  • Equivalent corticosteroids and dosages can be found, for example, in Liu et a , Allergy, Asthma & Clinical Immunology, 2013, 9:30.
  • Equivalent antihistamines (HI blockers and/or H2 blockers) and dosages include the customary dose for a suitable member of the class, as known in the art.
  • At least two doses of the corticosteroid are administered before the administration of the composition.
  • a first dose of the corticosteroid is administered before a second dose of the corticosteroid is administered before the composition is administered.
  • a first dose of the corticosteroid is administered within 8-24 hours before the composition is administered.
  • a first dose of the corticosteroid is administered orally within 8-24 hours before the composition is administered.
  • a second dose of the corticosteroid is administered within 1-2 hours before the composition is administered.
  • a second dose of the corticosteroid is administered intravenously within 1-2 hours before the composition is administered.
  • a first dose of the corticosteroid is administered within 8-24 hours before the composition is administered and a second dose of the corticosteroid is administered within 1-2 hours before the composition is administered.
  • a first dose of the corticosteroid is administered orally and a second dose of the corticosteroid is administered intravenously before the composition is administered.
  • a first dose of the corticosteroid is administered orally within 8-24 hours before the composition is administered and a second dose of the corticosteroid is administered intravenously within 1-2 hours before the composition is administered.
  • a first dose of the corticosteroid is administered orally and a second dose of the corticosteroid is concurrently administered with one or more of acetaminophen, HI blocker, or H2 blocker before the composition is administered.
  • a first dose of the corticosteroid is administered orally and a second dose of the corticosteroid is concurrently administered with acetaminophen, HI blocker and H2 blocker before the composition is administered.
  • a first dose of the corticosteroid is administered orally within 8-24 hours before the composition is administered and a second dose of the corticosteroid is administered intravenously concurrently administered with one or more of acetaminophen, HI blocker or H2 blocker within 1-2 hours before the composition is administered.
  • a first dose of the corticosteroid is administered orally within 8-24 hours before the composition is administered and a second dose of the corticosteroid is administered intravenously concurrently administered with acetaminophen, HI blocker and H2 blocker within 1-2 hours before the composition is administered.
  • a first dose of the corticosteroid is administered orally within 8-24 hours before the composition is administered and a second dose of the corticosteroid is administered intravenously concurrently administered with acetaminophen, HI blocker and H2 blocker within 1-2 hours before the composition is administered, wherein the acetaminophen is administered orally and the HI blocker and H2 blocker are administered intravenously.
  • administering the corticosteroid improves tolerabilit of the composition comprising the guide RNA.
  • administering the corticosteroid may reduce the incidence or severity of one or more adverse effects, such as inflammation, nausea, vomiting, elevated ALT concentration in blood, hyperthermia, and/or hyperalgesia.
  • administering the corticosteroid reduces or inhibits production or activity of one or more interferons and/or inflammatory cytokines in response to the composition comprising the guide RNA.
  • Exemplary' corticosteroids include, but are not limited to, dexamethasone, betamethasone, prednisone, prednisolone, methylprednisolone, cortisone, hydrocortisone, triamcinolone, or ethamethasone, or a pharmaceutically acceptable salt thereof.
  • corticosteroids include, but are not limited to, dexamethasone, betamethasone, prednisone (Ray os®, Horizon Pharma), prednisolone (Pred Forte®, Allergan; OmnipredTM, Novartis) methylprednisolone (Medrol®, Pharmacia&Upjohn; Solu-Medrolx®, Pharmacia&Upjohn), cortisone, hydrocortisone, triamcinolone, ethamethasone, budesonide (ENTOCORT®, Perrigo Pharma Inti; Rhinocort®, Symbicort®, Astrazeneca Pharms; Ulceris®, Valeant Pharms), paramethasone, and deflazacort.
  • the corticosteroid is dexamethasone.
  • the corticosteroid used in the disclosed methods may be administered according to regimens known in the art, e.g., US FDA-approved regimens. Suitable modes of administration include, but are not limited to, enteral, topical, and parenteral administration.
  • parenteral administration and“administered parenterally” as used herein means modes of administration other than enteral (which includes oral) and topical administration, usually by injection, and includes, without limitation, intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intraspinal and intrastemal injection and infusion.
  • the corticosteroid is administered to the subject parenterally or by injection.
  • the corticosteroid is administered to the subject by intravenous injection. In some embodiments, the corticosteroid is administered to the subject orally or enterally. In some embodiments, the corticosteroid is administered to the subject topically.
  • the corticosteroid can be administered in an amount that ranges from about 0.75 mg to about 25 mg. In some embodiments, e.g., comprising administration to or for use in a human subject, the corticosteroid can be administered in an amount that ranges from about 0.01 - 0.5 mg/kg, such as 0.1 - 0.40 mg/kg or 0.25 - 0.40 mg/kg.
  • dexamethasone is administered orally in the amount of 20 mg or 25 mg 6 to 12 hours before intravenous administration of the guide RNA. In another example, dexamethasone is administered intravenously in the amount of 20 mg or 25 mg for 30 minutes 6 to 12 hour before intravenous administration of the guide RNA. In another example, dexamethasone is administered orally in the amount of 8-12 mg, such as 10 mg, 8 to 24 hours before infusion of the guide RNA composition. In another example,
  • dexamethasone is administered intravenously in the amount of 8-12 mg, such as 10 mg, 1-2 hour before infusion of the guide RNA composition.
  • dexamethasone is administered orally in the amount of 8-12 mg, such as 10 mg, 8 to 24 hours before infusion of the guide RNA composition and dexamethasone is administered intravenously in the amount of 8-12 mg, such as 10 mg, 1-2 hour before infusion of the guide RNA composition.
  • the corticosteroid is dexamethasone
  • dexamethasone is administered to the subject orally in the amount of 8 mg 8-24 hours before the composition is administered to the subject.
  • the corticosteroid is dexamethasone, and the dexamethasone is administered to the subject orally in the amount of 8 mg 8-24 hours before the composition is administered to the subject.
  • the corticosteroid is dexamethasone
  • dexamethasone is administered to the subject intravenously in the amount of 10 mg 1-2 hours before the composition is administered to the subject.
  • the composition is administered to the subject intravenously in the amount of 10 mg 1-2 hours before the composition is administered to the subject.
  • corticosteroid is dexamethasone, and the dexamethasone is administered to the subject intravenously in the amount of 10 mg 1-2 hours before the composition is administered to the subject.
  • the corticosteroid is dexamethasone, and a first dose of dexamethasone in the amount of 8 mg is administered to the subject orally 8-24 hours before the composition is administered to the subject, and a second dose of dexamethasone in the amount of 10 mg is administered to the subject intravenously 1-2 hours before the composition is administered to the subject.
  • the corticosteroid is dexamethasone, and a first dose of dexamethasone in the amount of 8 mg is administered to the subject orally 8-24 hours before the composition is administered to the subject, and a second dose of dexamethasone in the amount of 10 mg is administered to the subject intravenously 1-2 hours before the composition is administered to the subject, wherein the second dose of the corticosteroid is concurrently administered with one or more of acetaminophen, HI blocker or H2 blocker.
  • the corticosteroid is dexamethasone, and a first dose of dexamethasone in the amount of 8 mg is administered to the subject orally 8-24 hours before the composition is administered to the subject, and a second dose of dexamethasone in the amount of 10 mg is administered to the subject intravenously 1-2 hours before the composition is administered to the subject, wherein the second dose of the corticosteroid is concurrently administered with acetaminophen, HI blocker and H2 blocker.
  • the corticosteroid is dexamethasone
  • a first dose of dexamethasone in the amount of 8 mg is administered to the subject orally 8-24 hours before the composition is administered to the subject
  • a second dose of dexamethasone in the amount of 10 mg is administered to the subject intravenously, concurrently with oral administration of acetaminophen and intravenous administration of HI blocker and H2 blocker, 1-2 hours before the composition is administered to the subject.
  • the corticosteroid is dexamethasone, and a first dose of dexamethasone in the amount of 8 mg is administered to the subject orally 8-24 hours before the composition is administered to the subject, and a second dose of dexamethasone in the amount of 10 mg is administered to the subject intravenously, concurrently with oral administration of acetaminophen in the amount of 500 mg and intravenous administration of HI blocker in the amount of 50 mg and H2 blocker in the amount of 50 mg, 1-2 hours before the composition is administered to the subject.
  • corticosteroid is easily adjustable depending on the choice of particular corticosteroid.
  • gRNAs Guide RNA
  • the guide RNA used in the disclosed methods and compositions comprises a guide sequence targeting the TTR gene.
  • Exemplary guide sequences targeting the TTR gene are shown in Table 1 at SEQ ID Nos: 5-82.
  • Table 1 TTR targeted guide sequences, nomenclature, chromosomal coordinates, and sequence.
  • Each of the Guide Sequences above may further comprise additional nucleotides to form a crRNA, e.g., with the following exemplary nucleotide sequence following the Guide Sequence at its 3’ end: GUUUUAGAGCUAUGCUGUUUUG (SEQ ID NO: 126).
  • the above Guide Sequences may further comprise additional nucleotides to form a sgRNA, e.g., with the following exemplary nucleotide sequence following the 3’ end of the Guide Sequence:
  • the sgRNA is modified.
  • the sgRNA comprises the modification pattern shown below in SEQ ID NO: 3, where N is any natural or non-natural nucleotide, and where the totality 7 of the N’s comprise a guide sequence as described herein and the modified sgRNA comprises the following sequence:
  • N may be any natural or non-natural nucleotide.
  • SEQ ID NO: 3 where“N” may be any natural or non-natural nucleotide.
  • N may be any natural or non-natural nucleotide.
  • SEQ ID NO: 3 encompassed herein is SEQ ID NO: 3, where the N’s are replaced with any of the guide sequences disclosed herein.
  • any one of the sequences recited in Table 2 is
  • the gRNA comprises a guide sequence that direct an RNA- guided DNA binding agent, which can be a nuclease (e.g., a Cas nuclease such as Cas9), to a target DNA sequence in TTR.
  • the gRNA may comprise a crRNA comprising a guide sequence shown in Table 1.
  • the gRNA may comprise a crRNA comprising 17, 18, 19, or 20 contiguous nucleotides of a guide sequence shown in Table 1.
  • the gRNA comprises a crRNA comprising a sequence with about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to at least 17, 18, 19, or 20 contiguous nucleotides of a guide sequence shown in Table 1.
  • the gRNA comprises a crRNA comprising a sequence with about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a guide sequence shown in Table 1.
  • the gRNA may further comprise a trRNA.
  • the crRNA and trRNA may be associated as a single RNA (sgRNA), or may be on separate RNAs (dgRNA).
  • sgRNA single RNA
  • dgRNA separate RNAs
  • the crRNA and trRNA components may be covalently linked, e.g., via a phosphodiester bond or other covalent bond.
  • the guide RNA may comprise two RNA molecules as a“dual guide RNA” or“dgRNA”.
  • the dgRNA comprises a first RNA molecule comprising a crRNA comprising, e.g., a guide sequence shown in Table 1, and a second RNA molecule comprising a trRNA.
  • the first and second RNA molecules may not be covalently linked, but may form a RNA duplex via the base pairing between portions of the crRNA and the trRNA.
  • the guide RNA may comprise a single RNA molecule as a“single guide RNA” or“sgRNA”.
  • the sgRNA may comprise a crRNA (or a portion thereof) comprising a guide sequence shown in Table 1 covalently linked to a trRNA.
  • the sgRNA may comprise 17, 18, 19, or 20 contiguous nucleotides of a guide sequence shown in Table 1.
  • the crRNA and the trRNA are covalently linked via a linker.
  • the sgRNA forms a stem- loop structure via the base pairing between portions of the crRNA and the trRNA.
  • the crRNA and the trRNA are covalently linked via one or more bonds that are not a phosphodiester bond.
  • the trRNA may comprise all or a portion of a trRNA sequence derived from a naturally-occurring CRISPR/Cas system.
  • the trRNA comprises a truncated or modified wild type trRNA. The length of the trRNA depends on the CRISPR/Cas system used.
  • the trRNA comprises or consists of
  • the trRNA may comprise certain secondary structures, such as, for example, one or more hairpin or stem-loop structures, or one or more bulge structures.
  • the composition comprises one or more guide RNAs comprising a guide sequence selected from SEQ ID NOs: 5-82.
  • the composition comprises a gRNA that comprises a guide sequence that is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to a sequence selected from SEQ ID NOs: 5-82.
  • the composition comprises one or more guide RNAs comprising a guide sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82.
  • the composition comprises a gRNA that comprises a guide sequence that is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to a sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82.
  • sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82 is SEQ ID NOs: 5, 6, 7, 8, 9, 12, 13, 14, 15, 16, 17, 22, 23, 27, 29, 30, 35, 36, 37, 38, 55, 61, 63, 65, 66, 68, or 69.
  • sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82 is SEQ ID NO: 5, 6, 9, 13, 14, 15, 16, 17, 22, 23, 27, 30, 35, 36, 37, 38, 55, 63, 65, 66, 68, or 69.
  • the composition comprises at least one, e.g., at least two gRNAs comprising guide sequences selected from any two or more of the guide sequences of SEQ ID NOs: 5-82.
  • the composition comprises at least two gRNAs that each comprise a guide sequence at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to a sequence selected from SEQ ID NOs: 5-82.
  • the composition comprises at least one, e.g., at least two gRNAs comprising guide sequences selected from any two or more of the guide sequences selected from SEQ ID NOs: 5-72, 74-78, and 80-82.
  • the composition comprises at least two gRNAs that each comprise a guide sequence at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to any of the sequences selected from SEQ ID NOs: 5-72, 74-78, and 80-82.
  • sequences selected from SEQ ID NOs: 5-72, 74-78, and 80-82 comprise a sequence, or two sequences, selected from SEQ ID NOs: 5, 6, 7, 8, 9, 12, 13, 14, 15, 16, 17, 22, 23, 27, 29, 30, 35, 36, 37, 38, 55, 61, 63, 65, 66, 68, or 69.
  • sequence selected from SEQ ID NOs: 5-72, 74- 78, and 80-82 comprise a sequence, or two sequences, selected from SEQ ID NO: 5, 6, 9, 13, 14, 15, 16, 17, 22, 23, 27, 30, 35, 36, 37, 38, 55, 63, 65, 66, 68, or 69.
  • the gRNA is a sgRNA comprising any one of the sequences shown in Table 2 (SEQ ID Nos. 87-124). In some embodiments, the gRNA is a sgRNA comprising any one of the sequences shown in Table 2 (SEQ ID Nos. 87-124, but without the modifications as shown (i.e., unmodified SEQ ID Nos. 87-124). In some embodiments, the sgRNA comprises a sequence that is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to any of the nucleic acids of SEQ ID Nos. 87-124.
  • the sgRNA comprises a sequence that is at least 99%, 98%, 97%,
  • the sgRNA comprises any one of the guide sequences shown in Table 1 in place of the guide sequences shown in the sgRNA sequences of Table 2 at SEQ ID Nos: 87-124, with or without the modifications.
  • the gRNA is a sgRNA comprising any one of SEQ ID Nos. 87-113, 115-120, or 122-124. In some embodiments, the gRNA is a sgRNA comprising any one of SEQ ID Nos. 87-113, 115-120, or 122-124, but without the modifications as shown in Table 2 (i.e., unmodified SEQ ID Nos. 87-113, 115-120, or 122-124). In some embodiments, the sgRNA comprises a sequence that is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%,
  • the sgRNA comprises a sequence that is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to any of the nucleic acids of SEQ ID Nos. 87-113, 115-120, or 122-124, but without the modifications as shown (i.e., unmodified SEQ ID Nos. 87-113, 115-120, or 122-124).
  • the sgRNA comprises any one of the guide sequences shown in Table 1 in place of the guide sequences shown in the sgRNA sequences of Table 2 at SEQ ID Nos: 87-113, 115-120, or 122-124, with or without the modifications.
  • the guide RNAs provided herein can be useful for recognizing (e.g., hybridizing to) a target sequence in the TTR gene.
  • the TTR target sequence may be recognized and cleaved by a provided Cas cleavase comprising a guide RNA.
  • an RNA- guided DNA binding agent such as a Cas cleavase
  • the selection of the one or more guide RNAs is determined based on target sequences within the TTR gene.
  • mutations e.g., frameshift mutations resulting from indels occurring as a result of a nuclease-mediated DSB
  • a gRNA complementary or having complementarity to a target sequence within TTR is used to direct the RNA-guided DNA binding agent to a particular location in the TTR gene.
  • gRNAs are designed to have guide sequences that are complementary or have complementarity to target sequences in exon 1, exon 2, exon 3, or exon 4 of TTR.
  • the guide sequence is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to a target sequence present in the human TTR gene.
  • the target sequence may be complementary to the guide sequence of the guide RNA.
  • the degree of complementarity or identity between a guide sequence of a guide RNA and its corresponding target sequence may be at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%.
  • the target sequence and the guide sequence of the gRNA may be 100% complementary or identical.
  • the target sequence and the guide sequence of the gRNA may contain at least one mismatch.
  • the target sequence and the guide sequence of the gRNA may contain 1, 2, 3, or 4 mismatches, where the total length of the guide sequence is 20.
  • the target sequence and the guide sequence of the gRNA may contain 1-4 mismatches where the guide sequence is 20 nucleotides.
  • the gRNA is chemically modified.
  • a gRNA comprising one or more modified nucleosides or nucleotides is called a“modified” gRNA or“chemically modified” gRNA, to describe the presence of one or more non-naturally and/or naturally occurring components or configurations that are used instead of or in addition to the canonical A, G, C, and U residues.
  • a modified gRNA is synthesized with a non-canonical nucleoside or nucleotide, is here called“modified.”
  • Modified nucleosides and nucleotides can include one or more of: (i) alteration, e.g., replacement, of one or both of the non-linking phosphate oxygens and/or of one or more of the linking phosphate oxygens in the phosphodiester backbone linkage (an exemplary backbone modification); (ii) alteration, e.g., replacement, of a constituent of the ribose sugar, e.g, of the 2' hydroxyl on the ribose sugar (an exemplary sugar modification); (iii) wholesale replacement of the phosphate moiety with“dephospho” linkers (an exemplary backbone modification); (iv) modification or replacement of a naturally occurring nucleobase, including with a non-canonical nucleobase (an exemplary base modification); (v) replacement or modification of the ribo
  • modified gRNAs comprising nucleosides and nucleotides (collectively“residues”) that can have two, three, four, or more modifications.
  • a modified residue can have a modified sugar and a modified nucleobase.
  • every base of a gRNA is modified, e.g., all bases have a modified phosphate group, such as a phosphorothioate group.
  • all, or substantially all, of the phosphate groups of an gRNA molecule are replaced with phosphorothioate groups.
  • modified gRNAs comprise at least one modified residue at or near the 5' end of the RNA.
  • modified gRNAs comprise at least one modified residue at or near the 3' end of the RNA.
  • the gRNA comprises one, two, three or more modified residues.
  • at least 5% e.g, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100%
  • modified nucleosides or nucleotides are modified nucleosides or nucleotides.
  • Unmodified nucleic acids can be prone to degradation by, e.g. , intracellular nucleases or those found in serum.
  • nucleases can hydrolyze nucleic acid phosphodiester bonds.
  • the gRNAs described herein can contain one or more modified nucleosides or nucleotides, e.g. , to introduce stability toward intracellular or semm-based nucleases.
  • the modified gRNA molecules described herein can exhibit a reduced innate immune response when introduced into a population of cells, both in vivo and ex vivo.
  • the term“innate immune response” includes a cellular response to exogenous nucleic acids, including single stranded nucleic acids, which involves the induction of cytokine expression and release, particularly the interferons, and cell death.
  • the phosphate group of a modified residue can be modified by replacing one or more of the oxygens with a different substituent.
  • the modified residue e.g, modified residue present in a modified nucleic acid
  • the backbone modification of the phosphate backbone can include alterations that result in either an uncharged linker or a charged linker with unsymmetrical charge distribution.
  • modified phosphate groups include, phosphorothioate,
  • the phosphorous atom in an unmodified phosphate group is achiral. However, replacement of one of the nonbridging oxygens with one of the above atoms or groups of atoms can render the phosphorous atom chiral.
  • the stereogemc phosphorous atom can possess either the“R” configuration (herein Rp) or the“S” configuration (herein Sp).
  • the backbone can also be modified by replacement of a bridging oxygen, (i.e., the oxygen that links the phosphate to the nucleoside), with nitrogen (bridged phosphoroamidates), sulfur (bridged phosphorothioates) and carbon (bridged methylenephosphonates).
  • a bridging oxygen i.e., the oxygen that links the phosphate to the nucleoside
  • nitrogen bridged phosphoroamidates
  • sulfur bridged phosphorothioates
  • carbon bridged methylenephosphonates
  • the phosphate group can be replaced by non-phosphorus containing connectors in certain backbone modifications.
  • the charged phosphate group can be replaced by a neutral moiety.
  • moieties which can replace the phosphate group can include, without limitation, e.g., methyl phosphonate, hydroxylamino, siloxane, carbonate, carboxymethyl, carbamate, amide, thioether, ethylene oxide linker, sulfonate, sulfonamide, thioformacetal, formacetal, oxime, methyleneimino, methylenemethylimino, methylenehydrazo, methylenedimethylhydrazo and methyleneoxymethylimmo.
  • Scaffolds that can mimic nucleic acids can also be constructed wherein the phosphate linker and ribose sugar are replaced by nuclease resistant nucleoside or nucleotide surrogates. Such modifications may comprise backbone and sugar modifications.
  • the nucleobases can be tethered by a surrogate backbone. Examples can include, without limitation, the morpholino, cyclobutyl, pyrrolidine and peptide nucleic acid (PNA) nucleoside surrogates.
  • the modified nucleosides and modified nucleotides can include one or more modifications to the sugar group, i.e. at sugar modification.
  • the 2' hydroxyl group (OH) can be modified, e.g. replaced with a number of different“oxy” or deoxy " substituents.
  • modifications to the 2' hydroxyl group can enhance the stability of the nucleic acid since the hydroxyl can no longer be deprotonated to form a 2'- alkoxide ion.
  • Examples of 2' hydroxyl group modifications can include alkoxy or aryloxy (OR, wherein“R” can be, e.g., alkyl, cycloalkyl, aryl, aralkyl, heteroaryl or a sugar);
  • polyethyleneglycols PEG
  • R can be, e.g., H or optionally substituted alkyl
  • n can be an integer from 0 to 20 (e.g, from 0 to 4, from 0 to 8, from 0 to 10, from 0 to 16, from 1 to 4, from 1 to 8, from 1 to 10, from 1 to 16, from 1 to 20, from 2 to 4, from 2 to 8, from 2 to 10, from 2 to 16, from 2 to 20, from 4 to 8, from 4 to 10, from 4 to 16, and from 4 to 20).
  • the 2' hydroxyl group modification can be 2'-0-Me.
  • the 2' hydroxyl group modification can be a 2'-fluoro modification, which replaces the 2' hydroxyl group with a fluoride.
  • the 2' hydroxyl group modification can include 'locked” nucleic acids (LNA) in which the 2' hydroxyl can be connected, e.g., by a Ci-6 alkylene or Ci-6 heteroalkylene bridge, to the 4' carbon of the same ribose sugar, where exemplary bridges can include methylene, propylene, ether, or amino bridges; O-amino (wherein amino can be, e.g, N3 ⁇ 4 alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, or diheteroarylamino, ethylenediamine, or polyamino) and aminoalkoxy, 0(CH2)n-amino, (wherein amino can be, e.g, NH2; alkyla
  • the 2' hydroxyl group modification can included“unlocked” nucleic acids (UNA) in which the ribose ring lacks the C2'-C3' bond.
  • the 2' hydroxyl group modification can include the methoxy ethyl group (MOE), (OCH2CH2OCH3, e.g., a PEG derivative).
  • MOE methoxy ethyl group
  • Deoxy 2' modifications can include hydrogen (i.e.
  • deoxyribose sugars e.g., at the overhang portions of partially dsRNA
  • halo e.g., bromo, chloro, fluoro, or iodo
  • amino wherein amino can be, e.g, Nth; alkylamino, dialk lamino, heterocyclyl, aiydamino, diarylamino, heteroarylamino, diheteroarylamino, or amino acid);
  • amino can be, e.g, as described herein), - NHC(0)R (wherein R can be, e.g, alky l, cycloalkyl, aryl, aralkyl, heteroaryl or sugar), cyano; mercapto; alkyl-thio-alkyl; thioalkoxy; and alkyl, cycloalkyl, aryl, alkenyl and alkynyl, which may be optionally substituted with e.g, an amino as described herein.
  • the sugar modification can comprise a sugar group which may also contain one or more carbons that possess the opposite stereochemical configuration than that of the corresponding carbon in ribose.
  • a modified nucleic acid can include nucleotides containing e.g. , arabinose, as the sugar.
  • the modified nucleic acids can also include abasic sugars. These abasic sugars can also be further modified at one or more of the constituent sugar atoms.
  • the modified nucleic acids can also include one or more sugars that are in the L form, e.g. L- nucleosides.
  • the modified nucleosides and modified nucleotides described herein, which can be incorporated into a modified nucleic acid, can include a modified base, also called a nucleobase.
  • a modified base also called a nucleobase.
  • nucleobases include, but are not limited to, adenine (A), guanine (G), cytosine (C), and uracil (U). These nucleobases can be modified or wholly replaced to provide modified residues that can be incorporated into modified nucleic acids.
  • the nucleobase of the nucleotide can be independently selected from a purine, a pyrimidine, a purine analog, or pyrimidine analog.
  • the nucleobase can include, for example, naturally-occurring and synthetic derivatives of a base.
  • each of the crRNA and the tracr RNA can contain modifications. Such modifications may be at one or both ends of the crRNA and/or tracr RNA.
  • modifications may be at one or both ends of the crRNA and/or tracr RNA.
  • one or more residues at one or both ends of the sgRNA may be chemically modified, or the entire sgRNA may be chemically modified.
  • Certain embodiments comprise a 5' end modification.
  • Certain embodiments comprise a 3' end modification.
  • one or more or all of the nucleotides in single stranded overhang of a guide RNA molecule are deoxynucleotides.
  • the guide RNAs disclosed herein comprise one of the modification patterns disclosed in US 62/431,756, filed December 8, 2016, titled “Chemically Modified Guide RNAs. the contents of which are hereby incorporated by reference in their entirety.
  • the invention comprises a gRNA comprising one or more modifications.
  • the modification comprises a 2'-0-methyl (2'-0-Me) modified nucleotide.
  • the modification comprises a phosphorothioate (PS) bond between nucleotides.
  • the terms“mA,”“mC,”“mU,” or“mG” may be used to denote a nucleotide that has been modified with 2’-0-Me.
  • nucleotide sugar rings Another chemical modification that has been shown to influence nucleotide sugar rings is halogen substitution.
  • 2 -fluoro (2 -F) substitution on nucleotide sugar rings can increase oligonucleotide binding affinity and nuclease stability.
  • the terms“fA,”“fC,”“fU,” or“fG” may be used to denote a nucleotide that has been substituted with 2’-F.
  • Phosphorothioate (PS) linkage or bond refers to a bond where a sulfur is substituted for one nonbridging phosphate oxygen in a phosphodiester linkage, for example in the bonds between nucleotides bases.
  • PS Phosphorothioate
  • the modified oligonucleotides may also be referred to as S-oligos.
  • A“*” may be used to depict a PS modification.
  • the terms A*, C*, LI* or G* may be used to denote a nucleotide that is linked to the next (e.g., 3’) nucleotide with a PS bond.
  • mA* “mA*,”“mC*,”“mU*,” or ” mG* “ may be used to denote a nucleotide that has been substituted with 2’-0-Me and that is linked to the next (e.g., 3’) nucleotide with a PS bond.
  • Abasic nucleotides refer to those which lack nitrogenous bases.
