WO2020197323A1 - 마이크로채널 네트워크가 형성된 하이드로젤 구조체 - Google Patents

마이크로채널 네트워크가 형성된 하이드로젤 구조체 Download PDF

Info

Publication number
WO2020197323A1
WO2020197323A1 PCT/KR2020/004210 KR2020004210W WO2020197323A1 WO 2020197323 A1 WO2020197323 A1 WO 2020197323A1 KR 2020004210 W KR2020004210 W KR 2020004210W WO 2020197323 A1 WO2020197323 A1 WO 2020197323A1
Authority
WO
WIPO (PCT)
Prior art keywords
hydrogel
poly
microchannel
hydrogel structure
acid
Prior art date
Application number
PCT/KR2020/004210
Other languages
English (en)
French (fr)
Inventor
성학준
이정복
Original Assignee
연세대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 연세대학교 산학협력단 filed Critical 연세대학교 산학협력단
Publication of WO2020197323A1 publication Critical patent/WO2020197323A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
    • A61L27/00—Materials for grafts or prostheses or for coating grafts or prostheses
    • A61L27/50—Materials characterised by their function or physical properties, e.g. injectable or lubricating compositions, shape-memory materials, surface modified materials
    • A61L27/52—Hydrogels or hydrocolloids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
    • A61L27/00—Materials for grafts or prostheses or for coating grafts or prostheses
    • A61L27/36—Materials for grafts or prostheses or for coating grafts or prostheses containing ingredients of undetermined constitution or reaction products thereof, e.g. transplant tissue, natural bone, extracellular matrix
    • A61L27/38—Materials for grafts or prostheses or for coating grafts or prostheses containing ingredients of undetermined constitution or reaction products thereof, e.g. transplant tissue, natural bone, extracellular matrix containing added animal cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
    • A61L27/00—Materials for grafts or prostheses or for coating grafts or prostheses
    • A61L27/36—Materials for grafts or prostheses or for coating grafts or prostheses containing ingredients of undetermined constitution or reaction products thereof, e.g. transplant tissue, natural bone, extracellular matrix
    • A61L27/38—Materials for grafts or prostheses or for coating grafts or prostheses containing ingredients of undetermined constitution or reaction products thereof, e.g. transplant tissue, natural bone, extracellular matrix containing added animal cells
    • A61L27/3895—Materials for grafts or prostheses or for coating grafts or prostheses containing ingredients of undetermined constitution or reaction products thereof, e.g. transplant tissue, natural bone, extracellular matrix containing added animal cells using specific culture conditions, e.g. stimulating differentiation of stem cells, pulsatile flow conditions
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
    • A61L27/00—Materials for grafts or prostheses or for coating grafts or prostheses
    • A61L27/50—Materials characterised by their function or physical properties, e.g. injectable or lubricating compositions, shape-memory materials, surface modified materials
    • A61L27/56—Porous materials, e.g. foams or sponges
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
    • A61L2300/00—Biologically active materials used in bandages, wound dressings, absorbent pads or medical devices
    • A61L2300/40—Biologically active materials used in bandages, wound dressings, absorbent pads or medical devices characterised by a specific therapeutic activity or mode of action
    • A61L2300/412—Tissue-regenerating or healing or proliferative agents

Definitions

  • the present invention relates to a hydrogel structure capable of inducing fluid perfusion by forming a microchannel network therein.
  • vascularization In order to regenerate tissue, blood vessels must be grown in damaged areas or implanted scaffolds, and for this, various methods for inducing target-specific angiogenesis (vascularization) have been studied. Among them, topical treatment using pro-angiogenic molecules such as vascular endothelial growth factor (VEGF) has been considered the most promising approach.
  • VEGF vascular endothelial growth factor
  • the molecule is injected at the target site, released from an implant, or delivered to the target site through systemic circulation.
  • this method has some drawbacks.
  • the main pathway for molecules to reach the target site is blood or interstitial fluid flow, the molecules can be delivered throughout the body due to systemic circulation, which may have unexpected effects on off-target sites.
  • the molecule may affect one or more in vivo mechanisms or may unintentionally induce targeting mechanisms excessively.
  • VEGF causes inflammation as well as angiogenesis, and excessive induction of angiogenesis can lead to tumorigenesis. In treatment with pro-angiogenic molecules, this problem has not yet been solved.
  • a structure induces a biological function
  • structure-function relationship a technology capable of physically engineering a vascular network in a damaged area.
  • surface patterning, porous scaffold design, and 3D bioprinting techniques have been widely studied in the last decade to control cellular function.
  • pre-angiogenic molecules such as VEGF.
  • the present inventors have developed a structure in which a three-dimensional microchannel network is formed in order to solve the problem of pre-angiogenic molecules and mimic the specific vascular structure, and this structure induces blood perfusion at the damaged site, and The present invention was completed by confirming that it promotes the polarization of phagocytes and recovery of functional endothelial cells (EC).
  • EC endothelial cells
  • An object of the present invention is to provide a hydrogel structure including a hydrogel having a three-dimensional microchannel network formed therein, and a use thereof.
  • a hydrogel made of a biocompatible polymer
  • hydrogel It is formed inside the hydrogel and includes a plurality of microchannels through which a fluid flows,
  • the plurality of microchannels are connected to each other to form a 3D network, and each microchannel provides a hydrogel structure existing within 200 ⁇ m in the 3D direction.
  • the present inventors have produced a hydrogel structure capable of forming a circulatory system by permeating fluid through an internal three-dimensional microchannel network.
  • a plurality of microchannels formed inside the hydrogel structure form a three-dimensional network, and such a three-dimensional network is within 200 ⁇ m of each other in the three-dimensional (x-axis, y-axis and z-axis) direction as each microchannel is connected to each other. It means to exist.
  • the distance takes into account the limit of diffusion of blood vessels in a living body, and is a distance that allows blood cells and nutrients to escape from the blood vessels and transfer to surrounding cells and tissues. Due to such a limiting distance, the microchannel structure of the present invention can be usefully used for cell, organoid, and spheroid culture.
  • biocompatible polymer refers to a polymer having tissue compatibility and anticoagulability that does not destroy tissue or coagulate blood in contact with living tissue or blood. .
  • the biocompatible polymer is gelatin, alginate, polyethylene glycol (PEG), polydimethylsiloxane (PDMS), collagen, chitin, chitosan, keratin, cellulose, fibronectin, elastin, fibrinogen, fibromodule Lin, laminin, tenacin, vitronectin, hyaluronic acid, heparin, collagen, chondroitin sulfate, pectin, dextran, silk protein, silk fibroin and their derivatives, agarose, polylactic acid, PLA), polyglycolic acid (PGA), a copolymer of polylactic acid and polyglycolic acid (PLGA), polycaprolactone (PCL), poly(poly(ethylene oxide) terephthalate-co-butylene tere Phthalate) (PEOT/PBT), polyphosphoester (PPE), polyphosphazene (PPA), polyanhydride (PA), poly(ortho ester,
  • the hydrogel structure may have an elastic modulus in the range of 1000 to 3000 Pa, and preferably may have an elastic modulus in the range of 1000 to 2000 Pa. If the elastic modulus of the hydrogel structure is lower than the above range, the physical properties of the hydrogel are weak, so that the internal 3D microchannel network structure cannot be maintained. Conversely, if the modulus of elasticity is higher than the above range, the hydrogel may be too hard, and thus its effectiveness may decrease when applied in vivo.
  • the modulus of elasticity of the hydrogel structure may be changed by controlling the crosslinking method of the hydrogel.
  • the microchannel may have a diameter in the range of 5 to 50 ⁇ m, preferably 10 to 50 ⁇ m, more preferably 15 to 30 ⁇ m.
  • the hydrogel structure may further include an inlet channel and an outlet channel (FIG. 2), and the inlet channel and the outlet channel are connected to the microchannels to form a circulation system through which fluid flows.
  • the hydrogel structure according to an embodiment of the present invention is manufactured by a method comprising the following steps.
  • the method of manufacturing the hydrogel structure begins with making fibers made of a temperature-sensitive polymer, as shown in FIG. 1.
  • the fibers forming the microchannels are produced by spraying a stimulation-sensitive polymer solution with a rotary injection device, and the diameter of the fibers can be adjusted by changing the rotation speed, and as a result, the diameter and density of the microchannels formed in the hydrogel can be adjusted. (Fig. 1).
  • the term "stimuli-responsive polymer” refers to physical properties such as sol-gel phase transition or volume phase transition reversibly or irreversibly by stimulation such as temperature, pH, electricity, stress, pressure, magnetism, etc. It refers to a polymer whose properties change. If the stimulus source is temperature, it is called “temperature-responsive polymer”. Polymers exhibiting lower critical solution temperature (LCST) behavior exist in a sol state at temperatures lower than LCST.
  • LCST critical solution temperature
  • magnetic is an ethylene - co - vinyl acetate (ethylene- co -vinyl acetate)
  • ultrasound is ethylene - co - vinyl acetate and ethylene - co - vinyl alcohol
  • poly(2-hydroxyethyl methacrylate) can be used.
  • chitosan-poly(ethylene oxide), poly(acrylic acid)-poly(ethylene oxide) (Poly(acrylic acid)-PEO), poly(2-hydroxyl) the like may be used (maleic acid) (poly (acrylamide-co- maleic acid acrylamide - - co)) ethyl methacrylate) (poly (2-hydroxyethyl methacrylate )), poly.
  • the temperature-sensitive polymer is poly(N-isopropylacrylamide), poly-N-vinylcaprolactam, polymethacrylic acid, hydroxypropylcellulose, polyvinylmethylether, poly(2) -Hydromethacrylic acid), poly(N-isopropylacrylamide), poly(N,N-diethylacrylamide), poly(N-diethylmethacrylamide), poly(methylvinyl ether), poly(2) -Ethoxyethyl vinyl ether), poly(N-vinylcaprolactam), poly(N-vinylisobutylamine), poly(N-vinyl-n-butylamine), and polyfumaric acid may be selected from the group consisting of, Preferably poly(N-isopropylacrylamide) can be used.
