WO2020198675A1 - Generation of chimeric antigen receptor (car)-primary nk cells for cancer immunotherapy using a combination of cas9/rnp and aav viruses - Google Patents
Generation of chimeric antigen receptor (car)-primary nk cells for cancer immunotherapy using a combination of cas9/rnp and aav viruses Download PDFInfo
- Publication number
- WO2020198675A1 WO2020198675A1 PCT/US2020/025454 US2020025454W WO2020198675A1 WO 2020198675 A1 WO2020198675 A1 WO 2020198675A1 US 2020025454 W US2020025454 W US 2020025454W WO 2020198675 A1 WO2020198675 A1 WO 2020198675A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- cell
- cells
- transgene
- plasmid
- aav
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K40/00—Cellular immunotherapy
- A61K40/10—Cellular immunotherapy characterised by the cell type used
- A61K40/15—Natural-killer [NK] cells; Natural-killer T [NKT] cells
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K40/00—Cellular immunotherapy
- A61K40/30—Cellular immunotherapy characterised by the recombinant expression of specific molecules in the cells of the immune system
- A61K40/31—Chimeric antigen receptors [CAR]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K40/00—Cellular immunotherapy
- A61K40/40—Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
- A61K40/41—Vertebrate antigens
- A61K40/42—Cancer antigens
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K40/00—Cellular immunotherapy
- A61K40/40—Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
- A61K40/41—Vertebrate antigens
- A61K40/42—Cancer antigens
- A61K40/428—Undefined tumor antigens, e.g. tumor lysate or antigens targeted by cells isolated from tumor
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/111—General methods applicable to biologically active non-coding nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
- C12N15/90—Stable introduction of foreign DNA into chromosome
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0634—Cells from the blood or the immune system
- C12N5/0646—Natural killers cells [NK], NKT cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
- C12N9/22—Ribonucleases [RNase]; Deoxyribonucleases [DNase]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K2121/00—Preparations for use in therapy
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K2300/00—Mixtures or combinations of active ingredients, wherein at least one active ingredient is fully defined in groups A61K31/00 - A61K41/00
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/20—Cytokines; Chemokines
- C12N2501/23—Interleukins [IL]
- C12N2501/2321—Interleukin-21 (IL-21)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2510/00—Genetically modified cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
- C12N2750/00011—Details
- C12N2750/14011—Parvoviridae
- C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
- C12N2750/14141—Use of virus, viral particle or viral elements as a vector
- C12N2750/14143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
Definitions
- CRISPR/Cas9 technology has been used recently in engineering cells. The technology has proven a robust method for silencing genes by creating DNA breaks or making small substitutions or small insertions. However, the technology is beset by technological hurdles. Techniques for delivering CRISPR/Cas9 into a cell (along with any donor DNA or RNA) such as microinjection, electroporation, and nucleofection are not suitable for in vivo use. Moreover, knock-in mutations typically have very low efficiency in in vitro, in vivo, and clinical applications.
- Using viral vectors to deliver CRISPR/Cas9 into a cell addresses the in vivo suitability, but has limitations with transgene size and can induce host immune responses lead to substantial procedure-associated cell apoptosis and the limited production of genetically engineered cells. What are needed are new methods of genetically and vectors for engineering cells.
- AAV plasmids for delivery of a CRISPR/CAS9 gene editing system to a cell.
- the AAV plasmids further comprise a transgene.
- plasmids for use in clustered regularly interspaced short palindromic repeat (CRISPR)/ CRISPR-associated 9 (Cas9) integration systems wherein the plasmid comprises in order a left homology arm, a splice acceptor, a transgene, and a right homology arm; wherein the left and right homology arms are each 800bp in length or less (such as for example 30bp in plasmids 1 and 2, 300bp in plasmids 3 and 4, 500bp in plasmids 5 and 6, or 800bp).
- the plasmid can further comprise a polyadenylation signal between the transgene and the right homology arm.
- plasmids of any preceding aspect wherein the left homology arm and right homology arm are the same length or different lengths.
- plasmids for use in CRISPaint (or non- homologous end joining) methods consisting of 1 or 2 protospacer adjacent motifs (PAMs) and CRISPR RNAs (crRNAs) and a transgene; wherein the order of the encoded nucleic acid comprises a PAM, a gRNA and a transgene; and wherein when 2 PAMs and gRNAs are used, of the encoded nucleic acid comprises a first PAM, a first gRNA, a transgene, a second PAM, and second gRNA.
- PAMs protospacer adjacent motifs
- crRNAs CRISPR RNAs
- plasmids of any preceding aspect wherein the homology arms or the PAMs of the plasmid specifically hybridize to the Adeno-Associated Virus Integration Site 1 (AAVS1) of chromosome 19 of humans.
- AAVS1 Adeno-Associated Virus Integration Site 1
- transgene comprises a polynucleotide encoding a chimeric antigen receptor for a tumor antigen.
- AAV vectors such as an AAV vector of serotype AAV6 comprising the plasmid of any preceding aspect.
- the AAV can be a single stranded AAV or a self-compleemtary AAV.
- vectors of any preceding wherein the vector further comprises a plasmid encoding a gRNA (a crispr RNA (crRNA), tracer RNA (tracrRNA)), and a CAS endonuclease.
- a gRNA a crispr RNA (crRNA), tracer RNA (tracrRNA)
- a CAS endonuclease a CAS endonuclease
- modified cells comprising the plasmid or vector of any preceding aspect.
- Also disclosed herein are methods of treating a cancer in a subject comprising administering to a subject with a cancer the modified cell of any of any preceding aspect.
- RNA ribonucleoprotein
- Cas9 class 2 CRISPR/Cas endonuclease
- AAV vector comprising a plasmid comprising a transgene (such as, for example, a chimeric antigen receptor for a tumor antigen); wherein the transgene is flanked by homology arms; and wherein the homology arms are 800bp in length or less; and b) introducing the transgene and the RNP complex into the cell; wherein the transgene is introduced into the cell via infection with the A
- the RNP complex hybridizes to a target sequence within the genomic DNA of the cell and the cell’s DNA repair enzymes insert the transgene into the host genome (for example, by homologous repair) at the target sequence, thereby creating a modified cell.
- the RNP complex can be introduced into the cell via electroporation.
- the RNP complex can be introduced into the cell via viral delivery in the same or a different AAV (i.e., superinfection). 13.
- RNA and a transgene complex comprising a cell (such as, for example, a chimeric antigen receptor for a tumor antigen); wherein the transgene is adjacent to one PAM and crRNA or flanked by two PAMs and crRNAs; and b) introducing the transgene and the RNP complex into the cell; wherein the transgene is introduced into the cell via infection with the Adenosine (Cas9), a ribonucleoprotein (RNP) complex comprising a class 2 CRISPR/Cas endonuclease (Cas9) complexed with a corresponding CRISPR/Cas guide RNA and an AAV vector comprising a plasmid comprising a transgene (such as, for example, a chimeric antigen receptor for a tumor antigen); wherein the transgene is adjacent to one PAM and crRNA or flanked by two PAMs and crRNAs; and b) introducing the transgene and the RNP complex into
- Figure 1 shows a schematic of CRISPR/Cas 9 complex using an AAV vector for delivery of the CRISPR/Cas9 and transgene. The schematic details the action of the
- CRISPR/Cas9 system in integrating the transgene via homology directed repair, shows the AAVSl target site on chromosome 19 and provides detail of the donor plasmids having homology arms of 30, 300, 500, or 800bp.
- Figure 2 shows a schematic of the CRISPR/Cas9 containing plasmid.
- Figures 3 A and 3B show a schematic of the plasmids for the transgene used in non- homologous end joining methods such as HITI or CRISPaint referred to herein as plasmids 9 and 10 (3B) which have a single PAM +crRNA and plasmids 11 and 12 (3 A) which add a second PAM + crRNA. It should be noted that the figure shows gRNA which is understood to comprise a PAM and a crRNA.
- Figures 4A and 4B show the determination of the AAV serotype for transfecting NK cells.
- Figure 4A shows the expression of GFP for various AAV serotypes under differing transfection conditions.
- Figure 4B shows the copy number of AAV 6 genomic DNA in NK cells.
- FIGs 5A, 5B, and 5C show mCherry reporter gene integration in to AAVS1 locus of HEK293 cells was evaluated using PCR (5 A).
- Forward and reverse primers for the amplification of mCherryl (forward primer is SEQ ID NO: 2 and reverse primer is SE QID NO: 3) and mCherry2 (forward primer is SEQ ID NO: 4 and reverse primer is SE QID NO: 5) are shown. Also shown is that the stable gene expression of mCherry was studied using flow cytometry (5B) and florescent microscopy (5C). *The results represent 2 out of 12 designed AAV constructs.
- FIGS. 6A and 6B show mCherry reporter gene integration in to AAVS 1 locus of human primary NK cells was evaluated using PCR (6A). The stable gene expression of mCherry post expansion was studied using flow cytometry (6B). *The results represent 2 out of 12 designed AAV constructs.
- Figures 7A, 7B, 7C, 7D, 7E, 7F, 7G, and 7H show a schematic of the mCherry transgene containing plasmids 1, 2, 3, 4, 5, 6, 7, and 8 show the relative location of the left homology arm (LHA), splice acceptor, transgene, polyadenylation terminator, and right homology arm (RHA); and the corresponding sequence for the entire construct.
- Figures 7A and 7B show the schematic and sequence (SEQ ID NO: 13) for the 30bp homology arm plasmid 1 and 2.
- Figures 7C and 7D show the schematic and sequence (SEQ ID NO: 14) for the 300bp homology arm plasmid 3 and 4.
- Figures 7E and 7F show the schematic and sequence (SEQ ID NO: 15) for the 500bp homology arm plasmid 5 and 6.
- Figures 7G and 7H show the schematic and sequence (SEQ ID NO: 16) for the 800bp homology arm plasmid 7 and 8 which comprises a 800bp LHA and a lOOObp RHA.
- Figure 8 shows scheme of NK isolation and expansion.
- Primary human NK cells were isolated from huffy coats from healthy donor and expanded using mbIL21 K562 for 7 days.
- Figure 9 shows flow cytometry result of isolated NK cells shows the purity of NK cells.
- the cells isolated from huffy coat were evaluated for T-cell contamination by staining for CD3 and CD56. Based on the flow cytometry results, the isolated lymphocytes were >90%
- FIG. 10 shows ATAC-seq analysis shows that AAVS1 in NK cells has suitable chromatin accessibility for gene insertion. ATAC-seq peaks representing open chromatin regions. The data shows AAVS1 has similar chromatin accessibility in naive and expanded day 7 NK cells.
- Figure 11 shows production and electroporation of Cas9/RNP to target the gene of interest in human primary NK cells.
- pre-transcribed crRNA and Tracer- RNA were annealed at 95C for 5 minutes.
- pre-translated Cas9 endonuclease protein was mixed with gRNA at room temperature for 10 minutes.
- the Cas9/RNP and electroporation enhancer were added to NK cells. The mix then was transferred into Lonza4D nucleofection cuvette. The cells were electroporated with EN-138 program using Lonza 4D.
- Figure 12 shows the ICE analysis shows successful gene (AAVSl) targeting in NK cells using Cas9/RNP.
- the ICE uses sanger sequencing data to produce quantitative analysis of CRISPR editing. Using this method, we showed that more than 85% of NK cells were successfully targeted at AAVSl locus.
- FIG. 13 shows knocking-out AAVSl does not alter NK cells cytotoxcicty.
- Calcein- AM cytotoxicity assay showed no difference in NK cell-mediated killing against AML cell line by AAVSl -KO and wildtype NK cells. This demonstrates the safety of targeting AAVSl locus in NK cells.
- FIG. 14 shows identifying the best serotype of AAV to transduce human primary NK cells.
- NK cells that were transduced with AAV6 showed expression of GFP (upper panel).
- AAV6 viral genome could be detected after 48 hours post transduction of NK cells at MOI of 300K (lower panel).
- FIG. 31 shows HR-directed gene insertion requires optimal length of HAs.
- NHEJ Non- Homologues End Joining
- the Homology Repair (HR) DNA repair machinery is the pathway which its activation results in gene insertion in presence of a DNA template with optimum homology arms for C as 9-targeting site (AAVSl).
- AAVSl 9-targeting site
- the HR templates were cloned within ITRs of ssAAV6 or scAAV6 vectors.
- FIG. 16A and 16B show gene integeration through CRISPaint approach does not require HA for flanking region of Cas9-targeting site.
- FIG. 15 A For non-homologues gene insertion through CRISPaint approach (FIG. 15 A), a single (PAMg) or double (PAMgPAMg) AAVSl targeting sites (crRNA+PAM sequences) were included within ITRs.
- the CRISPaint helps to overcome the time-consuming process of designing HAs for HR- gene insertion (FIG. 15B).
- Figure 17 shows flow cytometry results showed successful transgene expression in HEK293 cells. Electroporation of lpg of DNA-encoding mCherry into HEK293 cells to assay the accuracy of the vectors showed successful gene expression. Flow cytometry showed the stable expression of mCherry.
- Figure 18 show studying the expression level of HR and CRISPaint regulating enzymes in naive and expanded NK cells.