  • the figure below depicts an oligonucleotide with an abasic (also known as apurinic) site that lacks a base:
  • Inverted bases refer to those with linkages that are inverted from the normal 5’ to 3’ linkage (i.e., either a 5' to 5’ linkage or a 3’ to 3’ linkage). For example:
  • An abasic nucleotide can be attached with an inverted linkage.
  • an abasic nucleotide may be attached to the terminal 5’ nucleotide via a 5’ to 5’ linkage, or an abasic nucleotide may be attached to the terminal 3’ nucleotide via a 3’ to 3’ linkage.
  • An inverted abasic nucleotide at either the terminal 5’ or 3’ nucleotide may also be called an inverted abasic end cap.
  • one or more of the first three, four, or five nucleotides at the 5' terminus, and one or more of the last three, four, or five nucleotides at the 3' terminus are modified.
  • the modification is a 2’-0-Me, 2’-F, inverted abasic nucleotide, PS bond, or other nucleotide modification well known in the art to increase stability and/or performance.
  • the first four nucleotides at the 5' terminus, and the last four nucleotides at the 3' terminus are linked with phosphorothioate (PS) bonds.
  • the first three nucleotides at the 5' terminus, and the last three nucleotides at the 3' terminus comprise a 2'-0-methyl (2'-0-Me) modified nucleotide. In some embodiments, the first three nucleotides at the 5' terminus, and the last three nucleotides at the 3' terminus comprise a 2'-fluoro (2'-F) modified nucleotide. In some embodiments, the first three nucleotides at the 5' terminus, and the last three nucleotides at the 3' terminus comprise an inverted abasic nucleotide.
  • the guide RNA comprises a modified sgRNA.
  • the sgRNA comprises the modification pattern shown in SEQ ID No: 3, where N is any natural or non-natural nucleotide, and where the totality of the N’s comprise a guide sequence that directs a nuclease to a target sequence.
  • the guide RNA comprises a sgRNA shown in any one of SEQ ID No: 87-124. In some embodiments, the guide RNA comprises a sgRNA comprising any one of the guide sequences of SEQ ID No: 5-82 and the nucleotides of SEQ ID No: 125, wherein the nucleotides of SEQ ID No: 125 are on the 3’ end of the guide sequence, and wherein the guide sequence may be modified as shown in SEQ ID No: 3.
  • the guide RNA comprises a sgRNA comprising a guide sequence selected from SEQ ID Nos: 5-72, 74-78, and 80-82 and nucleotides 21-100 of SEQ ID No: 3, wherein the nucleotides of SEQ ID No: 3 are on the 3 ' end of the guide sequence, and wherein the guide sequence may be modified as shown in SEQ ID No: 3.
  • the RNA-guided DNA-binding agent is a Class 2 Cas nuclease.
  • the RNA-guided DNA-binding agent has cleavase activity, which can also be referred to as double-strand endonuclease activity.
  • the RNA-guided DNA-binding agent comprises a Cas nuclease, such as a Class 2 Cas nuclease (which may be, e.g., a Cas nuclease of Type II, V, or VI).
  • Class 2 Cas nucleases include, for example, Cas9, Cpfl, C2cl, C2c2, and C2c3 proteins and modifications thereof.
  • Cas9 nucleases examples include those of the type II CRISPR systems of S. pyogenes, S. aureus, and other prokaryotes (see, e.g., the list in the next paragraph), and modified (e.g., engineered or mutant) versions thereof. See, e.g., US2016/0312198 Al; US 2016/0312199 A1.
  • Other examples of Cas nucleases include a Csm or Cmr complex of a type III CRISPR system or the Cas 10, Csml, or Cmr2 subunit thereof; and a Cascade complex of a type I CRISPR system, or the Cas3 subunit thereof.
  • the Cas nuclease may be from a Type-IIA, Type-IIB, or Type-IIC system.
  • a Type-IIA Type-IIB
  • Type-IIC Type-IIC system
  • the RNA-guided DNA binding agent is a Cas cleavase, e.g. a Cas9 cleavase.
  • the RNA-guided DNA binding agent is a Cas nickase, e.g. a Cas9 nickase.
  • the RNA-guided DNA binding agent is a Cas9 nuclease, such as a cleavase or nickase.
  • the RNA- guided DNA binding agent is an S. pyogenes Cas9 nuclease, e.g. a cleavase.
  • Non-limiting exemplary species that the Cas nuclease can be derived from include Streptococcus pyogenes, Streptococcus thermophilus, Streptococcus sp., Staphylococcus aureus, Listeria innocua, Lactobacillus gasseri, Francisella novicida, Wolinella
  • succinogenes Sutterella wadsworthensis, Gammaproteobacterium, Neisseria meningitidis, Campylobacter jejuni, Pasteurella multocida, Fibrobacter succinogene, Rhodospirillum rubrum, Nocardiopsis rougei, Streptomyces pristinaespiralis, Streptomyces viridochromogenes, Streptomyces viridochromogenes, Streptosporangium roseum,
  • Streptosporangium roseum Alicyclobacillus acidocaldarius, Bacillus pseudomycoides, Bacillus selenitireducens, Exiguobacterium sibiricum, Lactobacillus delbrueckii,
  • Lactobacillus salivarius Lactobacillus buchneri, Treponema denticola, Microscilla marina, Burkholderiales bacterium, Polar omonas naphthalenivorans, Polar omonas sp.,
  • Crocosphaera watsonii Cyanothece sp., Microcystis aeruginosa, Synechococcus sp., Acetohalobium arabaticum, Ammonifex degensii, Caldic effetosiruptor becscii, Candidatus Desulforudis, Clostridium botulinum, Clostridium difficile, Finegoldia magna,
  • the Cas nuclease is the Cas9 nuclease from Streptococcus pyogenes. In some embodiments, the Cas nuclease is the Cas9 nuclease from Streptococcus thermophilus. In some embodiments, the Cas nuclease is the Cas9 nuclease from Neisseria meningitidis. In some embodiments, the Cas nuclease is the Cas9 nuclease is from
  • the Cas nuclease is the Cpfl nuclease from Francisella novicida. In some embodiments, the Cas nuclease is the Cpfl nuclease from Acidaminococcus sp. In some embodiments, the Cas nuclease is the Cpfl nuclease from Lachnospiraceae bacterium ND2006. In further embodiments, the Cas nuclease is the Cpfl nuclease from Francisella tularensis, Lachnospiraceae bacterium, Butyrivibrio
  • proteoclasticus Peregrinibacteria bacterium, Parcubacteria bacterium, Smithella
  • Acidaminococcus Candidatus Methanoplasma termitum, Eubacterium eligens, Moraxella bovoculi, Leptospira inadai, Porphyromonas crevioricanis, Prevotella disiens, or
  • the Cas nuclease is a Cpfl nuclease from an Acidaminococcus or Lachnospiraceae.
  • Wild type Cas9 has two nuclease domains: RuvC and HNH.
  • the RuvC domain cleaves the non-target DNA strand
  • the HNH domain cleaves the target strand of DNA.
  • the Cas9 nuclease comprises more than one RuvC domain and/or more than one HNH domain.
  • the Cas9 nuclease is a wild type Cas9.
  • the Cas9 is capable of inducing a double strand break in target DNA.
  • the Cas nuclease may cleave dsDNA, it may cleave one strand of dsDNA, or it may not have DNA cleavase or nickase activity.
  • An exemplary Cas9 amino acid sequence is provided as SEQ ID NO: 203.
  • An exemplary Cas9 mRNA ORE sequence, which includes start and stop codons, is provided as SEQ ID NO: 311.
  • An exemplary Cas9 mRNA coding sequence, suitable for inclusion in a fusion protein, is provided as SEQ ID NO: 210.
  • chimeric Cas nucleases are used, where one domain or region of the protein is replaced by a portion of a different protein.
  • a Cas nuclease domain may be replaced with a domain from a different nuclease such as Fokl.
  • a Cas nuclease may be a modified nuclease.
  • the Cas nuclease may be from a Type-I CRISPR/Cas system.
  • the Cas nuclease may be a component of the Cascade complex of a Type-I CRISPR/Cas system.
  • the Cas nuclease may be a Cas3 protein.
  • the Cas nuclease may be from a Type-III CRISPR/Cas system.
  • the Cas nuclease may have an RNA cleavage activity.
  • the RNA-guided DNA-binding agent has single-strand nickase activity, i.e., can cut one DNA strand to produce a single-strand break, also known as a“nick.”
  • the RNA-guided DNA-binding agent comprises a Cas nickase.
  • a nickase is an enzyme that creates a nick in dsDNA, i.e., cuts one strand but not the other of the DNA double helix.
  • a Cas nickase is a version of a Cas nuclease (e.g., a Cas nuclease discussed above) in which an endonucleolytic active site is inactivated, e.g., by one or more alterations (e.g., point mutations) in a catalytic domain. See, e.g., US Pat. No. 8,889,356 for discussion of Cas nickases and exemplary catalytic domain alterations.
  • a Cas nickase such as a Cas9 nickase has an inactivated RuvC or HNH domain.
  • An exemplary Cas9 nickase amino acid sequence is provided as SEQ ID NO: 206.
  • An exemplary Cas9 nickase mRNA ORE sequence, which includes start and stop codons, is provided as SEQ ID NO: 207.
  • An exemplary Cas9 nickase mRNA coding sequence, suitable for inclusion in a fusion protein, is provided as SEQ ID NO: 211.
  • the RNA-guided DNA-binding agent is modified to contain only one functional nuclease domain.
  • the agent protein may be modified such that one of the nuclease domains is mutated or fully or partially deleted to reduce its nucleic acid cleavage activity 7 .
  • a nickase is used having a RuvC domain with reduced activity.
  • a nickase is used having an inactive RuvC domain.
  • a nickase is used having an HNH domain with reduced activity.
  • a nickase is used having an inactive HNH domain.
  • a conserved amino acid within a Cas protein nuclease domain is substituted to reduce or alter nuclease activity.
  • a Cas nuclease may comprise an amino acid substitution in the RuvC or RuvC-like nuclease domain.
  • Exemplary amino acid substitutions in the RuvC or RuvC-like nuclease domain include D10A (based on the S. pyogenes Cas9 protein). See, e.g.. Zetsche et al. (2015) Cell Oct 22: 163(3): 759-771.
  • the Cas nuclease may comprise an amino acid substitution in the HNH or HNH-like nuclease domain.
  • Exemplary amino acid substitutions in the HNH or HNH-like nuclease domain include E762A, H840A, N863A, H983A, and D986A (based on the S. pyogenes Cas9 protein). See, e.g., Zetsche et al. (2015). Further exemplary amino acid substitutions include D917A, E1006A, and D1255A (based on th e Francisella novicida U112 Cpfl (FnCpfl) sequence (UniProtKB - A0Q7Q2
  • a nucleic acid encoding a nickase is provided in combination with a pair of guide RNAs that are complementary to the sense and antisense strands of the target sequence, respectively.
  • the guide RNAs direct the nickase to a target sequence and introduce a DSB by generating a nick on opposite strands of the target sequence (i.e., double nicking).
  • double nicking may improve specificity and reduce off-target effects.
  • a nickase is used together with two separate guide RNAs targeting opposite strands of DNA to produce a double nick in the target DNA.
  • a nickase is used together with two separate guide RNAs that are selected to be in close proximity to produce a double nick in the target DNA.
  • the RNA-guided DNA-binding agent lacks cleavase and nickase activity.
  • the RNA-guided DNA-binding agent comprises a dCas DNA-binding polypeptide.
  • a dCas polypeptide has DNA-binding activity while essentially lacking catalytic (cleavase/nickase) activity.
  • the dCas polypeptide is a dCas9 polypeptide.
  • the RNA-guided DNA-binding agent lacking cleavase and nickase activity or the dCas DNA-binding polypeptide is a version of a Cas nuclease (e.g., a Cas nuclease discussed above) in which its endonucleolytic active sites are inactivated, e.g., by one or more alterations (e.g., point mutations) in its catalytic domains. See, e.g., US 2014/0186958 Al; US 2015/0166980 Al.
  • An exemplary dCas9 amino acid sequence is provided as SEQ ID NO: 208.
  • An exemplary dCas9 mRNA ORF sequence which includes start and stop codons, is provided as SEQ ID NO: 209.
  • the RNA-guided DNA-binding agent e.g. a Cas9 nuclease such as an S. pyogenes Cas9, comprises one or more heterologous functional domains (e.g., is or comprises a fusion polypeptide).
  • the heterologous functional domain may facilitate transport of the RNA-guided DNA-binding agent into the nucleus of a cell.
  • the heterologous functional domain may be a nuclear localization signal (NLS).
  • the RNA-guided DNA-binding agent may be fused with 1-10 NLS(s).
  • the RNA-guided DNA-binding agent may be fused with 1-5 NLS(s).
  • the RNA-guided DNA-binding agent may be fused with one NLS. Where one NLS is used, the NLS may be linked at the N-terminus or the C-terminus of the RNA-guided DNA-binding agent sequence.
  • the RNA-guided DNA-binding agent may be fused C-terminally to at least one NLS.
  • An NLS may also be inserted within the RNA-guided DNA binding agent sequence.
  • the RNA-guided DNA- binding agent may be fused with more than one NLS.
  • the RNA- guided DNA-binding agent may be fused with 2, 3, 4, or 5 NLSs.
  • the RNA-guided DNA-binding agent may be fused with two NLSs. In certain circumstances, the two NLSs may be the same (e.g., two SV40 NLSs) or different.
  • the RNA-guided DNA-binding agent is fused to two SV40 NLS sequences linked at the carboxy terminus. In some embodiments, the RNA-guided DNA-binding agent may be fused with two NLSs, one linked at the N-terminus and one at the C-terminus. In some embodiments, the RNA-guided DNA-binding agent may be fused with 3 NLSs. In some embodiments, the RNA-guided DNA-binding agent may be fused with no NLS.
  • the NLS may be a monopartite sequence, such as, e.g., the SV40 NLS, PKKKRKV (SEQ ID NO: 278) or PKKKRRV (SEQ ID NO: 290).
  • the NLS may be a bipartite sequence, such as the NLS of nucleoplasmin, KRPAATKKAGQAKKKK (SEQ ID NO: 91).
  • the NLS sequence may comprise LAAKRSRTT (SEQ ID NO: 279), QAAKRSRTT (SEQ ID NO: 280), PAPAKRERTT (SEQ ID NO: 281), QAAKRPRTT (SEQ ID NO: 282), RAAKRPRTT (SEQ ID NO: 283), AAAKRSWSMAA (SEQ ID NO: 284), AAAKRVWSMAF (SEQ ID NO: 285), AAAKRSWSMAF (SEQ ID NO: 286),
  • AAAKRKYFAA (SEQ ID NO: 287), RAAKRKAFAA (SEQ ID NO: 288), or
  • RAAKRKYFAV (SEQ ID NO: 289).
  • a single PKKKRKV (SEQ ID NO: 278) NLS may be linked at the C-terminus of the RNA-guided DNA-binding agent.
  • One or more linkers are optionally included at the fusion site.
  • one or more NLS(s) according to any of the foregoing embodiments are present in the RNA-guided DNA-binding agent in combination with one or more additional heterologous functional domains, such as any of the heterologous functional domains described below.
  • the heterologous functional domain may be capable of modifying the intracellular half-life of the RNA-guided DNA binding agent. In some embodiments, the half-life of the RNA-guided DNA binding agent may be increased. In some embodiments, the half-life of the RNA-guided DNA-binding agent may be reduced. In some embodiments, the heterologous functional domain may be capable of increasing the stability of the RNA-guided DNA-binding agent. In some embodiments, the heterologous functional domain may be capable of reducing the stabilit of the RNA-guided DNA-binding agent. In some embodiments, the heterologous functional domain may act as a signal peptide for protein degradation.
  • the protein degradation may be mediated by proteolytic enzymes, such as, for example, proteasomes, lysosomal proteases, or calpain proteases.
  • the heterologous functional domain may comprise a PEST sequence.
  • the RNA-guided DNA-binding agent may be modified by addition of ubiquitin or a polyubiquitin chain.
  • the ubiquitin may be a ubiquitin-like protein (UBL).
  • Non-limiting examples of ubiquitin-like proteins include small ubiquitin-like modifier (SUMO), ubiquitin cross-reactive protein (UCRP, also known as interferon-stimulated gene-15 (ISG15)), ubiquitin-related modifier-1 (URM1), neuronal- precursor-cell-expressed developmentally downregulated protein-8 (NEDD8, also called Rubl in S. cerevisiae ), human leukocyte antigen F-associated (FAT10), autophagy-8 (ATG8) and -12 (ATG12), Fau ubiquitin-like protein (FUB1), membrane-anchored UBL (MUB), ubiquitin fold-modifier- 1 (UFM1), and ubiquitin-like protein-5 (UBL5).
  • SUMO small ubiquitin-like modifier
  • UCRP ubiquitin cross-reactive protein
  • ISG15 interferon-stimulated gene-15
  • UDM1 ubiquitin-related modifier-1
  • NEDD8 neuronal- precursor-cell-ex
  • the heterologous functional domain may be a marker domain.
  • marker domains include fluorescent proteins, purification tags, epitope tags, and reporter gene sequences.
  • the marker domain may be a fluorescent protein.
  • Non-limiting examples of suitable fluorescent proteins include green fluorescent proteins (e.g., GFP, GFP-2, tagGFP, turboGFP, sfGFP, EGFP, Emerald, Azami Green, Monomeric Azami Green, CopGFP, AceGFP, ZsGreenl ), yellow fluorescent proteins (e.g., YFP, EYFP, Citrine, Venus, YPet, PhiYFP, ZsYellowl), blue fluorescent proteins (e.g., EBFP, EBFP2, Azurite, mKalamal, GFPuv, Sapphire, T-sapphire,), cyan fluorescent proteins (e.g, ECFP, Cerulean, CyPet, AmCyanl, Midoriishi-Cyan), red fluorescent proteins (e.g, mKate, mKate2, mPlum, DsRed monomer, mCherry, mRFPl, DsRed-Express, DsRed2, DsRed-Monomer, H
  • the marker domain may be a purification tag and/or an epitope tag.
  • Non-limiting exemplary tags include glutathione-S-transferase (GST), chitin binding protein (CBP), maltose binding protein (MBP), thioredoxin (TRX), poly(NANP), tandem affinity purification (TAP) tag, myc, AcV5, AU1, AU5, E, ECS, E2, FLAG, HA, nus, Softag 1, Softag 3, Strep, SBP, Glu-Glu, HSV, KT3, S, SI, T7, V5, VSV-G, 6xHis, 8xHis, biotin carboxyl carrier protein (BCCP), poly-His, and calmodulin.
  • GST glutathione-S-transferase
  • CBP chitin binding protein
  • MBP maltose binding protein
  • TRX thioredoxin
  • poly(NANP) tandem affinity purification
  • TAP tandem affinity pur
  • Non- limiting exemplary reporter genes include glutathione-S-transferase (GST), horseradish peroxidase (HRP), chloramphenicol acetyltransferase (CAT), beta-galactosidase, beta- glucuronidase, luciferase, or fluorescent proteins.
  • GST glutathione-S-transferase
  • HRP horseradish peroxidase
  • CAT chloramphenicol acetyltransferase
  • beta-galactosidase beta-glucuronidase
  • luciferase or fluorescent proteins.
  • the heterologous functional domain may target the RNA-guided DNA-binding agent to a specific organelle, cell type, tissue, or organ. In some embodiments, the heterologous functional domain may target the RNA-guided DNA-binding agent to mitochondria.
  • the heterologous functional domain may be an effector domain.
  • the effector domain may modify or affect the target sequence.
  • the effector domain may be chosen from a nucleic acid binding domain, a nuclease domain (e.g., a non-Cas nuclease domain), an epigenetic modification domain, a transcriptional activation domain, or a transcriptional repressor domain.
  • the heterologous functional domain is a nuclease, such as a Fokl nuclease. See, e.g., US Pat. No. 9,023,649.
  • the heterologous functional domain is a transcriptional activator or repressor. See, e.g., Qi et al,“Repurposing CRISPR as an RNA-guided platform for sequence-specific control of gene expression,” Cell 152: 1173-83 (2013); Perez-Pinera et al.,“RNA-guided gene activation by CRISPR-Cas9-based transcription factors,” Nat. Methods 10:973-6 (2013);
  • the RNA-guided DNA-binding agent essentially becomes a transcription factor that can be directed to bind a desired target sequence using a guide RNA.
  • the DNA modification domain is a methylation domain, such as a demethylation or methyltransferase domain.
  • the effector domain is a DNA modification domain, such as a base-editing domain.
  • the DNA modification domain is a nucleic acid editing domain that introduces a specific modification into the DNA, such as a deaminase domain. See, e.g., WO 2015/089406; US 2016/0304846.
  • the nucleic acid editing domains, deaminase domains, and Cas9 variants described in WO 2015/089406 and US 2016/0304846 are hereby incorporated by reference.
  • any nucleic acid comprising an ORF encoding an RNA-guided DNA binding agent disclosed herein e.g. a Cas9 nuclease such as an S pyogenes Cas9, may be optionally combined in a composition or method with any of the gRNAs disclosed herein.
  • the nucleic acid comprising an open reading frame encoding an RNA-guided DNA binding agent may be an mRNA.
  • the ORF encoding the RNA-guided DNA-binding agent e.g. a Cas9 nuclease such as an A pyogenes Cas9
  • the ORF encoding the RNA-guided DNA-binding agent has an adenine content ranging from its minimum adenine content to about 150% of its minimum adenine content.
  • the adenine content of the ORF is less than or equal to about 145%, 140%, 135%, 130%, 125%, 120%, 115%, 110%, 105%, 104%, 103%, 102%, or 101% of its minimum adenine content.
  • the ORF has an adenine content equal to its minimum adenine content.
  • the ORF has an adenine content less than or equal to about 150% of its minimum adenine content. In some embodiments, the ORF has an adenine content less than or equal to about 145% of its minimum adenine content. In some embodiments, the ORF has an adenine content less than or equal to about 140% of its minimum adenine content. In some embodiments, the ORF has an adenine content less than or equal to about 135% of its minimum adenine content. In some embodiments, the ORF has an adenine content less than or equal to about 130% of its minimum adenine content. In some embodiments, the ORF has an adenine content less than or equal to about 125% of its minimum adenine content.
  • the ORF has an adenine content less than or equal to about 120% of its minimum adenine content. In some embodiments, the ORF has an adenine content less than or equal to about 115% of its minimum adenine content. In some embodiments, the ORF has an adenine content less than or equal to about 110% of its minimum adenine content. In some embodiments, the ORF has an adenine content less than or equal to about 105% of its minimum adenine content. In some embodiments, the ORF has an adenine content less than or equal to about 104% of its minimum adenine content. In some embodiments, the ORF has an adenine content less than or equal to about 103% of its minimum adenine content.
  • the ORF has an adenine content less than or equal to about 102% of its minimum adenine content. In some embodiments, the ORF has an adenine content less than or equal to about 101% of its minimum adenine content.
  • the ORF has an adenine dinucleotide content ranging from its minimum adenine dinucleotide content to 200% of its minimum adenine dinucleotide content.
  • the adenine dinucleotide content of the ORF is less than or equal to about 195%, 190%, 185%, 180%, 175%, 170%, 165%, 160%, 155%, 150%, 145%, 140%, 135%, 130%, 125%, 120%, 115%, 110%, 105%, 104%, 103%, 102%, or 101% of its minimum adenine dinucleotide content.
  • the ORF has an adenine dinucleotide content equal to its minimum adenine dinucleotide content. In some embodiments, the ORF has an adenine dinucleotide content less than or equal to about 200% of its minimum adenine dinucleotide content. In some embodiments, the ORF has an adenine dinucleotide content less than or equal to about 195% of its minimum adenine dinucleotide content. In some embodiments, the ORF has an adenine dinucleotide content less than or equal to about 190% of its minimum adenine dinucleotide content.
  • the ORF has an adenine dinucleotide content less than or equal to about 185% of its minimum adenine dinucleotide content. In some embodiments, the ORF has an adenine dinucleotide content less than or equal to about 180% of its minimum adenine dinucleotide content. In some embodiments, the ORF has an adenine dinucleotide content less than or equal to about 175% of its minimum adenine dinucleotide content. In some embodiments, the ORF has an adenine dinucleotide content less than or equal to about 170% of its minimum adenine dinucleotide content.
  • the ORF has an adenine dinucleotide content less than or equal to about 165% of its minimum adenine dinucleotide content. In some embodiments, the ORF has an adenine dinucleotide content less than or equal to about 160% of its minimum adenine dinucleotide content. In some embodiments, the ORF has an adenine dinucleotide content less than or equal to about 155% of its minimum adenine dinucleotide content. In some embodiments, the ORF has an adenine dinucleotide content equal to its minimum adenine dinucleotide content.
  • the ORF has an adenine dinucleotide content less than or equal to about 150% of its minimum adenine dinucleotide content. In some embodiments, the ORF has an adenine dinucleotide content less than or equal to about 145% of its minimum adenine dinucleotide content. In some embodiments, the ORF has an adenine dinucleotide content less than or equal to about 140% of its minimum adenine dinucleotide content. In some embodiments, the ORF has an adenine dinucleotide content less than or equal to about 135% of its minimum adenine dinucleotide content.
  • the ORF has an adenine dinucleotide content less than or equal to about 130% of its minimum adenine dinucleotide content. In some embodiments, the ORF has an adenine dinucleotide content less than or equal to about 125% of its minimum adenine dinucleotide content. In some embodiments, the ORF has an adenine dinucleotide content less than or equal to about 120% of its minimum adenine dinucleotide content. In some embodiments, the ORF has an adenine dinucleotide content less than or equal to about 115% of its minimum adenine dinucleotide content.
  • the ORF has an adenine dinucleotide content less than or equal to about 110% of its minimum adenine dinucleotide content. In some embodiments, the ORF has an adenine dinucleotide content less than or equal to about 105% of its minimum adenine dinucleotide content. In some embodiments, the ORF has an adenine dinucleotide content less than or equal to about 104% of its minimum adenine dinucleotide content. In some embodiments, the ORF has an adenine dinucleotide content less than or equal to about 103% of its minimum adenine dinucleotide content.
  • the ORF has an adenine dinucleotide content less than or equal to about 102% of its minimum adenine dinucleotide content. In some embodiments, the ORF has an adenine dinucleotide content less than or equal to about 101% of its minimum adenine dinucleotide content.
  • the ORF has an adenine dinucleotide content ranging from its minimum adenine dinucleotide content to the adenine dinucleotide content that is 90% or lower of the maximum adenine dinucleotide content of a reference sequence that encodes the same protein as the mRNA in question.
  • the adenine dinucleotide content of the ORF is less than or equal to about 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, or 5% of the maximum adenine dinucleotide content of a reference sequence that encodes the same protein as the mRNA in question.
  • the ORF has an adenine trinucleotide content ranging from 0 adenine trinucleotides to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, or 50 adenine trinucleotides (where a longer run of adenines counts as the number of unique three-adenine segments within it, e.g., an adenine tetranucleotide contains two adenine trinucleotides, an adenine pentanucleotide contains three adenine trinucleotides, etc.).
  • the ORF has an adenine trinucleotide content ranging from 0% adenine trinucleotides to 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1%, 1.5%, or 2% adenine trinucleotides, where the percentage content of adenine trinucleotides is calculated as the percentage of positions in a sequence that are occupied by adenines that form part of an adenine trinucleotide (or longer run of adenines), such that the sequences UUUAAA and UUUUAAAA would each have an adenine trinucleotide content of 50%.
  • the ORF has an adenine trinucleotide content less than or equal to 2%.
  • the ORF has an adenine trinucleotide content less than or equal to 1.5%.
  • the ORF has an adenine trinucleotide content less than or equal to 1%.
  • the ORF has an adenine trinucleotide content less than or equal to 0.9%.
  • the ORF has an adenine tnnucleotide content less than or equal to 0.8%.
  • the ORF has an adenine trinucleotide content less than or equal to 0.7%.
  • the ORF has an adenine trinucleotide content less than or equal to 0.6%. In some embodiments, the ORF has an adenine trinucleotide content less than or equal to 0.5%. In some embodiments, the ORF has an adenine trinucleotide content less than or equal to 0.4%. In some embodiments, the ORF has an adenine trinucleotide content less than or equal to 0.3%. In some embodiments, the ORF has an adenine trinucleotide content less than or equal to 0.2%. In some embodiments, the ORF has an adenine trinucleotide content less than or equal to 0.1%. In some embodiments, a nucleic acid is provided that encodes an RNA-guided DNA-binding agent comprising an ORF containing no adenine trinucleotides.
  • the ORF has an adenine trinucleotide content ranging from its minimum adenine trinucleotide content to the adenine trinucleotide content that is 90% or lower of the maximum adenine trinucleotide content of a reference sequence that encodes the same protein as the mRNA in question.
  • the adenine trinucleotide content of the ORF is less than or equal to about 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, or 5% of the maximum adenine trinucleotide content of a reference sequence that encodes the same protein as the mRNA in question.
  • a given ORF can be reduced in adenine content or adenine dinucleotide content or adenine trinucleotide content, for example, by using minimal adenine codons in a sufficient fraction of the ORF.
  • an amino acid sequence for an RNA-guided DNA-binding agent can be back-translated into an ORF sequence by converting amino acids to codons, wherein some or all of the ORF uses the exemplary minimal adenine codons shown below.
  • at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% of the codons in the ORF are codons listed in Table 4.
  • a nucleic acid encodes an RNA-guided DNA-binding agent, e.g. a Cas9 nuclease such as an S. pyogenes Cas9, comprising an ORF consisting of a set of codons of which at least about 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% of the codons are codons listed in Table 4.
  • the ORF has minimal nucleotide homopolymers, e.g., repetitive strings of the same nucleotides.
  • a nucleic acid when selecting a minimal uridine codon from the codons listed in Table 4, a nucleic acid is constructed by selecting the minimal adenine codons that reduce the number and length of nucleotide homopolymers, e.g., selecting GCG instead of GCC for alanine or selecting GGC instead of GGG for glycine.
  • the nucleic acid may be an mRNA.
  • Codons that increase translation and/or that correspond to highly expressed tRNAs exemplary codon sets