  • the rotary spray device is a device similar to a cotton candy machine, and the reason for using this device is that the electrospinning method could not make a bulky fiber mesh, and the 3D printing method closed the dense fibers. This is because it could not reach a resolution sufficient to create the network. Only when the fibers were produced like cotton candy using a rotary injection device could form a fiber bundle capable of overcoming the diffusion limit of blood vessels (200 ⁇ m).
  • the position of the 3D microchannel network in the hydrogel can be adjusted by adjusting the position of the 3D fiber bundle placed in the frame in step (a), and the microchannel of the hydrogel is 3 Since they are connected to each other in the dimensional direction, there is an advantage that a closed fluid circulation is possible without leaking between the influent and the effluent.
  • the size and shape of the hydrogel structure can be variously modified by changing the size and shape of the frame in step (a) and increasing the amount of the hydrogel solution.
  • the hydrogel crosslinking of step (b) may use both physical and chemical crosslinking methods, and for example, an enzymatic crosslinking agent such as transglutaminase may be used.
  • Enzyme crosslinking agents are inexpensive and biocompatible, and are practical because cells and therapeutic agents can be easily loaded before gelation.
  • the crosslinking time and degree of crosslinking can be controlled by adjusting the ratio of the enzyme to the hydrogel solution, making it applicable to a wide range of tissues and organs.
  • the ratio of the hydrogel solution to the transglutaminase may be in the range of 5:1 to 30:1 (w/v%), preferably 5:1 to 25: It can be in the range of 1. If the ratio exceeds 40:1, it is inefficient to take a long gelation time, and it is impossible to use a hydrogel structure due to low physical properties (modulus of elasticity).
  • the step (c) may be performed by converting the three-dimensional fiber bundle into a sol, and specifically, may be performed by applying a stimulus corresponding to a stimulation-sensitive polymer.
  • a fluid lower than LCST can be perfused through the hydrogel to remove it.
  • the hydrogel structure includes cells, spheroids, organoids, proteins, nucleic acids, peptides, lipids, nanoparticles, drugs or compounds in a hydrogel solution or frame when supplying the hydrogel in step (a). It may be made of a hydrogel structure containing the above materials.
  • hydrogel structure provides a composition for in vivo transplantation comprising a material for transplantation enclosed therein.
  • At least one material selected from the group consisting of cells, spheroids, organoids, tissues and tissue fragments isolated from a living body, proteins, nucleic acids, peptides, lipids, nanoparticles, drugs or compounds may be used. However, it is not limited thereto.
  • the term “spheroid” refers to a circular aggregate of cells cultured in three dimensions, and the interaction between cells and cells through three-dimensional contact, paracrine signaling by diffusion of cell secretions ( Paracrine singaling) is known to reflect well the in vivo environment and bioreactivity compared to 2D cell culture.
  • organoid organ-specific cell aggregate made by re-aggregating and recombining cells isolated from stem cells or organ origin cells by a three-dimensional culture method, It has the advantage of being able to construct specific cells of an organ as a model, reproducing specific functions of an organ, and allowing spatial organization with a structure similar to that of an actual organ.
  • the current organoid technology has limitations in that it cannot reflect the complex biological, physical, and chemical environment of the actual organ, and in order to increase the similarity between organoids and real organs, a biotechnological approach such as a microfluidic system It is expected to be necessary.
  • hydrogel structure of the present invention can perfuse the cell culture medium to the internal microchannel network, three-dimensional culture of cells is possible and the survival of spheroids and/or organoids can be maintained.
  • the hydrogel structure of the present invention has a three-dimensional microchannel network formed therein to induce perfusion of a fluid such as blood, and thus, a target substance such as cells and spheroids can be effectively implanted into a living body.
  • FIG. 1 schematically shows a manufacturing process of a channel network hydrogel according to an embodiment of the present invention.
  • a is a scanning electron microscope image of a PNIPAM fiber formed after spinning the solution
  • a is an image showing a state in which tubes are connected to both sides of the generated channel network hydrogel
  • b is an image showing a microchannel hydrogel perfusing a cell culture medium.
  • a is a result of perfusing fluorospheres in the generated channel network hydrogel and then confirmed with a confocal microscope
  • b is a graph showing the channel diameter distribution of the channel network hydrogel
  • c and d are polydimethylsiloxane, respectively, This is a result showing the diameter of the microchannel in alginate hydrogel.
  • FIG. 5 is a result of confirming the interconnectivity of the channels in a cross section with a confocal microscope after perfusing fluorospheres in a microchannel hydrogel, and white arrows indicate channel lumens.
  • FIG. 6 shows the results of measuring the elastic modulus of the channel network hydrogel according to the mixing ratio of gelatin and microbial transglutaminase.
  • FIG. 7 shows the results of perfusion with FITC-dextran (green) and fluorosphere (red) in a microchannel hydrogel and then confirmed with a confocal microscope over time.
  • FIG 8 shows a state in which the channel network hydrogel according to an embodiment of the present invention is applied to an ischemic injury site.
  • a is a result of confirming the degree of blood perfusion over time after implanting the channel network hydrogel in the ischemic region of the lower limb ischemia model mouse
  • b is a graph quantifying the blood perfusion level of the ischemic lower limb compared to the normal lower limb.
  • c is the result of confirming the degree of recovery of the ischemic lower limb at 14 days after channel network hydrogel implantation.
  • a is a result of confirming the level of apoptosis in the lower extremity tissue after transplanting the channel network hydrogel to the ischemic region of the lower extremity ischemia model mouse
  • b is the expression of angiogenesis markers CD31 and ⁇ SMA in the lower extremity tissue. This is the result of checking the level.
  • FIG. 13 is a result of confirming blood flow with a confocal microscope on the 14th day after transplanting the channel network hydrogel to the ischemic region of the lower limb ischemia model mouse.
  • FIG. 14 is a result of confirming blood perfusion on the 14th day after transplanting the channel network hydrogel to the ischemic region of the lower extremity ischemia model mouse, and arrows in the figure indicate anastomosis between the channel network and blood vessels.
  • a is a result of confirming blood perfusion on the 14th day after transplanting the channel network hydrogel to the ischemic region of the lower limb ischemia model mouse
  • b is the total branch length (i) and the number of branches (ii), which are microvascular indicators. ), the number of joints (iii), and the partial area (iv).
  • a shows antigen-presenting T cell markers CD3 and mononuclear/macrophage markers CD68 and CD31 genes in cells infiltrated with the hydrogel on the 14th day after implantation of the channel network hydrogel at the ischemic site of the lower limb ischemia model mouse. The expression level was confirmed, and b is the result of confirming the degree of invasion of macrophages at the hydrogel implantation site after injection of fluorescently labeled macrophages into lower limb ischemia model mice.
  • Fig. 17 is a result of staining the tissue of the lower limb ischemic region transplanted with channel network hydrogel with hematocillin & eosin and CD68.
  • 19 is a result of confirming the cell morphology after culturing M1 activated macrophages in a channel network hydrogel while perfusing a medium.
  • Fig. 21 is a result of confirming the expression levels of skeletal muscle markers MyoG, endothelial cell markers KDR and vWF, and vascular smooth muscle cell marker ⁇ SMA in endothelial cells infiltrated with the channel network hydrogel implanted in the ischemic region of the lower extremity.
  • Figure 24 is a result of confirming the presence of functional endothelial cells (lectin +) after implantation of the channel network hydrogel in the ischemic region of the lower extremity (a) and the result of quantitative analysis (b), the white arrows in a indicate functional endothelial cells ( Green) and perfusion-stained channels (red) coexist.
  • 25 is a result of confirming whether endothelial cells are infiltrated by F-actin, CD31 and cell nucleus staining after transplanting the channel network hydrogel to the ischemic region of the lower extremity.
  • 26 is a result of confirming cell morphology while culturing GFP-HUVECs in a microchannel hydrogel under medium perfusion.
  • FIG. 28 is a result of confirming the wound tissue by staining the wound tissue with hematocillin & eosin and Mason's trichrome after implanting the microchannel hydrogel in the wound treatment mouse model, and the green arrow indicates the extent of the unsealed wound.
  • FIG. 30 is a result of confirming blood perfusion and CD31+ cell levels after transplanting the channel network hydrogel into the colon, normal lower extremities, and subcutaneous tissues with different numbers of adjacent blood vessels.
  • a is a result of staining the tissue section with hematocillin & eosin after transplanting the channel network hydrogel to the colon, normal lower extremity, and subcutaneous tissues with different numbers of adjacent blood vessels
  • b is the microchannel hydrogel in the a
  • the blue arrows indicate blood cells infiltrated into the implanted hydrogel
  • c is the result of confirming CD31+ cells in each tissue implanted with the microchannel hydrogel.
  • FIG. 32 is a result of confirming CD31+ cells after implanting macrochannel hydrogels in colon, normal lower extremities, and subcutaneous tissues with different numbers of adjacent blood vessels.
  • PNIPAM is biocompatible and has a low critical solution temperature of 32°C. LCST) was selected because of the thermo-responsibility property.
  • a silicone tube was connected to both ends of the gelatin hydrogel to perfuse PBS below 32° C. and PNIPAM fibers were removed by a sol-gel phase transition.
  • a 3D channel network hydrogel structure having a macrochannel or microchannel structure formed therein according to the diameter of the PNIPAM fiber was produced (Figs. 1 to 3.)
  • PDMS or alginate was used instead of gelatin, or the ratio of gelatin and mTG was determined.
  • a 3D channel network hydrogel structure was fabricated in the same manner as above except for the change.
  • the channel structure of the prepared 3D channel network hydrogel structure was observed with a confocal microscope LSM 780 (ZEISS, Germany) after perfusion of red Fluorspheres (FluoSpheres, 45 nm; Invitrogen, USA).