- HR related enzymes were upregulated in day-7 expanded NK cells in comparison to naive NK cells.
- LIG4 non-homologues related enzyme
- Figure 19 shows combination of the electroporation of Cas9/RNP and transduction of AAV6 for gene insertion.
- 500K, 300K or 150K MOI of ssAAV6 or scAAV6 of HR and CRISPaint viruses delivering DNA-encoding mCherry were used to transduce the day 7 expanded NK cells which were electroporated with Cas9/RNP.
- FIG. 20 shows flow cytometry results showed stable mCherry expression in CRISPR modified NK cells transuced with higher MOI of AAV6.
- FIG. 21 shows flow cytometry results of CRIPSR modified primary NK cells demonstrated highly efficient transgene expression.
- CRISPaint DNA template Six days post CRISPR modification, flow cytometry results show that, delivering DNA encoding mCherry with minimum optimal homology arm lengths of 300bp for the flanking region of the Cas9-targeting site using scAAV6 results in highly efficient gene insertion in primary NK cells larger HA including 500bp and 800-1000bp for smaller transgenes also can be utilized for gene insertion into NK cells. We also show that for the large transgenes 30bp of HA also can be used for gene insertion. Additionally, we demonstrate that CRISPaint is applicable approach for gene insertion into human primary NK cells.
- Figure 22 shows mCherry positive NK cells can be expanded on mb-IL21 expressing feeder cells.
- the mCherry NK cells which were generated with ssAAV6-HR-800bp and scAAV6-CRISPaint-PAMgPAMg and had lower efficiency were FACS sorted and grown for 20 days using feeder cells. The flow cytometry results 20 days post sorting showed the stable and enriched mCherry expression in CRISPR modified NK cells generated via both HR and CRISPaint.
- Ranges can be expressed herein as from“about” one particular value, and/or to “about” another particular value. When such a range is expressed, another embodiment includes from the one particular value and/or to the other particular value. Similarly, when values are expressed as approximations, by use of the antecedent“about,” it will be understood that the particular value forms another embodiment. It will be further understood that the endpoints of each of the ranges are significant both in relation to the other endpoint, and independently of the other endpoint. It is also understood that there are a number of values disclosed herein, and that each value is also herein disclosed as“about” that particular value in addition to the value itself. For example, if the value“10” is disclosed, then“about 10” is also disclosed.
- a particular data point“10” and a particular data point 15 are disclosed, it is understood that greater than, greater than or equal to, less than, less than or equal to, and equal to 10 and 15 are considered disclosed as well as between 10 and 15. It is also understood that each unit between two particular units are also disclosed. For example, if 10 and 15 are disclosed, then 11, 12, 13, and 14 are also disclosed.
- Primers are a subset of probes which are capable of supporting some type of enzymatic manipulation and which can hybridize with a target nucleic acid such that the enzymatic manipulation can occur.
- a primer can be made from any combination of nucleotides or nucleotide derivatives or analogs available in the art which do not interfere with the enzymatic manipulation.
- Probes are molecules capable of interacting with a target nucleic acid, typically in a sequence specific manner, for example through hybridization. The hybridization of nucleic acids is well understood in the art and discussed herein. Typically a probe can be made from any combination of nucleotides or nucleotide derivatives or analogs available in the art.
- a DNA sequence that "encodes" a particular RNA is a DNA nucleic acid sequence that is transcribed into RNA.
- a DNA polynucleotide may encode an RNA (mRNA) that is translated into protein (and therefore the DNA and the mRNA both encode the protein), or a DNA polynucleotide may encode an RNA that is not translated into protein (e.g. tRNA, rRNA, microRNA (miRNA), a "non-coding" RNA (ncRNA), a guide RNA, etc.).
- a "protein coding sequence” or a sequence that encodes a particular protein or polypeptide is a nucleic acid sequence that is transcribed into mRNA (in the case of DNA) and is translated (in the case of mRNA) into a polypeptide in vitro or in vivo when placed under the control of appropriate regulatory sequences.
- the boundaries of the coding sequence are determined by a start codon at the 5' terminus (N-terminus) and a translation stop nonsense codon at the 3' terminus (C -terminus).
- a coding sequence can include, but is not limited to, cDNA from prokaryotic or eukaryotic mRNA, genomic DNA sequences from prokaryotic or eukaryotic DNA, and synthetic nucleic acids.
- a transcription termination sequence will usually be located 3' to the coding sequence.
- nucleic acid a nucleic acid, a polypeptide, a cell, or an organism
- nucleic acid a nucleic acid, polypeptide, cell, or organism that is found in nature.
- polynucleotide sequence that is present in an organism (including viruses) that can be isolated from a source in nature and which has not been intentionally modified by a human in the laboratory is wild type (and naturally occurring).
- Administration to a subject includes any route of introducing or delivering to a subject an agent. Administration can be carried out by any suitable route, including oral, topical, intravenous, subcutaneous, transcutaneous, transdermal, intramuscular, intra-joint, parenteral, intra-arteriole, intradermal, intraventricular, intracranial, intraperitoneal, intralesional, intranasal, rectal, vaginal, by inhalation, via an implanted reservoir, parenteral (e.g., subcutaneous, intravenous, intramuscular, intra-articular, intra-synovial, intrastemal, intrathecal,
- parenteral e.g., subcutaneous, intravenous, intramuscular, intra-articular, intra-synovial, intrastemal, intrathecal,
- “Concurrent administration”, “administration in combination”, “simultaneous administration” or “administered simultaneously” as used herein, means that the compounds are administered at the same point in time or essentially immediately following one another. In the latter case, the two compounds are administered at times sufficiently close that the results observed are indistinguishable from those achieved when the compounds are administered at the same point in time.
- Systemic administration refers to the introducing or delivering to a subject an agent via a route which introduces or delivers the agent to extensive areas of the subject’s body (e.g. greater than 50% of the body), for example through entrance into the circulatory or lymph systems.
- “local administration” refers to the introducing or delivery to a subject an agent via a route which introduces or delivers the agent to the area or area
- locally administered agents are easily detectable in the local vicinity of the point of administration, but are undetectable or detectable at negligible amounts in distal parts of the subject’s body.
- Administration includes self-administration and the administration by another.
- “Effective amount” of an agent refers to a sufficient amount of an agent to provide a desired effect.
- the amount of agent that is“effective” will vary from subject to subject, depending on many factors such as the age and general condition of the subject, the particular agent or agents, and the like. Thus, it is not always possible to specify a quantified“effective amount.” However, an appropriate“effective amount” in any subject case may be determined by one of ordinary skill in the art using routine experimentation. Also, as used herein, and unless specifically stated otherwise, an“effective amount” of an agent can also refer to an amount covering both therapeutically effective amounts and prophylactically effective amounts. An“effective amount” of an agent necessary to achieve a therapeutic effect may vary according to factors such as the age, sex, and weight of the subject. Dosage regimens can be adjusted to provide the optimum therapeutic response. For example, several divided doses may be administered daily or the dose may be proportionally reduced as indicated by the exigencies of the therapeutic situation.
- “Pharmaceutically acceptable” component can refer to a component that is not biologically or otherwise undesirable, i.e., the component may be incorporated into a pharmaceutical formulation of the invention and administered to a subject as described herein without causing significant undesirable biological effects or interacting in a deleterious manner with any of the other components of the formulation in which it is contained.
- the term When used in reference to administration to a human, the term generally implies the component has met the required standards of toxicological and manufacturing testing or that it is included on the Inactive Ingredient Guide prepared by the U.S. Food and Drug Administration.
- “Pharmaceutically acceptable carrier” means a carrier or excipient that is useful in preparing a pharmaceutical or therapeutic composition that is generally safe and non-toxic, and includes a carrier that is acceptable for veterinary and/or human pharmaceutical or therapeutic use.
- carrier or “pharmaceutically acceptable carrier” can include, but are not limited to, phosphate buffered saline solution, water, emulsions (such as an oil/water or water/oil emulsion) and/or various types of wetting agents.
- carrier encompasses, but is not limited to, any excipient, diluent, filler, salt, buffer, stabilizer, solubilizer, lipid, stabilizer, or other material well known in the art for use in pharmaceutical formulations and as described further herein.
- “Pharmacologically active” (or simply“active”), as in a“pharmacologically active” derivative or analog, can refer to a derivative or analog (e.g., a salt, ester, amide, conjugate, metabolite, isomer, fragment, etc.) having the same type of pharmacological activity as the parent compound and approximately equivalent in degree.
- Therapeutic agent refers to any composition that has a beneficial biological effect.
- Beneficial biological effects include both therapeutic effects, e.g., treatment of a disorder or other undesirable physiological condition, and prophylactic effects, e.g., prevention of a disorder or other undesirable physiological condition (e.g., a non-immunogenic cancer).
- the terms also encompass pharmaceutically acceptable, pharmacologically active derivatives of beneficial agents specifically mentioned herein, including, but not limited to, salts, esters, amides, proagents, active metabolites, isomers, fragments, analogs, and the like.
- therapeutic agent when used, then, or when a particular agent is specifically identified, it is to be understood that the term includes the agent per se as well as pharmaceutically acceptable, pharmacologically active salts, esters, amides, proagents, conjugates, active metabolites, isomers, fragments, analogs, etc.
- compositions refers to an amount that is effective to achieve a desired therapeutic result.
- a desired therapeutic result is the control of type I diabetes.
- a desired therapeutic result is the control of obesity.
- Therapeutically effective amounts of a given therapeutic agent will typically vary with respect to factors such as the type and severity of the disorder or disease being treated and the age, gender, and weight of the subject. The term can also refer to an amount of a therapeutic agent, or a rate of delivery of a therapeutic agent (e.g., amount over time), effective to facilitate a desired therapeutic effect, such as pain relief.
- a desired therapeutic effect will vary according to the condition to be treated, the tolerance of the subject, the agent and/or agent formulation to be administered (e.g., the potency of the therapeutic agent, the concentration of agent in the formulation, and the like), and a variety of other factors that are appreciated by those of ordinary skill in the art.
- a desired biological or medical response is achieved following administration of multiple dosages of the composition to the subject over a period of days, weeks, or years.
- Endonuclease/RNPs are comprised of three components, recombinant endonuclease protein (for example, a Cas9 endonuclease) complexed with a CRISPR loci.
- the endonuclease complexed to the CRISPR loci can be referred to as a
- the CRISPR loci comprises a synthetic single-guide RNA (gRNA) comprised of a RNA that can hybridize to a target sequence complexed complementary repeat RNA (crRNA) and trans complementary repeat RNA (tracrRNA). Accordingly, the CRISPR loci comprises a synthetic single-guide RNA (gRNA) comprised of a RNA that can hybridize to a target sequence complexed complementary repeat RNA (crRNA) and trans complementary repeat RNA (tracrRNA). Accordingly, the
- the CRISPR/Cas guide RNA hybridizes to a target sequence within the genomic DNA of the cell.
- the class 2 CRISPR/Cas endonuclease is a type II CRISPR/Cas endonuclease.
- the class 2 CRISPR/Cas endonuclease is a Cas9 polypeptide and the corresponding CRISPR/Cas guide RNA is a Cas9 guide RNA.
- These Cas9/RNPs are capable of cleaving genomic targets with higher efficiency as compared to foreign DNA-dependent approaches due to their delivery as functional complexes. Additionally, rapid clearance of Cas9/RNPs from the cells can reduce the off-target effects such as induction of apoptosis.
- crRNA and tracrRNA can be mixed at a 1 : 1, 2: 1, or 1 :2 ratio of concentrations between about 50 mM and about 500mM (for example, 50, 60, 70, 80, 90,
- RNA 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 35, 375, 400, 425, 450, 475, or 500mM), preferably between 100 mM and about 300 mM, most preferably about 200 mM at 95C for about 5 min to form a crRNA:tracrRNA complex (i.e., the guide RNA).
- the crRNA:tracrRNA complex can then be mixed with between about 20mM and about 50mM (for example 21, 22, 23,24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47 48, 49, or 50mM) final dilution of a Cas endonuclease (such as, for example, Cas9).
- a Cas endonuclease such as, for example, Cas9
- the CRISPR loci can modify the genome by introducing into the target DNA insertion or deletion of one or more base pairs, by insertion of a heterologous DNA fragment (e.g., the donor polynucleotide), by deletion of an endogenous DNA fragment, by inversion or translocation of an endogenous DNA fragment, or a combination thereof.
- a heterologous DNA fragment e.g., the donor polynucleotide
- the disclosed methods can be used to generate knock-outs, or knock- ins when combined with DNA for homologous recombination.
- AAV Adeno-associated viral
- the CRISPR/Cas9 system has recently been shown to facilitate high levels of precise genome editing using Adeno-associated viral (AAV) vectors to serve as donor template DNA during homologous recombination (HR).
- AAV Adeno-associated viral
- HR homologous recombination
- NK cells are resistant to viral and bacterial vectors and the induction of NK cell apoptosis by said vectors.
- CRISPR/Cas modification of NK cells has been unsuccessful.
- the maximum AAV packaging capacity of ⁇ 4.5 kilobases limits the donor size which includes Homology arms.