  • the nucleic acid comprises an ORF having codons that increase translation in a mammal, such as a human.
  • the nucleic acid comprises an ORF having codons that increase translation in an organ, such as the liver, of the mammal, e.g., a human.
  • the nucleic acid comprises an ORF having codons that increase translation in a cell type, such as a hepatocyte, of the mammal, e.g., a human.
  • An increase in translation in a mammal, cell type, organ of a mammal, human, organ of a human, etc. can be determined relative to the extent of translation wild-type sequence of the ORF, or relative to an ORF having a codon distribution matching the codon distribution of the organism from which the ORF was derived or the organism that contains the most similar ORF at the amino acid level, such as S. pyogenes , S. aureu , or another prokaryote as the case may be for prokaryotically-derived Cas nucleases, such as the Cas nucleases from other prokaryotes described below.
  • an increase in translation for a Cas9 sequence in a mammal, cell type, organ of a mammal, human, organ of a human, etc. is determined relative to translation of an ORF with the sequence of SEQ ID NO: 205 with all else equal, including any applicable point mutations, heterologous domains, and the like.
  • Codons useful for increasing expression in a human, including the human liver and human hepatocytes can be codons corresponding to highly expressed tRNAs in the human liver/hepatocytes, which are discussed in Dittmar KA, PLos Genetics 2(12): e221 (2006).
  • At least about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of the codons in an ORF are codons corresponding to highly expressed tRNAs (e.g., the highest-expressed tRNA for each amino acid) in a mammal, such as a human. In some embodiments, at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of the codons in an ORF are codons corresponding to highly expressed tRNAs (e.g., the highest-expressed tRNA for each amino acid) in a mammalian organ, such as a human organ.
  • At least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of the codons in an ORF are codons corresponding to highly expressed tRNAs (e.g., the highest-expressed tRNA for each amino acid) in a mammalian liver, such as a human liver. In some embodiments, at least 75%, 80%, 85%, 90%, 95%,
  • codons in an ORF are codons corresponding to highly expressed tRNAs (e.g., the highest-expressed tRNA for each amino acid) in a mammalian hepatocyte, such as a human hepatocyte.
  • codons corresponding to highly expressed tRNAs in an organism e.g., human
  • codons corresponding to highly expressed tRNAs in an organism e.g., human
  • any of the foregoing approaches to codon selection can be combined with the minimal adenine codons shown above, e.g., by starting with the codons of Table 4, and then where more than one option is available, using the codon that corresponds to a more highly- expressed tRNA, either in the organism (e.g., human) in general, or in an organ or cell type of interest, such as the liver or hepatocytes (e.g., human liver or human hepatocytes).
  • codons in an ORF are codons from a codon set shown in Table 5 (e.g., the low U 1, low A, or low AU codon set).
  • the codons in the low U 1, low G, low C, low A, and low A/U sets use codons that minimize the indicated nucleotides while also using codons corresponding to highly expressed tRNAs where more than one option is available.
  • at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of the codons in an ORF are codons from the low U 1 codon set shown in Table 5.
  • At least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of the codons in an ORF are codons from the low A codon set shown in Table 5. In some embodiments, at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of the codons in an ORF are codons from the low A/U codon set shown in Table 5.
  • the ORF encoding the RNA-guided DNA binding agent comprises a sequence with at least 93% identity to SEQ ID NO: 311; and/or the ORF has at least 93% identity to SEQ ID NO: 311 over at least its first 50, 200, 250, or 300 nucleotides, or at least 95% identity to SEQ ID NO: 311 over at least its first 30, 50, 70, 100, 150, 200, 250, or 300 nucleotides; and/or the ORF consists of a set of codons of which at least 95%, 96%, 97%, 98%, 99%, 99.5%, or 100% of the codons are codons listed in Table 1; and/or the ORF has an adenine content ranging from its minimum adenine content to 123% of the minimum adenine content; and/or the ORF has an adenine dinucleotide content ranging from its minimum adenine dinucleotide content to 150% of the minimum
  • the polynucleotide encoding the RNA-guided DNA binding agent comprises a sequence with at least 95%, 96%, 97%, 98%, 99%, 99.5%, or 100% identity to SEQ ID NO: 377.
  • the ORF encoding the RNA-guided DNA binding agent comprises a sequence with at least 90% identity to any one of SEQ ID NOs: 201, 204, 207, 209, 210, 211, 212, 214, 215, 217, 218, 220, 221, 223, 224, 226, 227, 229, 230, 250, 252,
  • the mRNA comprises an ORF encoding an RNA-guided DNA binding agent, wherein the RNA-guided DNA binding agent comprises an amino acid sequence with at least 90% identity to any one of SEQ ID NOs: 203, 206, 208, 213, 216, 219, 222, 225, 228, 268, or 386-396, wherein the ORF has an adenine content ranging from its minimum adenine content to 150% of the minimum adenine content, and/or has a adenine dinucleotide content ranging from its minimum adenine dmucleotide content to 150% of the minimum adenine dinucleotide content.
  • the encoded RNA-guided DNA binding agent comprises an amino acid sequence with at least 90% identity to any one of SEQ ID NOs: 203, 206, 208, 213, 216, 219, 222, 225, 228, 268, or 386- 396, wherein the ORF has a uridine content ranging from its minimum uridine content to 150% of the minimum uridine content, and/or has a uridine dinucleotide content ranging from its minimum uridine dinucleotide content to 150% of the minimum uridine dinucleotide content.
  • both the adenine and uridine nucleotide contents are less than or equal to 150% of their respective minima. In some embodiments, both the adenine and uridine dinucleotide contents are less than or equal to 150% of their respective minima.
  • the mRNA comprises a sequence with at least 90% identity to any one of SEQ ID NOs: 243, 244, 251, 253, 255-261, or 267, wherein the sequence comprises an ORF encoding an RNA-guided DNA binding agent.
  • the mRNA comprises a sequence with at least 90% identity to any one of SEQ ID NOs: 243, 244, 251, 253, 255-261, or 267, wherein the sequence comprises an ORF encoding an RNA-guided DNA binding agent, wherein the first three nucleotides of SEQ ID NOs: 243, 244, 251, 253, 255-261, or 267are omitted.
  • any of the foregoing levels of identity is at least 95%, at least 98%, at least 99%, or 100%.
  • the ORF encoding an RNA-guided DNA binding agent has at least 90% identity to any one of SEQ ID NO: 201, 204, 207, 209, 210, 211, 212, 214, 215, 217, 218, 220, 221, 223, 224, 226, 227, 229, 230, 250, 252, 254, 265, 266, or 307-375over at least its first 30, 50, 70, 100, 150, 200, 250, or 300 nucleotides.
  • the first 30, 50, 70, 100, 150, 200, 250, or 300 nucleotides are measured from the first nucleotide of the start codon (typically ATG), such that the A is nucleotide 1, the T is nucleotide 2, etc.
  • the open reading frame has at least 90% identity to any one of SEQ ID NO: 201, 204, 207, 209, 210, 211, 212, 214, 215, 217, 218, 220, 221, 223, 224, 226, 227, 229,
  • the length of the sequence of the ORF is the number of nucleotides from the beginning of the start codon to the end of the stop codon, and the first 10%, 12%, 15%, 20%, 25%, 30%, or 35% of its sequence corresponds to the number of nucleotides starting from the first nucleotide of the start codon that make up the indicated percentage of the length of the total sequence.
  • the nucleic acid comprising an ORF encoding an RNA- guided DNA binding agent comprises a sequence having at least 90% identity to SEQ ID NO: 243in which the ORF of SEQ ID NO: 243 (i.e., SEQ ID NO: 204) is substituted with the ORF of any one of SEQ ID NO: 207, 209, 210, 211, 212, 214, 215, 217, 218, 220, 221, 223, 224, 226, 227, 229, 230, 250, 252, 254, 265, 266, or 307-375.
  • the nucleic acid comprising an ORF encoding an RNA- guided DNA binding agent comprises a sequence having at least 90% identity to SEQ ID NO: 244in which the ORF of SEQ ID NO: 244 (i.e., SEQ ID NO: 204) is substituted with the ORF of any one of SEQ ID NO: 207, 209, 210, 211, 212, 214, 215, 217, 218, 220, 221, 223, 224, 226, 227, 229, 230, 250, 252, 254, 265, 266, or 307-375.
  • the nucleic acid comprising an ORF encoding an RNA- guided DNA binding agent comprises a sequence having at least 90% identity to SEQ ID NO: 256in which the ORF of SEQ ID NO: 256 (i.e., SEQ ID NO: 204) is substituted with an alternative ORF of any one of SEQ ID NO: 207, 209, 210, 211, 212, 214, 215, 217, 218, 220, 221, 223, 224, 226, 227, 229, 230, 250, 252, 254, 265, 266, or 307-375.
  • the nucleic acid comprising an ORF encoding an RNA- guided DNA binding agent comprises a sequence having at least 90% identity to SEQ ID NO: 257 in which the ORF of SEQ ID NO: 257 (i.e., SEQ ID NO: 204) is substituted with the ORF of any one of SEQ ID NO: 207, 209, 210, 211, 212, 214, 215, 217, 218, 220, 221, 223, 224, 226, 227, 229, 230, 250, 252, 254, 265, 266, or 307-375
  • the nucleic acid comprising an ORF encoding an RNA- guided DNA binding agent comprises a sequence having at least 90% identity to SEQ ID NO: 258 in which the ORF of SEQ ID NO: 258 (i.e., SEQ ID NO: 204) is substituted with the ORF of any one of SEQ ID NO: 207, 209, 210, 211, 212, 214, 215, 217, 218, 220, 221, 223, 224, 226, 227, 229, 230, 250, 252, 254, 265, 266, or 307-375.
  • the nucleic acid comprising an ORF encoding an RNA- guided DNA binding agent comprises a sequence having at least 90% identity to SEQ ID NO: 259 in which the ORF of SEQ ID NO: 259 (i.e., SEQ ID NO: 204) is substituted with the ORF of any one of SEQ ID NO: 207, 209, 210, 211, 212, 214, 215, 217, 218, 220, 221, 223, 224, 226, 227, 229, 230, 250, 252, 254, 265, 266, or 307-375.
  • the nucleic acid comprising an ORF encoding an RNA- guided DNA binding agent comprises a sequence having at least 90% identity to SEQ ID NO: 260 in which the ORF of SEQ ID NO: 260 (i.e., SEQ ID NO: 204) is substituted with the ORF of any one of SEQ ID NO: 207, 209, 210, 211, 212, 214, 215, 217, 218, 220, 221, 223, 224, 226, 227, 229, 230, 250, 252, 254, 265, 266, or 307-375.
  • the nucleic acid comprising an ORF encoding an RNA- guided DNA binding agent comprises a sequence having at least 90% identity to SEQ ID NO: 261 in which the ORF of SEQ ID NO: 261 (i.e., SEQ ID NO: 204) is substituted with the ORF of any one of SEQ ID NO: 207, 209, 210, 211, 212, 214, 215, 217, 218, 220, 221, 223, 224, 226, 227, 229, 230, 250, 252, 254, 265, 266, or 307-375.
  • the nucleic acid comprising an ORF encoding an RNA- guided DNA binding agent comprises a sequence having at least 90% identity to SEQ ID NO: 376 in which the ORF of SEQ ID NO: 376 (i.e., SEQ ID NO: 204) is substituted with the ORF of any one of SEQ ID NO: 207, 209, 210, 211, 212, 214, 215, 217, 218, 220, 221, 223, 224, 226, 227, 229, 230, 250, 252, 254, 265, 266, or 307-375.
  • the nucleic acid comprising an ORF encoding an RNA- guided DNA binding agent comprises a sequence having at least 90% identity to SEQ ID NO: 377 in which the ORF of SEQ ID NO: 377 (i.e., SEQ ID NO: 204) is substituted with the ORF of any one of SEQ ID NO: 207, 209, 210, 211, 212, 214, 215, 217, 218, 220, 221, 223, 224, 226, 227, 229, 230, 250, 252, 254, 265, 266, or 307-375.
  • the nucleic acid comprising an ORF encoding an RNA- guided DNA binding agent comprises a sequence having at least 90% identity to SEQ ID NO: 378 in which the ORF of SEQ ID NO: 378 (i.e., SEQ ID NO: 204) is substituted with the ORF of any one of SEQ ID NO: 207, 209, 210, 211, 212, 214, 215, 217, 218, 220, 221, 223, 224, 226, 227, 229, 230, 250, 252, 254, 265, 266, or 307-375.
  • the nucleic acid comprising an ORF encoding an RNA- guided DNA binding agent comprises a sequence having at least 90% identity to SEQ ID NO: 379 in which the ORF of SEQ ID NO: 379 (i.e., SEQ ID NO: 204) is substituted with the ORF of any one of SEQ ID NO: 207, 209, 210, 211, 212, 214, 215, 217, 218, 220, 221, 223, 224, 226, 227, 229, 230, 250, 252, 254, 265, 266, or 307-375.
  • the nucleic acid comprising an ORF encoding an RNA- guided DNA binding agent comprises a sequence having at least 90% identity to SEQ ID NO: 380 in which the ORF of SEQ ID NO: 380 (i.e., SEQ ID NO: 204) is substituted with the ORF of any one of SEQ ID NO: 207, 209, 210, 211, 212, 214, 215, 217, 218, 220, 221, 223, 224, 226, 227, 229, 230, 250, 252, 254, 265, 266, or 307-375.
  • the nucleic acid comprising an ORF encoding an RNA- guided DNA binding agent comprises a sequence having at least 90% identity to SEQ ID NO: 381 in which the ORF of SEQ ID NO: 381 (i.e., SEQ ID NO: 204) is substituted with the ORF of any one of SEQ ID NO: 207, 209, 210, 211, 212, 214, 215, 217, 218, 220, 221, 223, 224, 226, 227, 229, 230, 250, 252, 254, 265, 266, or 307-375.
  • the nucleic acid comprising an ORF encoding an RNA- guided DNA binding agent comprises a sequence having at least 90% identity to SEQ ID NO: 382 in which the ORF of SEQ ID NO: 382 (i.e., SEQ ID NO: 204) is substituted with the ORF of any one of SEQ ID NO: 207, 209, 210, 211, 212, 214, 215, 217, 218, 220, 221, 223, 224, 226, 227, 229, 230, 250, 252, 254, 265, 266, or 307-375.
  • the nucleic acid comprising an ORF encoding an RNA- guided DNA binding agent comprises a sequence having at least 90% identity to SEQ ID NO: 383 in which the ORF of SEQ ID NO: 383 (i.e., SEQ ID NO: 204) is substituted with the ORF of any one of SEQ ID NO: 207, 209, 210, 211, 212, 214, 215, 217, 218, 220, 221, 223, 224, 226, 227, 229, 230, 250, 252, 254, 265, 266, or 307-375.
  • SEQ ID NO: 383 i.e., SEQ ID NO: 204
  • the nucleic acid comprising an ORF encoding an RNA- guided DNA binding agent comprises a sequence having at least 90% identity to SEQ ID NO: 384 in which the ORF of SEQ ID NO: 384 (i.e., SEQ ID NO: 204) is substituted with the ORF of any one of SEQ ID NO: 207, 209, 210, 211, 212, 214, 215, 217, 218, 220, 221, 223, 224, 226, 227, 229, 230, 250, 252, 254, 265, 266, or 307-375.
  • the nucleic acid comprising an ORF encoding an RNA- guided DNA binding agent comprises a sequence having at least 90% identity to SEQ ID NO: 385 in which the ORF of SEQ ID NO: 385 (i.e., SEQ ID NO: 204) is substituted with the ORF of any one of SEQ ID NO: 207, 209, 210, 211, 212, 214, 215, 217, 218, 220, 221, 223, 224, 226, 227, 229, 230, 250, 252, 254, 265, 266, or 307-375.
  • the degree of identity to the optionally substituted sequences of SEQ ID Nos: 243, 244, 256-61, or 376-385 is at least 95%. In some embodiments, the degree of identity to the optionally substituted sequences of SEQ ID NOs: 243, 244, 256-61, or 376-385 is at least 98%. In some embodiments, the degree of identity to the optionally substituted sequences of SEQ ID NOs: 243, 244, 256-61, or 376-385 is at least 99%. In some embodiments, the degree of identity to the optionally substituted sequences of SEQ ID NOs: 243, 244, 256-61, or 376-385 is 100%.
  • the ORF encoding the RNA-guided DNA-binding agent e.g. a Cas9 nuclease such as an A. pyogenes Cas9
  • the ORF encoding the RNA-guided DNA-binding agent has a uridine content ranging from its minimum uridine content to about 150% of its minimum uridine content.
  • the uridine content of the ORF is less than or equal to about 145%, 140%, 135%, 130%, 125%, 120%, 115%, 110%, 105%, 104%, 103%, 102%, or 101% of its minimum uridine content.
  • the ORF has a uridine content equal to its minimum uridine content.
  • the ORF has a uridine content less than or equal to about 150% of its minimum uridine content. In some embodiments, the ORF has a uridine content less than or equal to about 145% of its minimum uridine content. In some embodiments, the ORF has a uridine content less than or equal to about 140% of its minimum uridine content. In some embodiments, the ORF has a uridine content less than or equal to about 135% of its minimum uridine content. In some embodiments, the ORF has a uridine content less than or equal to about 130% of its minimum uridine content. In some embodiments, the ORF has a uridine content less than or equal to about 125% of its minimum uridine content.
  • the ORF has a uridine content less than or equal to about 120% of its minimum uridine content. In some embodiments, the ORF has a uridine content less than or equal to about 115% of its minimum uridine content. In some embodiments, the ORF has a uridine content less than or equal to about 110% of its minimum uridine content. In some embodiments, the ORF has a uridine content less than or equal to about 105% of its minimum uridine content. In some embodiments, the ORF has a uridine content less than or equal to about 104% of its minimum uridine content. In some embodiments, the ORF has a uridine content less than or equal to about 103% of its minimum uridine content. In some embodiments, the ORF has a uridine content less than or equal to about 102% of its minimum uridine content. In some embodiments, the ORF has a uridine content less than or equal to about 101% of its minimum uridine content.
  • the ORF has a uridine dinucleotide content ranging from its minimum uridine dinucleotide content to 200% of its minimum uridine dinucleotide content.
  • the uridine dinucleotide content of the ORF is less than or equal to about 195%, 190%, 185%, 180%, 175%, 170%, 165%, 160%, 155%, 150%, 145%, 140%, 135%, 130%, 125%, 120%, 115%, 110%, 105%, 104%, 103%, 102%, or 101% of its minimum uridine dinucleotide content.
  • the ORF has a uridine dinucleotide content equal to its minimum uridine dinucleotide content. In some embodiments, the ORF has a uridine dinucleotide content less than or equal to about 200% of its minimum uridine dinucleotide content. In some embodiments, the ORF has a uridine dinucleotide content less than or equal to about 195% of its minimum uridine dinucleotide content. In some embodiments, the ORF has a uridine dinucleotide content less than or equal to about 190% of its minimum uridine dinucleotide content.
  • the ORF has a uridine dinucleotide content less than or equal to about 185% of its minimum uridine dinucleotide content. In some embodiments, the ORF has a uridine dinucleotide content less than or equal to about 180% of its minimum uridine dinucleotide content. In some embodiments, the ORF has a uridine dinucleotide content less than or equal to about 175% of its minimum uridine dinucleotide content. In some embodiments, the ORF has a uridine dinucleotide content less than or equal to about 170% of its minimum uridine dinucleotide content.
  • the ORF has a uridine dinucleotide content less than or equal to about 165% of its minimum uridine dinucleotide content. In some embodiments, the ORF has a uridine dinucleotide content less than or equal to about 160% of its minimum uridine dinucleotide content. In some embodiments, the ORF has a uridine dinucleotide content less than or equal to about 155% of its minimum uridine dinucleotide content. In some embodiments, the ORF has a uridine dinucleotide content equal to its minimum uridine dinucleotide content.
  • the ORF has a uridine dinucleotide content less than or equal to about 150% of its minimum uridine dinucleotide content. In some embodiments, the ORF has a uridine dinucleotide content less than or equal to about 145% of its minimum uridine dinucleotide content. In some embodiments, the ORF has a uridine dinucleotide content less than or equal to about 140% of its minimum uridine dinucleotide content. In some embodiments, the ORF has a uridine dinucleotide content less than or equal to about 135% of its minimum uridine dinucleotide content.
  • the ORF has a uridine dinucleotide content less than or equal to about 130% of its minimum uridine dinucleotide content. In some embodiments, the ORF has a uridine dinucleotide content less than or equal to about 125% of its minimum uridine dinucleotide content. In some embodiments, the ORF has a uridine dinucleotide content less than or equal to about 120% of its minimum uridine dinucleotide content. In some embodiments, the ORF has a uridine dinucleotide content less than or equal to about 115% of its minimum uridine dinucleotide content.
  • the ORF has a uridine dmucleotide content less than or equal to about 110% of its minimum uridine dinucleotide content. In some embodiments, the ORF has a uridine dinucleotide content less than or equal to about 105% of its minimum uridine dinucleotide content. In some embodiments, the ORF has a uridine dinucleotide content less than or equal to about 104% of its minimum uridine dinucleotide content. In some embodiments, the ORF has a uridine dinucleotide content less than or equal to about 103% of its minimum uridine dinucleotide content.
  • the ORF has a uridine dinucleotide content less than or equal to about 102% of its minimum uridine dinucleotide content. In some embodiments, the ORF has a uridine dmucleotide content less than or equal to about 101% of its minimum uridine dinucleotide content.
  • the ORF has a uridine dinucleotide content ranging from its minimum uridine dinucleotide content to the uridine dinucleotide content that is 90% or lower of the maximum uridine dinucleotide content of a reference sequence that encodes the same protein as the mRNA in question.
  • the uridine dinucleotide content of the ORF is less than or equal to about 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, or 5% of the maximum uridine dinucleotide content of a reference sequence that encodes the same protein as the mRNA in question.
  • the ORF has a uridine trinucleotide content ranging from 0 uridine trinucleotides to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, or 50 undine trinucleotides (where a longer run of uridines counts as the number of unique three-uridine segments within it, e.g., a uridine tetranucleotide contains two uridine trinucleotides, a uridine pentanucleotide contains three uridine trinucleotides, etc.).
  • the ORF has a uridine trinucleotide content ranging from 0% uridine trinucleotides to 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1%, 1.5%, or 2% uridine trinucleotides, where the percentage content of uridine trinucleotides is calculated as the percentage of positions in a sequence that are occupied by uridines that form part of a uridine trinucleotide (or longer run of uridines), such that the sequences UUUAAA and UUUUAAAA would each have a uridine trinucleotide content of 50%.
  • the ORF has a uridine trinucleotide content less than or equal to 2%.
  • the ORF has a uridine trinucleotide content less than or equal to 1.5%.
  • the ORF has a uridine trinucleotide content less than or equal to 1%.
  • the ORF has a uridine trinucleotide content less than or equal to 0.9%.
  • the ORF has a uridine trinucleotide content less than or equal to 0.8%.
  • the ORF has a uridine trinucleotide content less than or equal to 0.7%.
  • the ORF has a uridine trinucleotide content less than or equal to 0.6%. In some embodiments, the ORF has a uridine trinucleotide content less than or equal to 0.5%. In some embodiments, the ORF has a uridine trinucleotide content less than or equal to 0.4%. In some embodiments, the ORF has a uridine trinucleotide content less than or equal to 0.3%. In some embodiments, the ORF has a uridine trinucleotide content less than or equal to 0.2%. In some embodiments, the ORF has a uridine trinucleotide content less than or equal to 0.1%. In some embodiments, the ORF has no uridine trinucleotides.
  • the ORF has a uridine trinucleotide content ranging from its minimum uridine trinucleotide content to the uridine trinucleotide content that is 90% or lower of the maximum uridine trinucleotide content of a reference sequence that encodes the same protein as the mRNA in question.
  • the uridine trinucleotide content of the ORF is less than or equal to about 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, or 5% of the maximum uridine trinucleotide content of a reference sequence that encodes the same protein as the mRNA in question.
  • a given ORF can be reduced in uridine content or uridine dinucleotide content or uridine trinucleotide content, for example, by using minimal uridine codons in a sufficient fraction of the ORF.
  • an amino acid sequence for an RNA-guided DNA-binding agent can be back-translated into an ORF sequence by converting amino acids to codons, wherein some or all of the ORF uses the exemplary minimal uridine codons shown below. In some embodiments, at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% of the codons in the ORF are codons listed in Table 6.
  • the ORF consists of a set of codons of which at least about 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% of the codons are codons listed in Table 6. b) Low adenine and uridine content
  • a nucleic acid e.g., mRNA
  • an RNA-guided DNA-binding agent comprising an ORF having a uridine content ranging from its minimum uridine content to about 150% of its minimum uridine content (e.g., a uridine content of the ORF is less than or equal to about 145%, 140%, 135%, 130%, 125%, 120%, 115%, 110%, 105%, 104%, 103%, 102%, or 101% of its minimum uridine content) and an adenine content ranging from its minimum adenine content to about 150% of its minimum adenine content (e.g., less than or equal to about 145%, 140%, 135%, 130%, 125%, 120%, 115%, 110%, 105%, 104%,
  • a given ORF can be reduced in uridine and adenine nucleotide and/or dinucleotide content, for example, by using minimal uridine and adenine codons in a sufficient fraction of the ORF.
  • an amino acid sequence for an RNA-guided DNA-binding agent can be back-translated into an ORF sequence by converting amino acids to codons, wherein some or all of the ORF uses the exemplary minimal uridine and adenine codons shown below. In some embodiments, at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% of the codons in the ORF are codons listed in Table 7.
  • the ORF consists of a set of codons of which at least about 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% of the codons are codons listed in Table 7. As can be seen in Table 7, each of the three listed serine codons contains either one A or one U.
  • uridine minimization is pnoritized by using AGC codons for serine.
  • adenine minimization is prioritized by using UCC and/or UCG codons for serine.
  • UTRs Kozak sequences
  • the polynucleotide (e.g., mRNA) comprises a 5’ UTR, a 3’ UTR, or 5’ and 3’ UTRs.
  • the polynucleotide (e.g., mRNA) comprises at least one UTR from Hydroxysteroid 17-Beta Dehydrogenase 4 (HSD17B4 or HSD), e.g., a 5’ UTR from HSD.
  • HSD17B4 or HSD Hydroxysteroid 17-Beta Dehydrogenase 4
  • the polynucleotide comprises at least one UTR from a globin polynucleotide (e.g., mRNA), for example, human alpha globin (HBA) polynucleotide (e.g., mRNA), human beta globin (HBB) polynucleotide (e.g., mRNA), or Xenopus laevis beta globin (XBG) polynucleotide (e.g., mRNA).
  • HBA human alpha globin
  • HBB human beta globin
  • XBG Xenopus laevis beta globin
  • the polynucleotide (e.g., mRNA) comprises a 5’ UTR, 3’ UTR, or 5’ and 3’ UTRs from a globin polynucleotide (e.g., mRNA), such as HBA, HBB, or XBG.
  • a globin polynucleotide e.g., mRNA
  • the polynucleotide comprises a 5’ UTR from bovine growth hormone, cytomegalovirus (CMV), mouse Hba-al, HSD, an albumin gene, HBA, HBB, or XBG.
  • the polynucleotide (e.g., mRNA) comprises a 3’ UTR from bovine growth hormone, cytomegalovirus, mouse Hba-al, HSD, an albumin gene, HBA, HBB, or XBG.
  • the polynucleotide (e.g., mRNA) comprises 5’ and 3’ UTRs from bovine growth hormone, cytomegalovirus, mouse Hba-al, HSD, an albumin gene, HBA, HBB, XBG, heat shock protein 90 (Hsp90), glyceraldehyde 3-phosphate dehydrogenase (GAPDH), beta-actin, alpha-tubulin, tumor protein (p53), or epidermal growth factor receptor (EGFR).
  • bovine growth hormone cytomegalovirus
  • mouse Hba-al HSD
  • an albumin gene HBA, HBB, XBG
  • heat shock protein 90 Hsp90
  • GPDH glyceraldehyde 3-phosphate dehydrogenase
  • beta-actin beta-actin
  • alpha-tubulin alpha-tubulin
  • tumor protein p53
  • EGFR epidermal growth factor receptor
  • the polynucleotide (e.g., mRNA) comprises 5’ and 3’
  • UTRs that are from the same source, e.g., a constitutively expressed polynucleotide (e.g., mRNA) such as actin, albumin, or a globin such as HBA, HBB, or XBG.
  • a constitutively expressed polynucleotide e.g., mRNA
  • actin e.g., actin, albumin, or a globin
  • HBA HBB
  • XBG XBG
  • a nucleic acid disclosed herein comprises a 5’ UTR with at least 90% identity to any one of SEQ ID NOs: 232, 234, 236, 238, 241, or 275-277.
  • a nucleic acid disclosed herein comprises a 3’ UTR with at least 90% identity to any one of SEQ ID NOs: 233, 235, 237, 239, or 240.
  • any of the foregoing levels of identity is at least 95%, at least 98%, at least 99%, or 100%.
  • a nucleic acid disclosed herein comprises a 5’ UTR having the sequence of any one of SEQ ID NOs: 232, 234, 236, 238, or 241.
  • a nucleic acid disclosed herein comprises a 3’ UTR having the sequence of any one of SEQ ID NOs: 233, 235, 237, 239, or 240.
  • the polynucleotide (e.g., mRNA)does not comprise a 5’ UTR, e.g., there are no additional nucleotides between the 5’ cap and the start codon.
  • the polynucleotide (e.g., mRNA) comprises a Kozak sequence (described below) between the 5’ cap and the start codon, but does not have any additional 5’ UTR.
  • the polynucleotide (e.g., mRNA)does not comprise a 3’ UTR, e.g., there are no additional nucleotides between the stop codon and the poly-A tail.
  • the polynucleotide (e.g., mRNA)comprises a Kozak sequence.
  • the Kozak sequence can affect translation initiation and the overall yield of a polypeptide translated from a nucleic acid.
  • a Kozak sequence includes a methionine codon that can function as the start codon.
  • a minimal Kozak sequence is NNNRUGN wherein at least one of the following is true: the first N is A or G and the second N is G.
  • R means a purine (A or G).
  • the Kozak sequence is RNNRUGN, NNNRUGG, RNNRUGG, RNNAUGN, NNNAUGG, or
  • the Kozak sequence is rccRUGg with zero mismatches or with up to one or two mismatches to positions in lowercase. In some embodiments, the Kozak sequence is rccAUGg with zero mismatches or with up to one or two mismatches to positions in lowercase. In some embodiments, the Kozak sequence is gccRccAUGG