  • the channel size distribution inside the 3D channel network hydrogel structure was confirmed with ImageJ/Fiji software.
  • a 3D channel network hydrogel structure having a macrochannel or a microchannel structure is described as “macrochannel hydrogel” and “microchannel hydrogel”, respectively, and when referring to including both, “channel network hydrogel Described as ".
  • xylazine (10 mg/kg) and zoletyl (50 mg/kg) was anesthetized into a 5-week-old Balb/c male mouse (Orient Bio, Korea), weighing 20 to 25 g.
  • Blood vessels between the upper and lower points of the femoral artery and vein of the left lower limb were removed, and the vessels were tied with 6-0 silk sutures (Ethicon, Somersville, USA) to induce lower limb ischemia.
  • the vascular suture point is a proximal branch point of the external iliac artery and a distal point where the external iliac artery is divided into a saphenous artery and a popliteal artery.
  • microchannel hydrogels were applied to the greater omentum and subcutaneous tissues for 14 days, respectively, in order to confirm the mechanical role of the host vessel number in angiogenesis-mediated anastomosis using channel network hydrogel. It was transplanted and used as a host proximity vascular-rich model and vascular-poor model.
  • the lower limb ischemic pig model was a 40 kg female Yorkshire pig (XP Bio, Korea), and atropine (0.04 mg/kg), xylazine (2 mg/kg) and azaferon (2 mg/kg) as pre-dose
  • a mixture of was injected intramuscularly, and anesthesia was induced with alfaxane (1 mg/kg).
  • 2% isoflurane was supplied by endotracheal intubation to maintain anesthesia.
  • the vessels at the upper and lower points were tied with 1-0 silk sutures.
  • a cylindrical hydrogel (1 cm in diameter and 1.5 cm in height) was implanted into the central lower limb muscle at the ischemic region, and sacrificed for histological examination 18 days later.
  • LDPI laser Doppler perfusion imaging
  • a contrast agent Pamiray 370 (Pamiray 370, 100 ⁇ l of iopamidol-370, Dongkuk Pharmaceutical, Korea) was injected into the tail vein and standard conditions (tube voltage: 65 Kvp; tube current: 115 uA) ; 720 images per 360° rotation; MicroCT scanning (NFR Polaris-G90, Nano 669 Focus Ray, Republic of Korea) was performed according to a resolution of 100 ⁇ m.
  • the obtained microCT image was processed with the FDK algorithm (volumetric cone-beam reconstruction algorithm) and then analyzed with 3D-rendering software (RadiAnt DICOM Viewer 4.2.1).
  • EC invasion of the channel network hydrogel implanted from the distal site of the ischemic lower extremity was performed by confocal imaging for 30 minutes after injection of lectin (100 ⁇ l, FITC-binding, L-2895, Sigma-Aldrich) into the tail vein of the mouse. Confirmed. Flow perfusion connections from neighboring blood vessels to channel network hydrogels were imaged using indicators of anastomotic angiogenesis according to a previously reported method. Briefly, after the inferior vena cava of the mouse was cut, whole blood was removed through the cut drainage point by perfusion of PBS containing 0.1 mg/ml of heparin sulfate through the left ventricle.
  • the recovered sample was washed 3 times with PBS, fixed with 10% formaldehyde for 1 day, and then a paraffin block was prepared. Paraffin blocks were cut to a thickness of 4 ⁇ m at 6 different locations of each section, and stained with hematocillin and eosin, and Masson's trichrome respectively for tissue and tissue fibrosis analysis, and stained with an inverted microscope (Leica DMi8, Leica microsystems, Germany).
  • Each section was also used for immunofluorescence staining, and for this purpose, after sequentially reacting with xylene and ethanol (100%, 95%, 80%, and 70% v/v in DW), a pepsin solution (Sigma- Aldrich) was treated at 37° C. for 30 minutes.
  • Whole mount samples were treated with a buffer solution containing 5% bovine serum albumin (Millipore) and 0.3% Triton X-100 (Sigma-Aldrich), and reacted at room temperature for 1 hour.
  • the primary antibodies CD68 (ab125212, Abcam), CD31 (sc-1505, Santa Cruz Biotechnology), Involucrin (sc-21748, Santa Cruz), F4/80 (ab6640, Abcam), iNOS (ab955, Abcam), And CD206 (ab64693, Abcam) were treated, respectively, and reacted at 4° C. overnight.
  • each sample was treated with Alexa Fluor 488 or Alexa Fluor 594-conjugated secondary antibody (Jackson 702 Immuno Research Laboratories, USA), and DAPI (H-1500, Vector Laboratories) staining was performed as a counter stain. Then, it was observed with a confocal microscope, and quantitative analysis was performed with Image J/Sebum software.
  • Apoptosis in the sample was confirmed by TUNEL staining (Roche Molecular 706 Biochemicals, Germany) according to the manufacturer's protocol, and then observed with a confocal microscope, and quantitative analysis was performed with Image J/sebum software.
  • monocytes into the implantation site in vivo were confirmed using mouse monocytes (RAW264.7) labeled with a fluorescent dye (Vivotrack 711 680, PerkinElmer, USA) according to the manufacturer's protocol.
  • Monocytes (2x10 6 cells/mouse) were injected into a vein on the 3rd day after the lower limb ischemia, and after 24 hours, the distribution of monocytes was confirmed with an in vivo imaging system (IVIS), PerkinElmer.
  • IVIS in vivo imaging system
  • the intensity of the fluorescent dye at the channel network hydrogel implantation site of the ischemic lower limb was compared with that of the normal lower limb. The mice were then sacrificed, and the samples were used for other experiments.
  • RAW264.7 cells 5 ⁇ 10 5 cells
  • LPS 100 ng/ml
  • GAPDH glycose
  • the primer sequences used are shown in Table 1 below.
  • Macrochannel hydrogels and microchannel hydrogels were prepared according to the method shown in FIG. 1.
  • the method of FIG. 1 is a non-toxic process without an organic solvent because the PNIPAM fiber is dissolved by perfusion when the temperature of the washing water is lowered to less than 32°C.
  • a macrochannel hydrogel and a microchannel hydrogel were prepared, respectively, and then a fluorosphere (45 nm, red) was perfused to confirm the confocal image.
  • a fluorosphere 45 nm, red
  • the average diameter of the microchannel and the macrochannel was 16.37 ⁇ 7.76 ⁇ m to 150.46 ⁇ 57.02 ⁇ m, respectively (Fig. 4)
  • the channels were connected to each other in the hydrogel (Fig. 5).
  • the microchannel hydrogel structure using PDMS and alginate instead of gelatin had an average channel diameter of 14.65 ⁇ 4.93 ⁇ m and 22.48 ⁇ 6.75 ⁇ m, respectively (c and d of FIG. 4).
  • the channel network in the hydrogel has diffusion and perfusion properties similar to capillaries, and specifically, FITC-dextran (40 kDa, green) efficiently diffuses from the microchannel to the gelatin matrix in the hydrogel, It was confirmed that the fluorine sphere (40 nm, red) was well perfused through the microchannel (FIG. 7).
  • the channel network hydrogel was implanted at the center of the ischemic region of the lower extremity ischemic mouse model in order to confirm whether the damaged tissue could be recovered using only the channel network hydrogel.
  • the proximal and distal blood vessels at the ischemic region grew into a channel network hydrogel, and vascular anastomosis was performed using a microchannel network (FIG. 8).
  • This process like the closed circulatory system of the body, enabled blood perfusion from the proximal host blood vessel (inlet) to the microchannel and then to the distal blood vessel (outlet), thereby recovering the ischemic damage of the lower extremities.
  • the perfusion rate improved up to 50% on days 7 and 14 after transplantation, and it was found that the normal right lower limb maintained 100% perfusion rate until 14 days after transplantation.
  • the hydrogel non-experimental group, and the macrochannel hydrogel experimental group sufficient perfusion was insufficient ( ⁇ 30% perfusion rate) 7 to 14 days after transplantation, indicating that gradual limb loss appeared (b and c in FIG. 9). ).
  • microchannel hydrogel The main mechanism of recovery of severely damaged lower limbs by microchannel hydrogel was investigated.
  • anastomical blood perfusion between the host vessel and the microchannel network was confirmed by microCT and perfusion-based confocal imaging along with quantitative analysis on day 14 after microchannel hydrogel implantation.
  • Macrophages are polarized from the M1 phenotype to the M2 phenotype during the initial inflammation, inflammation alleviation, proliferation, and wound healing process. In this process, it was confirmed on the 14th day after hydrogel implantation whether the channel size of the hydrogel affects the polarization of macrophages.
  • RAW264.7 mouse mononuclear cells labeled with Vivotrack-680 were transferred to the mouse on the 3rd day after the channel network hydrogel transplantation. It was injected into the tail vein, and IVIS imaging was performed 24 hours after cell injection. As a result of the imaging, it was confirmed that monocytes penetrated significantly more into the hydrogel in the channel network hydrogel experimental group, especially the macrochannel experimental group, compared to the saline perfusion group and the non-hydrogel experimental group (data not included in the non-hydrogel experimental group). ) (FIG. 16B).
  • RAW264.7 cells were treated with lipopolysaccharide (LPS) to activate M1, and the activated macrophages were perfused with a medium and macrochannels for 4 days. It was cultured in hydrogel or microchannel hydrogel. As a result, it was confirmed that the attached spindle cell morphology was dominant in the macrochannel hydrogel experimental group, whereas the circular mononuclear cell-like morphology was dominant in the microchannel hydrogel experimental group (FIG. 19). This means that the microchannels of the hydrogel inhibit LPS-induced macrophage activation.