- any transcript above lOObp and any transgene is to have homology arms that are at least 800bp for each arm with many systems employing asymmetric arms of 800bp and lOOObp for a total of 1800bp.
- the AAV vector cannot deliver a transgene larger than ⁇ 2.5 kb.
- AAV CRISPR/CAS9 nucleotide delivery systems comprising a donor construct plasmid with homology arms between 30bp and lOOObp, including, but not limited to 30, 50, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380,
- the homology arms can be symmetrical 30bp homology arms as in plasmids 1 and 2 ( Figures 7A and 7B), symmetrical 300bp homology arms as in plasmids 3 and 4 ( Figures 7C and 7D), symmetrical 500bp homology arms as in plasmids 5 and 6 ( Figures 7E and 7F), or asymmetrical 800bp homology arms as in plasmids 7 and 8 comprising a 800bp left homology arm (LHA) and a lOOObp right homology arm (RHA)
- LHA left homology arm
- RHA right homology arm
- Plasmids 1, 2, 3, 4, 5, and 6 can also be used in any cell type, and have clinically approved splice acceptor (SA) (SEQ ID NO: 10) and clinically approved polyadenylation terminator (PA)(such as, for example BGH polyA terminator SEQ ID NOL 11).
- SA splice acceptor
- PA polyadenylation terminator
- Plasmids 7 and 8 possess clinically approved splice acceptor (SA) and clinically approved polyadenylation terminator (PA). It is understood and herein contemplated that homology arms can be symmetrical (same length on each side) or asymmetrical (different lengths on each side) to accommodate differing transgene lengths.
- SA splice acceptor
- PA polyadenylation terminator
- homology arm lengths can have any combination of left homology arm (LHA) length and right homology arm (RHA) length including but not limited to LHA 30bp (SEQ ID NO: 2) and RHA 30bp (SEQ ID NO: 1), LHA 30bp and RHA lOObp, LHA 30bp and RHA 300bp (SEQ ID NO: 3), LHA 30bp and RHA 500bp (SEQ ID NO: 5), LHA 30bp and RHA 800bp (actually 1000bps in plasmids 7 and 8; SEQ ID NO: 7), LHA 30bp and RHA lOOObp, LHA lOObp and RHA 30bp, LHA lOObp and RHA lOObp, LHA lOObp and RHA 300bp, LHA lOObp and RHA 500bp, LHA lOObp and RHA 800bp, LHA lOObp and RHA lOOObp, LHA 300bp
- Plasmids 9, 10, 11, and 12 differ significantly from plasmids 1-8 or any described in the art. These plasmids possess the same clinically approved SA and PA and can be used in any cell type, but are not integrated through homologously directed repair (HDR), but rather integrated via HITI, CRISPaint, or other nonhomolgous end joining (NHEJ). As such, they have an advantage of integrating with higher efficiency.
- the plasmids comprise the protospacer adjacent motif (PAM) and crRNA (i.e., the gRNA) (SEQ ID NO: 9) to target the donor transgene integration. Plasmids 11 and 12 comprise two PAM sequences to increase the likelihood of Cas9-targetting at least one site on the donor transgene plasmid.
- Table 1 Differences of the 12 novel plasmids disclosed herein as defined by homology arm length, insertion scheme and transgene construction
- SS plasmids need longer time to be folded and served as a double stranded DNA inside the cells prior to the integration which increases the DNA-sensing mechanism and cytotoxicity in some cells (such as, for example, T cells, B cells, macrophages, NK cells, fibroblasts, osteoblasts, hepatocytes, neuronal cells, epithelial cells, and/or muscle cells).
- T cells for example, T cells, B cells, macrophages, NK cells, fibroblasts, osteoblasts, hepatocytes, neuronal cells, epithelial cells, and/or muscle cells.
- SC complementary (SC)(double stranded) constructs in order to decrease the time of exposure to the exogenous DNA in cells the presently disclosed plasmids.
- a crispr RNA (crRNA) is used.
- the crRNA is combined with a tracrRNA to form guide RNA (gRNA).
- the disclosed plasmids use AAV integration, intron 1 of the protein phosphatase 1, regulatory subunit 12C (PPP1R12C) gene on human chromosome 19, which is referred to the AAVS1, as the target site for the integration of the transgene. This locus is a“safe harbor gene” and allows stable, long-term transgene expression in many cell types.
- the AAVS1 locus is often considered a safe-harbor for transgene targeting. Because the AAVS1 site is being used as the target location, the CRSPR RNA (crRNA) must target said DNA.
- the guide RNA used in the disclosed plasmids comprises
- GGGGCCACTAGGGACAGGAT SEQ ID NO: 1 or any 10 nucleotide sense or antisense contiguous fragment thereof.
- AAVSl is used for exemplary purposes here, it is understood and herein contemplated that other“safe harbor genes” can be used with equivalent results and can be substituted for AAVSl if more appropriate given the particular cell type being transfected or the transgene.
- Other safe harbor genes include but are not limited to C-C chemokine receptor type 5 (CCR5), the ROSA26 locus, and TRAC.
- CRISPR/Cas9 plasmid and any donor transgene is limited to a maximum of ⁇ 4.5kb. It is understood and herein contemplated that one method of increasing the allowable size of the transgene is to create additional room by exchanging the Cas9 of Streptococcus pyogenes (SpCas9) typically used for a synthetic Cas9, or Cas9 from a different bacterial source.
- SpCas9 Streptococcus pyogenes
- the Cas9 can be derived from Staphylococcus aureus (SaCas9), Acidaminococcus sp.
- AsCpfl Lachnospiracase bacterium
- LbCpfl Lachnospiracase bacterium
- NmCas9 Neisseria meningitidis
- StCas9 Streptococcus thermophilus
- CjCas9 Campylobacter jejuni
- eSpCas9 enhanced SpCas9
- SpCas9-HFl Fokl-Fused dCas9
- dCas9 expanded Cas9
- dCas9 catalytically dead Cas9
- RNA complex comprising a class 2 CRISPR/Cas endonuclease (Cas9) complexed with a corresponding CRISPR/Cas guide RNA (gRNA) specific for a target DNA sequence in the cell and a plasmid comprising a transgene (such as, for example, a chimeric antigen receptor for a tumor antigen); wherein the transgene is flanked by homology arms; and b) introducing the transgene and the RNP complex into the cell; wherein the transgene is introduced into the cell via infection with the Adeno-associated virus (AAV) into a target cell; wherein the RNP complex hybridizes to a target sequence within the genomic DNA of the cell.
- AAV Adeno-associated virus
- the method can further comprise introducing the RNP complex into the cell via electroporation (such as when modifying an NK cell).
- the method can further comprise superinfecting the target cell with a second AAV virus comprising the RNP complex.
- the same AAV can comprise both the transgene and the RNP complex.
- the transgene and RNP complex can be encoded on the same plasmid.
- NK cells are a particularly excellent target for the disclosed plasmids and methods of their use.
- NK cells are a subset of peripheral blood lymphocytes defined by the expression of CD56 or CD16 and the absence of T cell receptor (CD3). NK cells sense and kill target cells that lack major histocompatibility complex (MHC)-class I molecules.
- MHC major histocompatibility complex
- NK cell activating receptors include, among others, the natural cytotoxicity receptors (NKp30, NKp44 and NKp46), and lectin-like receptors NKG2D and DNAM-1. Their ligands are expressed on stressed, transformed, or infected cells but not on normal cells, making normal cells resistant to NK cell killing. NK cell activation is negatively regulated via inhibitory receptors, such as killer immunoglobin (Ig)-like receptors (KIRs), NKG2A /CD94, TGFp, and leukocyte Ig-like receptor-1 (LIR-1).
- the target cells can be primary NK cells from a donor source (such as, for example, an allogeneic donor source for an adoptive transfer therapy or an autologous donor source (i.e., the ultimate recipient of the modified cells), NK cell line
- NK RPMI8866 including, but not limited to NK RPMI8866; HFWT, K562, and EBV-LCL
- a source of expanded NK cells derived a primary NK cell source or NK cell line including, but not limited to NK RPMI8866; HFWT, K562, and EBV-LCL
- the cell Prior to the transduction of the cells (such as, for example, T cells, B cells, macrophages, NK cells, fibroblasts, osteoblasts, hepatocytes, neuronal cells, epithelial cells, and/or muscle cells), the cell can be incubated in a media suitable for the propagation of the cells. It is understood and herein contemplated that the culturing conditions can comprise the addition of cytokines, antibodies, and/or feeder cells.
- a cell such as, for example, a T cell, B cell, macrophage, NK cell, fibroblast, osteoblast, hepatocyte, neuronal cell, epithelial cell, and/or muscle cell
- incubating the cells for 1, 2, 3, 4, 5, 6,7 ,8 9, 10, 11, 12, 13, or 14 days prior to transducing the cells in media that supports the propagation of cells; wherein the media further comprises cytokines, antibodies, and/or feeder cells.
- the media can comprise IL-2, IL-12, IL-15, IL-18, and/or IL-21.
- the media can also comprise anti-CD3 antibody.
- the feeder cells can be purified from feeder cells that stimulate cells.
- NK cell stimulating feeder cells for use in the claimed invention, disclosed herein can be either irradiated autologous or allogeneic peripheral blood mononuclear cells (PBMCs) or nonirradiated autologous or PBMCs; RPMI8866; HFWT, K562; K562 cells transfected with membrane bound IL-15, and 41BBL, or IL-21 or any combination thereof; or EBV-LCL.
- the feeder cells provided in combination with a solution of IL-21, IL-15, and/or 41BBL.
- Feeder cells can be seeded in the culture of cells at a 1 :2, 1 : 1, or 2: 1 ratio.
- the period of culturing can be between 1 and 14 days post AAV infection (i.e., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 days), preferably between 3 and 7 days, most preferably between 4 and 6 days.
- the incubation conditions for primary cells and expanded cells can be different.
- the culturing of primary NK cells prior to AAV infection comprises media and cytokines (such as, for example, IL-2, IL-12, IL-15, IL-18, and/or IL-21) and/or anti-CD3 antibody for less than 5 days (for example 1, 2, 3, or 4 days).
- NK feeder cells at for example, a 1 : 1 ratio
- cytokines such as, for example, IL-2, IL-12, IL-15, IL-18, and/or IL-21
- anti-CD3 antibody anti-CD3 antibody
- a cell such as for example, a T cell, B cell, macrophage, NK cell, fibroblast, neuronal cell osteoblast, hepatocyte, epithelial cell, and/or muscle cell
- methods of genetically modifying a cell comprising incubating primary cells for 4 days in the presence of IL-2 prior to infection with an AAV vector and/or electroporation (when the RNP complex is introduced via electroporation) or incubating expanded cells in the presence of irradiated feeder cells for 4, 5, 6, or 7 days prior to infection with AAV and/or electroporation when the RNP complex is introduced via electroporation.
- the now modified cell can be propagated in a media comprising feeder cells that stimulate the modified cells (such as, for example, a T cell, B cell, macrophage, NK cell, fibroblast, osteoblast, hepatocyte, neuronal cell, epithelial cell, and/or muscle cell).
- a media comprising feeder cells that stimulate the modified cells (such as, for example, a T cell, B cell, macrophage, NK cell, fibroblast, osteoblast, hepatocyte, neuronal cell, epithelial cell, and/or muscle cell).
- NK cell stimulating feeder cells for use in the claimed invention, disclosed herein can be either irradiated autologous or allogeneic peripheral blood mononuclear cells (PBMCs) or nonirradiated autologous or PBMCs; RPMI8866; HFWT, K562; K562 cells transfected with membrane bound IL-15, and 41BBL, or IL-21 or any combination thereof; or EBV-LCL.
- PBMCs peripheral blood mononuclear cells
- RPMI8866 HFWT, K562; K562 cells transfected with membrane bound IL-15, and 41BBL, or IL-21 or any combination thereof
- EBV-LCL EBV-LCL
- the NK cell feeder cells provided in combination with a solution of IL-21, IL-15, and/or 41BBL.
- Feeder cells can be seeded in the culture of NK cells at a 1 :2, 1 : 1, or 2: 1 ratio.
- the It is understood and herein contemplated that the period of culturing can be between 1 and 14 days post infection and/or electroporation (i.e., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 days), preferably between 3 and 7 days, most preferably between 4 and 6 days.
- the media for culturing the modified NK cells can further comprise cytokines such as, for example, IL-2, IL-12, IL-15, IL- 18, and/or IL-21.
- the disclosed plasmids can be used to modify cells useful in the treatment of a cancer.
- Cancer immunotherapy has been advanced in recent years; genetically-modified chimeric antigen receptor (CAR) T cells are an excellent example of engineered immune cells successfully deployed in cancer immunotherapy. These cells were recently approved by the FDA for treatment against CD 19 + B cell malignancies, but success has so far been limited to diseases bearing a few targetable antigens, and targeting such limited antigenic repertoires is prone to failure by immune escape.
- CAR chimeric antigen receptor
- CAR T cells have been focused on the use of autologous T cells because of the risk of graft- versus -host disease caused by allogeneic T cells.