  • the Kozak sequence is gccAccAUG with zero mismatches or with up to one, two, three, or four mismatches to positions in lowercase.
  • the Kozak sequence is GCCACCAUG.
  • the Kozak sequence is gccgccRccAUGG (SEQ ID NO: 305) with zero mismatches or with up to one, two, three, or four mismatches to positions in lowercase. d) Poly-A tail
  • the polynucleotide (e.g., mRNA)further comprises a poly- adenylated (poly-A) tail.
  • the poly-A tail is“interrupted” with one or more non-adenine nucleotide“anchors” at one or more locations within the poly-A tail.
  • the poly-A tails may comprise at least 8 consecutive adenine nucleotides, but also comprise one or more non-adenine nucleotide.
  • “non-adenine nucleotides” refer to any natural or non-natural nucleotides that do not comprise adenine. Guanine, thymine, and cytosine nucleotides are exemplary non-adenine nucleotides.
  • polynucleotide e.g., mRNA
  • polynucleotide described herein may comprise consecutive adenine nucleotides located 3’ to nucleotides encoding an RNA-guided DNA-binding agent or a sequence of interest.
  • the poly-A tails on polynucleotide e.g., mRNA
  • the poly-A tails on polynucleotide comprise non- consecutive adenine nucleotides located 3’ to nucleotides encoding an RNA-guided DNA- binding agent or a sequence of interest, wherein non-adenine nucleotides interrupt the adenine nucleotides at regular or irregularly spaced intervals.
  • the poly-A tail is encoded in the plasmid used for in vitro transcription of mRNA and becomes part of the transcript.
  • the poly-A sequence encoded in the plasmid i.e., the number of consecutive adenine nucleotides in the poly-A sequence, may not be exact, e.g., a 100 poly-A sequence in the plasmid may not result in a precisely 100 poly-A sequence in the transcribed mRNA.
  • the poly-A tail is not encoded in the plasmid, and is added by PCR tailing or enzymatic tailing, e.g., using E.
  • the one or more non-adenine nucleotides are positioned to interrupt the consecutive adenine nucleotides so that a poly(A) binding protein can bind to a stretch of consecutive adenine nucleotides.
  • one or more non-adenine nucleotide(s) is located after at least 8, 9, 10, 11, or 12 consecutive adenine nucleotides.
  • the one or more non-adenine nucleotide is located after at least 8-50 consecutive adenine nucleotides.
  • the one or more non-adenine nucleotide is located after at least 8-100 consecutive adenine nucleotides.
  • the non-adenine nucleotide is after one, two, three, four, five, six, or seven adenine nucleotides and is followed by at least 8 consecutive adenine nucleotides.
  • the poly-A tail of the present disclosure may comprise one sequence of consecutive adenine nucleotides followed by one or more non-adenine nucleotides, optionally followed by additional adenine nucleotides.
  • the poly-A tail comprises or contains one non-adenine nucleotide or one consecutive stretch of 2-10 non-adenine nucleotides.
  • the non-adenine nucleotide(s) is located after at least 8, 9, 10, 11, or 12 consecutive adenine nucleotides.
  • the one or more non-adenine nucleotides are located after at least 8-50 consecutive adenine nucleotides.
  • the one or more nonadenine nucleotides are located after at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20,
  • the non-adenine nucleotide is guanine, cytosine, or thymine. In some instances, the non-adenine nucleotide is a guanine nucleotide. In some embodiments, the non-adenine nucleotide is a cytosine nucleotide. In some embodiments, the non-adenine nucleotide is a thymine nucleotide.
  • the non-adenine nucleotide may be selected from: a) guanine and thymine nucleotides; b) guanine and cytosine nucleotides; c) thymine and cytosine nucleotides; or d) guanine, thymine and cytosine nucleotides.
  • An exemplary poly-A tail comprising non-adenine nucleotides is provided as SEQ ID NO: 262. e) Modified nucleotides
  • the nucleic acid comprising an ORF encoding an RNA- guided DNA-binding agent comprises a modified uridine at some or all uridine positions.
  • the modified uridine is a uridine modified at the 5 position, e.g., with a halogen or C1-C3 alkoxy.
  • the modified uridine is a pseudouridine modified at the 1 position, e.g., with a C1-C3 alkyl.
  • the modified uridine can be, for example, pseudouridine, N1 -methyl-pseudouridine, 5-methoxyuridine, 5-iodouridine, or a combination thereof.
  • the modified uridine is 5-methoxyuridine. In some embodiments the modified uridine is 5-iodouridine. In some embodiments the modified uridine is pseudouridine. In some embodiments the modified uridine is N1 -methyl- pseudouridine. In some embodiments, the modified uridine is a combination of pseudouridine and N1 -methyl-pseudouridine. In some embodiments, the modified uridine is a combination of pseudouridine and 5-methoxyuridine. In some embodiments, the modified uridine is a combination of Nl-methyl pseudouridine and 5-methoxyuridine.
  • the modified uridine is a combination of 5-iodouridine and N1 -methyl-pseudouridine. In some embodiments, the modified uridine is a combination of pseudouridine and 5-iodouridine. In some embodiments, the modified uridine is a combination of 5-iodouridine and 5- methoxyuridine.
  • modified uridines 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% of the uridine positions in the nucleic acid are modified uridines.
  • 10%-25%, 15- 25%, 25-35%, 35-45%, 45-55%, 55-65%, 65-75%, 75-85%, 85-95%, or 90-100% of the uridine positions in the nucleic acid are modified uridines, e.g., 5-methoxyuridine, 5- iodouridine, Nl-methyl pseudouridine, pseudouridine, or a combination thereof.
  • 10%-25%, 15-25%, 25-35%, 35-45%, 45-55%, 55-65%, 65-75%, 75-85%, 85- 95%, or 90-100% of the uridine positions in the nucleic acid are 5-methoxyuridine. In some embodiments, 10%-25%, 15-25%, 25-35%, 35-45%, 45-55%, 55-65%, 65-75%, 75-85%, 85- 95%, or 90-100% of the uridine positions in the nucleic acid are pseudouridine.
  • 10%-25%, 15-25%, 25-35%, 35-45%, 45-55%, 55-65%, 65-75%, 75-85%, 85- 95%, or 90-100% of the uridine positions in the nucleic acid are Nl-methyl pseudouridine. In some embodiments, 10%-25%, 15-25%, 25-35%, 35-45%, 45-55%, 55-65%, 65-75%, 75- 85%, 85-95%, or 90-100% of the uridine positions in the nucleic acid are 5-iodouridine.
  • 10%-25%, 15-25%, 25-35%, 35-45%, 45-55%, 55-65%, 65-75%, 75- 85%, 85-95%, or 90-100% of the uridine positions in the nucleic acid are 5 -methoxy uridine, and the remainder are N1 -methyl pseudouridine.
  • 10%-25%, 15-25%, 25-35%, 35-45%, 45-55%, 55-65%, 65-75%, 75-85%, 85-95%, or 90-100% of the uridine positions in the nucleic acid are 5-iodouridine, and the remainder are N1 -methyl pseudouridine.
  • the nucleic acid comprising an ORF encoding an RNA-guided DNA-binding agent comprises a 5’ cap, such as a CapO, Capl, or Cap2.
  • a 5’ cap is generally a 7-methylguanine ribonucleotide (which may be further modified, as discussed below e.g. with respect to ARC A) linked through a 5’-triphosphate to the 5’ position of the first nucleotide of the 5’-to-3’ chain of the nucleic acid, i.e., the first cap-proximal nucleotide.
  • the riboses of the first and second cap-proximal nucleotides of the mRNA both comprise a 2’-hydroxyl.
  • the riboses of the first and second transcribed nucleotides of the mRNA comprise a 2’-methoxy and a 2’-hydroxyl, respectively.
  • the riboses of the first and second cap-proximal nucleotides of the mRNA both comprise a 2’-methoxy. See, e.g., Katibah et al. (2014) Proc Natl Acad Sci USA 111(33): 12025-30; Abbas et al.
  • CapO and other cap structures differing from Capl and Cap2 may be immunogenic in mammals, such as humans, due to recognition as“non-self’ by components of the innate immune system such as IFIT-1 and IFIT-5, which can result in elevated cytokine levels including type I interferon.
  • components of the innate immune system such as IFIT-1 and IFIT-5 may also compete with eIF4E for binding of a nucleic acid with a cap other than Capl or Cap2, potentially inhibiting translation of the mRNA.
  • a cap can be included in an RNA co-transcriptionally.
  • ARCA antireverse cap analog; Thermo Fisher Scientific Cat. No. AM8045
  • ARCA is a cap analog comprising a 7-methylguanine 3’-methoxy-5’ -triphosphate linked to the 5’ position of a guanine ribonucleotide which can be incorporated in vitro into a transcript at initiation.
  • ARCA results in a CapO cap in which the 2’ position of the first cap-proximal nucleotide is hydroxyl.
  • the ARC A structure is shown below.
  • CleanCapTM AG (m7G(5')ppp(5')(2'OMeA)pG; TriLink Biotechnologies Cat. No. N-7113) or CleanCapTM GG (m7G(5')ppp(5')(2'OMeG)pG; TriLink Biotechnologies Cat. No. N-7133) can be used to provide a Capl structure co-transcriptionally.
  • 3’-0-methylated versions of CleanCapTM AG and CleanCapTM GG are also available from TriLink
  • CleanCapTM AG structure is shown below. CleanCapTM structures are sometimes referred to herein using the last three digits of the catalog numbers listed above (e.g.,“CleanCapTM 113” for TriLink Biotechnologies Cat. No. N-7113).
  • a cap can be added to an RNA post-transcriptionally.
  • Vaccinia capping enzyme is commercially available (New England Biolabs Cat. No.
  • M2080S has RNA triphosphatase and guanylyltransferase activities, provided by its D1 subunit, and guanine methyltransferase, provided by its D 12 subunit.
  • it can add a 7- methylguanine to an RNA, so as to give CapO, in the presence of S-adenosyl methionine and GTP.
  • CapO S-adenosyl methionine and GTP.
  • the efficacy of a gRNA is determined when delivered together with other components, e.g., a nucleic acid encoding an RNA-guided DNA binding agent such as any of those described herein.
  • the efficacy of a combination of a corticosteroid and a gRNA, and optionally an RNA-guided DNA binding agent or nucleic acid encoding such an agent is determined.
  • RNA-guided DNA binding agent and a guide RNA disclosed herein can lead to double-stranded breaks in the DNA which can produce errors in the form of insertion/deletion (indel) mutations upon repair by cellular machinery.
  • Indel insertion/deletion
  • Many mutations due to indels alter the reading frame or introduce premature stop codons and, therefore, produce a non-functional protein.
  • the efficacy of particular gRNAs, compositions, or treatments comprising administering a gRNA, corticosteroid, and optionally an RNA-guided DNA binding agent or nucleic acid encoding such an agent is determined based on in vitro models.
  • the in vitro model is HEK293 cells.
  • the in vitro model is HUH7 human hepatocarcinoma cells.
  • the in vitro model is HepG2 cells.
  • the in vitro model is primary human hepatocytes.
  • the in vitro model is primary cynomolgus hepatocytes.
  • the number of off-target sites at which a deletion or insertion occurs in an in vitro model is determined, e.g., by analyzing genomic DNA from primary human hepatocytes transfected in vitro with Cas9 mRNA and the guide RNA.
  • such a determination comprises analyzing genomic DNA from primary human hepatocytes transfected in vitro with Cas9 mRNA, the guide RNA, and a donor oligonucleotide. Exemplary procedures for such determinations are provided in the working examples below.
  • the efficacy of particular gRNAs, compositions, or treatments comprising administering a gRNA, corticosteroid, and optionally an RNA-guided DNA binding agent or nucleic acid encoding such an agent is determined across multiple in vitro cell models for a gRNA selection process.
  • a cell line comparison of data with selected gRNAs is performed.
  • cross screening in multiple cell models is performed.
  • the efficacy of particular gRNAs, compositions, or treatments comprising administering a gRNA, corticosteroid, and optionally an RNA-guided DNA binding agent or nucleic acid encoding such an agent is determined based on in vivo models.
  • the in vivo model is a rodent model.
  • the rodent model is a mouse which expresses a human TTR gene, which may be a mutant human TTR gene.
  • the in vivo model is a non-human primate, for example cynomolgus monkey.
  • the efficacy of a guide RNA, compositions, or treatments comprising administering a gRNA, corticosteroid, and optionally an RNA-guided DNA binding agent or nucleic acid encoding such an agent is measured by percent editing of TTR.
  • the percent editing of TTR is compared to the percent editing necessary to acheive knockdown of TTR protein, e.g., in the cell culture media in the case of an in vitro model or in semm or tissue in the case of an in vivo model.
  • the efficacy of a gRNA, compositions, or treatments comprising administering a gRNA, corticosteroid, and optionally an RNA-guided DNA binding agent or nucleic acid encoding such an agent is measured by the number and/or frequency of indels at off-target sequences within the genome of the target cell type.
  • efficacious guide RNAs are provided which produce indels at off target sites at very low frequencies (e.g., ⁇ 5%) in a cell population and/or relative to the frequency of indel creation at the target site.
  • the disclosure provides for guide RNAs which do not exhibit off-target indel formation in the target cell type (e.g., a hepatocyte), or which produce a frequency of off-target indel formation of ⁇ 5% in a cell population and/or relative to the frequency of indel creation at the target site.
  • the disclosure provides guide RNAs which do not exhibit any off target indel formation in the target cell type (e.g., hepatocyte).
  • guide RNAs are provided which produce indels at less than 5 off-target sites, e.g., as evaluated by one or more methods described herein.
  • guide RNAs are provided which produce indels at less than or equal to 4, 3, 2, or 1 off-target site(s) e.g., as evaluated by one or more methods described herein.
  • the off-target site(s) does not occur in a protein coding region in the target cell (e.g., hepatocyte) genome.
  • detecting gene editing events such as the formation of insertion/deletion (“indel”) mutations and homology directed repair (HDR) events in target DNA utilize linear amplification with a tagged primer and isolating the tagged amplification products (herein after referred to as“LAM-PCR,” or“Linear Amplification (LA)” method), as described in WO2018/067447 or Schmidt et al., Nature Methods 4:1051-1057 (2007).
  • Indel insertion/deletion
  • HDR homology directed repair
  • the method comprises isolating cellular DNA from a cell that has been induced to have a double strand break (DSB) and optionally that has been provided with an HDR template to repair the DSB; performing at least one cycle of linear amplification of the DNA with a tagged primer; isolating the linear amplification products that comprise tag, thereby discarding any amplification product that was amplified with a non-tagged primer; optionally further amplifying the isolated products; and analyzing the linear amplification products, or the further amplified products, to determine the presence or absence of an editing event such as, for example, a double strand break, an insertion, deletion, or HDR template sequence in the target DNA.
  • the editing event can be quantified. Quantification and the like as used herein (including in the context of HDR and non-HDR editing events such as indels) includes detecting the frequency and/or type(s) of editing events in a population.
  • the tagged primer comprises a molecular barcode. In some embodiments, the tagged primer comprises a molecular barcode, and only one cycle of linear amplification is conducted.
  • detecting gene editing events such as the formation of insertion/deletion (“indel”) mutations and homology directed repair (HDR) events in target DNA, further comprises sequencing the linear amplified products or the further amplified products.
  • Sequencing may comprise any method known to those of skill in the art, including, next generation sequencing, and cloning the linear amplification products or further amplified products into a plasmid and sequencing the plasmid or a portion of the plasmid. Exemplary next generation sequencing methods are discussed, e.g., in Shendure et al, Nature 26: 1135- 1145 (2008).
  • detecting gene editing events such as the formation of insertion/deletion (“indel”) mutations and homology directed repair (HDR) events in target DNA
  • detecting gene editing events further comprises performing digital PCR (dPCR) or droplet digital PCR (ddPCR) on the linear amplified products or the further amplified products or contacting the linear amplified products or the further amplified products with a nucleic acid probe designed to identify DNA comprising HDR template sequence and detecting the probes that have bound to the linear amplified product(s) or further amplified product(s).
  • the method further comprises determining the location of the HDR template in the target DNA.
  • the method further comprises determining the sequence of an insertion site in the target DNA, wherein the insertion site is the location where the HDR template incorporates into the target DNA, and wherein the insertion site may include some target DNA sequence and some HDR template sequence.
  • the efficacy of a guide RNA or combination is measured by secretion of TTR.
  • secretion of TTR is measured using an enzyme- linked immunosorbent assay (ELISA) assay with cell culture media or serum.
  • ELISA enzyme- linked immunosorbent assay
  • secretion of TTR is measured in the same in vitro or in vivo systems or models used to measure editing.
  • secretion of TTR is measured in primary human hepatocytes.
  • secretion of TTR is measured in HUH7 cells.
  • secretion of TTR is measured in HepG2 cells.
  • ELISA assays are generally known to the skilled artisan and can be designed to determine serum TTR levels.
  • blood is collected and the serum is isolated.
  • the total TTR serum levels may be determined using a Mouse Prealbumin (Transthyretin) ELISA Kit (Aviva Systems Biology, Cat. OKIA00111) or similar kit for measuring human TTR. If no kit is available, an ELISA can be developed using plates that are pre-coated with with capture antibody specific for the TTR one is measuring. The plate is next incubated at room temperature for a period of time before washing. Enzyme-anti-TTR antibody conjugate is added and inncubated. Unbound antibody conjugate is removed and the plate washed before the addition of the chromogenic substrate solution that reactes with the enzyme. The plate is read on an appropriate plate reader at an absorbance specific for the enzy me and substrate used.
  • the amount of TTR in cells measures efficacy of a gRNA or combination. In some embodiments, the amount of TTR in cells is measured using western blot. In some embodiments, the cell used is HUH7 cells. In some embodiments, the cell used is a primary human hepatocyte. In some embodiments, the cell used is a vast cell obtained from an animal. In some embodiments, the amount of TTR is compared to the amount of glyceraldehyde 3-phosphate dehydrogenase GAPDH (a housekeeping gene) to control for changes in cell number.
  • GAPDH a housekeeping gene
  • a method of treating ATTR comprising administering a corticosteroid and a composition comprising a guide RNA as described herein, e.g., comprising any one or more of the guide sequences of SEQ ID NOs: 5-82, or any one or more of the sgRNAs of SEQ ID Nos: 87-124.
  • gRNAs comprising any one or more of the guide sequences of SEQ ID NOs: 5-82, or any one or more of the sgRNAs of SEQ ID Nos: 87-124 are administered to treat ATTR.
  • the guide RNA may be administered together with an RNA-guided DNA nuclease such as a Cas nuclease (e.g., Cas9) or a nucleic acid or vector described herein encoding an RNA-guided DNA nuclease.
  • a Cas nuclease e.g., Cas9
  • a nucleic acid or vector described herein encoding an RNA-guided DNA nuclease.
  • the RNA-guided DNA nuclease is a Cas cleavase.
  • the RNA-guided DNA nuclease is a Cas from a Type-II CRISPR/Cas system.
  • the RNA-guided DNA nuclease is a Cas9.
  • the RNA-guided DNA nuclease is an S.
  • the guide RNA is chemically modified.
  • the guide RNA and the nucleic acid encoding an RNA-guided DNA nuclease are administered in an LNP described herein, such as an LNP comprising a CCD lipid (e.g., an amine lipid, such as lipid A), a helper lipid (e.g., cholesterol), a stealth lipid (e.g., a PEG lipid, such as PEG2k-DMG), and optionally a neutral lipid (e.g., DSPC).
  • a CCD lipid e.g., an amine lipid, such as lipid A
  • a helper lipid e.g., cholesterol
  • a stealth lipid e.g., a PEG lipid, such as PEG2k-DMG
  • a neutral lipid e.g., DSPC
  • a method of treating ATTR comprising administering a corticosteroid and a composition comprising a guide RNA as described herein, e.g., comprising any one or more of the guide sequences of SEQ ID NOs: 5-72, 74-78, and 80-82, or any one or more of the sgRNAs of SEQ ID Nos: 87-113, 115-120, and 122- 124.
  • gRNAs comprising any one or more of the guide sequences of SEQ ID NOs: 5-72, 74-78, and 80-82, or any one or more of the sgRNAs of SEQ ID Nos: 87- 113, 115-120, and 122-124 are administered to treat ATTR.
  • the guide RNA is optionally administered together with an RNA-guided DNA nuclease such as a Cas nuclease (e.g., Cas9) or a nucleic acid or vector described herein encoding an RNA-guided DNA nuclease.
  • the RNA-guided DNA nuclease is a Cas cleavase.
  • the RNA-guided DNA nuclease is a Cas from a Type-II CRISPR/Cas system. In some embodiments, the RNA-guided DNA nuclease is a Cas9. In some embodiments, the RNA- guided DNA nuclease is an S. pyogenes Cas9 nuclease. In particular embodiments, the guide RNA is chemically modified.
  • the guide RNA and the nucleic acid encoding an RNA-guided DNA nuclease are administered in an LNP described herein, such as an LNP comprising a CCD lipid (e.g., an amine lipid, such as lipid A), a helper lipid (e.g., cholesterol), a stealth lipid (e.g., a PEG lipid, such as PEG2k-DMG), and optionally a neutral lipid (e.g., DSPC).
  • a CCD lipid e.g., an amine lipid, such as lipid A
  • helper lipid e.g., cholesterol
  • a stealth lipid e.g., a PEG lipid, such as PEG2k-DMG
  • a neutral lipid e.g., DSPC
  • a method of reducing TTR serum concentration comprising administering a corticosteroid and a guide RNA as described herein, e.g., comprising any one or more of the guide sequences of SEQ ID NOs: 5-82, or any one or more of the sgRNAs of SEQ ID Nos: 87-124.
  • gRNAs comprising any one or more of the guide sequences of SEQ ID NOs: 5-82 or any one or more of the sgRNAs of SEQ ID Nos: 87-124 are administered to reduce or prevent the accumulation of TTR in amyloids or amyloid fibrils.
  • the gRNA is administered together with a nucleic acid or vector described herein encoding an RNA-guided DNA nuclease such as a Cas nuclease (e.g.,
  • the RNA-guided DNA nuclease is a Cas cleavase. In some embodiments, the RNA-guided DNA nuclease is a Cas from a Type-II CRISPR Cas system. In some embodiments, the RNA-guided DNA nuclease is a Cas9. In some embodiments, the RNA-guided DNA nuclease is an S. pyogenes Cas9 nuclease. In particular embodiments, the guide RNA is chemically modified.
  • the guide RNA and the nucleic acid encoding an RNA-guided DNA nuclease are administered in an LNP described herein, such as an LNP comprising a CCD lipid (e.g., an amine lipid, such as lipid A), a helper lipid (e.g., cholesterol), a stealth lipid (e.g., a PEG lipid, such as PEG2k-DMG), and optionally a neutral lipid (e.g., DSPC).
  • a CCD lipid e.g., an amine lipid, such as lipid A
  • helper lipid e.g., cholesterol
  • a stealth lipid e.g., a PEG lipid, such as PEG2k-DMG
  • a neutral lipid e.g., DSPC
  • a method of reducing TTR serum concentration comprising administering a guide RNA as described herein, e.g., comprising any one or more of the guide sequences of SEQ ID NOs: 5-72, 74-78, and 80-82, or any one or more of the sgRNAs of SEQ ID Nos: 87-113, 115-120, and 122-124.
  • gRNAs comprising any one or more of the guide sequences of SEQ ID NOs: 5-72, 74-78, and 80-82, or any one or more of the sgRNAs of SEQ ID Nos: 87-113, 115-120, and 122-124are administered to reduce or prevent the accumulation of TTR in amyloids or amyloid fibrils.
  • the guide RNA is optionally administered together with an RNA-guided DNA nuclease such as a Cas nuclease (e.g., Cas9) or a nucleic acid or vector descnbed herein encoding an RNA- guided DNA nuclease.
  • the RNA-guided DNA nuclease is a Cas cleavase. In some embodiments, the RNA-guided DNA nuclease is a Cas from a Type-II CRISPR/Cas system. In some embodiments, the RNA-guided DNA nuclease is a Cas9. In some embodiments, the RNA-guided DNA nuclease is an S. pyogenes Cas9 nuclease. In particular embodiments, the guide RNA is chemically modified.
  • the guide RNA and the nucleic acid encoding an RNA-guided DNA nuclease are administered in an LNP described herein, such as an LNP comprising a CCD lipid (e.g., an amine lipid, such as lipid A), a helper lipid (e.g., cholesterol), a stealth lipid (e.g., a PEG lipid, such as PEG2k- DMG) and optionally a neutral lipid (e.g., DSPC).
  • a CCD lipid e.g., an amine lipid, such as lipid A
  • helper lipid e.g., cholesterol
  • a stealth lipid e.g., a PEG lipid, such as PEG2k- DMG
  • a neutral lipid e.g., DSPC
  • a method of reducing or preventing the accumulation of TTR in amyloids or amyloid fibrils of a subject comprising administering a corticosteroid and a composition comprising a guide RNA as described herein,
  • a method of reducing or preventing the accumulation of TTR in amyloids or amyloid fibrils of a subject comprising administering a corticosteroid and a composition comprising any one or more of the sgRNAs of SEQ ID Nos: 87-113.
  • gRNAs comprising any one or more of the guide sequences of SEQ ID NOs: 5-82 or any one or more of the sgRNAs of SEQ ID Nos: 87-124 are administered to reduce or prevent the accumulation of TTR in amyloids or amyloid fibrils.
  • the gRNA is optionally administered together with a nucleic acid or vector described herein encoding an RNA-guided DNA nuclease such as a Cas nuclease (e.g., Cas9).
  • the RNA-guided DNA nuclease is a Cas cleavase.
  • the RNA-guided DNA nuclease is a Cas from a Type-II CRISPR/Cas system. In some embodiments, the RNA-guided DNA nuclease is a Cas9. In some embodiments, the RNA-guided DNA nuclease is an S. pyogenes Cas9 nuclease. In particular embodiments, the guide RNA is chemically modified.
  • the guide RNA and the nucleic acid encoding an RNA-guided DNA nuclease are administered in an LNP described herein, such as an LNP comprising a CCD lipid (e.g., an amine lipid, such as lipid A), a helper lipid (e.g., cholesterol), a stealth lipid (e.g., a PEG lipid, such as PEG2k- DMG), and optionally a neutral lipid (e.g., DSPC).
  • a CCD lipid e.g., an amine lipid, such as lipid A
  • helper lipid e.g., cholesterol
  • a stealth lipid e.g., a PEG lipid, such as PEG2k- DMG
  • a neutral lipid e.g., DSPC
  • a method of reducing or preventing the accumulation of TTR in amyloids or amyloid fibrils of a subject comprising administering a composition comprising a guide RNA as described herein, e.g., comprising any one or more of the guide sequences of SEQ ID NOs: 5-72, 74-78, and 80-82, or any one or more of the sgRNAs of SEQ ID Nos: 87-124.
  • a method of reducing or preventing the accumulation of TTR in amyloids or amyloid fibrils of a subject comprising administering a composition comprising any one or more of the sgRNAs of SEQ ID Nos: 87- 113, 115-120, and 122-124.
  • gRNAs comprising any one or more of the guide sequences of SEQ ID Nos: 5-72, 74-78, and 80-82 or any one or more of the sgRNAs of SEQ ID Nos: 87-113, 115-120, and 122-124are administered to reduce or prevent the accumulation of TTR in amyloids or amyloid fibrils.
  • the guide RNA is optionally administered together with an RNA-guided DNA nuclease such as a Cas nuclease (e.g., Cas9) or a nucleic acid or vector described herein encoding an RNA-guided DNA nuclease.
  • a Cas nuclease e.g., Cas9
  • a nucleic acid or vector described herein encoding an RNA-guided DNA nuclease.
  • the RNA-guided DNA nuclease is a Cas cleavase.
  • the RNA-guided DNA nuclease is a Cas from a Type-II CRISPR/Cas system.
  • the RNA-guided DNA nuclease is a Cas9.
  • the RNA- guided DNA nuclease is an S.
  • the guide RNA is chemically modified.
  • the guide RNA and the nucleic acid encoding an RNA-guided DNA nuclease are administered in an LNP described herein, such as an LNP comprising a CCD lipid (e.g., an amine lipid, such as lipid A), a helper lipid (e.g., cholesterol), a stealth lipid (e.g., a PEG lipid, such as PEG2k-DMG), and optionally a neutral lipid (e.g., DSPC).
  • a CCD lipid e.g., an amine lipid, such as lipid A
  • a helper lipid e.g., cholesterol
  • a stealth lipid e.g., a PEG lipid, such as PEG2k-DMG
  • a neutral lipid e.g., DSPC
  • the gRNA comprising a guide sequence of Table 1 or one or more sgRNAs from Table 2 together with an RNA-guided DNA nuclease such as a Cas nuclease translated from the nucleic acid induce DSBs, and non-homologous ending joining (NHEJ) during repair leads to a mutation in the TTR gene.
  • NHEJ non-homologous ending joining
  • NHEJ leads to a deletion or insertion of a nucleotide(s), which induces a frame shift or nonsense mutation in the TTR gene.
  • administering the corticosteroid and the guide RNA reduces levels (e.g., serum levels) of TTR in the subject, and therefore prevents accumulation and aggregation of TTR in amyloids or amyloid fibrils.
  • levels e.g., serum levels
  • reducing or preventing the accumulation of TTR in amyloids or amyloid fibrils of a subject comprises reducing or preventing TTR deposition in one or more tissues of the subject, such as stomach, colon, or nervous tissue.
  • the nervous tissue comprises sciatic nerve or dorsal root ganglion.
  • TTR deposition is reduced in two, three, or four of the stomach, colon, dorsal root ganglion, and sciatic nerve. The level of deposition in a given tissue can be determined using a biopsy sample, e.g., using immunostaining.
  • reducing or preventing the accumulation of TTR in amyloids or amyloid fibrils of a subject and/or reducing or preventing TTR deposition is inferred based on reducing serum TTR levels for a period of time.
  • reducing serum TTR levels in accordance with methods and uses provided herein can result in clearance of deposited TTR from tissues such as those discussed above and in the examples, e.g., as measured 8 weeks after administration of the composition.