  • LPS lipopolysaccharide
  • M2 marker gene The gene expressions of the M2 markers IL-10, Arg-1, CD163, and CD206 were significantly higher in the microchannel hydrogel experimental group than in the macrochannel hydrogel experimental group, and the M1 markers IL-1 ⁇ , IL-6, TNF- ⁇ , The tendency of expression of CD80 and NOS2 was opposite to that of the M2 marker (FIG. 20 ).
  • EPC endothelial progenitor cell
  • Microchannel-induced EC infiltration was further confirmed by CD31 immunostaining and in vitro endothelialization. As a result, it was found that the expression level of CD31 was high in the microchannel hydrogel experimental group compared to the macrochannel hydrogel experimental group (FIG. 25). In addition, as a result of culturing GFP-HUVECs in microchannel hydrogel under medium perfusion, EC lining, tight junction, and capillary-like germination were more efficient in the microchannel hydrogel experimental group compared to other experimental groups. It could be confirmed that this happens (FIG. 26).
  • microchannel hydrogel of the present invention can trigger EC invasion and M2 macrophage polarization to induce vascular anastomosis between the stagnant vessel and the microchannel hydrogel.
  • microchannel hydrogel In order to confirm whether the microchannel hydrogel can be applied to other ischemic injury models in which adjacent host vascular structures exist, it was implanted into a wound healing mouse model.
  • tissue staining experiments were further confirmed by tissue staining experiments. As a result, compared to the untreated group and the non-channel hydrogel experimental group, tissue formation was more in the hydrogel experimental group and the normal group (H&E), the collagen content was more abundant (Mason's trichrome staining), and epidermal formation was promoted. , CD31+ cell infiltration was also found to be more (Fig. 29).
  • the microchannel hydrogel experimental group showed remarkably superior tissue growth and blood cell infiltration and CD31+ cell infiltration levels (Fig. 31b and c).
  • the non-channel hydrogel experimental group and the macro-channel hydrogel experimental group showed little or no CD 31+ cells (FIG. 32).

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Oral & Maxillofacial Surgery (AREA)
  • Transplantation (AREA)
  • Epidemiology (AREA)
  • Dermatology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Medicinal Chemistry (AREA)
  • Public Health (AREA)
  • Dispersion Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Cell Biology (AREA)
  • Zoology (AREA)
  • Botany (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Developmental Biology & Embryology (AREA)
  • Materials For Medical Uses (AREA)

Abstract

본 발명은 내부에 마이크로채널 네트워크가 형성되어 있는 하이드로젤 구조체에 관한 것으로, 상기 하이드로젤 구조체는 혈액과 같은 유체의 관류를 유도할 수 있어 세포, 스페로이드와 같은 목적 물질을 생체 내로 효과적으로 전달할 수 있다.

Description

마이크로채널 네트워크가 형성된 하이드로젤 구조체
본 발명은 내부에 마이크로채널 네트워크가 형성되어 유체 관류를 유도할 수 있는 하이드로젤 구조체에 관한 것이다.
조직이 재생되기 위해서는 손상된 부위 또는 이식된 스캐폴드로 혈관이 성장되어야 하며, 이를 위해 표적-특이적 혈관신생(vascularization)을 유도하는 다양한 방법이 연구되어 왔다. 그 중에서도 혈관 내피 성장 인자(VEGF)와 같은 전-혈관 형성 분자를 이용한 국소 치료가 가장 유망한 접근법으로 여겨져 왔다. 상기 분자는 표적 부위에 주사되거나 이식물에서 방출되거나 또는 전신 순환을 통해 표적 부위에 전달된다. 그러나 상기 방법은 일부 단점이 있다. 첫째, 분자가 표적 부위에 도달하는 주요 경로가 혈액 또는 간질액 흐름이므로 전신 순환으로 인해 분자가 전신으로 전달되어 표적외 부위에 예기치 않은 영향을 미칠 수 있다. 둘째, 상기 분자가 하나 이상의 생체내 메커니즘에 영향을 미치거나 의도하지 않게 표적 메커니즘을 과도하게 유도할 수 있다. 예를 들어, VEGF는 혈관신생뿐만 아니라 염증을 유발하며, 혈관신생의 과도한 유도는 종양 발생으로 이어질 수 있다. 전-혈관신생 분자를 이용한 치료에서 이러한 문제는 아직까지 해결된 적이 없다.
상기 문제를 해결하기 위해 구조가 생물학적 기능을 유도한다는 개념("구조-기능 관계")에 근거하여 손상된 부위에서 혈관 네트워크를 물리적으로 엔지니어링할 수 있는 기술이 개발되었다. 예를 들어, 지난 10년 동안 세포 기능을 제어하기 위해 표면 패터닝, 다공성 스캐폴드 디자인 및 3D 바이오프린팅 기술이 널리 연구되어 왔다. 그러나 상기 기술들은 아직까지 VEGF와 같은 전-혈관형성 분자들의 문제점을 해결하지 못하고 있다.
한편, 혈관이 제 기능을 발휘하기 위해서는 다음과 같은 특이한 구조가 필요하다: i) 유입구에서 유출구로의 무손실 관류를 가능하게 하는 3차원적으로 닫힌 네트워크, ii) 최소 유동 저항(minimum flow resistance)으로 최대 표면 영역을 확보하기 위한 분지된 연결, iii) xyz 방향에서 산소 및 영양소의 200 ㎛ 확산 한계를 극복하기 위한 혈관의 밀집 국소화(dense localization), 및 iv) 혈관 내 공간으로 분자 확산을 촉진하고 미세혈관의 내외부 성장을 지원하기 위한 세포외 매트릭스 스캐폴딩. 혈액은 상기 언급한 구조를 갖춘 혈관 네트워크를 통해 흐르며, 이는 이식물 내부에 기능적 혈관 구조를 도입하면 숙주 조직으로부터 이식물로 혈액 관류를 유도할 수 있음을 나타낸다. 실제로, 이전의 연구는 이식 가능한 스캐폴드에서 신생혈관 형성이 상호 연결된 내부 구조와 함께 ~ 40 ㎛ 기공 직경에서 주로 발생하는 것으로 보고하였다(비특허문헌 1 및 2).
본 발명자들은 전-혈관형성 분자들의 문제점을 해결하고, 상기 특이적 혈관 구조를 모방하기 위해 내부에 3차원 마이크로채널 네트워크가 형성된 구조체를 개발하였으며, 이 구조체가 손상 부위에서 혈액 관류를 유도하고, 대식세포의 분극 및 기능성 내피 세포(EC)의 회복을 촉진하는 것을 확인하여 본 발명을 완성하였다.
본 발명의 목적은 내부에 3차원 마이크로채널 네트워크가 형성된 하이드로젤을 포함하는 하이드로젤 구조체 및 이의 용도를 제공하는 것이다.
상기 목적을 달성하기 위하여, 본 발명의 일 양상은
생체적합성 고분자로 이루어진 하이드로젤; 및
상기 하이드로젤 내부에 형성되고, 유체가 관류하는 복수개의 마이크로채널을 포함하며,
상기 복수개의 마이크로채널은 서로 연결되어 3차원 네트워크를 형성하고, 각각의 마이크로채널은 3차원 방향으로 200 ㎛ 이내에 존재하는 하이드로젤 구조체를 제공한다.
본 발명자들은 기능적 혈관 구조를 가지면서 생체 내에 이식할 수 있는 구조체를 연구한 결과, 내부의 3차원 마이크로채널 네트워크를 통해 유체가 관류하여 순환 시스템을 형성할 수 있는 하이드로젤 구조체를 제작하였다.
구체적으로 하이드로젤 구조체 내부에 형성된 복수개의 마이크로채널은 3차원 네트워크를 형성하며, 이러한 3차원 네트워크는 각 마이크로채널이 서로 연결되면서 3차원(x축, y축 및 z축) 방향으로 서로 200 ㎛ 이내에 존재하는 것을 의미한다. 상기 거리는 생체 내 혈관의 확산 한계를 고려한 것으로 혈관으로부터 혈구, 영양성분 등이 빠져 나와 주변의 세포, 조직 등으로 전달될 수 있는 거리이다. 이러한 한계 거리로 인해 본 발명의 마이크로채널 구조체는 세포, 오가노이드, 스페로이드 배양에도 유용하게 사용될 수 있다.
본 명세서에 사용된 용어, "생체적합성 고분자"는 생체조직 또는 혈액과 접촉하여 조직을 파괴시키거나 혈액을 응고시키지 않는 조직적합성(tissue compatibility) 및 항응혈성(blood compatibility)을 갖는 고분자를 의미한다.
본 발명에서, 상기 생체적합성 고분자는 젤라틴, 알지네이트, 폴리에틸렌글리콜 (polyethylene glycol, PEG), 폴리디메틸실록산 (polydimethylsiloxane, PDMS), 콜라겐, 키틴, 키토산, 케라틴, 셀룰로스, 피브로넥틴, 엘라스틴, 피브리노겐, 피브로모듈린, 라미닌, 테나신(tenacin), 비트로넥틴 (vitronectin), 히알루론산, 헤파린, 콜라겐, 콘드로이틴황산, 펙틴, 덱스트란, 실크 프로테인, 실크 피브로인 및 그들의 유도체, 아가로스, 폴리락틱산(polylactic acid, PLA), 폴리글리콜산(polyglycolic acid, PGA), 폴리락틱산과 폴리글리콜산의 공중합체(PLGA), 폴리카프로락톤 (polycaprolactone, PCL), 폴리(폴리(에틸렌옥사이드)테레프탈레이트-co-부틸렌테레프탈레이트)(PEOT/PBT), 폴리포스포에스터(polyphosphoester, PPE), 폴리포스파젠(polyphosphazene, PPA), 폴리안하이드라이드(polyanhydride, PA), 폴리오르쏘에스터 (poly(ortho ester, POE) 및 폴리(프로필렌푸마레이트) 디아크릴레이트(poly(propylene fumarate) diacrylate, PPF-DA)로 이루어진 군에서 선택될 수 있으며, 바람직하게는 알지네이트, 젤라틴, 폴리디메틸실록산 또는 폴리에틸렌글리콜이 사용될 수 있다.