- NK cells are able to kill tumor targets in an antigen-independent manner and do not cause GvHD, which makes them a good candidate for cancer immunotherapy. It is understood and herein contemplated that the disclosed plasmids and methods can be used to generate CAR T cells and CAR NK cells to target T cells and/or NK cells to a cancer.
- chimeric antigen receptor refers to a chimeric receptor that targets a cancer antigen and brings to bring the cell expressing the receptor to a cancer cell expressing the target antigen.
- the CAR comprises a natural ligand of the tumor antigen a molecule that recognizes peptides derived from the tumor antigen presented by MHC molecules, or an antibody or fragment thereof (such as for example, a Fab’, scFv, Fv) expressed on the surface of the CAR cell that targets a cancer antigen.
- the receptor is fused to a signaling domain (such as, for example the CD3z domain for T and NKG2C, NKp44, or CD3z domain for NK cells) via a linker.
- Tumor antigen targets are proteins that are produced by tumor cells that elicit an immune response, particularly B-cell, NK cell, and T-cell mediated immune responses.
- the selection of the antigen binding domain will depend on the particular type of cancer to be treated.
- Tumor antigens are well known in the art and include, for example, a glioma-associated antigen, carcinoembryonic antigen (CEA), EGFRvIII, IL-llRa, IL-13Ra, EGFR, FAP, B7H3, Kit, CA LX, CS-1, MUC1, BCMA, bcr-abl, HER2, b-human chorionic gonadotropin, alphafetoprotein (AFP), ALK, CD19, CD123, cyclin Bl, lectin-reactive AFP, Fos-related antigen 1, ADRB3, thyroglobulin, EphA2, RAGE-1, RU1, RU2, SSX2, AKAP-4, LCK, OY-TES
- tumor antigens include the following: Differentiation antigens such as tyrosinase, TRP-1, TRP-2 and tumor-specific multilineage antigens such as MAGE-1, MAGE-3, BAGE, GAGE-1, GAGE-2, pi 5; overexpressed embryonic antigens such as CEA; overexpressed oncogenes and mutated tumor-suppressor genes such as p53, Ras, HER- 2/neu; unique tumor antigens resulting from chromosomal translocations; such as BCR-ABL, E2A-PRL, H4-RET, IGH-IGK, MYL-RAR; and viral antigens, such as the Epstein Barr virus antigens EBVA and the human papillomavirus (HPV) antigens E6 and E7.
- Differentiation antigens such as tyrosinase, TRP-1, TRP-2 and tumor-specific multilineage antigens such as MAGE-1, MAGE-3, BAGE,
- one goal of the disclosed methods of genetically modifying a cell is to produce a modified cell. Accordingly, disclosed herein are modified T cells, B cells, macrophages, NK cells, fibroblasts, osteoblasts, hepatocytes, neuronal cells, epithelial cells, and/or muscle cells made by the disclosed methods.
- the disclosed modified NK cells are ideally suited for use in immunotherapy such as the adoptive transfer of modified (i.e, engineered NK cells to a subject in need thereof.
- a target cell such as, for example, a T cell, B cell, macrophage, NK cell, fibroblast, osteoblast, hepatocyte, neuronal cell, epithelial cell, and/or muscle cell
- RNP ribonucleoprotein
- the transgene can be comprised on the same plasmid as the Cas9 endonuclease or encoded on a second plasmid in the same or different AAV vector.
- the target cell can be transduced with the RNP complex via electroporation before or concurrently with the infection of the cell with the transgene comprising AAV.
- RNA and RNA complex comprising a class 2 CRISPR/Cas endonuclease (Cas9) complexed with a corresponding CRISPR/Cas guide RNA and an AAV vector comprising a plasmid comprising a transgene (such as, for example, a chimeric antigen receptor for a tumor antigen); wherein the transgene is adjacent to one PAM and crRNA or flanked by two PAMs and crRNAs; and b) introducing the transgene and the RNP complex into the cell; wherein the transgene is introduced into the cell via infection with a ribonucleoprotein (RNP) complex comprising a class 2 CRISPR/Cas endonuclease (Cas9) complexed with a corresponding CRISPR/Cas guide RNA and an AAV vector comprising a plasmid comprising a transgene (such as, for example, a chimeric antigen receptor for a tumor antigen); wherein
- the modified cells cell used in the disclosed immunotherapy methods can be primary cells from a donor source (such as, for example, an allogeneic donor source for an adoptive transfer therapy or an autologous donor source (i.e., the ultimate recipient of the modified cells), a cell line (including, but not limited to NK cell lines NK RPMI8866; HFWT, K562, and EBV-LCL ), or from a source of expanded cells derived a primary cell source or cell line.
- a donor source such as, for example, an allogeneic donor source for an adoptive transfer therapy or an autologous donor source (i.e., the ultimate recipient of the modified cells
- a cell line including, but not limited to NK cell lines NK RPMI8866; HFWT, K562, and EBV-LCL , or from a source of expanded cells derived a primary cell source or cell line.
- the disclosed modifications of the cell can occur ex vivo or in vitro. 79.
- the modified cells can be expanded and stimulated prior to administration of the modified (i.e., engineered) cells to the subject.
- the immune cell such as, for example, a T cell, B cell, macrophage, natural killer (NK) cell, NK T cell, tumor infiltrating lymphocyte (TIM), marrow infiltrating lymphocyte (MIL), tumor infiltrating NK cell (TINK), fibroblast, osteoblast, hepatocyte, neuronal cell, epithelial cell, and/or muscle cell
- the immune cell is expanded with irradiated feeder cells, plasma membrane (PM) particles, or exosomes (EX) expressing membrane bound IL-21 (mbIL-21)(PM particles and EX exosomes expressing mblL- 21 are referred to herein as PM21 particlses and EX21 exosomes, respectively) prior to administration to the subject.
- expansion can further comprise irradiated feeder cells, plasma membrane (PM) particles, or exosomes expressing membrane bound IL-15 (mblL- 15) and/or membrane boudn 4-1BBL (mb4-lBBL)
- irradiated feeder cells plasma membrane (PM) particles
- exosomes expressing membrane bound IL-15 mblL- 15
- membrane boudn 4-1BBL mb4-lBBL
- the cells such as, for example, T cells, B cells, macrophages, NK cells, NK T cells, TILs, MILs, TINKs, fibroblasts, osteoblasts, hepatocytes, neuronal cells, epithelial cells, and/or muscle cells
- the expansion further comprises the administration of IL-15 and/or 4- 1BBL or PM particles, exosomes, and/or irradiated feeder cells that express membrane bound IL-15 and/or 4-1BBL.
- the disclosed modified cell (such as, for example, T cells, B cells, macrophages, NK cells, fibroblasts, osteoblasts, hepatocytes, neuronal cells, epithelial cells, and/or muscle cells and including, but not limited to the CAR NK cells and CAR T cells disclosed herein ) and adoptive transfer methods of the modified cells can be effective immunotherapy against a cancer.
- the disclosed methods and compositions can be used to treat any disease where uncontrolled cellular proliferation occurs such as cancers.
- lymphomas Hodgkins and non- Hodgkins
- leukemias carcinomas, carcinomas of solid tissues
- squamous cell carcinomas adenocarcinomas
- sarcomas gliomas
- high grade gliomas blastomas
- neuroblastomas plasmacytomas
- histiocytomas melanomas
- adenomas hypoxic tumours
- myelomas AIDS- related lymphomas or sarcomas, metastatic cancers, or cancers in general.
- a representative but non-limiting list of cancers that the disclosed compositions can be used to treat is the following: lymphoma, B cell lymphoma, T cell lymphoma, mycosis fungoides, Hodgkin’s Disease, myeloid leukemia, bladder cancer, brain cancer, nervous system cancer, head and neck cancer, squamous cell carcinoma of head and neck, lung cancers such as small cell lung cancer and non-small cell lung cancer, neuroblastoma/glioblastoma, ovarian cancer, skin cancer, liver cancer, melanoma, squamous cell carcinomas of the mouth, throat, larynx, and lung, cervical cancer, cervical carcinoma, breast cancer, and epithelial cancer, renal cancer, genitourinary cancer, pulmonary cancer, esophageal carcinoma, head and neck carcinoma, large bowel cancer, hematopoietic cancers; testicular cancer; colon cancer, rectal cancer, prostatic cancer, or pancreatic cancer.
- Treating,” “treating,” “treatment,” and grammatical variations thereof as used herein include the administration of a composition with the intent or purpose of partially or completely preventing, delaying, curing, healing, alleviating, relieving, altering, remedying, ameliorating, improving, stabilizing, mitigating, and/or reducing the intensity or frequency of one or more a diseases or conditions, a symptom of a disease or condition, or an underlying cause of a disease or condition. Treatments according to the invention may be applied preventively,
- Prophylactic treatments are administered to a subject prior to onset (e.g., before obvious signs of cancer), during early onset (e.g., upon initial signs and symptoms of cancer), or after an established development of cancer. Prophylactic administration can occur for day(s) to years prior to the manifestation of symptoms of an infection.
- hybridization typically means a sequence driven interaction between at least two nucleic acid molecules, such as a primer or a probe and a gene.
- Sequence driven interaction means an interaction that occurs between two nucleotides or nucleotide analogs or nucleotide derivatives in a nucleotide specific manner. For example, G interacting with C or A interacting with T are sequence driven interactions. Typically sequence driven interactions occur on the Watson-Crick face or Hoogsteen face of the nucleotide.
- the hybridization of two nucleic acids is affected by a number of conditions and parameters known to those of skill in the art. For example, the salt concentrations, pH, and temperature of the reaction all affect whether two nucleic acid molecules will hybridize. 84.
- selective hybridization conditions can be defined as stringent hybridization conditions.
- stringency of hybridization is controlled by both temperature and salt concentration of either or both of the hybridization and washing steps.
- the conditions of hybridization to achieve selective hybridization may involve hybridization in high ionic strength solution (6X SSC or 6X SSPE) at a temperature that is about 12-25°C below the Tm (the melting temperature at which half of the molecules dissociate from their hybridization partners) followed by washing at a combination of temperature and salt concentration chosen so that the washing temperature is about 5°C to 20°C below the Tm.
- hybridization temperatures are typically higher for DNA-RNA and RNA-RNA hybridizations.
- the conditions can be used as described above to achieve stringency, or as is known in the art.
- a preferable stringent hybridization condition for a DNA:DNA hybridization can be at about 68°C (in aqueous solution) in 6X SSC or 6X SSPE followed by washing at 68°C. Stringency of hybridization and washing, if desired, can be reduced accordingly as the degree of complementarity desired is decreased, and further, depending upon the G-C or A-T richness of any area wherein variability is searched for.
- stringency of hybridization and washing can be increased accordingly as homology desired is increased, and further, depending upon the G-C or A-T richness of any area wherein high homology is desired, all as known in the art.
- selective hybridization conditions would be when at least about, 60, 65, 70, 71, 72,
- the non-limiting primer is in for example, 10 or 100 or 1000-fold excess.
- This type of assay can be performed at under conditions where both the limiting and non-limiting primer are for example, 10-fold or 100-fold or 1000-fold below their kd, or where only one of the nucleic acid molecules is 10-fold or 100-fold or 1000-fold or where one or both nucleic acid molecules are above their kd.
- selective hybridization conditions are when at least about, 60, 65, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100 percent of the primer is enzymatically manipulated under conditions which promote the enzymatic
- selective hybridization conditions would be when at least about 60, 65, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100 percent of the primer molecules are extended.
- Preferred conditions also include those suggested by the manufacturer or indicated in the art as being appropriate for the enzyme performing the manipulation.
- hybridization between two nucleic acid molecules but unless otherwise indicated meeting the parameters of any of the methods would be sufficient. For example if 80% hybridization was required and as long as hybridization occurs within the required parameters in any one of these methods it is considered disclosed herein.
- composition or method meets any one of these criteria for determining hybridization either collectively or singly it is a composition or method that is disclosed herein.
- nucleic acid based there are a variety of molecules disclosed herein that are nucleic acid based, including for example the nucleic acids that encode, for example TGFPR2, or any of the nucleic acids disclosed herein for making TGFRP2 knockouts, or fragments thereof, as well as various functional nucleic acids.
- the disclosed nucleic acids are made up of for example, nucleotides, nucleotide analogs, or nucleotide substitutes. Non-limiting examples of these and other molecules are discussed herein. It is understood that for example, when a vector is expressed in a cell, that the expressed mRNA will typically be made up of A, C, G, and U.
- an antisense molecule is introduced into a cell or cell environment through for example exogenous delivery, it is advantagous that the antisense molecule be made up of nucleotide analogs that reduce the degradation of the antisense molecule in the cellular environment.
- a nucleotide is a molecule that contains a base moiety, a sugar moiety and a phosphate moiety. Nucleotides can be linked together through their phosphate moieties and sugar moieties creating an intemucleoside linkage.
- the base moiety of a nucleotide can be adenin-9-yl (A), cytosin-l-yl (C), guanin-9-yl (G), uracil- 1-yl (U), and thymin-l-yl (T).
- the sugar moiety of a nucleotide is a ribose or a deoxyribose.
- the phosphate moiety of a nucleotide is pentavalent phosphate.
- An non-limiting example of a nucleotide would be 3'-AMP (3'- adenosine monophosphate) or 5'-GMP (5'-guanosine monophosphate).