  • the subject is mammalian. In some embodiments, the subject is human. In some embodiments, the subject is cow, pig, monkey, sheep, dog, cat, fish, or poultry.
  • RNA-guided DNA-binding agent may be a Cas9, e.g. an S. pyogenes Cas9.
  • the guide RNA is chemically modified.
  • the composition comprising the guide RNA and nucleic acid is administered intravenously. In some embodiments, the composition comprising the guide RNA and nucleic acid is administered into the hepatic circulation.
  • a single administration of a composition comprising a guide RNA (and optionally an RNA-guided DNA binding agent or a nucleic acid encoding an RNA-guided DNA binding agent) provided herein is sufficient to knock down expression of the mutant protein.
  • a single administration of a composition comprising a guide RNA (and optionally an RNA-guided DNA binding agent or a nucleic acid encoding an RNA-guided DNA binding agent) provided herein is sufficient to knock out expression of the mutant protein in a population of cells.
  • a composition comprising a guide RNA (and optionally an RNA- guided DNA binding agent or a nucleic acid encoding an RNA-guided DNA binding agent) provided herein may be beneficial to maximize editing via cumulative effects.
  • a composition provided herein can be administered 2, 3, 4, 5, or more times, such as 2 times. Administrations can be separated by a period of time ranging from, e.g., 1 day to 2 years, such as 1 to 7 days, 7 to 14 days, 14 days to 30 days, 30 days to 60 days, 60 days to 120 days, 120 days to 183 days, 183 days to 274 days, 274 days to 366 days, or 366 days to 2 years.
  • a composition is administered in an effective amount in the range of 0.01 to 10 mg/kg (mpk), e.g., 0.01 to 0.1 mpk, 0.1 to 0.3 mpk, 0.3 to 0.5 mpk, 0.5 to 1 mpk, 1 to 2 mpk, 2 to 3 mpk, 3 to 5 mpk, 5 to 10 mpk, or 0.1, 0.2, 0.3, 0.5, 1, 2, 3, 5, or 10 mpk.
  • a composition is administered in the amount of 2-4 mpk, such as 2.5-3.5 mpk.
  • a composition is administered in the amount of about 3 mpk.
  • the dosage or effective amount is assessed by total RNA administered.
  • the efficacy of treatment with the compositions of the invention is seen at 1 year, 2 years, 3 years, 4 years, 5 years, or 10 years after delivery .
  • efficacy of treatment with the compositions of the invention is assessed by measuring serum levels of TTR before and after treatment.
  • efficacy of treatment with the compositions assessed via a reduction of serum levels of TTR is seen at 1 week, 2 weeks, 3 weeks, 4 weeks, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, or at 11 months.
  • treatment slows or halts disease progression.
  • treatment slows or halts progression of FAP. In some embodiments, treatment results in improvement, stabilization, or slowing of change in symptoms of sensorimotor neuropathy or autonomic neuropathy.
  • treatment results in improvement, stabilization, or slowing of change in symptoms of FAC. In some embodiments, treatment results in improvement, stabilization, or slowing of change symptoms of restrictive cardiomyopathy or congestive heart failure.
  • efficacy of treatment is measured by increased survival time of the subject. In some embodiments, efficacy of treatment is measured by increased tolerability of the treatment. In some embodiments, increased tolerability, e.g. cytokine, complement, or other immune response is measured.
  • efficacy of treatment is measured by improvement or slowing of progression in symptoms of sensorimotor or autonomic neuropathy. In some embodiments, efficacy of treatment is measured by an increase or a a slowing of decrease in ability to move an area of the body or to feel in any area of the body. In some embodiments, efficacy of treatment is measured by improvement or a slowing of decrease in the ability to swallow; breath; use arms, hands, legs, or feet; or walk. In some embodiments, efficacy of treatment is measured by improvement or a slowing of progression of neuralgia. In some embodiments, the neuralgia is characterized by pain, burning, tingling, or abnormal feeling.
  • efficacy of treatment is measured by improvement or a slowing of increase in postural hypotension, dizziness, gastrointestinal dysmotility, bladder dysfunction, or sexual dysfunction. In some embodiments, efficacy of treatment is measured by improvement or a slowing of progression of weakness. In some embodiments, efficacy of treatment is measured using electromyogram, nerve conduction tests, or patient-reported outcomes. [00574] In some embodiments, efficacy of treatment is measured by improvement or slowing of progression of symptoms of congestive heart failure or CHF. In some
  • efficacy of treatment is measured by an decrease or a slowing of increase in shortness of breath, trouble breathing, fatigue, or swelling in the ankles, feet, legs, abdomen, or veins in the the neck.
  • efficacy of treatment is measured by improvement or a slowing of progression of fluid buildup in the body, which may be assessed by measures such as weight gain, frequent urination, or nighttime cough.
  • efficacy of treatment is measured using cardiac biomarker tests (such as El- type natriuretic peptide [BNP] or N-termmal pro b-type natriuretic peptide [NT-proBNP]), lung function tests, chest x-rays, or electrocardiography.
  • the invention comprises combination therapies comprising administering a corticosteroid and any one of the gRNAs compnsing any one or more of the guide sequences disclosed in Table 1 or any one or more of the sgRNAs in Table 2 (and optionally an RNA-guided DNA binding agent or a nucleic acid described herein encoding an RNA-guided DNA binding agent, such as a nucleic acid (e.g. mRNA) or vector described herein encoding an S. pyogenes Cas9) (e.g., in a composition provided herein) together with an additional therapy suitable for alleviating symptoms of ATTR.
  • the guide RNA is chemically modified.
  • the guide RNA and the nucleic acid encoding an RNA-guided DNA nuclease are administered in an LNP described herein, such as an LNP comprising a CCD lipid (e.g., an amine lipid, such as lipid A), a helper lipid (e.g., cholesterol), a stealth lipid (e.g., a PEG lipid, such as PEG2k-DMG), and optionally a neutral lipid (e.g., DSPC).
  • a CCD lipid e.g., an amine lipid, such as lipid A
  • helper lipid e.g., cholesterol
  • a stealth lipid e.g., a PEG lipid, such as PEG2k-DMG
  • a neutral lipid e.g., DSPC
  • the additional therapy for ATTR is a treatment for sensorimotor or autonomic neuropathy.
  • the treatment for sensorimotor or autonomic neuropathy is a nonsteroidal anti-inflammatory drug, antidepressant, anticonvulsant medication, antiarrythmic medication, or narcotic agent.
  • the antidepressant is a tncylic agent or a serotonin-norepinephrine reuptake inhibitor. In some embodiments, the antidepressant is amitriptyline, duloxetine, or venlafaxine. In some embodiments, the anticonvulsant agent is gabapentin, pregabalin, topiramate, or carbamazepine. In some embodiments, the additional therapy for sensorimotor neuropathy is transcutaneous electrical nerve stimulation. [00577] In some embodiments, the additional therapy for ATTR is a treatment for restrictive cardiomyopathy or congestive heart failure (CHF).
  • CHF congestive heart failure
  • the treatment for CHF is a ACE inhibitor, aldosterone antagonist, angiotensin receptor blocker, beta blocker, digoxin, diuretic, or isosorbide dinitrate/hydralazine hydrochloride.
  • the ACE inhibitor is enalapril, captopril, ramipril, perindopril, imidapril, or quinapril.
  • the aldosterone antagonist is eplerenone or spironolactone.
  • the angiotensin receptor blocker is azilsartan, cadesartan, eprosartan, irbesartan, losartan, olmesartan, telmisartan, or valsartan.
  • the beta blocker is acebutolol, atenolol, bisoprolol, metoprolol, nadolol, nebivolol, or propranolol.
  • the diuretic is chlorothiazide, chlorthalidone, hydrochlorothiazide, indapamide, metolazone, bumetanide, furosemide, torsemide, amiloride, or triameterene.
  • the combination therapy comprises administering a corticosteroid and any one of the gRNAs comprising any one or more of the guide sequences disclosed in Table 1 or any one or more of the sgRNAs in Table 2 (and optionally an RNA- guided DNA binding agent or a nucleic acid described herein encoding an RNA-guided DNA binding agent) (e.g., in a composition provided herein) together with a siRNA that targets TTR or mutant TTR.
  • the siRNA is any siRNA capable of further reducing or eliminating the expression of wild type or mutant TTR.
  • the siRNA is the drug Patisiran (ALN-TTR02) or ALN-TTRsc02.
  • the siRNA is administered after any one of the gRNAs comprising any one or more of the guide sequences disclosed in Table 1 or any one or more of the sgRNAs in Table 2 (e.g., in a composition provided herein). In some embodiments, the siRNA is administered on a regular basis following treatment with any of the gRNA compositions provided herein.
  • the combination therapy comprises administering a corticosteroid and any one of the gRNAs comprising any one or more of the guide sequences disclosed in Table 1 or any one or more of the sgRNAs in Table 2 (and optionally an RNA- guided DNA binding agent or a nucleic acid described herein encoding an RNA-guided DNA binding agent) (e.g., in a composition provided herein) together with antisense nucleotide that targets TTR or mutant TTR.
  • the antisense nucleotide is any antisense nucleotide capable of further reducing or eliminating the expression of wild type or mutant TTR.
  • the antisense nucleotide is the dmg Inotersen (IONS- TTRR X ). In some embodiments, the antisense nucleotide is administered after any one of the gRNAs comprising any one or more of the guide sequences disclosed in Table 1 or any one or more of the sgRNAs in Table 2 and a nucleic acid encoding an RNA-guided DNA-binding agent (e g., in a composition provided herein). In some embodiments, the antisense nucleotide is administered on a regular basis following treatment with any of the gRNA compositions provided herein.
  • the combination therapy comprises administering a corticosteroid and any one of the gRNAs comprising any one or more of the guide sequences disclosed in Table 1 or any one or more of the sgRNAs in Table 2 (and optionally an RNA- guided DNA binding agent or a nucleic acid described herein encoding an RNA-guided DNA binding agent) (e.g., in a composition provided herein) together with a small molecule stabilizer that promotes kinetic stabilization of the correctly folded tetrameric form of TTR.
  • the small molecule stabilizer is the dmg tafamidis (Vyndaqel ® ) or diflumsal. In some embodiments, the small molecule stabilizer is administered after any one of the gRNAs comprising any one or more of the guide sequences disclosed in Table 1 or any one or more of the sgRNAs in Table 2 (e g., in a composition provided herein). In some embodiments, the small molecule stabilizer is administered on a regular basis following treatment with any of the compositions provided herein.
  • the guide sequences disclosed in Table 1 may be selected from SEQ ID Nos: 5-72, 74-78, and 80-82, and/or the sgRNAs in Table 2 may be selected from SEQ ID Nos: 87-113, 115-120, and 122-124, and/or the guide RNA may be a chemically modified guide RNA.
  • the nucleic acid compositions described herein comprising a gRNA, and optionally a nucleic acid described herein encoding an RNA-guided DNA- binding agent as RNA or encoded on one or more vectors, are formulated in or administered via a lipid nanoparticle; see e.g., WO2017173054A1 published October 5, 2017 and WO2019067992A1 published April 4, 2019, the contents of which are hereby incorporated by reference in their entirety.
  • lipid nanoparticle Any lipid nanoparticle (LNP) known to those of skill in the art to be capable of delivering nucleotides to subjects may be utilized with the guide RNAs described herein, and optionallythe nucleic acid encoding an RNA-guided DNA nuclease.
  • LNP lipid nanoparticle
  • LNP formulations for RNAs may include (i) a CCD lipid, such as an amine lipid, (ii) a neutral lipid, (iii) a helper lipid, and (IV) a stealth lipid, such as a PEG lipid.
  • Some embodiments of the LNP formulations include an“amine lipid”, along with a helper lipid, a neutral lipid, and a stealth lipid such as a PEG lipid.
  • the LNP formulations include less than 1 percent neutral phospholipid.
  • the LNP formulations include less than 0.5 percent neutral phospholipid.
  • “lipid nanoparticle” is meant a particle that comprises a plurality of (i.e. more than one) lipid molecules physically associated with each other by intermolecular forces.
  • Lipid compositions for delivery of CRISPR/Cas mRNA and guide RNA components to a target cell, such as a liver cell comprise a CCD Lipid.
  • the CCD lipid is Lipid A, which is (9Z,12Z)-3-((4,4- bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylammo)propoxy)carbonyl)oxy)methyl)propyl octadeca-9,12-dienoate, also called 3-((4,4-bis(octyloxy)butanoyl)oxy)-2-(((3- (diethylamino)propoxy)carbonyl)oxy)methyl)propyl (9Z, 12Z)-octadeca-9, 12-dienoate.
  • Lipid A can be depicted as:
  • Lipid A may be synthesized according to W02015/095340 (e.g., pp. 84-86).
  • the CCD lipid is Lipid B, which is ((5- ((dimethylamino)methyl)-l,3-phenylene)bis(oxy))bis(octane-8,l-diyl)bis(decanoate), also called ((5-((dimethylamino)methyl)-l,3-phenylene)bis(oxy))bis(octane-8,l-diyl)
  • Lipid B can be depicted as:
  • Lipid B may be synthesized according to WO2014/136086 (e.g., pp. 107-09).
  • the CCD lipid is Lipid C, which is 2-((4-(((3- (dimethylamino)propoxy)carbonyl)oxy)hexadecanoyl)oxy)propane-l,3-diyl (9Z,9'Z,12Z,12'Z)-bis(octadeca-9,12-dienoate).
  • Lipid C can be depicted as:
  • the CCD lipid is Lipid D, which is 3-(((3- (dimethylamino)propoxy)carbonyl)oxy)-13-(octanoyloxy)tridecyl 3-octylundecanoate.
  • Lipid D can be depicted as:
  • Lipid C and Lipid D may be synthesized according to W02015/095340.
  • the CCD lipid can also be an equivalent to Lipid A, Lipid B, Lipid C, or Lipid D.
  • the CCD lipid is an equivalent to Lipid A, an equivalent to Lipid B, an equivalent to Lipid C, or an equivalent to Lipid D.
  • the LNP compositions for the delivery of biologically active agents comprise an“amine lipid”, which is defined as Lipid A, Lipid B, Lipid C, Lipid D or equivalents of Lipid A (including acetal analogs of Lipid A), equivalents of Lipid B, equivalents of Lipid C, and equivalents of Lipid D.
  • an“amine lipid which is defined as Lipid A, Lipid B, Lipid C, Lipid D or equivalents of Lipid A (including acetal analogs of Lipid A), equivalents of Lipid B, equivalents of Lipid C, and equivalents of Lipid D.
  • the amine lipid is Lipid A, which is (9Z,12Z)-3-((4,4- bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-9,12-dienoate, also called 3-((4,4-bis(octyloxy)butanoyl)oxy)-2-(((3- (diethylamino)propoxy)carbonyl)oxy)methyl)propyl (9Z, 12Z)-octadeca-9, 12-dienoate.
  • Lipid A can be depicted as:
  • Lipid A may be synthesized according to W02015/095340 (e.g., pp. 84-86).
  • the amine lipid is an equivalent to Lipid A.
  • an amine lipid is an analog of Lipid A.
  • a Lipid A analog is an acetal analog of Lipid A.
  • the acetal analog is a C4-C12 acetal analog.
  • the acetal analog is a C5-C12 acetal analog.
  • the acetal analog is a C5-C10 acetal analog.
  • the acetal analog is chosen from a C4, C5, C6, C7,
  • Amine lipids suitable for use in the LNPs described herein are biodegradable in vivo and suitable for delivering a biologically active agent, such as an RNA to a cell.
  • the amine lipids have low toxicity (e.g., are tolerated in an animal model without adverse effect in amounts of greater than or equal to 10 mg/ ' kg of RNA cargo).
  • LNPs comprising an amine lipid include those where at least 75% of the amine lipid is cleared from the plasma within 8, 10, 12, 24, or 48 hours, or 3, 4, 5, 6, 7, or 10 days.
  • LNPs comprising an amine lipid include those where at least 50% of the mRNA or gRNA is cleared from the plasma within 8, 10, 12, 24, or 48 hours, or 3, 4, 5, 6, 7, or 10 days. In certain embodiments, LNPs comprising an amine lipid include those where at least 50% of the LNP is cleared from the plasma within 8, 10, 12, 24, or 48 hours, or 3, 4,
  • lipid-encapsulated versus free lipid, RNA, or nucleic acid component of the LNP is measured.
  • Lipid clearance may be measured as described in literature. See Maier, M.A., et al. Biodegradable Lipids Enabling Rapidly Eliminated Lipid Nanoparticles for Systemic Delivery of RNAi Therapeutics. Mol. Ther. 2013, 21(8), 1570-78 ⁇ Maier”).
  • LNP-siRNA systems containing luciferases-targeting siRNA were administered to six- to eight-week old male C57B1/6 mice at 0.3 mg/kg by intravenous bolus injection via the lateral tail vein. Blood, liver, and spleen samples were collected at 0.083, 0.25, 0.5, 1, 2, 4, 8, 24, 48, 96, and 168 hours post-dose.
  • mice were perfused with saline before tissue collection and blood samples were processed to obtain plasma. All samples were processed and analyzed by LC-MS. Further, Maier descnbes a procedure for assessing toxicity after administration of LNP-siRNA formulations. For example, a luciferase-targeting siRNA was administered at 0, 1, 3, 5, and 10 mg/kg (5 animals/group) via single intravenous bolus injection at a dose volume of 5 mL/kg to male Sprague-Dawley rats. After 24 hours, about 1 mL of blood was obtained from the jugular vein of conscious animals and the serum was isolated. At 72 hours post-dose, all animals were euthanized for necropsy.
  • a luciferase-targeting siRNA was administered at 0, 1, 3, 5, and 10 mg/kg (5 animals/group) via single intravenous bolus injection at a dose volume of 5 mL/kg to male Sprague-Dawley rats. After 24 hours, about 1
  • the amine lipids may lead to an increased clearance rate.
  • the clearance rate is a lipid clearance rate, for example the rate at which a lipid is cleared from the blood, serum, or plasma.
  • the clearance rate is an RNA clearance rate, for example the rate at which an mRNA or a gRNA is cleared from the blood, serum, or plasma.
  • the clearance rate is the rate at which LNP is cleared from the blood, serum, or plasma.
  • the clearance rate is the rate at which LNP is cleared from a tissue, such as liver tissue or spleen tissue.
  • a high clearance rate leads to a safety profile with no substantial adverse effects.
  • the amine lipids may reduce LNP accumulation in circulation and in tissues. In some embodiments, a reduction in LNP accumulation in circulation and in tissues leads to a safety profile with no substantial adverse effects.
  • the amine lipids of the present disclosure are ionizable (e.g., may form a salt) depending upon the pH of the medium they are in.
  • the amine lipids may be protonated and thus bear a positive charge.
  • a slightly basic medium such as, for example, blood, where pH is approximately 7.35
  • the amine lipids may not be protonated and thus bear no charge.
  • the amine lipids of the present disclosure may be protonated at a pH of at least about 9.
  • the amine lipids of the present disclosure may be protonated at a pH of at least about 9.
  • the amine lipids of the present disclosure may be protonated at a pH of at least about 10.
  • the pH at which an amine lipid is predominantly protonated is related to its intrinsic pKa.
  • the amine lipids of the present disclosure may each, independently, have a pKa in the range of from about 5.1 to about 7.4. In some
  • the amine lipids of the present disclosure may each, independently, have a pKa in the range of from about 5.5 to about 6.6. In some embodiments, the amine lipids of the present disclosure may each, independently, have a pKa in the range of from about 5.6 to about 6.4. In some embodiments, the amine lipids of the present disclosure may each, independently, have a pKa in the range of from about 5.8 to about 6.2. For example, the amine lipids of the present disclosure may each, independently, have a pKa in the range of from about 5.8 to about 6.5.
  • the pKa of an amine lipid can be an important consideration in formulating LNPs as it has been found that cationic lipids with a pKa ranging from about 5.1 to about 7.4 are effective for delivery of cargo in vivo, e.g., to the liver. Furthermore, it has been found that cationic lipids with a pKa ranging from about 5.3 to about 6.4 are effective for delivery in vivo, e.g., to tumors. See , e.g., WO 2014/136086.
  • Neutral lipids suitable for use in a lipid composition of the disclosure include, for example, a variety of neutral, uncharged or zwitterionic lipids.
  • Examples of neutral phospholipids suitable for use in the present disclosure include, but are not limited to, 5- heptadecylbenzene-l,3-diol (resorcinol), dipalmitoylphosphatidylcholine (DPPC), distearoylphosphatidylcholine (DSPC), pohsphocholine (DOPC),
  • DMPC dimyristoylphosphatidylcholine
  • PLPC phosphatidylcholine
  • DAPC 1,2-distearoyl-sn- glycero-3-phosphocholine
  • PE phosphatidylethanolamine
  • EPC egg phosphatidylcholine
  • DLPC dilauryloylphosphatidylcholine
  • DMPC dimyristoylphosphatidylcholine
  • MPPC 1- myristoyl-2-palmitoyl phosphatidylcholine
  • MPPC l-palmitoyl-2-myristoyl
  • PMPC phosphatidylcholine
  • PSPC l-palmitoyl-2-stearoyl phosphatidylcholine
  • DBPC 1,2- diarachidoyl-sn-glycero-3-phosphocholine
  • SPPC phosphatidylcholine
  • DEPC l,2-dieicosenoyl-sn-glycero-3-phosphocholine
  • POPC palmitoyloleoyl phosphatidylcholine
  • DOPE dioleoyl phosphatidylethanolamine
  • DOPE dilinoleoylphosphatidylcholine
  • DSPE distearoylphosphatidylethanolamine
  • DMPE dimyristoyl phosphatidylethanolamine
  • DPPE dipalmitoyl phosphatidylethanolamine
  • the neutral phospholipid may be selected from the group consisting of distearoylphosphatidylcholine (DSPC) and dimyristoyl phosphatidyl ethanolamine (DMPE).
  • the neutral phospholipid may be distearoylphosphatidylcholine (DSPC).
  • the neutral phospholipid may be
  • DPPC dipalmitoylphosphatidylcholine
  • Helper lipids include steroids, sterols, and alkyl resorcinols.
  • Helper lipids suitable for use in the present disclosure include, but are not limited to, cholesterol, 5- heptadecylresorcinol, and cholesterol hemisuccinate.
  • the helper lipid may be cholesterol.
  • the helper lipid may be cholesterol hemisuccinate.
  • Stepalth lipids are lipids that alter the length of time the nanoparticles can exist in vivo (e.g., in the blood). Stealth lipids may assist in the formulation process by, for example, reducing particle aggregation and controlling particle size. Stealth lipids used herein may modulate pharmacokinetic properties of the LNP.
  • Stealth lipids suitable for use in a lipid composition of the disclosure include, but are not limited to, stealth lipids having a hydrophilic head group linked to a lipid moiety .
  • Stealth lipids suitable for use in a lipid composition of the present disclosure and information about the biochemistry of such lipids can be found in Romberg et ak, Pharmaceutical Research, Vol.
  • the hydrophilic head group of stealth lipid comprises a polymer moiety selected from polymers based on PEG.
  • Stealth lipids may comprise a lipid moiety.
  • the stealth lipid is a PEG lipid.
  • PEG lipids may assist in the formulation process by, for example, reducing particle aggregation and controlling particle size. PEG lipids used herein may modulate pharmacokinetic properties of the LNPs.
  • the PEG lipid comprises a lipid moiety and a polymer moiety based on PEG.
  • a stealth lipid comprises a polymer moiety selected from polymers based on PEG (sometimes referred to as polyethylene oxide)), poly(oxazoline), poly(vinyl alcohol), poly(glycerol), poly(N-vinylpyrrolidone), polyaminoacids and poly[N- (2-hydroxypropyl)methacrylamide]
  • PEG sometimes referred to as polyethylene oxide
  • poly(oxazoline) poly(vinyl alcohol), poly(glycerol), poly(N-vinylpyrrolidone), polyaminoacids and poly[N- (2-hydroxypropyl)methacrylamide]
  • the PEG lipid comprises a polymer moiety' based on PEG (sometimes referred to as polyethylene oxide)).
  • the PEG lipid further comprises a lipid moiety.
  • the lipid moiety may be derived from diacylglycerol or diacylglycamide, including those comprising a dialkylglycerol or dialkylglycamide group having alkyl chain length independently comprising from about C4 to about C40 saturated or unsaturated carbon atoms, wherein the chain may comprise one or more functional groups such as, for example, an amide or ester.
  • the alkyl chad length comprises about CIO to C20.
  • dialkylglycerol or dialkylglycamide group can further comprise one or more substituted alkyl groups.
  • the chain lengths may be symmetrical or assymetric.
  • PEG polyethylene glycol or other polyalky lene ether polymer.
  • PEG is an optionally substituted linear or branched polymer of ethylene glycol or ethylene oxide.
  • PEG is unsubstituted.
  • the PEG is substituted, e.g., by one or more alkyl, alkoxy, acyl, hydroxy, or aryl groups.
  • the term includes PEG copolymers such as PEG-poly urethane or PEG-polypropylene (see, e g., J. Milton Harris, Polyethylene glycol) chemistry: biotechnical and biomedical applications (1992)); in another embodiment, the term does not include PEG copolymers.
  • the PEG has a molecular weight of from about 130 to about 50,000, in a sub embodiment, about 150 to about 30,000, in a sub-embodiment, about 150 to about 20,000, in a sub-embodiment about 150 to about 15,000, in a sub-embodiment, about 150 to about 10,000, in a sub-embodiment, about 150 to about 6,000, in a sub-embodiment, about 150 to about 5,000, in a sub-embodiment, about 150 to about 4,000, in a sub-embodiment, about 150 to about 3,000, in a sub-embodiment, about 300 to about 3,000, in a sub-embodiment, about 1,000 to about 3,000, and in a sub-embodiment, about 1,500 to about 2,500.
  • the PEG (e.g., conjugated to a lipid moiety or lipid, such as a stealth lipid), is a“PEG-2K,” also termed“PEG 2000,” which has an average molecular weight of about 2,000 daltons.
  • PEG-2K is represented herein by the following formula (I), wherein n is 45, meaning that the number averaged degree of polymerization comprises about 45 subunits.
  • n may range from about 30 to about 60.
  • n may range from about 35 to about 55. In some embodiments, n may range from about 40 to about 50. In some embodiments, n may range from about 42 to about 48. In some embodiments, n may be 45.
  • R may be selected from H, substituted alkyl, and unsubstituted alkyl. In some embodiments, R may be unsubstituted alky l. In some embodiments, R may be methyl.
  • the PEG lipid may be selected from PEG-dilauroylglycerol, PEG-dimyristoylglycerol (PEG-DMG) (catalog # GM-020 from NOF, Tokyo, Japan), PEG-dipalmitoylglycerol, PEG-distearoylglycerol (PEG-DSPE) (catalog # DSPE-020CN, NOF, Tokyo, Japan), PEG-dilaurylglycamide, PEG- dimynstylglycamide, PEG-dipalmitoylglycamide, and PEG-distearoylglycamide, PEG- cholesterol (l-[8'-(Cholest-5-en-3[beta]-oxy)carboxamido-3',6'-dioxaoctanyl]carbamoyl- [omega]-methyl-poly(ethylene glycol)
  • the PEG lipid may be PEG2k-DMG. In some embodiments, the PEG lipid may be PEG2k-DSG. In one embodiment, the PEG lipid may be PEG2k-DSPE.
  • the PEG lipid may be PEG2k-DMA. In one embodiment, the PEG lipid may be PEG2k-C-DMA. In one embodiment, the PEG lipid may be compound S027, disclosed in WO2016/010840
  • the PEG lipid may be PEG2k-DSA. In one embodiment, the PEG lipid may be PEG2k-Cl 1. In some embodiments, the PEG lipid may be PEG2k-C14. In some embodiments, the PEG lipid may be PEG2k-C16. In some embodiments, the PEG lipid may be PEG2k-C18.
  • the LNP may contain (i) an amine lipid for encapsulation and for endosomal escape, (ii) a neutral lipid for stabilization, (iii) a helper lipid, also for stabilization, and (iv) a stealth lipid, such as a PEG lipid.
  • the neutral lipid may be omitted.
  • an LNP composition may comprise an RNA component that includes one or more of an RNA-guided DNA-binding agent, a Cas nuclease mRNA, a Class 2 Cas nuclease mRNA, a Cas9 mRNA, and a gRNA.
  • an LNP composition includes an mRNA encoding a Class 2 Cas nuclease, e.g. S. pyogenes Cas9, and a gRNA as the RNA component.
  • an LNP composition may comprise the RNA component, an amine lipid, a helper lipid, a neutral lipid, and a stealth lipid.
  • the helper lipid is cholesterol.
  • the neutral lipid is DSPC.
  • the stealth lipid is PEG2k-DMG or PEG2k-Cl 1.
  • the LNP composition comprises Lipid A or an equivalent of Lipid A; a helper lipid; a neutral lipid; a stealth lipid; and a guide RNA.
  • the amine lipid is Lipid A.
  • the amine lipid is Lipid A or an acetal analog thereof; the helper lipid is cholesterol; the neutral lipid is DSPC; and the stealth lipid is PEG2k-DMG.
  • lipid compositions are described according to the respective molar ratios of the component lipids in the formulation.
  • Embodiments of the present disclosure provide lipid compositions described according to the respective molar ratios of the component lipids in the formulation.
  • the mol-% of the amine lipid may be from about 30 mol-% to about 60 mol-%.
  • the mol-% of the amine lipid may be from about 40 mol-% to about 60 mol-%.
  • the mol-% of the amine lipid may be from about 45 mol-% to about 60 mol-%.
  • the mol-% of the amine lipid may be from about 50 mol-% to about 60 mol-%. In one embodiment, the mol-% of the amine lipid may be from about 55 mol-% to about 60 mol-%. In one embodiment, the mol-% of the amine lipid may be from about 50 mol-% to about 55 mol-%. In one embodiment, the mol-% of the amine lipid may be about 50 mol-%. In one embodiment, the mol-% of the amine lipid may be about 55 mol-%.
  • the amine lipid mol-% of the LNP batch will be ⁇ 30%, ⁇ 25%, ⁇ 20%, ⁇ 15%, ⁇ 10%, ⁇ 5%, or ⁇ 2.5% of the target mol-%. In some embodiments, the amine lipid mol-% of the LNP batch will be ⁇ 4 mol-%, ⁇ 3 mol-%, ⁇ 2 mol-%, ⁇ 1.5 mol-%, ⁇ 1 mol-%, ⁇ 0.5 mol-%, or ⁇ 0.25 mol-% of the target mol-%. All mol-% numbers are given as a fraction of the lipid component of the LNP compositions. In certain embodiments, LNP inter-lot variability of the amine lipid mol-% will be less than 15%, less than 10% or less than 5%.
  • the mol-% of the neutral lipid may be from about 5 mol-% to about 15 mol-%. In one embodiment, the mol-% of the neutral lipid, e.g., neutral phospholipid, may be from about 7 mol-% to about 12 mol-%. In one embodiment, the mol-% of the neutral lipid, e.g., neutral phospholipid, may be from about 0 mol-% to about 5 mol-%. In one embodiment, the mol-% of the neutral lipid, e.g., neutral phospholipid, may be from about 0 mol-% to about 10 mol-%.