본 발명의 일 구체예에 따르면, 상기 하이드로젤 구조체는 1000 내지 3000 Pa 범위의 탄성 계수를 가질 수 있고, 바람직하게는 1000 내지 2000 Pa 범위의 탄성 계수를 가질 수 있다. 상기 하이드로젤 구조체의 탄성 계수가 상기 범위보다 낮으면 하이드로젤의 물성이 약해 내부의 3차원 마이크로채널 네트워크 구조가 유지될 수 없는 문제가 있다. 반대로 탄성 계수가 상기 범위보다 높으면 하이드로젤이 지나치게 딱딱하여 생체 내에 적용시 효용성이 떨어질 수 있다. 상기 하이드로젤 구조체의 탄성 계수는 하이드로젤의 가교 방식을 조절하여 변화시킬 수 있다.
또한, 상기 마이크로채널은 직경이 5 내지 50 ㎛ 범위일 수 있고, 바람직하게는 10 내지 50 ㎛, 더욱 바람직하게는 15 내지 30 ㎛의 직경을 가질 수 있다. 본 발명에서, 상기 하이드로젤 구조체는 유입 채널 및 유출 채널을 추가로 포함할 수 있으며(도 2), 상기 유입 채널 및 유출 채널은 마이크로채널과 연결되어 유체가 관류하는 순환 시스템을 형성한다.
본 발명의 일 구체예에 따른 하이드로젤 구조체는 하기 단계를 포함하는 방법으로 제작된다.
(a) 3차원 섬유 다발을 포함하는 틀에 하이드로젤 용액을 공급하는 단계;
(b) 상기 하이드로젤 용액을 가교시키는 단계; 및
(c) 가교된 하이드로젤에서 3차원 섬유 다발을 제거하는 단계
본 발명의 일 구체예에 따르면, 상기 하이드로젤 구조체의 제작 방법은 도 1에 도시된 바와 같이 온도 감응성 고분자로 이루어진 섬유를 만드는 것에서 시작된다. 마이크로채널을 이루는 섬유는 회전식 분사장치로 자극 감응성 고분자 용액을 분사하여 제작되며, 회전 속도를 변화시킴으로써 섬유의 직경을 조절할 수 있고, 결과적으로 하이드로젤 내에 형성되는 마이크로채널의 직경 및 밀도를 조절할 수 있다(도 1).
본 명세서에 사용된 용어, "자극 감응성 고분자(stimuli-responsive polymer)"는 온도, pH, 전기, 응력, 압력, 자성 등과 같은 자극에 의하여 가역적 혹은 비가역적으로 졸-겔 상전이 또는 부피 상전이와 같은 물리적 성질이 변하는 고분자를 말하며, 자극원이 온도이면 "온도 감응성 고분자(temperature-responsive polymer; TRP)"라고 부른다. 하한 임계 용액 온도(lower critical solution temperature, LCST) 거동을 보이는 고분자들은 LCST보다 낮은 온도에서는 졸 상태로 존재한다.
본 발명에서, 상기 자극 감응성 고분자로는 자극원이 자성(magnetic)이면 에틸렌- co-비닐 아세테이트(ethylene- co-vinyl acetate), 초음파이면 에틸렌- co-비닐 아세테이트 및 에틸렌- co-비닐 알코올, 전기장이면 폴리(2-하이드록시에틸 메타크릴레이트) (Poly(2-hydroxyethyl methacrylate))가 사용될 수 있다. 또한, 자극원이 pH이면 키토산-폴리(에틸렌 옥사이드)(Chitosan-poly(ethylene oxide)), 폴리(아크릴산)-폴리(에틸렌 옥사이드) (Poly(acrylic acid)-PEO), 폴리(2-하이드록시에틸 메타크릴레이트) (Poly(2-hydroxyethyl methacrylate)), 폴리(아크릴아미드- co-말레산) (Poly(acrylamide-co-maleic acid)) 등이 사용될 수 있다.
본 발명의 일 구체예에 따르면, 상기 온도 감응성 고분자는 폴리(N-이소프로필아크릴아미드), 폴리-N-비닐카프로락탐, 폴리메타크릴산, 하이드록시프로필셀룰로오스, 폴리비닐메틸에테르, 폴리(2-하이드로메타크릴산), 폴리(N-이소프로필아크릴아미드), 폴리(N,N-디에틸아크릴아미드), 폴리(N-디에틸메타크릴아미드), 폴리(메틸비닐에테르), 폴리(2-에톡시에틸비닐에테르), 폴리(N-비닐카프로락탐), 폴리(N-비닐이소부틸아민), 폴리(N-비닐-n-부틸아민) 및 폴리푸마르산으로 이루어진 군에서 선택될 수 있으며, 바람직하게는 폴리(N-이소프로필아크릴아미드)가 사용될 수 있다.
본 발명에서, 상기 회전식 분사장치는 솜사탕 기계와 유사한 장치이며, 이 장치를 사용한 이유는 전기 방사 방법으로는 부피감 있는 섬유망(fiber mesh)을 만들 수 없었고, 3D 프린팅 방법으로는 조밀한 섬유의 폐쇄 네트워크를 생성하기에 충분한 해상도에 도달할 수 없었기 때문이다. 회전식 분사장치를 사용하여 섬유를 솜사탕 같이 생산한 경우에만 혈관의 확산 한계(200 ㎛)를 극복할 수 있는 섬유 다발을 형성할 수 있었다.
도 1과 같은 제작 방법을 사용함으로써 상기 단계 (a)에서 틀에 넣는 3차원 섬유 다발의 위치를 조정하여 하이드로젤 내에서 3차원 마이크로채널 네트워크의 위치를 조정할 수 있고, 하이드로젤의 마이크로채널이 3차원 방향으로 서로 연결되므로 유입액과 유출액 사이에 새는 부분 없이 폐쇄된 유체 순환이 가능한 장점이 있다. 또한, 단계 (a)에서 틀의 크기, 모양을 변경시키고, 하이드로젤 용액의 양을 증가시킴으로써 하이드로젤 구조체의 크기 및 형태를 다양하게 변형시킬 수 있다.
본 발명의 일 구체예에 따르면, 상기 단계 (b)의 하이드로젤 가교는 물리적 및 화학적 가교 방법 모두를 사용할 수 있고, 예를 들어, 트랜스글루타미나제와 같은 효소 가교제를 사용할 수 있다. 효소 가교제는 저렴하고 생체적합성을 가지며, 겔화 전에 세포 및 치료제를 용이하게 로딩할 수 있으므로 실용적이다. 또한, 효소 대 하이드로젤 용액의 비율을 조정함으로써 가교 시간 및 가교 정도를 제어할 수 있어 광범위한 조직 및 기관에 적용할 수 있다.
본 발명의 일 구체예에 따르면, 하이드로젤 용액과 상기 트랜스글루타미나제의 비율은 5:1 내지 30:1의 범위(w/v%)일 수 있으며, 바람직하게는 5:1 내지 25:1의 범위일 수 있다. 상기 비율이 40:1을 넘어서면 젤화 시간이 오래 걸려 비효율적이고, 낮은 물성(탄성계수) 때문에 하이드로젤 구조체 사용이 불가능하였다.
본 발명에서, 상기 단계 (c)는 3차원 섬유 다발을 졸(sol)화시켜 이루어질 수 있으며, 구체적으로 자극 감응성 고분자에 해당하는 자극을 가하여 수행될 수 있다. 에를 들어, 상기 온도 감응성 고분자로 이루어진 섬유는 LCST보다 낮은 온도에서는 수용액 상태로 존재하므로 LCST보다 낮은 유체를 하이드로젤에 관류시켜 제거할 수 있다. 상기 폴리(N-이소프로필아크릴아미드)) (poly(N-isopropylacrylamide, PNIPAM; Mn=~40,000)는 25 내지 32℃ 정도의 LCST를 나타내므로 이 온도보다 낮은 유체를 하이드로젤에 관류시켜 PNIPAM 섬유를 제거할 수 있다.
본 발명에서, 상기 하이드로젤 구조체는 단계 (a)에서 하이드로젤을 공급할 때 하이드로젤 용액 또는 틀에 세포, 스페로이드, 오가노이드, 단백질, 핵산, 펩티드, 지질, 나노입자, 약물 또는 화합물을 포함시킴으로써 상기 물질들이 포함된 하이드로젤 구조체로 제작될 수 있다.
따라서, 본 발명의 다른 양상은 상기 하이드로젤 구조체; 및 여기에 봉입된 이식용 목적 물질을 포함하는 생체내 이식용 조성물을 제공한다.
상기 이식용 목적 물질로는 세포, 스페로이드, 오가노이드, 생체로부터 분리한 조직 및 조직 단편, 단백질, 핵산, 펩티드, 지질, 나노입자, 약물 또는 화합물로 이루어진 군에서 선택되는 하나 이상의 물질이 이용될 수 있으나, 이에 제한되지 아니한다.
본 명세서에 사용된 용어, "스페로이드(spheroid)"는 3차원으로 배양된 세포의 원형 집합체를 말하며, 세포와 세포의 3차원 접촉으로 인한 상호작용, 세포 분비물의 확산에 의한 측분비 신호전달(Paracrine singaling) 등으로 인해 2차원 세포 배양과 비교하여 생체내 환경 및 생체 반응성을 잘 반영하는 것으로 알려져 있다.