- 3'-AMP 3'- adenosine monophosphate
- 5'-GMP 5'-guanosine monophosphate
- a nucleotide analog is a nucleotide which contains some type of modification to either the base, sugar, or phosphate moieties. Modifications to nucleotides are well known in the art and would include for example, 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, and 2-aminoadenine as well as modifications at the sugar or phosphate moieties. There are many varieties of these types of molecules available in the art and available herein.
- Nucleotide substitutes are molecules having similar functional properties to nucleotides, but which do not contain a phosphate moiety, such as peptide nucleic acid (PNA). Nucleotide substitutes are molecules that will recognize nucleic acids in a Watson-Crick or Hoogsteen manner, but which are linked together through a moiety other than a phosphate moiety. Nucleotide substitutes are able to conform to a double helix type structure when interacting with the appropriate target nucleic acid. There are many varieties of these types of molecules available in the art and available herein.
- conjugates can be chemically linked to the nucleotide or nucleotide analogs.
- conjugates include but are not limited to lipid moieties such as a cholesterol moiety.
- a Watson-Crick interaction is at least one interaction with the Watson-Crick face of a nucleotide, nucleotide analog, or nucleotide substitute.
- the Watson-Crick face of a nucleotide, nucleotide analog, or nucleotide substitute includes the C2, Nl, and C6 positions of a purine based nucleotide, nucleotide analog, or nucleotide substitute and the C2, N3, C4 positions of a pyrimidine based nucleotide, nucleotide analog, or nucleotide substitute.
- a Hoogsteen interaction is the interaction that takes place on the Hoogsteen face of a nucleotide or nucleotide analog, which is exposed in the major groove of duplex DNA.
- the Hoogsteen face includes the N7 position and reactive groups (NH2 or O) at the C6 position of purine nucleotides.
- sequences related to the protein molecules involved in the signaling pathways disclosed herein for example TGFPR2, all of which are encoded by nucleic acids or are nucleic acids.
- sequences for the human analogs of these genes, as well as other anlogs, and alleles of these genes, and splice variants and other types of variants are available in a variety of protein and gene databases, including Genbank.
- Genbank Those of skill in the art understand how to resolve sequence discrepancies and differences and to adjust the compositions and methods relating to a particular sequence to other related sequences. Primers and/or probes can be designed for any given sequence given the information disclosed herein and known in the art.
- compositions including primers and probes, which are capable of interacting with the disclosed nucleic acids, such as the TGFPR2 and/or HPRT1 as disclosed herein.
- the primers are used to support DNA amplification reactions.
- the primers will be capable of being extended in a sequence specific manner.
- Extension of a primer in a sequence specific manner includes any methods wherein the sequence and/or composition of the nucleic acid molecule to which the primer is hybridized or otherwise associated directs or influences the composition or sequence of the product produced by the extension of the primer.
- Extension of the primer in a sequence specific manner therefore includes, but is not limited to, PCR, DNA sequencing, DNA extension, DNA polymerization, RNA transcription, or reverse transcription. Techniques and conditions that amplify the primer in a sequence specific manner are preferred.
- the primers are used for the DNA amplification reactions, such as PCR or direct sequencing.
- the primers can also be extended using non-enzymatic techniques, where for example, the nucleotides or oligonucleotides used to extend the primer are modified such that they will chemically react to extend the primer in a sequence specific manner.
- the disclosed primers hybridize with the disclosed nucleic acids or region of the nucleic acids or they hybridize with the complement of the nucleic acids or complement of a region of the nucleic acids.
- the size of the primers or probes for interaction with the nucleic acids in certain embodiments can be any size that supports the desired enzymatic manipulation of the primer, such as DNA amplification or the simple hybridization of the probe or primer.
- a typical primer or probe would be at least 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51,
- a primer or probe can be less than or equal to 6, 7, 8, 9, 10, 11,
- the primers for the TGF R2 and HPRT1 gene typically will be used to produce an amplified DNA product that contains a region of the TGFPR2 and HPRT1 gene or the complete gene. In general, typically the size of the product will be such that the size can be accurately determined to within 3, or 2 or 1 nucleotides.
- this product is at least 20, 21, 22, 23, 24, 25, 26, 27, 28,
- the product is less than or equal to 20, 21, 22, 23, 24, 25,
- compositions and methods which can be used to deliver nucleic acids to cells, either in vitro or in vivo. These methods and compositions can largely be broken down into two classes: viral based delivery systems and non-viral based delivery systems.
- the nucleic acids can be delivered through a number of direct delivery systems such as, electroporation, lipofection, calcium phosphate precipitation, plasmids, viral vectors, viral nucleic acids, phage nucleic acids, phages, cosmids, or via transfer of genetic material in cells or carriers such as cationic liposomes.
- Transfer vectors can be any nucleotide construction used to deliver genes into cells (e.g., a plasmid), or as part of a general strategy to deliver genes, e.g., as part of recombinant retrovirus or adenovirus (Ram et al. Cancer Res. 53:83-88, (1993)).
- plasmid or viral vectors are agents that transport the disclosed nucleic acids into the cell without degradation and include a promoter yielding expression of the gene in the cells into which it is delivered.
- Viral vectors are, for example, Adenovirus, Adeno- associated virus, Herpes virus, Vaccinia virus, Polio virus, AIDS virus, neuronal trophic virus, Sindbis and other RNA viruses, including these viruses with the HIV backbone. Also preferred are any viral families which share the properties of these viruses which make them suitable for use as vectors.
- Retroviruses include Murine Maloney Leukemia virus, MMLV, and retroviruses that express the desirable properties of MMLV as a vector.
- Retroviral vectors are able to carry a larger genetic payload, i.e., a transgene or marker gene, than other viral vectors, and for this reason are a commonly used vector. However, they are not as useful in non-proliferating cells.
- Adenovirus vectors are relatively stable and easy to work with, have high titers, and can be delivered in aerosol formulation, and can transfect non-dividing cells.
- Pox viral vectors are large and have several sites for inserting genes, they are thermostable and can be stored at room temperature.
- a preferred embodiment is a viral vector which has been engineered so as to suppress the immune response of the host organism, elicited by the viral antigens.
- Preferred vectors of this type will carry coding regions for Interleukin 8 or 10.
- Viral vectors can have higher transaction (ability to introduce genes) abilities than chemical or physical methods to introduce genes into cells.
- viral vectors contain, nonstructural early genes, structural late genes, an RNA polymerase III transcript, inverted terminal repeats necessary for replication and encapsidation, and promoters to control the transcription and replication of the viral genome.
- viruses When engineered as vectors, viruses typically have one or more of the early genes removed and a gene or gene/promotor cassette is inserted into the viral genome in place of the removed viral DNA. Constructs of this type can carry up to about 8 kb of foreign genetic material.
- the necessary functions of the removed early genes are typically supplied by cell lines which have been engineered to express the gene products of the early genes in trans.
- AAV adeno-associated virus
- AAV type vectors can transport about 4 to 5 kb and wild type AAV is known to stably insert into chromosome 19 (such as, for example at AAV integration site 1 (AAVS1)). Vectors which contain this site-specific integration property are preferred.
- AAVs used can be derived from any AAV serotype, including but not limited to AAC1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, and recombinant (rAAV) such as, for example AAV-Rh74, and/or synthetic AAV (such as, for example AAV-DJ, Anc80).
- AAV serotypes can be selected based on cell or tissue tropism.
- AAV vectors for use in the disclosed compositions and methods can be single stranded (SS) or self-complementary (SC).
- the AAV contains a pair of inverted terminal repeats (ITRs) which flank at least one cassette containing a promoter which directs cell-specific expression operably linked to a heterologous gene.
- ITRs inverted terminal repeats
- Heterologous in this context refers to any nucleotide sequence or gene which is not native to the AAV or B19 parvovirus.
- the AAV and B19 coding regions have been deleted, resulting in a safe, noncytotoxic vector.
- the AAV ITRs, or modifications thereof, confer infectivity and site- specific integration, but not cytotoxicity, and the promoter directs cell-specific expression.
- the disclosed vectors thus provide DNA molecules which are capable of integration into a mammalian chromosome without substantial toxicity.
- the inserted genes in viral and retroviral usually contain promoters, and/or enhancers to help control the expression of the desired gene product.
- a promoter is generally a sequence or sequences of DNA that function when in a relatively fixed location in regard to the transcription start site.
- a promoter contains core elements required for basic interaction of RNA polymerase and transcription factors, and may contain upstream elements and response elements.
- the packaging capacity of an AAV is limited.
- One method to overcome the loading capacity of an AAV vector is through the use of 2 vectors, wherein the transgene is split between the two plasmids and a 3’ splice donor and 5’ splice acceptor are used to join the two sections of transgene into a single full-length transgene.
- the two transgenes can be made with substantial overlap and homologous recombination will join the two segments into a full-length transcript.
- the nucleic acids that are delivered to cells typically contain expression controlling systems.
- the inserted genes in viral and retroviral systems usually contain promoters, and/or enhancers to help control the expression of the desired gene product.
- a promoter is generally a sequence or sequences of DNA that function when in a relatively fixed location in regard to the transcription start site.
- a promoter contains core elements required for basic interaction of RNA polymerase and transcription factors, and may contain upstream elements and response elements.
- Preferred promoters controlling transcription from vectors in mammalian host cells may be obtained from various sources, for example, the genomes of viruses such as:
- SV40 Simian Virus 40
- adenovirus adenovirus
- retroviruses retroviruses
- hepatitis-B virus hepatitis-B virus
- most preferably cytomegalovirus or from heterologous mammalian promoters, e.g. beta actin promoter.
- heterologous mammalian promoters e.g. beta actin promoter.
- the early and late promoters of the SV40 virus are conveniently obtained as an SV40 restriction fragment which also contains the SV40 viral origin of replication (Fiers et al, Nature, 273: 113 (1978)).
- the immediate early promoter of the human cytomegalovirus is conveniently obtained as a /// «dill E restriction fragment (Greenway, P.J. et al, Gene 18: 355-360 (1982)).
- promoters from the host cell or related species also are useful herein.
- Enhancer generally refers to a sequence of DNA that functions at no fixed distance from the transcription start site and can be either 5' (Laimins, L. et al, Proc. Natl. Acad. Sci. 78: 993 (1981)) or 3' (Lusky, M.L., et al, Mol. Cell Bio. 3: 1108 (1983)) to the
- enhancers can be within an intron (Banerji, J.L. et al, Cell 33: 729 (1983)) as well as within the coding sequence itself (Osborne, T.F., et al., Mol. Cell Bio. 4: 1293 (1984)). They are usually between 10 and 300 bp in length, and they function in cis. Enhancers f unction to increase transcription from nearby promoters. Enhancers also often contain response elements that mediate the regulation of transcription. Promoters can also contain response elements that mediate the regulation of transcription. Enhancers often determine the regulation of expression of a gene.
- enhancer sequences are now known from mammalian genes (globin, elastase, albumin, -fetoprotein and insulin), typically one will use an enhancer from a eukaryotic cell virus for general expression.
- Preferred examples are the SV40 enhancer on the late side of the replication origin (bp 100-270), the
- cytomegalovirus early promoter enhancer the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers.
- the promotor and/or enhancer may be specifically activated either by light or specific chemical events which trigger their function.
- Systems can be regulated by reagents such as tetracycline and dexamethasone.
- reagents such as tetracycline and dexamethasone.
- irradiation such as gamma irradiation, or alkylating chemotherapy drugs.
- the promoter and/or enhancer region can act as a constitutive promoter and/or enhancer to maximize expression of the region of the transcription unit to be transcribed.
- the promoter and/or enhancer region be active in all eukaryotic cell types, even if it is only expressed in a particular type of cell at a particular time.
- a preferred promoter of this type is the CMV promoter (650 bases).
- Other preferred promoters are SV40 promoters, cytomegalovirus (full length promoter), and retroviral vector LTR.
- GFAP glial fibrillary acetic protein
- Expression vectors used in eukaryotic host cells may also contain sequences necessary for the termination of transcription which may affect mRNA expression. These regions are transcribed as
- the 3' untranslated regions also include transcription termination sites.
- the transcription unit also contains a polyadenylation region.
- One benefit of this region is that it increases the likelihood that the transcribed unit will be processed and transported like mRNA.
- the identification and use of polyadenylation signals in expression constructs is well established. It is preferred that homologous polyadenylation signals be used in the transgene constructs.
- the polyadenylation region is derived from the SV40 early polyadenylation signal and consists of about 400 bases. It is also preferred that the transcribed units contain other standard sequences alone or in combination with the above sequences improve expression from, or stability of, the construct.
- the viral vectors can include nucleic acid sequence encoding a marker product. This marker product is used to determine if the gene has been delivered to the cell and once delivered is being expressed.
- Preferred marker genes are the E. Coli lacZ gene, which encodes b-galactosidase, and green fluorescent protein.
- the marker may be a selectable marker.
- suitable selectable markers for mammalian cells are dihydrofolate reductase (DHFR), thymidine kinase, neomycin, neomycin analog G418, hydromycin, and puromycin.