  • the mol- % of the neutral lipid may be from about 5 mol-% to about 10 mol-%. In one embodiment, the mol-% of the neutral lipid, e.g., neutral phospholipid, may be from about 8 mol-% to about 10 mol-%.
  • the mol-% of the neutral lipid may be about 5 mol-%, about 6 mol-%, about 7 mol-%, about 8 mol-%, about 9 mol-%, about 10 mol-%, about 11 mol-%, about 12 mol-%, about 13 mol-%, about 14 mol-%, or about 15 mol-%.
  • the mol-% of the neutral lipid e.g., neutral phospholipid
  • the mol-% of the neutral lipid may be from about 1 mol-% to about 5 mol-%. In one embodiment, the mol-% of the neutral lipid may be from about 0.1 mol-% to about 1 mol-%. In one embodiment, the mol-% of the neutral lipid such as neutral phospholipid may be about 0.1 mol-%, about 0.2 mol-%, about 0.5 mol-%, 1 mol-%, about 1.5 mol-%, about 2 mol-%, about 2.5 mol-%, about 3 mol-%, about 3.5 mol-%, about 4 mol-%, about 4.5 mol-%, or about 5 mol-%.
  • the mol-% of the neutral lipid may be less than about 1 mol-%. In one embodiment, the mol-% of the neutral lipid, e.g., neutral phospholipid, may be less than about 0.5 mol-%.
  • the mol-% of the neutral lipid may be about 0 mol-%, about 0.1 mol-%, about 0.2 mol-%, about 0.3 mol-%, about 0.4 mol-%, about 0.5 mol-%, about 0.6 mol-%, about 0.7 mol-%, about 0.8 mol-%, about 0.9 mol-%, or about 1 mol-%.
  • the formulations disclosed herein are free of neutral lipid (i.e., 0 mol-% neutral lipid).
  • the formulations disclosed herein are essentially free of neutral lipid (i.e., about 0 mol-% neutral lipid).
  • the formulations disclosed herein are free of neutral phospholipid (i.e., 0 mol-% neutral phospholipid). In some embodiments, the formulations disclosed herein are essentially free of neutral phospholipid (i.e., about 0 mol-% neutral phospholipid).
  • the neutral lipid mol-% of the LNP batch will be ⁇ 30%, ⁇ 25%, ⁇ 20%, ⁇ 15%, ⁇ 10%, ⁇ 5%, or ⁇ 2.5% of the target neutral lipid mol-%.
  • LNP inter-lot variability will be less than 15%, less than 10% or less than 5%.
  • the mol-% of the helper lipid may be from about 20 mol-% to about 60 mol-%. In one embodiment, the mol-% of the helper lipid may be from about 25 mol-% to about 55 mol-%. In one embodiment, the mol-% of the helper lipid may be from about 25 mol-% to about 50 mol-%. In one embodiment, the mol-% of the helper lipid may be from about 25 mol-% to about 40 mol-%. In one embodiment, the mol-% of the helper lipid may be from about 30 mol-% to about 50 mol-%.
  • the mol-% of the helper lipid may be from about 30 mol-% to about 40 mol-%. In one embodiment, the mol-% of the helper lipid is adjusted based on amine lipid, neutral lipid, and PEG lipid
  • the mol-% of the helper lipid is adjusted based on amine lipid and PEG lipid concentrations to bring the lipid component to 100 mol-%. In one embodiment, the mol-% of the helper lipid is adjusted based on amine lipid and PEG lipid concentrations to bring the lipid component to at least 99 mol-%. In some embodiments, the helper mol-% of the LNP batch will be ⁇ 30%, ⁇ 25%, ⁇ 20%, ⁇ 15%, ⁇ 10%, ⁇ 5%, or ⁇ 2.5% of the target mol-%. In certain embodiments, LNP inter-lot variability will be less than 15%, less than 10% or less than 5%.
  • the mol-% of the PEG lipid may be from about 1 mol-% to about 10 mol-%. In one embodiment, the mol-% of the PEG lipid may be from about 2 mol- % to about 10 mol-%. In one embodiment, the mol-% of the PEG lipid may be from about 2 mol-% to about 8 mol-%. In one embodiment, the mol-% of the PEG lipid may be from about 2 mol-% to about 4 mol-%. In one embodiment, the mol-% of the PEG lipid may be from about 2.5 mol-% to about 4 mol-%. In one embodiment, the mol-% of the PEG lipid may be about 3 mol-%.
  • the mol-% of the PEG lipid may be about 2.5 mol-%.
  • the PEG lipid mol-% of the LNP batch will be ⁇ 30%, ⁇ 25%, ⁇ 20%, ⁇ 15%, ⁇ 10%, ⁇ 5%, or ⁇ 2.5% of the target PEG lipid mol-%.
  • LNP inter-lot variability will be less than 15%, less than 10% or less than 5%.
  • the cargo includes a nucleic acid encoding an RNA- guided DNA-binding agent (e.g. a Cas nuclease, a Class 2 Cas nuclease, or Cas9), and a gRNA or a nucleic acid encoding a gRNA, or a combination of mRNA and gRNA.
  • an LNP composition may comprise a Lipid A or its equivalents.
  • the amine lipid is Lipid A.
  • the amine lipid is a Lipid A equivalent, e.g. an analog of Lipid A.
  • the amine lipid is an acetal analog of Lipid A.
  • an LNP composition comprises an amine lipid, a neutral lipid, a helper lipid, and a PEG lipid.
  • the helper lipid is cholesterol.
  • the neutral lipid is DSPC.
  • PEG lipid is PEG2k-DMG.
  • an LNP composition may comprise a Lipid A, a helper lipid, a neutral lipid, and a PEG lipid.
  • an LNP composition comprises an amine lipid, DSPC, cholesterol, and a PEG lipid.
  • the LNP composition comprises a PEG lipid comprising DMG.
  • the amine lipid is selected from Lipid A, and an equivalent of Lipid A, including an acetal analog of Lipid A.
  • an LNP composition comprises Lipid A, cholesterol, DSPC, and PEG2k-DMG.
  • an LNP composition comprises an amine lipid, a helper lipid, a neutral lipid, and a PEG lipid.
  • an LNP composition comprises an amine lipid, a helper lipid, a neutral phospholipid, and a PEG lipid.
  • an LNP composition comprises a lipid component that consists of an amine lipid, a helper lipid, a neutral lipid, and a PEG lipid.
  • an LNP composition comprises an amine lipid, a helper lipid, and a PEG lipid.
  • an LNP composition does not comprise a neutral lipid, such as a neutral phospholipid.
  • an LNP composition comprises a lipid component that consists of an amine lipid, a helper lipid, and a PEG lipid.
  • the neutral lipid is chosen from one or more of DSPC, DPPC, DAPC, DMPC, DOPC, DOPE, and DSPE.
  • the neutral lipid is DSPC.
  • the neutral lipid is DPPC.
  • the neutral lipid is DAPC.
  • the neutral lipid is DMPC.
  • the neutral lipid is DOPC.
  • the neutral lipid is DOPE.
  • the neutral lipid is DSPE.
  • the helper lipid is cholesterol.
  • an LNP composition may comprise a Lipid A, a helper lipid, and a PEG lipid.
  • an LNP composition may comprise a lipid component that consists of Lipid A, a helper lipid, and a PEG lipid.
  • an LNP composition comprises an amine lipid, cholesterol, and a PEG lipid.
  • an LNP composition comprises a lipid component that consists of an amine lipid, cholesterol, and a PEG lipid.
  • the LNP composition comprises a PEG lipid comprising DMG.
  • the amine lipid is selected from Lipid A and an equivalent of Lipid A, including an acetal analog of Lipid A.
  • the amine lipid is a C5-C12 or a C4-C12 acetal analog of Lipid A.
  • an LNP composition comprises Lipid A, cholesterol, and PEG2k- DMG.
  • Embodiments of the present disclosure also provide lipid compositions described according to the molar ratio between the positively charged amine groups of the amine lipid (N) and the negatively charged phosphate groups (P) of the nucleic acid to be encapsulated. This may be mathematically represented by the equation N/P.
  • an LNP composition may comprise a lipid component that comprises an amine lipid, a helper lipid, a neutral lipid, and a PEG lipid; and a nucleic acid component, wherein the N/P ratio is about 3 to 10.
  • an LNP composition may comprise a lipid component that comprises an amine lipid, a helper lipid, and a PEG lipid; and a nucleic acid component, wherein the N/P ratio is about 3 to 10.
  • an LNP composition may comprise a lipid component that comprises an amine lipid, a helper lipid, a neutral lipid, and a helper lipid; and an RNA component, wherein the N/P ratio is about 3 to 10.
  • an LNP composition may comprise a lipid component that comprises an amine lipid, a helper lipid, and a PEG lipid; and an RNA component, wherein the N/P ratio is about 3 to 10.
  • the N/P ratio may be about 5 to 7. In one embodiment, the N/P ration may be about 3 to 7. In one embodiment, the N/P ratio may be about 4.5 to 8. In one embodiment, the N/P ratio may be about 6. In one embodiment, the N/P ratio may be 6 ⁇ 1.
  • the N/P ratio may be 6 ⁇ 0.5. In some embodiments, the N/P ratio will be ⁇ 30%, ⁇ 25%, ⁇ 20%, ⁇ 15%, ⁇ 10%, ⁇ 5%, or ⁇ 2.5% of the target N/P ratio. In certain embodiments, LNP inter-lot variability will be less than 15%, less than 10% or less than 5%.
  • the RNA component may comprise a nucleic acid, such as a nucleic acid disclosed herein, e.g., encoding a Cas nuclease.
  • RNA component may comprise a Cas9 mRNA.
  • the LNP further comprises a gRNA nucleic acid, such as a gRNA.
  • the RNA component comprises a Cas nuclease mRNA and a gRNA.
  • the RNA component comprises a Class 2 Cas nuclease mRNA and a gRNA.
  • the gRNA may be an sgRNA described herein, such as a chemically modified sgRNA described herein.
  • an LNP composition may comprise a nucleic acid disclosed herein, e.g., encoding a Cas nuclease, such as a Class 2 Cas nuclease, a gRNA, an amine lipid, a helper lipid, a neutral lipid, and a PEG lipid.
  • the helper lipid is cholesterol; the neutral lipid is DSPC; and/or the PEG lipid is PEG2k-DMG or PEG2k-Cl 1.
  • the amine lipid is selected from Lipid A and its equivalents, such as an acetal analog of Lipid A.
  • the lipid component of the LNP composition consists of an amine lipid, a helper lipid, a neutral lipid, and a PEG lipid. In one embodiment, the lipid component of the LNP composition consists of an amine lipid, a helper lipid, and a PEG lipid. In certain compositions comprising an mRNA encoding a Cas nuclease and a gRNA, the helper lipid is cholesterol. In some compositions comprising an mRNA encoding a Cas nuclease and a gRNA, the neutral lipid is DSPC.
  • compositions comprising an mRNA encoding a Cas nuclease and a gRNA comprise less than about 1 mol-% neutral lipid, e.g. neutral phospholipid.
  • Certain compositions comprising an mRNA encoding a Cas nuclease and a gRNA comprise less than about 0.5 mol-% neutral lipid, e.g. neutral phospholipid.
  • the LNP does not comprise a neutral lipid, e.g., neutral phospholipid.
  • the PEG lipid is PEG2k-DMG or PEG2k-Cl 1.
  • the amine lipid is selected from Lipid A and its equivalents, such as acetal analogs of Lipid A.
  • an LNP composition may comprise an sgRNA.
  • an LNP composition may comprise a Cas9 sgRNA.
  • an LNP composition may comprise a Cpfl sgRNA.
  • the LNP includes an amine lipid, a helper lipid, a neutral lipid, and a PEG lipid.
  • the helper lipid is cholesterol.
  • the neutral lipid is DSPC.
  • the PEG lipid is PEG2k-DMG or PEG2k-Cl 1.
  • the amine lipid is selected from Lipid A and its equivalents, such as acetal analogs of Lipid A.
  • the LNP compositions include a Cas nuclease mRNA, such as a Class 2 Cas mRNA and at least one gRNA.
  • the LNP composition includes a ratio of gRNA to Cas nuclease mRNA, such as Class 2 Cas nuclease mRNA from about 25: 1 to about 1:25.
  • the LNP formulation includes a ratio of gRNA to Cas nuclease mRNA, such as Class 2 Cas nuclease mRNA from about 10: 1 to about 1:10.
  • the LNP formulation includes a ratio of gRNA to Cas nuclease mRNA, such as Class 2 Cas nuclease mRNA from about 8: 1 to about 1:8. As measured herein, the ratios are by weight. In some embodiments, the LNP formulation includes a ratio of gRNA to Cas nuclease mRNA, such as Class 2 Cas mRNA from about 5: 1 to about 1:5. In some embodiments, ratio range is about 3: 1 to 1:3, about 2:1 to 1:2, about 5: 1 to 1:2, about 5: 1 to 1: 1, about 3: 1 to 1:2, about 3:1 to 1: 1, about 3: 1, about 2: 1 to 1 : 1.
  • the gRNA to mRNA ratio is about 3 : 1 or about 2: 1
  • the ratio of gRNA to Cas nuclease mRNA, such as Class 2 Cas nuclease is about 1:1.
  • the ratio may be about 25: 1, 10: 1, 5: 1, 3:1, 1 : 1, 1:3, 1:5, 1 :10, or 1:25.
  • LNPs are formed by mixing an aqueous RNA solution with an organic solvent-based lipid solution, e.g., 100% ethanol.
  • Suitable solutions or solvents include or may contain: water, PBS, Tris buffer, NaCl, citrate buffer, ethanol, chloroform, diethylether, cyclohexane, tetrahydrofuran, methanol, isopropanol.
  • a pharmaceutically acceptable buffer e.g., for in vivo administration of LNPs, may be used.
  • a buffer is used to maintain the pH of the composition comprising LNPs at or above pH 6.5.
  • a buffer is used to maintain the pH of the composition comprising LNPs at or above pH 7.0.
  • the composition has a pH ranging from about 7.2 to about 7.7.
  • the composition has a pH ranging from about 7.3 to about 7.7 or ranging from about 7.4 to about 7.6.
  • the composition has a pH of about 7.2, 7.3, 7.4, 7.5, 7.6, or 7.7.
  • the pH of a composition may be measured with a micro pH probe.
  • a cryoprotectant is included in the composition.
  • cryoprotectants include sucrose, trehalose, glycerol, DMSO, and ethylene glycol.
  • Exemplary compositions may include up to 10% cr oprotectant, such as, for example, sucrose.
  • the LNP composition may include about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10% cryoprotectant. In certain embodiments, the LNP composition may include about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10% cryoprotectant. In certain embodiments, the LNP composition may include about 1, 2, 3, 4,
  • the LNP composition may include a buffer.
  • the buffer may comprise a phosphate buffer (PBS), a Tris buffer, a citrate buffer, and mixtures thereof.
  • the buffer comprises NaCl.
  • NaCl is omitted. Exemplary amounts of NaCl may range from about 20 mM to about 45 mM. Exemplary amounts of NaCl may range from about 40 mM to about 50 mM. In some embodiments, the amount of NaCl is about 45 mM.
  • the buffer is a Tris buffer. Exemplary amounts of Tris may range from about 20 mM to about 60 mM. Exemplary amounts of Tris may range from about 40 mM to about 60 mM. In some embodiments, the amount of Tris is about 50 mM.
  • the buffer comprises NaCl and Tris. Certain exemplary embodiments of the LNP compositions contain 5% sucrose and 45 mM NaCl in Tris buffer. In other exemplary embodiments, compositions contain sucrose in an amount of about 5% w/v, about 45 mM NaCl, and about 50 mM Tris at pH 7.5. The salt, buffer, and cryoprotectant amounts may be varied such that the osmolality of the overall formulation is maintained.
  • the final osmolality may be maintained at less than 450 mOsm/L.
  • the osmolalit is between 350 and 250 mOsm/L.
  • Certain embodiments have a final osmolality of 300 +/- 20 mOsm/L.
  • microfluidic mixing, T-mixing, or cross-mixing is used.
  • flow rates, junction size, junction geometry, junction shape, tube diameter, solutions, and/or RNA and lipid concentrations may be varied.
  • LNPs or LNP compositions may be concentrated or purified, e.g., via dialysis, tangential flow filtration, or
  • the LNPs may be stored as a suspension, an emulsion, or a lyophihzed powder, for example.
  • an LNP composition is stored at 2-8° C, in certain aspects, the LNP compositions are stored at room temperature.
  • an LNP composition is stored frozen, for example at -20° C or -80° C.
  • an LNP composition is stored at a temperature ranging from about 0° C to about -80° C. Frozen LNP compositions may be thawed before use, for example on ice, at room temperature, or at 25° C.
  • the LNPs may be, e.g. , microspheres (including unilamellar and multilamellar vesicles, e.g.,“liposomes”— lamellar phase lipid bilayers that, in some embodiments, are substantially spherical— and, in more particular embodiments, can comprise an aqueous core, e.g., comprising a substantial portion of RNA molecules), a dispersed phase in an emulsion, micelles, or an internal phase in a suspension.
  • microspheres including unilamellar and multilamellar vesicles, e.g.,“liposomes”— lamellar phase lipid bilayers that, in some embodiments, are substantially spherical— and, in more particular embodiments, can comprise an aqueous core, e.g., comprising a substantial portion of RNA molecules), a dispersed phase in an emulsion, micelles, or an internal phase in a suspension.
  • the LNP compositions are biodegradable, in that they do not accumulate to cytotoxic levels in vivo at a therapeutically effective dose. In some embodiments, the LNP compositions do not cause an innate immune response that leads to substantial adverse effects at a therapeutic dose level. In some embodiments, the LNP compositions provided herein do not cause toxicity at a therapeutic dose level.
  • the pdi may range from about 0.005 to about 0.75. In some embodiments, the pdi may range from about 0.01 to about 0.5. In some embodiments, the pdi may range from about zero to about 0.4. In some embodiments, the pdi may range from about zero to about 0.35. In some embodiments, the pdi may range from about zero to about 0.35. In some embodiments, the pdi may range from about zero to about 0.3. In some embodiments, the pdi may range from about zero to about 0.25. In some embodiments, the pdi may range from about zero to about 0.2. In some embodiments, the pdi may be less than about 0.08, 0.1, 0.15, 0.2, or 0.4.
  • the LNPs disclosed herein have a size (e.g., Z-average diameter) of about 1 to about 250 nm. In some embodiments, the LNPs have a size of about 10 to about 200 nm. In further embodiments, the LNPs have a size of about 20 to about 150 nm. In some embodiments, the LNPs have a size of about 50 to about 150 nm. In some embodiments, the LNPs have a size of about 50 to about 100 nm. In some embodiments, the LNPs have a size of about 50 to about 120 nm. In some embodiments, the LNPs have a size of about 60 to about 100 nm. In some embodiments, the LNPs have a size of about 75 to about 150 nm. In some embodiments, the LNPs have a size of about 75 to about 120 nm. In some embodiments,
  • the LNPs have a size of about 75 to about 100 nm. Unless indicated otherwise, all sizes referred to herein are the average sizes (diameters) of the fully formed nanoparticles, as measured by dynamic light scattering on a Malvern Zetasizer.
  • the nanoparticle sample is diluted in phosphate buffered saline (PBS) so that the count rate is approximately 200-400 kcps.
  • PBS phosphate buffered saline
  • the data is presented as a weighted-average of the intensify measure (Z-average diameter).
  • the LNPs are formed with an average encapsulation efficiency ranging from about 50% to about 100%. In some embodiments, the LNPs are formed with an average encapsulation efficiency ranging from about 50% to about 70%. In some embodiments, the LNPs are formed with an average encapsulation efficiency ranging from about 70% to about 90%. In some embodiments, the LNPs are formed with an average encapsulation efficiency ranging from about 90% to about 100%. In some embodiments, the LNPs are formed with an average encapsulation efficiency ranging from about 75% to about 95%.
  • the LNPs are formed with an average molecular weight ranging from about 1.00E+05 g/mol to about l.OOE+10 g/mol. In some embodiments, the LNPs are formed with an average molecular weight ranging from about 5.00E+05 g/mol to about 7.00E+07g/mol. In some embodiments, the LNPs are formed with an average molecular weight ranging from about 1.00E+06 g/mol to about l .OOE+10 g/mol. In some embodiments, the LNPs are formed with an average molecular weight ranging from about 1.00E+07 g/mol to about 1.00E+09 g/mol. In some embodiments, the LNPs are formed with an average molecular weight ranging from about 5.00E+06 g/mol to about 5.00E+09 g/mol.
  • the polydispersity (Mw/Mn; the ratio of the weight averaged molar mass (Mw) to the number averaged molar mass (Mn)) may range from about 1.000 to about 2.000. In some embodiments, the Mw/Mn may range from about 1.00 to about 1.500. In some embodiments, the Mw/Mn may range from about 1.020 to about 1.400. In some embodiments, the Mw/Mn may range from about 1.010 to about 1.100. In some embodiments, the Mw/Mn may range from about 1.100 to about 1.350.
  • DLS Dynamic Light Scattering
  • pdi polydispersity index
  • size of the LNPs of the present disclosure can be used to characterize the polydispersity index (“pdi”) and size of the LNPs of the present disclosure.
  • DLS measures the scattering of light that results from subjecting a sample to a light source.
  • PDI represents the distribution of particle size (around the mean particle size) in a population, with a perfectly uniform population having a PDI of zero.
  • the pdi may range from 0.005 to 0.75.
  • the pdi may range from 0.01 to 0.5.
  • the pdi may range from 0.02 to 0.4.
  • the pdi may range from 0.03 to 0.35.
  • the pdi may range from 0.1 to 0.35.
  • LNPs disclosed herein have a size of 1 to 250 nm. In some embodiments, the LNPs have a size of 10 to 200 nm. In further embodiments, the LNPs have a size of 20 to 150 nm. In some embodiments, the LNPs have a size of 50 to 150 nm. In some embodiments, the LNPs have a size of 50 to 100 nm. In some embodiments, the LNPs have a size of 50 to 120 nm. In some embodiments, the LNPs have a size of 75 to 150 nm. In some embodiments, the LNPs have a size of 30 to 200 nm.
  • the LNPs are formed with an average encapsulation efficiency ranging from 50% to 100%. In some embodiments, the LNPs are formed with an average encapsulation efficiency ranging from 50% to 70%. In some embodiments, the LNPs are formed with an average encapsulation efficiency ranging from 70% to 90%. In some embodiments, the LNPs are formed with an average encapsulation efficiency ranging from 90% to 100%. In some embodiments, the LNPs are formed with an average encapsulation efficiency ranging from 75% to 95%.
  • LNPs associated with the gRNAs disclosed herein are for use in preparing a medicament for treating ATTR.
  • LNPs associated with the gRNAs disclosed herein are for use in preparing a medicament for reducing or preventing accumulation and aggregation of TTR in amyloids or amyloid fibnls in subjects having ATTR.
  • LNPs associated with the gRNAs disclosed herein are for use in preparing a medicament for reducing serum TTR concentration.
  • LNPs associated with the gRNAs disclosed herein are for use in treating ATTR in a subject, such as a mammal, e.g., a primate such as a human. In some
  • LNPs associated with the gRNAs disclosed herein are for use in reducing or preventing accumulation and aggregation of TTR in amyloids or amyloid fibnls in subjects having ATTR, such as a mammal, e.g., a primate such as a human.
  • LNPs associated with the gRNAs disclosed herein are for use in reducing serum TTR concentration in a subject, such as a mammal, e.g., a primate such as a human.
  • the LNPs may be associated with the gRNAs disclosed herein and nucleic acids (e.g., mRNA) encoding an RNA-guided DNA binding agent (e.g. Cas9, Spy Cas9) disclosed herein.
  • nucleic acids e.g., mRNA
  • an RNA-guided DNA binding agent e.g. Cas9, Spy Cas9
  • Electroporation is also a well-known means for delivery of cargo, and any electroporation methodology may be used for delivery of any one of the gRNAs disclosed herein.
  • electroporation may be used to deliver any one of the gRNAs disclosed herein, and optionally an RNA-guided DNA nuclease such as Cas9 or a nucleic acid encoding an RNA-guided DNA nuclease such as Cas9.
  • the invention comprises a method for delivering any one of the gRNAs disclosed herein to an ex vivo cell, wherein the gRNA is associated with an LNP or not associated with an LNP.
  • the gRNA/LNP or gRNA is also optionally associated with an RNA-guided DNA nuclease such as Cas9 or a nucleic acid encoding an RNA-guided DNA nuclease, e.g., a nucleic acid (e.g., mRNA) encoding an RNA-guided DNA binding agent (e.g. Cas9, Spy Cas9) disclosed herein.
  • the invention comprises DNA or RNA vectors encoding any of the guide RNAs comprising any one or more of the guide sequences described herein.
  • the vectors in addition to guide RNA sequences, further comprise nucleic acids that do not encode guide RNAs. Nucleic acids that do not encode guide RNA include, but are not limited to, promoters, enhancers, regulatory sequences, and
  • the vector comprises one or more nucleotide sequence(s) encoding a crRNA, a trRNA, or a crRNA and trRNA.
  • the vector comprises one or more nucleotide sequence(s) encoding a sgRNA, and optionally a nucleic acid described herein encoding an RNA-guided DNA nuclease, which can be a Cas nuclease, such as Cas9 or Cpfl.
  • the vector comprises one or more nucleotide sequence(s) encoding a crRNA, a trRNA, and optionally a nucleic acid described herein encoding an RNA-guided DNA nuclease, which can be a Cas protein, such as, Cas9.
  • the Cas9 is from Streptococcus pyogenes (i.e.,
  • the nucleotide sequence encoding the crRNA, trRNA, or crRNA and trRNA comprises or consists of a guide sequence flanked by all or a portion of a repeat sequence from a naturally-occurring CRISPR/Cas system.
  • the nucleic acid comprising or consisting of the crRNA, trRNA, or crRNA and trRNA may further comprise a vector sequence wherein the vector sequence comprises or consists of nucleic acids that are not naturally found together with the crRNA. trRNA, or crRNA and trRNA.
  • the crRNA and the trRNA are encoded by non-contiguous nucleic acids within one vector. In other embodiments, the crRNA and the trRNA may be encoded by a contiguous nucleic acid. In some embodiments, the crRNA and the trRNA are encoded by opposite strands of a single nucleic acid. In other embodiments, the crRNA and the trRNA are encoded by the same strand of a single nucleic acid.
  • the vector may be circular. In other embodiments, the vector may be linear. In some embodiments, the vector may be enclosed in a lipid nanoparticle, liposome, non-lipid nanoparticle, or viral capsid.
  • Non-limiting exemplary vectors include plasmids, phagemids, cosmids, artificial chromosomes, minichromosomes, transposons, viral vectors, and expression vectors.
  • the vector may be a viral vector.
  • the viral vector may be genetically modified from its wild type counterpart.
  • the viral vector may comprise an insertion, deletion, or substitution of one or more nucleotides to facilitate cloning or such that one or more properties of the vector is changed.
  • properties may include packaging capacity, transduction efficiency, immunogenicity, genome integration, replication, transcription, and translation.
  • a portion of the viral genome may be deleted such that the virus is capable of packaging exogenous sequences having a larger size.
  • the viral vector may have an enhanced transduction efficiency.
  • the immune response induced by the virus in a host may be reduced.
  • viral genes that promote integration of the viral sequence into a host genome may be mutated such that the virus becomes non-integrating.
  • the viral vector may be replication defective.
  • the viral vector may comprise exogenous transcriptional or translational control sequences to drive expression of coding sequences on the vector.
  • the virus may be helper-dependent. For example, the virus may need one or more helper virus to supply viral components (such as, e.g., viral proteins) required to amplify and package the vectors into viral particles.
  • helper components including one or more vectors encoding the viral components
  • the vims may be helper-free.
  • the virus may be capable of amplifying and packaging the vectors without any helper virus.
  • the vector system described herein may also encode the viral components required for virus amplification and packaging.
  • Non-limiting exemplary viral vectors include adeno-associated virus (AAV) vector, lentivirus vectors, adenovirus vectors, helper dependent adenoviral vectors (HD Ad), herpes simplex virus (HSV-1) vectors, bacteriophage T4, baculovirus vectors, and retrovirus vectors.
  • AAV adeno-associated virus
  • lentivirus vectors lentivirus vectors
  • adenovirus vectors lentivirus vectors
  • adenovirus vectors lentivirus vectors
  • helper dependent adenoviral vectors HD Ad
  • HSV-1 herpes simplex virus
  • bacteriophage T4 bacteriophage T4
  • baculovirus vectors baculovirus vectors
  • retrovirus vectors include adeno-associated virus (AAV) vector, lentivirus vectors, adenovirus vectors, helper dependent adenoviral vectors (HD Ad), herpes simplex virus (
  • the viral vector is AAV2, AAV3, AAV3B, AAV5, AAV6, AAV6.2, AAV7, AAVrh.64Rl, AAVhu.37, AAVrh.8, AAVrh.32.33, AAV8, AAV9, AAVrhlO, or
  • the viral vector may a lentivirus vector.
  • the lentivirus may be non-integrating. In some embodiments, the lentivirus may be non-integrating. In some
  • the viral vector may be an adenovirus vector.
  • the adenovirus may be a high-cloning capacity or“gutless” adenovirus, where all coding viral regions apart from the 5' and 3' inverted terminal repeats (ITRs) and the packaging signal (T) are deleted from the virus to increase its packaging capacity.
  • the viral vector may be an HSV-1 vector.
  • the HSV-1 -based vector is helper dependent, and in other embodiments it is helper independent.
  • the viral vector may be bacteriophage T4.
  • the bacteriophage T4 may be able to package any linear or circular DNA or RNA molecules when the head of the virus is emptied.
  • the viral vector may be a baculovirus vector.
  • the viral vector may be a retrovirus vector.
  • one AAV vector may contain sequences encoding an RNA-guided DNA nuclease such as a Cas nuclease, while a second AAV vector may contain one or more guide sequences.
  • the vector may be capable of driving expression of one or more coding sequences in a cell.
  • the cell may be a prokaryotic cell, such as, e.g., a bacterial cell.
  • the cell may be a eukaryotic cell, such as, e.g., a yeast, plant, insect, or mammalian cell.
  • the eukaryotic cell may be a mammalian cell.
  • the eukaryotic cell may be a rodent cell.
  • the eukaryotic cell may be a human cell. Suitable promoters to drive expression in different types of cells are known in the art.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • Epidemiology (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Neurology (AREA)
  • Neurosurgery (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Cell Biology (AREA)
  • Mycology (AREA)
  • Pain & Pain Management (AREA)
  • Psychiatry (AREA)
  • Hospice & Palliative Care (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicinal Preparation (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
PCT/US2020/025533 2019-03-28 2020-03-27 Compositions and methods for ttr gene editing and treating attr amyloidosis comprising a corticosteroid or use thereof Ceased WO2020198706A1 (en)