본 명세서에 사용된 용어, "오가노이드(organoid, 장기유사체, 미니장기)"는 줄기세포나 장기 기원세포로부터 분리한 세포를 3차원 배양법으로 다시 응집·재조합하여 만든 장기 특이적 세포 집합체를 말하며, 모델로 하는 장기의 특이적 세포를 구성할 수 있고, 장기가 지닌 특정 기능을 재현할 수 있으며, 실제 장기와 유사한 구조로 공간적 조직화가 가능한 장점이 있다. 하지만 현재 오가노이드 기술로는 실제 장기의 복잡한 생물학적, 물리학적, 화학적 환경을 반영하지 못하는 한계가 존재하며, 오가노이드와 실제 장기와의 유사성을 높이기 위해서는 미세유체 시스템(microfluidic system)과 같은 생물공학적 접근이 필요할 것으로 예상되고 있다.
본 발명의 하이드로젤 구조체는 내부의 마이크로채널 네트워크에 세포 배양 배지를 관류시킬 수 있으므로 세포의 3차원 배양이 가능하고, 스페로이드 및/또는 오가노이드의 생존을 유지시킬 수 있다.
본 발명의 하이드로젤 구조체는 내부에 3차원 마이크로채널 네트워크가 형성되어 있어 혈액과 같은 유체의 관류를 유도할 수 있으며, 따라서 세포, 스페로이드와 같은 목적 물질을 생체 내로 효과적으로 이식할 수 있다.
도 1은 본 발명의 일 실시예에 따른 채널 네트워크 하이드로젤의 제조 과정을 개략적으로 나타낸다.
도 2에서 a는 용액 방사 후 형성된 PNIPAM 섬유의 주사전자현미경 이미지이고, b는 마이크로채널 하이드로젤의 명시야 현미경 이미지이다(scale bar=100 ㎛).
도 3에서 a는 생성된 채널 네트워크 하이드로젤의 양쪽에 튜브를 연결한 상태를 보여주는 이미지이고, b는 세포 배양 배지를 관류시키고 있는 마이크로채널 하이드로젤을 보여주는 이미지이다.
도 4에서 a는 생성된 채널 네트워크 하이드로젤에 플루오스피어를 관류시킨 후 공초점 현미경으로 확인한 결과이고, b는 채널 네트워크 하이드로젤의 채널 직경 분포를 보여주는 그래프이며, c 및 d는 각각 폴리디메틸실록산, 알지네이트 하이드로젤에서 마이크로채널의 직경을 보여주는 결과이다.
도 5는 마이크로채널 하이드로젤에 플루오스피어를 관류시킨 후 채널의 상호연결성을 공초점 현미경으로 횡단면에서 확인한 결과이며, 흰색 화살표는 채널 내부공간(channel lumen)을 나타낸다.
도 6은 젤라틴과 미생물 트랜스글루타미나제의 혼합 비율에 따른 채널 네트워크 하이드로젤의 탄성 계수를 측정한 결과를 나타낸다.
도 7은 마이크로채널 하이드로젤에 FITC-덱스트란(녹색)과 플루오스피어(적색)를 관류시킨 후 시간 경과에 따라 공초점 현미경으로 확인한 결과를 나타낸다.
도 8은 허혈 손상 부위에 본 발명의 일 실시예에 따른 채널 네트워크 하이드로젤을 적용한 모습을 나타낸다.
도 9에서 a는 하지 허혈 모델 마우스의 허혈 부위에 채널 네트워크 하이드로젤을 이식한 후 시간 경과에 따른 혈액 관류 정도를 확인한 결과이고, b는 정상 하지 대비 허혈 하지의 혈액 관류 수준을 정량화한 그래프이며, c는 채널 네트워크 하이드로젤 이식 후 14일 차에 허혈 하지의 회복 정도를 확인한 결과이다.
도 10은 하지 허혈 모델 마우스의 허혈 부위에 채널 네트워크 하이드로젤을 이식한 후 14일 차에 말단 조직에 대하여 헤마토실린&에오신 염색, 마송 트리크롬 염색을 수행한 결과이다.
도 11에서 a는 하지 허혈 모델 마우스의 허혈 부위에 채널 네트워크 하이드로젤을 이식한 후 하지 조직에서 세포사멸(apoptosis) 수준을 확인한 결과이고, b는 상기 하지 조직에서 혈관 생성 마커인 CD31 및 αSMA의 발현 수준을 확인한 결과이다.
도 12는 하지 허혈 모델 마우스의 허혈 부위에 채널 네트워크 하이드로젤을 이식한 후 14일 차에 혈관 구조를 마이크로CT로 확인한 결과이며, 상단에서 하단으로 갈수록 배율이 증가한다.
도 13은 하지 허혈 모델 마우스의 허혈 부위에 채널 네트워크 하이드로젤을 이식한 후 14일 차에 공초점 현미경으로 혈액 흐름을 확인한 결과이다.
도 14는 하지 허혈 모델 마우스의 허혈 부위에 채널 네트워크 하이드로젤을 이식한 후 14일 차에 혈액 관류 여부를 확인한 결과이며, 도면 내의 화살표는 채널 네트워크와 혈관의 문합을 표시한 것이다.
도 15에서 a는 하지 허혈 모델 마우스의 허혈 부위에 채널 네트워크 하이드로젤을 이식한 후 14일 차에 혈액 관류 여부를 확인한 결과이며, b는 마이크로혈관 지표인 총 분지 길이(i), 분지 수(ii), 접합 수(iii) 및 부분 면적(iv)을 확인한 결과이다.
도 16에서 a는 하지 허혈 모델 마우스의 허혈 부위에 채널 네트워크 하이드로젤을 이식한 후 14일 차에 하이드로젤에 침윤한 세포에서 항원 제시 T 세포 마커 CD3 및 단핵세포/대식세포 마커 CD68과 CD31의 유전자 발현 수준을 확인한 결과이고, b는 하지 허혈 모델 마우스에 형광 표지된 대식세포를 주입한 후 하이드로젤 이식 부위에서 대식세포의 침윤 정도를 확인한 결과이다.
도 17은 채널 네트워크 하이드로젤을 이식한 하지 허혈 부위 조직을 헤마토실린&에오신, CD68로 염색한 결과이다.
도 18은 채널 네트워크 하이드로젤을 이식한 하지 허혈 부위에서 대식세포의 M1 및 M2로의 분극화를 확인한 결과이다.
도 19는 M1으로 활성화된 대식세포를 배지를 관류시키면서 채널 네트워크 하이드로젤에서 배양한 후 세포 형태를 확인한 결과이다.
도 20은 M1으로 활성화된 대식세포를 배지를 관류시키면서 채널 네트워크 하이드로젤에서 배양한 후 M1 및 M2 마커 유전자의 발현 수준을 확인한 결과이다.
도 21은 하지 허혈 부위에 이식한 채널 네트워크 하이드로젤에 침윤한 내피세포에서 골격근 마커 MyoG, 내피세포 마커 KDR 및 vWF, 혈관 평활근 세포 마커 αSMA의 발현 수준을 확인한 결과이다.
도 22는 하지 허혈 부위에 이식한 채널 네트워크 하이드로젤을 헤마토실린&에오신으로 염색한 결과이며, 우측의 노란색 화살표는 마이크로채널 하이드로젤에 침윤한 혈액 세포를 나타낸다.
도 23은 돼지 하지 허혈 모델의 허혈 부위에 채널 네트워크 하이드로젤을 이식한 후 헤마토실린&에오신으로 염색한 결과이며, 우측의 노란색 화살표는 마이크로채널 하이드로젤에 침윤한 혈액 세포를 나타낸다.
도 24는 하지 허혈 부위에 채널 네트워크 하이드로젤을 이식한 후 기능성 내피세포(렉틴+)의 존재 여부를 확인한 결과(a) 및 정량 분석한 결과(b)이며, a에서 흰색 화살표는 기능성 내피세포(녹색)와 관류 염색된 채널(적색)이 같이 존재하는 지점을 의미한다.
도 25는 하지 허혈 부위에 채널 네트워크 하이드로젤을 이식한 후 내피세포의 침윤 여부를 F-액틴, CD31 및 세포핵 염색으로 확인한 결과이다.
도 26은 GFP-HUVECs을 배지 관류 하에 마이크로채널 하이드로젤 내에서 배양하면서 세포 형태를 확인한 결과이다.
도 27은 상처 치료 마우스 모델에 마이크로채널 하이드로젤을 이식한 후 14일 차에 상처 면적을 확인한 결과이다.
도 28은 상처 치료 마우스 모델에 마이크로채널 하이드로젤을 이식한 후 상처 조직을 헤마토실린&에오신, 마송 트리크롬으로 염색하여 확인한 결과이며, 녹색 화살표는 봉합되지 않은 상처의 범위를 나타낸다.
도 29는 상처 치료 마우스 모델에 마이크로채널 하이드로젤을 이식한 후 상처 조직에서 조직 형성, 콜라겐 생성, 표피 형성 및 CD31+ 세포 침윤 수준을 확인한 결과이며, 하단의 흰색 화살표는 피부 조직 단편에서 미세혈관 구조(CD31+)를 나타낸다.
도 30은 인접한 혈관의 수가 서로 상이한 대장막, 정상 하지 및 피하 조직에 채널 네트워크 하이드로젤을 이식한 후 혈액 관류 여부, CD31+ 세포 수준을 확인한 결과이다.
도 31에서 a는 인접한 혈관의 수가 서로 상이한 대장막, 정상 하지 및 피하 조직에 채널 네트워크 하이드로젤을 이식한 후 조직 단면을 헤마토실린&에오신으로 염색한 결과이고, b는 상기 a에서 마이크로채널 하이드로젤의 결과만을 상호 비교한 결과로 파란색 화살표는 이식된 하이드로젤에 침윤한 혈액 세포를 나타내며, c는 마이크로채널 하이드로젤을 이식한 각 조직에서 CD31+ 세포를 확인한 결과이다.
도 32는 인접한 혈관의 수가 서로 상이한 대장막, 정상 하지 및 피하 조직에 매크로채널 하이드로젤을 이식한 후 CD31+ 세포를 확인한 결과이다.