- DHFR dihydrofolate reductase
- thymidine kinase thymidine kinase
- neomycin neomycin analog G418, hydromycin
- puromycin puromycin.
- selectable markers When such selectable markers are successfully transferred into a mammalian host cell, the transformed mammalian host cell can survive if placed under selective pressure.
- These cells lack the ability to grow without the addition of such nutrients as thymidine or hypoxanthine. Because these cells lack certain genes necessary for a complete nucleotide synthesis pathway, they cannot survive unless the missing nucleotides are provided in a supplemented media.
- An alternative to supplementing the media is to introduce an intact DHFR or TK gene into cells lacking the respective genes, thus altering their growth requirements. Individual cells which were not transformed with the DHFR or TK gene will not be capable of survival in non-supplemented media.
- the second category is dominant selection which refers to a selection scheme used in any cell type and does not require the use of a mutant cell line. These schemes typically use a drug to arrest growth of a host cell. Those cells which have a novel gene would express a protein conveying drug resistance and would survive the selection. Examples of such dominant selection use the drugs neomycin, (Southern P. and Berg, P., J. Molec. Appl. Genet. 1 : 327 (1982)), mycophenolic acid, (Mulligan, R.C. and Berg, P. Science 209: 1422 (1980)) or hygromycin, (Sugden, B. et al, Mol. Cell. Biol. 5: 410-413 (1985)).
- the three examples employ bacterial genes under eukaryotic control to convey resistance to the appropriate drug G418 or neomycin (geneticin), xgpt (mycophenolic acid) or hygromycin, respectively. Others include the neomycin analog G418 and puramycin. 5.
- Protein variants and derivatives are well understood to those of skill in the art and in can involve amino acid sequence modifications.
- amino acid sequence modifications typically fall into one or more of three classes: substitutional, insertional or deletional variants.
- Insertions include amino and/or carboxyl terminal fusions as well as intrasequence insertions of single or multiple amino acid residues. Insertions ordinarily will be smaller insertions than those of amino or carboxyl terminal fusions, for example, on the order of one to four residues.
- Immunogenic fusion protein derivatives are made by fusing a polypeptide sufficiently large to confer immunogenicity to the target sequence by cross-linking in vitro or by recombinant cell culture transformed with DNA encoding the fusion.
- Deletions are characterized by the removal of one or more amino acid residues from the protein sequence. Typically, no more than about from 2 to 6 residues are deleted at any one site within the protein molecule.
- These variants ordinarily are prepared by site specific mutagenesis of nucleotides in the DNA encoding the protein, thereby producing DNA encoding the variant, and thereafter expressing the DNA in recombinant cell culture.
- substitution mutations at predetermined sites in DNA having a known sequence are well known, for example Ml 3 primer mutagenesis and PCR mutagenesis.
- Amino acid substitutions are typically of single residues, but can occur at a number of different locations at once; insertions usually will be on the order of about from 1 to 10 amino acid residues; and deletions will range about from 1 to 30 residues.
- Deletions or insertions preferably are made in adjacent pairs, i.e. a deletion of 2 residues or insertion of 2 residues.
- Substitutions, deletions, insertions or any combination thereof may be combined to arrive at a final construct.
- the mutations must not place the sequence out of reading frame and preferably will not create complementary regions that could produce secondary mRNA structure.
- Substitutional variants are those in which at least one residue has been removed and a different residue inserted in its place. Such substitutions generally are made in accordance with the following Tables 2 and 3 and are referred to as conservative substitutions.
- Substantial changes in function or immunological identity are made by selecting substitutions that are less conservative than those in Table 3, i.e., selecting residues that differ more significantly in their effect on maintaining (a) the structure of the polypeptide backbone in the area of the substitution, for example as a sheet or helical conformation, (b) the charge or hydrophobicity of the molecule at the target site or (c) the bulk of the side chain.
- substitutions which in general are expected to produce the greatest changes in the protein properties will be those in which (a) a hydrophilic residue, e.g. seryl or threonyl, is substituted for (or by) a hydrophobic residue, e.g.
- an electropositive side chain e.g., lysyl, arginyl, or histidyl
- an electronegative residue e.g., glutamyl or aspartyl
- substitutions include combinations such as, for example, Gly, Ala; Val, lie, Leu; Asp, Glu; Asn, Gin; Ser, Thr; Lys, Arg; and Phe, Tyr.
- substitutions include combinations such as, for example, Gly, Ala; Val, lie, Leu; Asp, Glu; Asn, Gin; Ser, Thr; Lys, Arg; and Phe, Tyr.
- Such conservatively substituted variations of each explicitly disclosed sequence are included within the mosaic polypeptides provided herein.
- Substitutional or deletional mutagenesis can be employed to insert sites for N- glycosylation (Asn-X-Thr/Ser) or O-glycosylation (Ser or Thr).
- Deletions of cysteine or other labile residues also may be desirable.
- Deletions or substitutions of potential proteolysis sites, e.g. Arg is accomplished for example by deleting one of the basic residues or substituting one by glutaminyl or histidyl residues.
- Certain post-translational derivatizations are the result of the action of recombinant host cells on the expressed polypeptide. Glutaminyl and asparaginyl residues are frequently post-translationally deamidated to the corresponding glutamyl and aspary 1 residues. Alternatively, these residues are deamidated under mildly acidic conditions. Other post- translational modifications include hydroxylation of proline and lysine, phosphorylation of hydroxyl groups of seryl or threonyl residues, methylation of the o-amino groups of lysine, arginine, and histidine side chains (T.E. Creighton, Proteins: Structure and Molecular
- homology/identity to specific known sequences Specifically disclosed are variants of these and other proteins herein disclosed which have at least, 70% or 75% or 80% or 85% or 90% or 95% homology to the stated sequence. Those of skill in the art readily understand how to determine the homology of two proteins. For example, the homology can be calculated after aligning the two sequences so that the homology is at its highest level.
- nucleic acid sequences related to a specific protein sequence i.e. all nucleic acids having a sequence that encodes one particular protein sequence as well as all nucleic acids, including degenerate nucleic acids, encoding the disclosed variants and derivatives of the protein sequences.
- each particular nucleic acid sequence may not be written out herein, it is understood that each and every sequence is in fact disclosed and described herein through the disclosed protein sequence. It is also understood that while no amino acid sequence indicates what particular DNA sequence encodes that protein within an organism, where particular variants of a disclosed protein are disclosed herein, the known nucleic acid sequence that encodes that protein is also known and herein disclosed and described.
- Molecules can be produced that resemble peptides, but which are not connected via a natural peptide linkage.
- Amino acid analogs and analogs and peptide analogs often have enhanced or desirable properties, such as, more economical production, greater chemical stability, enhanced pharmacological properties (half-life, absorption, potency, efficacy, etc.), altered specificity (e.g., a broad-spectrum of biological activities), reduced antigenicity, and others.
- D-amino acids can be used to generate more stable peptides, because D amino acids are not recognized by peptidases and such.
- Systematic substitution of one or more amino acids of a consensus sequence with a D-amino acid of the same type e.g., D-lysine in place of L-lysine
- Cysteine residues can be used to cyclize or attach two or more peptides together. This can be beneficial to constrain peptides into particular conformations.
- compositions can also be administered in vivo in a pharmaceutically acceptable carrier.
- pharmaceutically acceptable is meant a material that is not biologically or otherwise undesirable, i.e., the material may be administered to a subject, along with the nucleic acid or vector, without causing any undesirable biological effects or interacting in a deleterious manner with any of the other components of the pharmaceutical composition in which it is contained.
- the carrier would naturally be selected to minimize any degradation of the active ingredient and to minimize any adverse side effects in the subject, as would be well known to one of skill in the art.
- compositions may be administered orally, parenterally (e.g., intravenously), by intramuscular injection, by intrap eritoneal injection, transdermally, extracorporeally, topically or the like, including topical intranasal administration or administration by inhalant.
- topical intranasal administration means delivery of the compositions into the nose and nasal passages through one or both of the nares and can comprise delivery by a spraying mechanism or droplet mechanism, or through aerosolization of the nucleic acid or vector.
- Administration of the compositions by inhalant can be through the nose or mouth via delivery by a spraying or droplet mechanism.
- compositions can also be directly to any area of the respiratory system (e.g., lungs) via intubation.
- the exact amount of the compositions required will vary from subject to subject, depending on the species, age, weight and general condition of the subject, the severity of the allergic disorder being treated, the particular nucleic acid or vector used, its mode of administration and the like. Thus, it is not possible to specify an exact amount for every composition. However, an appropriate amount can be determined by one of ordinary skill in the art using only routine experimentation given the teachings herein.
- Parenteral administration of the composition is generally characterized by injection.
- Injectables can be prepared in conventional forms, either as liquid solutions or suspensions, solid forms suitable for solution of suspension in liquid prior to injection, or as emulsions.
- a more recently revised approach for parenteral administration involves use of a slow release or sustained release system such that a constant dosage is maintained. See, e.g., U.S. Patent No. 3,610,795, which is incorporated by reference herein.
- the materials may be in solution, suspension (for example, incorporated into microparticles, liposomes, or cells). These may be targeted to a particular cell type via antibodies, receptors, or receptor ligands.
- the following references are examples of the use of this technology to target specific proteins to tumor tissue (Senter, et al, Bioconjugate Chem., 2:447-451, (1991); Bagshawe, K.D., Br. J Cancer, 60:275-281, (1989); Bagshawe, et al, Br. J. Cancer, 58:700-703, (1988); Senter, et al, Bioconjugate Chem., 4:3-9, (1993); Battelli, et al., Cancer Immunol. Immunother., 35:421-425, (1992); Pietersz and McKenzie, Immunolog.
- Vehicles such as "stealth” and other antibody conjugated liposomes (including lipid mediated drug targeting to colonic carcinoma), receptor mediated targeting of DNA through cell specific ligands, lymphocyte directed tumor targeting, and highly specific therapeutic retroviral targeting of murine glioma cells in vivo.
- stealth and other antibody conjugated liposomes (including lipid mediated drug targeting to colonic carcinoma), receptor mediated targeting of DNA through cell specific ligands, lymphocyte directed tumor targeting, and highly specific therapeutic retroviral targeting of murine glioma cells in vivo.
- the following references are examples of the use of this technology to target specific proteins to tumor tissue (Hughes et al, Cancer Research, 49:6214- 6220, (1989); and Litzinger and Huang, Biochimica et Biophysica Acta, 1104: 179-187, (1992)).
- receptors are involved in pathways of endocytosis, either constitutive or ligand induced. These receptors cluster in clathrin-coated pits, enter the cell via clathrin-coated vesicles, pass through an acidified endosome in which the receptors are sorted, and then either recycle to the cell surface, become stored intracellularly, or are degraded in lysosomes.
- the internalization pathways serve a variety of functions, such as nutrient uptake, removal of activated proteins, clearance of macromolecules, opportunistic entry of viruses and toxins, dissociation and degradation of ligand, and receptor-level regulation.
- receptors follow more than one intracellular pathway, depending on the cell type, receptor concentration, type of ligand, ligand valency, and ligand concentration. Molecular and cellular mechanisms of receptor-mediated endocytosis has been reviewed (Brown and Greene, DNA and Cell Biology 10:6, 399-409 (1991)).
- Plasmids comprising in order a left homology arm, a splice acceptor, a transgene, and a right homology arm; wherein the left and right homology arms are each 800bp in length or less.
- plasmids comprising or consisting of 1 or 2 protospacer adjacent motifs (PAMs) and CRISPR RNAs (crRNAs) and a transgene; wherein the order of the encoded nucleic acid comprises a PAM, a crRNA and a transgene; and wherein when 2 PAMs and crRNAs are used, the encoded nucleic acid comprises a first PAM, a first crRNA, a transgene, a second PAM, and second gRNA.
- PAMs protospacer adjacent motifs
- crRNAs CRISPR RNAs
- a plasmid of the invention an AAV vector of the invention or a modified cell of the invention for use as a medicament.
- the invention further provides a use of a plasmid of the invention, an AAV vector of the invention or a modified cell of the invention for the manufacture of a medicament.
- the invention also provides a plasmid of the invention, an AAV vector of the invention or a modified cell of the invention for use in the treatment of cancer.
- the invention further provides a use of a plasmid of the invention, an AAV vector of the invention, or a modified cell of the invention for the manufacture of a medicament for the treatment of cancer.
- CAR T cells Genetically-modified chimeric antigen receptor (CAR) T cells are an excellent example of engineered immune cells successfully deployed in cancer immunotherapy. These cells were recently approved by the FDA for treatment against CD19+ B cell malignancies, but success has so far been limited to diseases bearing a few targetable antigens. It also has several side effects which make NK cells a better alternative.
- CAR chimeric antigen receptor
- Disclosed herein is a DNA-free technique for the genome editing of primary and expanded human cells (including NK cells) utilizing Cas9 ribonucleoprotein complexes (Cas9/RNPs) (See Fig. 1).
- transgene delivery with naturally recombinant adeno-associated virus (rAAV) donor vectors which are non-pathogenic viruses enables site-specific gene insertion by homology directed or homology independent targeted integration (HITI, CRISPaint)(FIG. 3).