Priority Applications (10)

Application Number Priority Date Filing Date Title
EP20720676.4A EP3946285A1 (en) 2019-03-28 2020-03-27 Compositions and methods for ttr gene editing and treating attr amyloidosis comprising a corticosteroid or use thereof
KR1020217035012A KR20220004984A (ko) 2019-03-28 2020-03-27 Ttr 유전자 편집을 위한 조성물 및 방법 및 코르티코스테로이드를 포함하는 attr 아밀로이드증의 치료 또는 그의 용도
JP2021557650A JP7636338B2 (ja) 2019-03-28 2020-03-27 コルチコステロイドを含む、ttr遺伝子編集およびattrアミロイドーシスを治療するための組成物および方法、またはその使用
CN202080039394.5A CN113874004A (zh) 2019-03-28 2020-03-27 用于ttr基因编辑和治疗attr淀粉样变性的包括皮质类固醇的组合物和方法或其用途
AU2020248337A AU2020248337A1 (en) 2019-03-28 2020-03-27 Compositions and methods for ttr gene editing and treating ATTR amyloidosis comprising a corticosteroid or use thereof
CA3134544A CA3134544A1 (en) 2019-03-28 2020-03-27 Compositions and methods for ttr gene editing and treating attr amyloidosis comprising a corticosteroid or use thereof
MX2021011690A MX2021011690A (es) 2019-03-28 2020-03-27 Composiciones y métodos para la edición del gen ttr y el tratamiento de la amiloidosis attr que comprende un corticosteroide o uso de este.
US17/486,758 US20230035659A1 (en) 2019-03-28 2021-09-27 Compositions and Methods for TTR Gene Editing and Treating ATTR Amyloidosis Comprising a Corticosteroid or Use Thereof
CONC2021/0014562A CO2021014562A2 (es) 2019-03-28 2021-10-28 Composiciones y métodos para la edición del gen ttr y el tratamiento de la amiloidosis attr que comprenden un corticosteroide o el uso de este
JP2025021006A JP2025081416A (ja) 2019-03-28 2025-02-12 コルチコステロイドを含む、ttr遺伝子編集およびattrアミロイドーシスを治療するための組成物および方法、またはその使用