이하 하나 이상의 구체예를 실시예를 통하여 보다 상세하게 설명한다. 그러나, 이들 실시예는 하나 이상의 구체예를 예시적으로 설명하기 위한 것으로 본 발명의 범위가 이들 실시예에 한정되는 것은 아니다.
실험 방법
1. 하이드로젤 구조체 제작
희생 물질인 폴리(N-이소프로필아크릴아미드)(poly(N-isopropylacrylamide, PNIPAM; Mn= ~40,000; 시그마-알드리치, 미국)를 메탄올과 에탄올의 혼합액(9:1)에 45 w/v% 농도로 용해시키고, 맞춤 제작한 순환식 회전 장치를 사용하여 각각 다른 rpm으로 용액을 분사하여 직경이 다른 PNIPAM 섬유 다발을 제작하였다. PNIPAM은 생체적합성, 32℃의 낮은 임계 용액 온도(lower critical solution temperature, LCST)를 갖는 열 감응성(thermo-responsibility) 특성 때문에 선택하였다. 이후 상기 PNIPAM 섬유 다발을 폴리디메틸실록산(polydimethylsiloxane, PDMS) 틀에 넣고, 젤라틴/mTG (microbial transglutaminase) 용액(9:1 비율, 최종 농도=5 w/v%)을 부어 37℃에서 젤라틴을 가교시켰다. 이후 상기 젤라틴 하이드로젤의 양 끝에 실리콘 튜브를 연결하여 32℃ 미만의 PBS를 관류시키고 졸-겔 상전이로 PNIPAM 섬유를 제거하였다. 최종적으로 PNIPAM 섬유의 직경에 따라 매크로채널 또는 마이크로채널 구조가 내부에 형성된 3D 채널 네트워크 하이드로젤 구조체를 제작하였다(도 1 내지 3). 또한, 젤라틴 대신 PDMS 또는 알지네이트를 사용하거나, 젤라틴과 mTG의 비율을 변화시킨 것만 제외하고 상기와 동일한 방식으로 3D 채널 네트워크 하이드로젤 구조체를 제작하였다.
제작한 3D 채널 네트워크 하이드로젤 구조체의 채널 구조는 적색 플루오스피어 (FluoSpheres, 45 ㎚; 인비트로젠, 미국)를 관류시킨 후 공초점 현미경 LSM 780 (자이스, 독일)으로 관찰하였다. 또한, 3D 채널 네트워크 하이드로젤 구조체 내부의 채널 크기 분포는 이미지J/피지(ImageJ/Fiji) 소프트웨어로 확인하였다.
이하에서, 매크로채널 또는 마이크로채널 구조를 갖는 3D 채널 네트워크 하이드로젤 구조체는 각각 "매크로채널 하이드로젤", "마이크로채널 하이드로젤"로 기재하며, 두 개 모두를 포함하여 지칭할 때는 "채널 네트워크 하이드로젤"로 기재한다.
2. 인 비보 실험
무게 20 내지 25g, 5주령의 Balb/c 수컷 마우스(오리엔트 바이오, 대한민국)에 자일라진(10 ㎎/㎏)과 졸레틸(50 ㎎/㎏)의 혼합물을 주사하여 마취시켰다. 왼쪽 하지의 대퇴부 동맥과 정맥에서 상부 및 하부 지점 사이의 혈관을 제거하고, 6-0 실크 봉합(Ethicon, 서머스빌, 미국)으로 혈관을 묶어 하지 허혈을 유도하였다. 혈관 봉합 지점은 외부 장골 동맥(external iliac artery)의 근위 분지점 및 외부 장골 동맥이 복재 동맥(saphenous artery)과 슬와 동맥(popliteal artery)으로 나누어지는 원위점이다. 이후 상기 1에서 제작한 매크로채널 하이드로젤 또는 마이크로채널 하이드로젤(가로x세로x두께=4 ㎜x4 ㎜x3 ㎜)을 하지 허혈을 유도한 부위의 중심 하지 근육 또는 정상 마우스(비교군)의 동일 위치에 이식하였다.
또한, 다른 허혈 모델 마우스에서 등쪽 피부를 완전히 제거하고(full thickness defect), 상기 1에서 제작한 매크로채널 하이드로젤 또는 마이크로채널 하이드로젤 (가로x세로x두께=2㎝ x 2㎝ x 3㎜) 및 드레싱 필름(Tegaderm TM, 3M Medical)으로 상기 결손 부위를 14일 동안 덮었다. 비-허혈성 모델에서는 채널 네트워크 하이드로젤을 이용한 혈관신생-매개 문합(anastomosis)에서 숙주 혈관 수의 기계적 역할을 확인하기 위해, 마이크로채널 하이드로젤을 대장막(greater omentum) 및 피하 조직에 각각 14일 동안 이식하여 숙주 근접 혈관-풍부 모델 및 혈관-빈약 모델로 이용하였다.
하지 허혈 돼지 모델은 40 ㎏의 암컷 요크샤이어 돼지(엑스피 바이오, 대한민국)를 이용하였고, 예비투약으로 아트로핀(0.04 mg/kg), 자일라진(2 mg/kg) 및 아자페론(2 mg/kg)의 혼합물을 근육주사하고, 알팍산(1 mg/kg)으로 마취를 유도하였다. 외과적 처치 과정 동안 2% 이소플루란을 기관내 삽관으로 공급하여 마취 상태를 유지시켰다. 이후 하지 허혈 마우스 모델과 같이 대퇴부 동맥과 정맥에서 상부 및 하부 지점 사이의 혈관을 제거한 후 1-0 실크 봉합으로 상하부 지점의 혈관을 묶었다. 실험군에는 실린더 형태의 하이드로젤(직경 1 ㎝ 및 높이 1.5 ㎝)을 허혈 부위의 중심 하지 근육에 이식하고, 18일 후에 조직 검사를 위해 희생시켰다.
3. 레이저 도플러 이미징 (laser Doppler imaging)
채널 네트워크 하이드로젤 이식 부위의 혈액 관류(perfusion)는 이식 후 0일, 7일 및 14일차에 레이저 도플러 관류 이미징(laser Doppler perfusion imaging, LDPI; Moor Instruments, 영국)으로 LDPI 수치의 정량 분석과 함께 확인하였다. 관류 변화를 최소화하기 위해 LDPI 스캐닝 동안 가열 패드로 마우스의 체온을 유지시켰다. LDPI 수치의 최대값 및 최소값은 각각 적색 및 진한 파란색으로 표시하였다. 상대적 관류 비율은 상응하는 LDPI 이미지에서 얻어지는 허혈 하지의 평균 관류값(왼쪽)을 정상 하지의 평균 관류값(오른쪽)으로 나누어 산출하였다.
4. 마이크로CT 혈관 조영술
숙주 혈관으로부터 이식된 채널 네트워크 하이드로젤로의 혈액 관류는 마이크로CT 혈관조영술(MicroCT angiography)로 확인하였다. 마우스를 이소플루란으로 마취시킨 후 조영제인 파미레이 370 (Pamiray 370, 100 ㎕ of iopamidol-370, 동국제약, 대한민국)을 꼬리 정맥에 주사하고 표준 조건(튜브 전압: 65 Kvp; 튜브 전류: 115 uA; 360° 회전마다 720개 이미지; 해상도 100 ㎛)에 따라 MicroCT 스캐닝 (NFR Polaris-G90, Nano 669 Focus Ray, 대한민국)을 수행하였다. 획득한 마이크로CT 이미지는 FDK 알고리즘(volumetric cone-beam reconstruction algorithm)으로 가공한 후 3D-렌더링 소프트웨어(RadiAnt DICOM Viewer 4.2.1)로 분석하였다.
5. 인 비보 EC 침윤 및 문합적 혈관신생 평가
허혈성 하지의 원위 부위로부터 이식된 채널 네트워크 하이드로젤로의 EC 침윤은 마우스의 꼬리 정맥에 렉틴(100 ㎕, FITC-결합, L-2895, Sigma-Aldrich)을 주사한 후 30분 동안 공초점 이미징으로 확인하였다. 이웃하는 혈관으로부터 채널 네트워크 하이드로젤로의 유동 관류 연결은 이전에 보고된 방법에 따라 문합 혈관 신생의 지표를 사용하여 이미지화하였다. 간략하게, 마우스의 하대 정맥(inferior vena cava)을 절단한 후, 0.1 ㎎/㎖의 헤파린 황산염을 함유하는 PBS를 좌심실을 통해 관류시켜 절단된 배수 지점을 통해 전혈을 제거하였다. 이후 관류 용기 및 채널의 형광 가시화를 위해 4 ㎛의 적색 형광성 마이크로비드(Invitrogen)를 포함하는 PBS를 좌심실을 통해 관류시키고, 채널 네트워크 하이드로젤을 회수한 후 3.7% 포름알데히드로 고정시켰다. 각각의 전체 마운트 샘플(684개의 인접 조직을 갖는 겔)에서 Z축 방향(Z-stack)으로 공초점 이미징(LSM 780, 자이스)을 실시한 후, 이미지J/피지 소프트웨어로 기능성 혈관 구조의 파라미터를 정량적으로 분석하였다.
6. 조직 및 세포 염색
회수한 샘플은 PBS로 3회 세척하여 10% 포름알데히드로 1일 동안 고정시킨 후 파라핀 블록을 제작하였다. 파라핀 블록은 각 섹션의 6개 다른 위치에서 4 ㎛ 두께로 절단하고, 조직 및 조직 섬유증 분석을 위해 헤마토실린 및 에오신, 마손 삼색 (Masson's trichrome)으로 각각 염색하여 도립 현미경(Leica DMi8, Leica microsystems, 독일)으로 관찰하였다.