- rAAV naturally recombinant adeno- associated virus
- Essential sequences from the different serotypes of AAV plasmids were used to develop 12 novel plasmids to be used in a combination with Cas9/RNP (Fig. 2) for directed integration of genes of interest in to human primary cells including NK cells and HEK293 cells.
- the Cas9 RNP complex cleaves DNA (at AA VS1 locus), In the presence of a DNA fragment of choice (CAR-expressing DNA or reporter gene) provided by one of our 12 AAV plasmids (single-stranded or self-complementary) with 30-1000bp homology arms between the target and the donor DNA on each side flanking the Cas9 cleavage site for HDR-guided gene insertion or the homology independent-guided insertion (by providing crRNA+PAM sequence in the DNA template), an exogenous gene was inserted into the genome of human NK cells and HEK293 cells as a proof.
- CAR-expressing DNA or reporter gene provided by one of our 12 AAV plasmids (single-stranded or self-complementary) with 30-1000bp homology arms between the target and the donor DNA on each side flanking the Cas9 cleavage site for HDR-guided gene insertion or the homology independent-guided insertion (by providing crRNA+PAM sequence
- NK cells were transfected with AAV delivered CRISPR/Cas9 plasmids and plasmids comprising transgenes.
- AAV serotype for infection in NK cells various AAV serotypes comprising plasmids encoding green fluorescence protein (GFP) encoding were used to infect NK cells under various transfection conditions (Fig. 4A). It was determined that AAV6 consistently provided the greatest expression under any culture conditions. Moreover, it was shown that the infection of AAV6 was transient having approximately 2.5xl0 7 copies of virus 6h after a MOI of 3xl0 6 , but falling to near undetectable levels by 48hrs post infection (4B). This is particularly important as it indicates a decreased risk of off target infection.
- HEK293 Cells were next electroporated with a ribonucleoprotein (RNP) complex comprising a class 2 CRISPR/Cas endonuclease (Cas9) complexed with a corresponding CRISPR/Cas guide RNA and infected with AAV encoding and the mCherry transgene targeted to the AAVS1 locus (Fig. 5).
- RNP ribonucleoprotein
- Cas9 class 2 CRISPR/Cas endonuclease
- NK cells Gene modification of NK cells using viral or non-viral vectors has been challenging due to robust foreign DNA- and RNA-sensing mechanisms, and hence limits the efficiency of gene delivery methods into NK cells.
- a new method was developed for electroporating Cas9/ribonucleoprotein complexes (Cas9/RNP) directly into human primary NK cells. This method introduces a double-strand break (DSB) in the genome of NK cells, which results in successful gene knock-out and enhanced antitumor activity.
- Cas9 protein is preferable to mRNA delivery due to its fast action and clearance. After this initial success in gene silencing, the method was further developed for gene insertion.
- adeno-associated viruses were used safely in clinical trials and are effective as vectors for sensitive primary immune cells, including T-cells.
- Transcripts that are delivered via AAV vectors can be packaged as a linear single-stranded (ss) DNA with a length of approximately 4.7 kb (ssAAV) or linear self-complementary (sc) DNA (scAAV).
- scAAV contains a mutated ITR which helps to bypass rate-limiting steps of second strand generation for converting ssDNA into double-stranded (ds)DNA.
- the scAAV has only half the packaging capacity compared to ssAAV and hence is not suitable for larger transgenes.
- Both ssAAV and scAAV are designed and tested for DNA template delivery into NK cells. 154.
- Stable gene integration through HR machinery depends on providing the transgenes with optimal homology arms for the flanking region of the D SB.
- To find the most optimal length of homology arms and optimize packaging capacity of a transgene into ssAAV and scAAV 30bp, 300bp, 500bp and 800-1000 bps of HAs were designed for the right and left side of Cas9-targeting site. Since designing homology arms is a time-consuming procedure and requires multiple optimizations, the CRISPaint approach was also investigated, a homology- independent method for gene insertion or tagging. In this method, the same Cas9 targeting site, including crRNA and PAM sequences, is provided in the DNA template encoding the gene of interest.
- NK cells were purified. Briefly, NK cells were isolated from PBMC using RosetteSepTM Human NK Cell Enrichment Cocktail (FIG. 8). Purified NK cells were phenotyped using flow cytometry as >90% CD3-negative/CD56-positive population (FIG. 9). These cells were stimulated with irradiated mbIL21 -expressing K562 feeder cells at a ratio of
- the stimulated cells were cultured for 7 days in the serum-free AIM-V/ICSR expansion medium containing 100 IU/mL of IL-2.
- Genomic safe harbors are sites in the genome which can be modified with no change in the normal function of the host cell and allow adequate expression of the transgene.
- the adeno-associated virus site 1 (AAVS1) was chosen, which is one of the GSHs and an exemplary locus within the phosphatase 1 regulatory subunit 12C (PPP1R12C) gene. This locus has been successfully used for directed gene insertion into several cell types.
- PPP1R12C phosphatase 1 regulatory subunit 12C
- This locus has been successfully used for directed gene insertion into several cell types.
- the chromatin accessibility of AAVS1 was evaluated in naive and expanded NK cells by ATAC-seq assay and showed no difference between the naive and IL-21 expanded cells (FIG. 10).
- AAVS1 was targeted using one gRNA (crRNA: 5’ GGGGCCACTAGGGAC AGGAT (SEQ ID NO: 17)) via electroporation of Cas9/RNP into
- NK cells were harvested and washed twice with 13ml of PBS followed by centrifugation for 7 minutes at 300g and aspiration of PBS. The cell pellet was resuspended in 20ul of P3 Primary Cell 4D-Nucleofector Solution. 5ul of pre-complexed Cas9/RNP (Alt-R® CRISPR-Cas9 crRNA, Alt-R® CRISPR-Cas9 tracrRNA and Alt-R® S.p.
- HiFi Cas9 Nuclease V3 Integrated DNA Technologies, Inc., Coralville, Iowa
- targeting AAVSl and lul of lOOuM electroporation enhancer Alt-R® Cas9 Electroporation Enhancer
- the total volume of 26ul of CRISPR reaction was transferred into 4D-NucleofectorTM 16-well Strip and electroporated using program EN-138. After electroporation, the cells were transferred into 2ml of serum-free media containing 100IU of IL- 2 in a 12 well plate (FIG. 11) and incubated at 37 degrees 5% CO2 pressure.
- NK cell DNA was isolated for detection of Insertions deletions (Indels) in CRISPR edited NK cells.
- the region flanking the Cas9 targeting site was PCR amplified and the amplicons were Sanger sequenced.
- Inference of CRISPR Edits was used to analyze the frequency of Indels (FIG. 12).
- the ICE results showed that more than 85% of CRISPR modified NK cells had at least one indel at the AAVSl Cas9-targeting site.
- cytotoxicity of AAVSl -KO NK cells was assessed using Kasumi, an AML cancer cell line. Using a Calcein AM assay, no difference between wild type and CRISPR modified NK cells in their killing ability was observed (FIG. 13).
- NK cells transduced with AAV6 had the highest expression level of GFP detected by flow cytometry.
- AAV6 viral genome can be detected up to 48 hours post-transduction by qPCR analysis, which is a critical time for the endonuclease function of Cas9 protein (FIG. 14).
- AAVSl locus can be modified in NK cells without altering their ability to target cancer cells
- AAV mediated delivery of the mCherry transgene for gene insertion at AAVSl was evaluated.
- HR-directed gene insertion DNA- encoding mCherry with homology arms (HA) to the flanking region of Cas9-targeting site were cloned into the backbone of single-stranded or self-complementary AAV vector.
- 30bp, 300bp, 500bp and lOOObp of HA was designed for the right and 30bp, 300bp, 500bp and 800bp was designed for the left HA (FIG. 15).
- CRISPaint and HR are regulated by enzymatic reactions.
- CRISPaint is a LIG4-dependent process, while other proteins such as BRCA1 and BRCA2 regulate HR. Therefore, expression levels of these genes in NK cells were analyzed to evaluate which repair pathway can be more efficient in this cell type.
- RNA-seq analysis showed that the expanded NK cells have higher expression of BRCA1 and BRCA2 in comparison to naive NK cells and there is no decrease in LIG4 level in these cells (FIG. 18), providing optimal conditions for either HR or NHEJ-directed gene insertion through CRISPaint.
- a media change and resuspension at 5 x 10 5 cells per ml was performed on day 6 of NK cell expansion one day prior to experimental manipulation.
- the NK cells were then electroporated with Cas9/RNP targeting AAVS l on day 7 as described above.
- live cells were collected and resuspended at 1 x 10 6 cells per ml in media containing 100IU IL2 in a 24 well plate.
- 300K electroporated cells were transduced with 300K MOI or 150K MOI.
- the cells were kept in culture for 48 hours after electroporation and were then restimulated with K562 feeder cells at a ratio of 2: 1 and kept in total volume of 1ml in 24 well plate.
- Flow cytometry of CR1SPR modified human NK cells shows successful integration of the mCherry gene.
- NK cells transduced with AAV6 delivering HR vectors had higher knock-in efficiency than CRISPaint.
- scAAV6 showed significantly better gene insertion.
- mCherry expression was not observed in control NK cells. Almost 20% of NK cells in the experimental conditions in which HR vectors were used to transduce cells with the ssAAV6 delivering DNA- encoding mCherry with 800bp of HA, were mCherry positive.
- NK cells which were transduced with 300K MOI of scAAV6 delivering CRISPaint PAMg or 300K MOI and 500K MOI of PAMgPAMg, up to 8% of mCherry positive cells were found. Importantly, the percentage of mCherry positive cells was significantly higher in the cells that were transduced with the scAAV6 HR vectors containing the shorter homology arms. These conditions included transduction at 300K MOI or 150K MOI of HR scAAV6 vectors with 30bp (19-20%), 300bp (80-85%), 500bp (75-85%), and 800bp (80-89%).
- the mCherry positive population was enriched to 85% by FACS sorting and was expaned for up to 20 days using irradiated mbIL21 -expressing K562 feeder cells with no changes in the percentages of mCherry positive NK cells (FIGS. 20-22).
- the flow analysis was repeated for the expanded mCherry positive NK cells up to 20 days post transduction and no significant changes in percentages of mCherry was observed in the cells generated by a combination of Cas9/RNP and ssAAV6 or scAAV6.
- the cells with Megamer® were 100% dead, and only 10% of the cells which were electroporated with the HR and CRISPaint DNA had survived. These cells can be expanded, but less than 1% of the resulting cells were mCherry positive although the DNA was integrated at the site of DSB. This indicates that AAV mediated NK cell modification is beher tolerated and more efficient compared to naked DNA delivery.
- SEQ ID NO: 13 30bp plasmid with incorporated mCherry transgene.
- SEQ ID NO: 15 500bp plasmid with incorporated mCherry transgene.