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US201962825676P 2019-03-28 2019-03-28
US201962825637P 2019-03-28 2019-03-28
US62/825,676 2019-03-28
US62/825,637 2019-03-28

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US17/486,758 Continuation US20230035659A1 (en) 2019-03-28 2021-09-27 Compositions and Methods for TTR Gene Editing and Treating ATTR Amyloidosis Comprising a Corticosteroid or Use Thereof

Publications (1)

Publication Number Publication Date
WO2020198706A1 true WO2020198706A1 (en) 2020-10-01

Family

ID=70334147

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2020/025533 Ceased WO2020198706A1 (en) 2019-03-28 2020-03-27 Compositions and methods for ttr gene editing and treating attr amyloidosis comprising a corticosteroid or use thereof

Country Status (10)

Country Link
US (1) US20230035659A1 (cg-RX-API-DMAC7.html)
EP (1) EP3946285A1 (cg-RX-API-DMAC7.html)
JP (2) JP7636338B2 (cg-RX-API-DMAC7.html)
KR (1) KR20220004984A (cg-RX-API-DMAC7.html)
CN (1) CN113874004A (cg-RX-API-DMAC7.html)
AU (1) AU2020248337A1 (cg-RX-API-DMAC7.html)
CA (1) CA3134544A1 (cg-RX-API-DMAC7.html)
CO (1) CO2021014562A2 (cg-RX-API-DMAC7.html)
MX (1) MX2021011690A (cg-RX-API-DMAC7.html)
WO (1) WO2020198706A1 (cg-RX-API-DMAC7.html)

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2022125968A1 (en) * 2020-12-11 2022-06-16 Intellia Therapeutics, Inc. Polynucleotides, compositions, and methods for genome editing involving deamination
WO2022221697A1 (en) * 2021-04-17 2022-10-20 Intellia Therapeutics, Inc. Lipid nanoparticle compositions
WO2022271780A1 (en) * 2021-06-22 2022-12-29 Intellia Therapeutics, Inc. Methods for in vivo editing of a liver gene
US11591544B2 (en) 2020-11-25 2023-02-28 Akagera Medicines, Inc. Ionizable cationic lipids
WO2024003805A1 (en) * 2022-06-30 2024-01-04 Geneditbio Limited Methods and compositions for ttr gene editing and therapy using crispr system
JP2024519922A (ja) * 2021-05-21 2024-05-21 ビーム セラピューティクス インク. トランスサイレチン遺伝子の塩基編集
US12064479B2 (en) 2022-05-25 2024-08-20 Akagera Medicines, Inc. Lipid nanoparticles for delivery of nucleic acids and methods of use thereof
WO2025128871A2 (en) 2023-12-13 2025-06-19 Renagade Therapeutics Management Inc. Lipid nanoparticles comprising coding rna molecules for use in gene editing and as vaccines and therapeutic agents

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN120225668A (zh) * 2023-10-25 2025-06-27 石药集团中奇制药技术(石家庄)有限公司 一种高效低脱靶的基因编辑工具

Citations (20)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1993013121A1 (en) 1991-12-24 1993-07-08 Isis Pharmaceuticals, Inc. Gapped 2' modified oligonucleotides
US5378825A (en) 1990-07-27 1995-01-03 Isis Pharmaceuticals, Inc. Backbone modified oligonucleotide analogs
WO1995032305A1 (en) 1994-05-19 1995-11-30 Dako A/S Pna probes for detection of neisseria gonorrhoeae and chlamydia trachomatis
US5585481A (en) 1987-09-21 1996-12-17 Gen-Probe Incorporated Linking reagents for nucleotide probes
WO2006007712A1 (en) 2004-07-19 2006-01-26 Protiva Biotherapeutics, Inc. Methods comprising polyethylene glycol-lipid conjugates for delivery of therapeutic agents
US20140186958A1 (en) 2012-12-12 2014-07-03 Feng Zhang Engineering and optimization of systems, methods and compositions for sequence manipulation with functional domains
WO2014136086A1 (en) 2013-03-08 2014-09-12 Novartis Ag Lipids and lipid compositions for the delivery of active agents
US8889356B2 (en) 2012-12-12 2014-11-18 The Broad Institute Inc. CRISPR-Cas nickase systems, methods and compositions for sequence manipulation in eukaryotes
US9023649B2 (en) 2012-12-17 2015-05-05 President And Fellows Of Harvard College RNA-guided human genome engineering
US20150166980A1 (en) 2013-12-12 2015-06-18 President And Fellows Of Harvard College Fusions of cas9 domains and nucleic acid-editing domains
WO2015089351A1 (en) * 2013-12-12 2015-06-18 The Broad Institute Inc. Compositions and methods of use of crispr-cas systems in nucleotide repeat disorders
WO2015095340A1 (en) 2013-12-19 2015-06-25 Novartis Ag Lipids and lipid compositions for the delivery of active agents
WO2016010840A1 (en) 2014-07-16 2016-01-21 Novartis Ag Method of encapsulating a nucleic acid in a lipid nanoparticle host
US20160312198A1 (en) 2015-03-03 2016-10-27 The General Hospital Corporation Engineered CRISPR-CAS9 NUCLEASES WITH ALTERED PAM SPECIFICITY
WO2017053297A1 (en) 2015-09-21 2017-03-30 Trilink Biotechnologies, Inc. Compositions and methods for synthesizing 5'-capped rnas
WO2017173054A1 (en) 2016-03-30 2017-10-05 Intellia Therapeutics, Inc. Lipid nanoparticle formulations for crispr/cas components
WO2018007871A1 (en) * 2016-07-08 2018-01-11 Crispr Therapeutics Ag Materials and methods for treatment of transthyretin amyloidosis
WO2018067447A1 (en) 2016-10-03 2018-04-12 Itellia Therapeutics, Inc. Improved methods for identifying double strand break sites
WO2019067910A1 (en) * 2017-09-29 2019-04-04 Intellia Therapeutics, Inc. POLYNUCLEOTIDES, COMPOSITIONS AND METHODS FOR GENOMIC EDITION
WO2019067992A1 (en) 2017-09-29 2019-04-04 Intellia Therapeutics, Inc. Formulations

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2010223967B2 (en) * 2009-03-12 2015-07-30 Alnylam Pharmaceuticals, Inc. Lipid formulated compositions and methods for inhibiting expression of Eg5 and VEGF genes
EP3688161A1 (en) * 2017-09-29 2020-08-05 Intellia Therapeutics, Inc. Compositions and methods for ttr gene editing and treating attr amyloidosis

Patent Citations (23)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5585481A (en) 1987-09-21 1996-12-17 Gen-Probe Incorporated Linking reagents for nucleotide probes
US5378825A (en) 1990-07-27 1995-01-03 Isis Pharmaceuticals, Inc. Backbone modified oligonucleotide analogs
WO1993013121A1 (en) 1991-12-24 1993-07-08 Isis Pharmaceuticals, Inc. Gapped 2' modified oligonucleotides
WO1995032305A1 (en) 1994-05-19 1995-11-30 Dako A/S Pna probes for detection of neisseria gonorrhoeae and chlamydia trachomatis
WO2006007712A1 (en) 2004-07-19 2006-01-26 Protiva Biotherapeutics, Inc. Methods comprising polyethylene glycol-lipid conjugates for delivery of therapeutic agents
US20140186958A1 (en) 2012-12-12 2014-07-03 Feng Zhang Engineering and optimization of systems, methods and compositions for sequence manipulation with functional domains
US8889356B2 (en) 2012-12-12 2014-11-18 The Broad Institute Inc. CRISPR-Cas nickase systems, methods and compositions for sequence manipulation in eukaryotes
US9023649B2 (en) 2012-12-17 2015-05-05 President And Fellows Of Harvard College RNA-guided human genome engineering
WO2014136086A1 (en) 2013-03-08 2014-09-12 Novartis Ag Lipids and lipid compositions for the delivery of active agents
WO2015089351A1 (en) * 2013-12-12 2015-06-18 The Broad Institute Inc. Compositions and methods of use of crispr-cas systems in nucleotide repeat disorders
US20150166980A1 (en) 2013-12-12 2015-06-18 President And Fellows Of Harvard College Fusions of cas9 domains and nucleic acid-editing domains
WO2015089406A1 (en) 2013-12-12 2015-06-18 President And Fellows Of Harvard College Cas variants for gene editing
US20160304846A1 (en) 2013-12-12 2016-10-20 President And Fellows Of Harvard College Cas variants for gene editing
WO2015095340A1 (en) 2013-12-19 2015-06-25 Novartis Ag Lipids and lipid compositions for the delivery of active agents
WO2016010840A1 (en) 2014-07-16 2016-01-21 Novartis Ag Method of encapsulating a nucleic acid in a lipid nanoparticle host
US20160312199A1 (en) 2015-03-03 2016-10-27 The General Hospital Corporation Engineered CRISPR-CAS9 Nucleases with Altered PAM Specificity
US20160312198A1 (en) 2015-03-03 2016-10-27 The General Hospital Corporation Engineered CRISPR-CAS9 NUCLEASES WITH ALTERED PAM SPECIFICITY
WO2017053297A1 (en) 2015-09-21 2017-03-30 Trilink Biotechnologies, Inc. Compositions and methods for synthesizing 5'-capped rnas
WO2017173054A1 (en) 2016-03-30 2017-10-05 Intellia Therapeutics, Inc. Lipid nanoparticle formulations for crispr/cas components
WO2018007871A1 (en) * 2016-07-08 2018-01-11 Crispr Therapeutics Ag Materials and methods for treatment of transthyretin amyloidosis
WO2018067447A1 (en) 2016-10-03 2018-04-12 Itellia Therapeutics, Inc. Improved methods for identifying double strand break sites
WO2019067910A1 (en) * 2017-09-29 2019-04-04 Intellia Therapeutics, Inc. POLYNUCLEOTIDES, COMPOSITIONS AND METHODS FOR GENOMIC EDITION
WO2019067992A1 (en) 2017-09-29 2019-04-04 Intellia Therapeutics, Inc. Formulations

Non-Patent Citations (34)

* Cited by examiner, † Cited by third party
Title
ABBAS ET AL., PROC NATL ACAD SCI USA, vol. 114, no. 11, 2017, pages E2106 - E2115
BUTLER ET AL., AMYLOID, vol. 23, no. 2, June 2016 (2016-06-01), pages 109 - 18
DITTMAR KA, PLOS GENETICS, vol. 2, no. 12, 2006, pages e221
GILBERT ET AL.: "CRISPR-mediated modular RNA-guided regulation of transcription in eukaryotes", CELL, vol. 154, 2013, pages 442 - 51, XP055115843, DOI: 10.1016/j.cell.2013.06.044
GONÇALVES ET AL., AMYLOID, vol. 21, no. 3, September 2014 (2014-09-01), pages 175 - 184
GUO, P.MOSS, B., PROC. NATL. ACAD. SCI. USA, vol. 87, 1990, pages 4023 - 4027
HOEKSTRA ET AL., BIOCHIMICA ET BIOPHYSICA ACTA, vol. 1660, 2004, pages 41 - 52
ISHIKAWA ET AL., NUCL. ACIDS. SYMP. SER., 2009, pages 129 - A130
J. MILTON HARRIS, POLY(ETHYLENE GLYCOL) CHEMISTRY: BIOTECHNICAL AND BIOMEDICAL APPLICATIONS, 1992, pages 5 - 36
JONATHAN D. FINN ET AL: "A Single Administration of CRISPR/Cas9 Lipid Nanoparticles Achieves Robust and Persistent In Vivo Genome Editing", CELL REPORTS, vol. 22, no. 9, 1 February 2018 (2018-02-01), US, pages 2227 - 2235, XP055527484, ISSN: 2211-1247, DOI: 10.1016/j.celrep.2018.02.014 *
KARIKO ET AL., NUCLEIC ACIDS RESEARCH, vol. 39, no. 21, 2011, pages el42
KATIBAH ET AL., PROC NATL ACAD SCI USA, vol. 111, no. 33, 2014, pages 12025 - 30
LIU ET AL., ALLERGY, ASTHMA & CLINICAL IMMUNOLOGY, vol. 9, 2013, pages 30
MAIER, M.A. ET AL.: "Biodegradable Lipids Enabling Rapidly Eliminated Lipid Nanoparticles for Systemic Delivery of RNAi Therapeutics", MOL. THER., vol. 21, no. 8, 2013, pages 1570 - 78, XP055237159, DOI: 10.1038/mt.2013.124
MAKAROVA ET AL., NAT REV MICROBIOL, vol. 13, no. 11, 2015, pages 722 - 36
MAKAROVA ET AL., NAT. REV. MICROBIOL, vol. 13, 2015, pages 722 - 36
MAKAROVA ET AL., NAT. REV. MICROBIOL., vol. 9, 2011, pages 467 - 477
MALI ET AL.: "CAS9 transcriptional activators for target specificity screening and paired nickases for cooperative genome engineering", NAT. BIOTECHNOL., vol. 31, 2013, pages 833 - 8, XP055294730, DOI: 10.1038/nbt.2675
MAO, X.SHUMAN, S., J. BIOL. CHEM., vol. 269, 1994, pages 24472 - 24479
MEFFERD ET AL., RNA, vol. 21, 2015, pages 1683 - 9
PEREZ-PINERA ET AL.: "RNA-guided gene activation by CRISPR-Cas9-based transcription factors", NAT. METHODS, vol. 10, 2013, pages 973 - 6, XP055181249, DOI: 10.1038/nmeth.2600
QI ET AL.: "Repurposing CRISPR as an RNA-guided platform for sequence-specific control of gene expression", CELL, vol. 152, 2013, pages 1173 - 83, XP055346792, DOI: 10.1016/j.cell.2013.02.022
ROMBERG ET AL., PHARMACEUTICAL RESEARCH, vol. 25, no. 1, 2008, pages 55 - 71
SANTOS ET AL., NEUROBIOL AGING., vol. 31, no. 2, February 2010 (2010-02-01), pages 280 - 9
SCHERER ET AL., NUCLEIC ACIDS RES., vol. 35, 2007, pages 2620 - 2628
SCHMIDT ET AL., NATURE METHODS, vol. 4, 2007, pages 1051 - 1057
See also references of EP3946285A1
SHENDURE ET AL., NATURE, vol. 26, 2008, pages 1135 - 1145
SHMAKOV ET AL., MOLECULAR CELL, vol. 60, 2015, pages 385 - 397
STEPINSKI ET AL.: "Synthesis and properties of mRNAs containing the novel 'anti- reverse' cap analogs 7-methyl(3'-O-methyl)GpppG and 7-methyl(3'deoxy)GpppG", RNA, vol. 7, 2001, pages 1486 - 1495
TSAI ET AL., NATURE BIOTECHNOLOGY, vol. 33, 2015, pages 187 - 197
VESTERWENGEL, BIOCHEMISTRY, vol. 43, no. 42, 2004, pages 13233 - 41
ZETSCHE ET AL., CELL, vol. 163, 2015, pages 1 - 13
ZETSCHE ET AL., CELL, vol. 163, no. 3, 22 October 2015 (2015-10-22), pages 759 - 771

Cited By (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11591544B2 (en) 2020-11-25 2023-02-28 Akagera Medicines, Inc. Ionizable cationic lipids
US12077725B2 (en) 2020-11-25 2024-09-03 Akagera Medicines, Inc. Ionizable cationic lipids
US12331264B2 (en) 2020-11-25 2025-06-17 Akagera Medicines, Inc. Lipid nanoparticles for delivery of nucleic acids and methods of use thereof
US12606773B2 (en) 2020-11-25 2026-04-21 Akagera Medicines, Inc. Ionizable cationic lipids
WO2022125968A1 (en) * 2020-12-11 2022-06-16 Intellia Therapeutics, Inc. Polynucleotides, compositions, and methods for genome editing involving deamination
WO2022221697A1 (en) * 2021-04-17 2022-10-20 Intellia Therapeutics, Inc. Lipid nanoparticle compositions
JP2024515650A (ja) * 2021-04-17 2024-04-10 インテリア セラピューティクス,インコーポレーテッド 脂質ナノ粒子組成物
JP2024519922A (ja) * 2021-05-21 2024-05-21 ビーム セラピューティクス インク. トランスサイレチン遺伝子の塩基編集
WO2022271780A1 (en) * 2021-06-22 2022-12-29 Intellia Therapeutics, Inc. Methods for in vivo editing of a liver gene
US12064479B2 (en) 2022-05-25 2024-08-20 Akagera Medicines, Inc. Lipid nanoparticles for delivery of nucleic acids and methods of use thereof
WO2024003805A1 (en) * 2022-06-30 2024-01-04 Geneditbio Limited Methods and compositions for ttr gene editing and therapy using crispr system
WO2025128871A2 (en) 2023-12-13 2025-06-19 Renagade Therapeutics Management Inc. Lipid nanoparticles comprising coding rna molecules for use in gene editing and as vaccines and therapeutic agents

Also Published As

Publication number Publication date
KR20220004984A (ko) 2022-01-12
JP2025081416A (ja) 2025-05-27
CN113874004A (zh) 2021-12-31
US20230035659A1 (en) 2023-02-02
CO2021014562A2 (es) 2021-11-19
AU2020248337A1 (en) 2021-11-04
EP3946285A1 (en) 2022-02-09
MX2021011690A (es) 2022-01-06
JP7636338B2 (ja) 2025-02-26
JP2022525429A (ja) 2022-05-13
CA3134544A1 (en) 2020-10-01

Similar Documents

Publication Publication Date Title
US11795460B2 (en) Compositions and methods for TTR gene editing and treating ATTR amyloidosis
JP7636338B2 (ja) コルチコステロイドを含む、ttr遺伝子編集およびattrアミロイドーシスを治療するための組成物および方法、またはその使用
US20240124897A1 (en) Compositions and Methods Comprising a TTR Guide RNA and a Polynucleotide Encoding an RNA-Guided DNA Binding Agent
JP2019516351A (ja) Crispr/cas構成成分のための脂質ナノ粒子製剤
WO2022056000A1 (en) Compositions and methods for treatment of duchenne muscular dystrophy
HK40065742A (zh) 用於ttr基因编辑和治疗attr淀粉样变性的包括皮质类固醇的组合物和方法或其用途
HK40065872A (zh) 包括ttr向导rna和对rna引导的dna结合剂进行编码的多核苷酸的组合物和方法
EA048535B1 (ru) Композиции и способы, содержащие гидовую рнк ttr и полинуклеотид, кодирующий днк-связывающий агент, гидируемый рнк
HK40110281A (zh) 用於ttr基因编辑及治疗attr淀粉样变性的组合物及方法
EA048813B1 (ru) Композиции и способы редактирования гена ttr и лечения транстиретинового амилоидоза (attr)
AU2021342057A1 (en) Compositions and methods for treatment of duchenne muscular dystrophy

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20720676

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 3134544

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2021557650

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112021019278

Country of ref document: BR

WWE Wipo information: entry into national phase

Ref document number: NC2021/0014562

Country of ref document: CO

ENP Entry into the national phase

Ref document number: 2020248337

Country of ref document: AU

Date of ref document: 20200327

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2020720676

Country of ref document: EP

Effective date: 20211028

WWP Wipo information: published in national office

Ref document number: NC2021/0014562

Country of ref document: CO

REG Reference to national code

Ref country code: BR

Ref legal event code: B01E

Ref document number: 112021019278

Country of ref document: BR

Free format text: EXIGENCIAS:1 - FAVOR EFETUAR, EM ATE 60 (SESSENTA) DIAS, O PAGAMENTO DE GRU CODIGO DE SERVICO 260 PARA A REGULARIZACAO DO PEDIDO, CONFORME ART 2O 1O DA RESOLUCAO 189/2017 E NOTA DE ESCLARECIMENTO PUBLICADA NA RPI 2421 DE 30/05/2017, UMA VEZ QUE A PETICAO NO 870210110869 DE 30/11/2021 APRESENTA DOCUMENTOS REFERENTES A 2 SERVICOS DIVERSOS (TRADUCAO DOS DOCUMENTOS APRESENTADOS E MODIFICACOES NO RESUMO E QUADRO REIVINDICATORIO) TENDO SIDO PAGA SOMENTE 1 RETRIBUICAO. DEVERA SER PAGA MAIS 1 (UMA) GRU CODIGO DE SERVICO 260 E A GRU CODIGO DE SERVICO 207 REFERENTE A RESPOSTA DESTA EXIGENCIA.2 - APRESENTAR A TRADUCAO SIMPLES DA FOLHA DE ROSTO DA CERTIDAO DE DEPOSITO DAS PRIORIDADES US 62/825,637 DE 2

ENP Entry into the national phase

Ref document number: 112021019278

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20210927