- SEQ ID NO: 16 800bp plasmid with incorporated mCherry transgene SEQ ID NO: 16 800bp plasmid with incorporated mCherry transgene.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Biomedical Technology (AREA)
- General Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Animal Behavior & Ethology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Epidemiology (AREA)
- Medicinal Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Virology (AREA)
- Immunology (AREA)
- Hematology (AREA)
- Cell Biology (AREA)
- Pharmacology & Pharmacy (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Mycology (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Peptides Or Proteins (AREA)
- Oncology (AREA)
Priority Applications (14)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP20777892.9A EP3946432A4 (en) | 2019-03-27 | 2020-03-27 | GENERATION OF CHIMERIC ANTIGEN RECEPTOR (CAR) PRIMARY NK CELLS FOR CANCER IMMUNOTHERAPY USING A COMBINATION OF CAS9/RNP AND AAV VIRUSES |
| PH1/2021/552383A PH12021552383A1 (en) | 2019-03-27 | 2020-03-27 | Generation of chimeric antigen receptor (car)-primary nk cells for cancer immunotherapy using a combination of cas9/rnp and aav viruses |
| SG11202110613SA SG11202110613SA (en) | 2019-03-27 | 2020-03-27 | Generation of chimeric antigen receptor (car)-primary nk cells for cancer immunotherapy using a combination of cas9/rnp and aav viruses |
| BR112021019180A BR112021019180A2 (pt) | 2019-03-27 | 2020-03-27 | Geração de células nk primárias de receptor de antígeno quimérico (car) para imunoterapia de câncer usando uma combinação de vírus cas9/rnp e aav |
| US17/598,619 US20220177917A1 (en) | 2019-03-27 | 2020-03-27 | Generation of chimeric antigen receptor (car)-primary nk cells for cancer immunotherapy using a combination of cas9/rnp and aav viruses |
| KR1020217034800A KR20220017887A (ko) | 2019-03-27 | 2020-03-27 | Cas9/rnp 및 aav 바이러스의 조합을 사용한 암 면역요법을 위한 키메라 항원 수용체 (car)-일차 nk 세포의 생성 |
| JP2021557392A JP7702878B2 (ja) | 2019-03-27 | 2020-03-27 | Cas9/rnpおよびaavウイルスの組み合わせを使用したがん免疫療法のための、キメラ抗原受容体(car)-初代nk細胞の生成 |
| CN202080036500.4A CN113891727A (zh) | 2019-03-27 | 2020-03-27 | 使用cas9/rnp和aav病毒的组合来产生用于癌症免疫疗法的嵌合抗原受体(car)-原代nk细胞 |
| CA3135198A CA3135198A1 (en) | 2019-03-27 | 2020-03-27 | Generation of chimeric antigen receptor (car)-primary nk cells for cancer immunotherapy using a combination of cas9/rnp and aav viruses |
| AU2020248097A AU2020248097A1 (en) | 2019-03-27 | 2020-03-27 | Generation of chimeric antigen receptor (CAR)-primary NK cells for cancer immunotherapy using a combination of Cas9/RNP and AAV viruses |
| MX2021011782A MX2021011782A (es) | 2019-03-27 | 2020-03-27 | Generación de células nk primarias del receptor de antígeno quimérico (car) para la inmunoterapia al cáncer usando una combinación de virus cas9/rnp y aav. |
| IL286701A IL286701A (en) | 2019-03-27 | 2021-09-26 | Generation of chimeric antigen receptor (car)-primary nk cells for cancer immunotherapy using a combination of cas9/rnp and aav viruses |
| CONC2021/0014353A CO2021014353A2 (es) | 2019-03-27 | 2021-10-26 | Generación de células nk primarias del receptor de antígeno quimérico (car) para la inmunoterapia al cáncer usando una combinación de virus cas9/rnp y aav |
| JP2025106768A JP2025160172A (ja) | 2019-03-27 | 2025-06-24 | Cas9/rnpおよびaavウイルスの組み合わせを使用したがん免疫療法のための、キメラ抗原受容体(car)-初代nk細胞の生成 |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201962825007P | 2019-03-27 | 2019-03-27 | |
| US62/825,007 | 2019-03-27 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2020198675A1 true WO2020198675A1 (en) | 2020-10-01 |
Family
ID=72611833
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2020/025454 Ceased WO2020198675A1 (en) | 2019-03-27 | 2020-03-27 | Generation of chimeric antigen receptor (car)-primary nk cells for cancer immunotherapy using a combination of cas9/rnp and aav viruses |
Country Status (14)
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2022093863A1 (en) * | 2020-10-26 | 2022-05-05 | Research Institute At Nationwide Children's Hospital | Chimeric antigen receptor (car) nk cells and uses thereof |
| WO2022236174A1 (en) * | 2021-05-07 | 2022-11-10 | Washington University | In situ car-t therapies, vectors and methods therefor |
| EP4349969A4 (en) * | 2021-06-01 | 2025-06-11 | Vaxcell-Bio | COMPOSITION CONTAINING A FEEDING CELL FOR THE PROLIFERATION OF NATURAL KILLER CELLS |
| US12466867B2 (en) | 2018-02-21 | 2025-11-11 | Board Of Regents, The University Of Texas System | Methods for activation and expansion of natural killer cells and uses thereof |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20160051651A1 (en) * | 2014-07-21 | 2016-02-25 | The Trustees Of The University Of Pennsylvania | Treatment of cancer using a cll-1 chimeric antigen receptor |
| US20160340661A1 (en) * | 2013-12-12 | 2016-11-24 | The Broad Institute Inc. | Delivery, use and therapeutic applications of the crispr-cas systems and compositions for genome editing |
| US20180214490A1 (en) * | 2012-07-11 | 2018-08-02 | Sangamo Therapeutics, Inc. | Methods of treating lysosomal storage diseases |
| US20180250424A1 (en) * | 2014-10-10 | 2018-09-06 | Editas Medicine, Inc. | Compositions and methods for promoting homology directed repair |
| US20180296603A1 (en) * | 2015-06-09 | 2018-10-18 | Editas Medicine, Inc. | Crispr/cas-related methods and compositions for improving transplantation |
| US20190010490A1 (en) * | 2015-12-01 | 2019-01-10 | Crispr Therapeutics Ag | Materials and methods for treatment of alpha-1 antitrypsin deficiency |
| US20190022192A1 (en) * | 2015-05-16 | 2019-01-24 | Genzyme Corporation | Gene editing of deep intronic mutations |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU2017347854B2 (en) | 2016-10-27 | 2022-12-08 | Intima Bioscience, Inc. | Viral methods of T cell therapy |
| US11655275B2 (en) * | 2017-05-03 | 2023-05-23 | Sangamo Therapeutics, Inc. | Methods and compositions for modification of a cystic fibrosis transmembrane conductance regulator (CFTR) gene |
| EP3645038B1 (en) * | 2017-06-30 | 2026-02-18 | Precision Biosciences, Inc. | Genetically-modified t cells comprising a modified intron in the t cell receptor alpha gene |
-
2020
- 2020-03-27 SG SG11202110613SA patent/SG11202110613SA/en unknown
- 2020-03-27 WO PCT/US2020/025454 patent/WO2020198675A1/en not_active Ceased
- 2020-03-27 BR BR112021019180A patent/BR112021019180A2/pt unknown
- 2020-03-27 CA CA3135198A patent/CA3135198A1/en active Pending
- 2020-03-27 EP EP20777892.9A patent/EP3946432A4/en active Pending
- 2020-03-27 PH PH1/2021/552383A patent/PH12021552383A1/en unknown
- 2020-03-27 US US17/598,619 patent/US20220177917A1/en active Pending
- 2020-03-27 KR KR1020217034800A patent/KR20220017887A/ko active Pending
- 2020-03-27 JP JP2021557392A patent/JP7702878B2/ja active Active
- 2020-03-27 MX MX2021011782A patent/MX2021011782A/es unknown
- 2020-03-27 AU AU2020248097A patent/AU2020248097A1/en active Pending
- 2020-03-27 CN CN202080036500.4A patent/CN113891727A/zh active Pending
-
2021
- 2021-09-26 IL IL286701A patent/IL286701A/en unknown
- 2021-10-26 CO CONC2021/0014353A patent/CO2021014353A2/es unknown
-
2025
- 2025-06-24 JP JP2025106768A patent/JP2025160172A/ja active Pending
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20180214490A1 (en) * | 2012-07-11 | 2018-08-02 | Sangamo Therapeutics, Inc. | Methods of treating lysosomal storage diseases |
| US20160340661A1 (en) * | 2013-12-12 | 2016-11-24 | The Broad Institute Inc. | Delivery, use and therapeutic applications of the crispr-cas systems and compositions for genome editing |
| US20160051651A1 (en) * | 2014-07-21 | 2016-02-25 | The Trustees Of The University Of Pennsylvania | Treatment of cancer using a cll-1 chimeric antigen receptor |
| US20180250424A1 (en) * | 2014-10-10 | 2018-09-06 | Editas Medicine, Inc. | Compositions and methods for promoting homology directed repair |
| US20190022192A1 (en) * | 2015-05-16 | 2019-01-24 | Genzyme Corporation | Gene editing of deep intronic mutations |
| US20180296603A1 (en) * | 2015-06-09 | 2018-10-18 | Editas Medicine, Inc. | Crispr/cas-related methods and compositions for improving transplantation |
| US20190010490A1 (en) * | 2015-12-01 | 2019-01-10 | Crispr Therapeutics Ag | Materials and methods for treatment of alpha-1 antitrypsin deficiency |
Non-Patent Citations (2)
| Title |
|---|
| BAEK ET AL.: "Ex Vivo Expansion of Natural Killer Cells Using Cryopreserved Irradiated Feeder Cells", ANTICANCER RES, vol. 33, 31 May 2013 (2013-05-31), pages 2011 - 2019, XP055745037 * |
| See also references of EP3946432A4 * |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US12466867B2 (en) | 2018-02-21 | 2025-11-11 | Board Of Regents, The University Of Texas System | Methods for activation and expansion of natural killer cells and uses thereof |
| US12473336B2 (en) | 2018-02-21 | 2025-11-18 | Board Of Regents, The University Of Texas System | Methods for activation and expansion of natural killer cells and uses thereof |
| WO2022093863A1 (en) * | 2020-10-26 | 2022-05-05 | Research Institute At Nationwide Children's Hospital | Chimeric antigen receptor (car) nk cells and uses thereof |
| JP2023552917A (ja) * | 2020-10-26 | 2023-12-19 | リサーチ インスティテュート アット ネーションワイド チルドレン’ズ ホスピタル | キメラ抗原受容体(car)nk細胞及びそれらの使用 |
| EP4232560A4 (en) * | 2020-10-26 | 2025-05-14 | Research Institute at Nationwide Children's Hospital | Chimeric antigen receptor (CAR) NK cells and their uses |
| WO2022236174A1 (en) * | 2021-05-07 | 2022-11-10 | Washington University | In situ car-t therapies, vectors and methods therefor |
| EP4349969A4 (en) * | 2021-06-01 | 2025-06-11 | Vaxcell-Bio | COMPOSITION CONTAINING A FEEDING CELL FOR THE PROLIFERATION OF NATURAL KILLER CELLS |
Also Published As
| Publication number | Publication date |
|---|---|
| JP2025160172A (ja) | 2025-10-22 |
| IL286701A (en) | 2021-10-31 |
| KR20220017887A (ko) | 2022-02-14 |
| AU2020248097A1 (en) | 2021-11-18 |
| MX2021011782A (es) | 2021-12-10 |
| EP3946432A1 (en) | 2022-02-09 |
| CO2021014353A2 (es) | 2022-01-17 |
| US20220177917A1 (en) | 2022-06-09 |
| CN113891727A (zh) | 2022-01-04 |
| PH12021552383A1 (en) | 2022-06-13 |
| JP2022527709A (ja) | 2022-06-03 |
| BR112021019180A2 (pt) | 2022-03-03 |
| EP3946432A4 (en) | 2023-04-05 |
| JP7702878B2 (ja) | 2025-07-04 |
| SG11202110613SA (en) | 2021-10-28 |
| CA3135198A1 (en) | 2020-10-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20220127644A1 (en) | Chimeric antigen receptor (car) nk cells and uses thereof | |
| AU2025275210A1 (en) | Cpf1-related methods and compositions for gene editing | |
| US20220177917A1 (en) | Generation of chimeric antigen receptor (car)-primary nk cells for cancer immunotherapy using a combination of cas9/rnp and aav viruses | |
| US20240167059A1 (en) | Systems and methods for targeted integration and genome editing and detection thereof using integrated priming sites | |
| KR20210013077A (ko) | Cas9 리보핵단백질을 사용하는 녹아웃 일차 및 확장된 인간 nk 세포의 생성 | |
| JP2024075603A (ja) | Hla遺伝子のrnaガイドゲノム編集を使用して関節リウマチを処置する方法 | |
| CN119585419A (zh) | 工程化t细胞 | |
| EP4630567A2 (en) | Chimeric antigen receptor (car) t cells and uses thereof | |
| RU2855865C2 (ru) | Получение первичных nk-клеток с химерными антигенными рецепторами (car) для иммунотерапии онкологических заболеваний с использованием комбинации cas9/рнп и вирусов aav | |
| WO2023070126A1 (en) | Genetically engineered t cell receptors | |
| EP4076480A1 (en) | Chimeric antigen receptor dendritic cells (car-dcs) and methods of making and using same | |
| WO2024076725A2 (en) | Self-regulatingchimeric antigen receptor for natural killer cells | |
| TW202542303A (zh) | 經工程改造之t細胞 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 20777892 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 2021557392 Country of ref document: JP Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 3135198 Country of ref document: CA |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112021019180 Country of ref document: BR |
|
| WWE | Wipo information: entry into national phase |
Ref document number: NC2021/0014353 Country of ref document: CO |
|
| WWE | Wipo information: entry into national phase |
Ref document number: DZP2021000649 Country of ref document: DZ Ref document number: 2021131306 Country of ref document: RU |
|
| ENP | Entry into the national phase |
Ref document number: 2020777892 Country of ref document: EP Effective date: 20211027 |
|
| ENP | Entry into the national phase |
Ref document number: 2020248097 Country of ref document: AU Date of ref document: 20200327 Kind code of ref document: A |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01E Ref document number: 112021019180 Country of ref document: BR Free format text: APRESENTAR, EM ATE 60 (SESSENTA) DIAS, A TRADUCAO SIMPLES DA FOLHA DE ROSTO DA CERTIDAO DE DEPOSITO DA PRIORIDADE US 62/825,007 DE 27/03/2019 OU DECLARACAO CONTENDO, OBRIGATORIAMENTE, TODOS OS DADOS IDENTIFICADORES DESTA (NUMERO DE PEDIDO, DATA DO DEPOSITO, PAIS DE ORIGEM, TITULAR E INVENTOR), CONFORME O ART. 15 DA PORTARIA 39/2021, UMA VEZ QUE ESSA INFORMACAO E NECESSARIA PARA O EXAME. |
|
| WWP | Wipo information: published in national office |
Ref document number: NC2021/0014353 Country of ref document: CO |
|
| ENP | Entry into the national phase |
Ref document number: 112021019180 Country of ref document: BR Kind code of ref document: A2 Effective date: 20210924 |
|
| WWP | Wipo information: published in national office |
Ref document number: 2021131306 Country of ref document: RU |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 521430419 Country of ref document: SA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 523451953 Country of ref document: SA |
|
| WWG | Wipo information: grant in national office |
Ref document number: 2021131306 Country of ref document: RU |