각 섹션은 면역형광 염색에도 사용하였으며, 이를 위해 자일렌 및 에탄올(100%, 95%, 80%, 및 70% v/v in D.W.)에 순차적으로 반응시킨 후 항원 활성화를 위해 펩신 용액(Sigma-Aldrich)을 37℃에서 30분 동안 처리하였다. 전체 마운트 샘플은 5% 소 혈청 알부민(Millipore) 및 0.3% 트리톤 X-100(Sigma-Aldrich)을 포함하는 버퍼 용액을 처리하여 실온에서 1시간 동안 반응시켰다. 이후 샘플에 일차 항체인 CD68 (ab125212, Abcam), CD31 (sc-1505, Santa Cruz Biotechnology), Involucrin (sc-21748, Santa Cruz), F4/80 (ab6640, Abcam), iNOS (ab955, Abcam), 및 CD206 (ab64693, Abcam)을 각각 처리하여 4℃에서 하룻밤 동안 반응시켰다. 다음날 각 샘플에 Alexa Fluor 488 또는 Alexa Fluor 594가 결합된 이차 항체 (Jackson 702 Immuno Research Laboratories, 미국)를 처리하고, 대조염색으로 DAPI (H-1500, Vector Laboratories) 염색을 수행하였다. 이후 공초점 현미경으로 관찰하고, 이미지J/피지 소프트웨어로 정량 분석을 수행하였다.
샘플 내 세포사멸(apoptosis)은 제조사의 프로토콜에 따라 TUNEL 염색 (Roche Molecular 706 Biochemicals, 독일)으로 확인하였으며, 이후 공초점 현미경으로 관찰하고, 이미지J/피지 소프트웨어로 정량 분석을 수행하였다.
7. 대식세포 침윤 및 분극화
생체 내에서 단핵구(monocyte)가 이식 부위로 침윤(infiltration)하는 것은 형광 염료(Vivotrack 711 680, PerkinElmer, 미국)로 표지된 마우스 단핵구 (RAW264.7)를 사용하여 제조사의 프로토콜에 따라 확인하였다. 하지 허혈 시술 후 3일 차에 단핵구(2x10 6 세포/마우스)를 정맥에 주사하고, 24시간 후 생체내 이미징 시스템( in vivo imaging system(IVIS), PerkinElmer)으로 단핵구의 분포를 확인하였다. 허혈 하지의 채널 네트워크 하이드로젤 이식 부위에서 형광 염료의 강도는 정상 하지에서의 염료 강도와 비교하여 분석하였다. 이후 마우스를 희생시키고, 샘플은 다른 실험에 사용하였다.
생체외 대식세포 분극화(macrophage polarization)는 채널 네트워크 구조체에 20 ㎕/분의 속도로 배지를 관류시키면서 2일 동안 RAW264.7 세포(5x10 5개)를 배양하여 확인하였다. 염증 반응 활성화를 위해 RAW264.7 세포에는 LPS(100 ng/㎖)를 1일 동안 처리하고, 이후 정량 RT-PCR로 분석하였다.
8. 정량 RT-PCR
총 RNA는 TRIzol® 시약으로 추출하여 DNA 분해효소(DNase)를 처리하고, RNA 1 ㎍, 랜덤-헥사머 프라이머 및 키트(TAKARA Bio Inc., 일본)를 사용하여 cDNA를 합성하였다. 정량 PCR은 cDNA, SYBR® Green 및 프라미어(정방향 및 역방향)를 사용하여 StepOne TM Real-Time PCR system (Applied Biosystems, 미국)으로 수행하였다. 상대적 유전자 발현 수준은 GAPDH(glyceraldehyde 3-phosphate dehydrogenase)의 Ct (threshod cycle) 값을 기준으로 상응하는 비교 Ct(2 -△△Ct) 값을 계산하여 산출하였다.
사용한 프라이머 서열은 하기 표 1에 기재하였다.
유전자 서열
CD3 Forward GCGTCTGGTGCCTTCTTCAG
Reverse AAAGTGTTCCACCGCATCCT
CD68 Forward AAAGGCTTGGGGCATATCTGT
Reverse GATGGGTACCGTCACAACCTC
MyoG Forward CCAAGTTGGTGTCAAAAGCC
Reverse CAGGGCTGTTTTCTGGACATC
αSMA Forward CCTGGCCTAGCAACACTGATT
Reverse AATTCTGTCACCCAGGGATGC
KDR Forward CATTGCCTGGTCAAACAGCTC
Reverse TGGTGATCCTCTTGTAGCTCTCC
vWF Forward CAACTTGGAGCTATTGCAGGCAG
Reverse CTTTCAGAGCCAGGGAGAGAAA
CD31 Forward TCACCAAGAGAACGGAAGGC
Reverse CTCTTCTCGGGACATGGACG
CD34 Forward GTTGGGAAGAAAAGAGGCTGC
Reverse GGGTTGTGAGGTACTGTGAGG
CD133 Forward TGGAAGGAGCCCAGCTTAGA
Forward AGTACCATCCCTCTCCGGTC
ARG1 Reverse AGGGACTGACTACCTTAAACCAC
Forward TTCTGTCTGCTTTGCTGTGATG
CD206 Reverse TAGCACTGGGTTGCATTGGT
Forward TCCGCCAGGATAGTAAATGAGCA
CD163 Reverse TGCTGTCACTAACGCTCCTG
Forward CAGTTGTTTTCACCACCCGC
GAPDH Reverse ATGTGTCCGTCGTGGATCTGA
Forward TGCCTGTCTTCACCACCTTCT
9. 통계 분석
모든 정량 데이터는 다중 비교를 위해 터키 유의차 사후 검정(Turkey's significant difference post-hoc test)과 함께 양측 스튜던트 t-검정 또는 일원 분산 분석(ANOVA)으로 분석하였다. *p<0.05 및 ***p<0.005의 값은 통계적으로 유의한 것으로 간주하였다.
실험 결과
1. 생성된 채널 네트워크 하이드로젤 확인
매크로채널 하이드로젤과 마이크로채널 하이드로젤은 도 1에 제시된 방법에 따라 제조하였다. 도 1의 방법은 세척수의 온도가 32℃ 미만으로 낮아질 때 관류에 의해 PNIPAM 섬유를 용해시키므로 유기 용매가 없는 무독성의 공정으로 이루어진다.
채널 네트워크 하이드로젤에서 채널 크기의 효과를 확인하기 위해, 매크로채널 하이드로젤 및 마이크로채널 하이드로젤을 각각 제조한 후 플루오스피어(45 ㎚, 적색)를 관류시켜 공초점 이미지로 확인하였다. 그 결과, 마이크로채널과 매크로채널의 평균 직경이 각각 16.37±7.76 ㎛ 내지 150.46±57.02 ㎛인 것을 확인하였고(도 4), 하이드로젤 내에서 각 채널들이 서로 연결되어 있는 것을 확인할 수 있었다(도 5). 또한, 젤라틴 대신 PDMS, 알지네이트를 사용한 마이크로채널 하이드로젤 구조체는 채널의 평균 직경이 각각 14.65±4.93 ㎛, 22.48±6.75 ㎛인 것을 확인하였다(도 4의 c 및 d).
또한, 젤라틴과 mTG의 비율을 변화시켜 제작한 채널 네트워크 하이드로젤의 탄성 계수를 확인한 결과 mTG의 비율이 감소할수록 저장 탄성 계수(storage modulus)가 감소하는 것을 확인하였으며, 젤라틴과 mTG의 비율이 1:40이면 하이드로젤 가교 시간이 길고, 탄성 계수가 낮아 사용하기에 부적합한 것을 알 수 있었다(도 6).
또한, 하이드로젤 내의 채널 네트워크는 모세혈관과 유사한 확산 및 관류 특성을 갖는 것을 알 수 있었으며, 구체적으로 FITC-덱스트란(40 kDa, 녹색)은 마이크로채널로부터 하이드로젤 내의 젤라틴 매트릭스로 효율적으로 확산되고, 플루오스피어(40 ㎚, 적색)는 마이크로채널을 통해 잘 관류되는 것을 확인할 수 있었다(도 7).
2. 채널 네트워크 하이드로젤의 치료 효과
채널 네트워크 하이드로젤만 사용하여 손상된 조직을 회복시킬 수 있는지 확인하기 위하여 하지 허혈 마우스 모델의 허혈 부위 중심에 채널 네트워크 하이드로젤을 이식하였다. 그 결과, 이식 이후 허혈 부위의 근위 및 원위 혈관이 채널 네트워크 하이드로젤로 성장하였고, 마이크로채널 네트워크를 이용한 혈관 문합(anastomosis)이 이루어졌다(도 8). 이 과정은 신체의 폐쇄 순환 시스템과 같이 근위 숙주 혈관(입구)에서 마이크로채널, 이후 원위 혈관(출구)으로의 혈액 관류를 가능하게 하여 하지의 허혈성 손상을 회복시킬 수 있었다.
하지 허혈 마우스 모델에서, 하지의 혈액 관류도(perfusion degrees) 및 하지 회복 정도는 채널 네트워크 하이드로젤 이식 후 0일, 7일 및 14일에 레이저 도플러 관류 이미징으로 분석하였다. 분석 결과, 각 실험군의 좌측 하지에서 심한 허혈 상태가 성공적으로 유도된 것을 알 수 있었고, 정상 오른쪽 하지의 0일차 혈액 관류 비율과 비교하여 5 내지 10%의 혈액 관류 비율을 가지는 것을 확인하였다(도 9의 a 및 b).
전반적으로, 마이크로채널 하이드로젤 실험군에서는 이식 후 7일 및 14일에 관류 비율이 최대 50%까지 향상되었고, 정상 우측 하지는 이식 후 14일까지 100%의 관류 비율을 유지하는 것을 알 수 있었다. 그러나 식염수 투여군, 하이드로젤 비실험군 및 매크로채널 하이드로젤 실험군에서는 이식 후 7일 내지 14일에 충분한 관류가 부족(<30% 관류 비율)하여 점진적인 사지 손실이 나타나는 것을 확인하였다(도 9의 b 및 c).
마이크로채널 하이드로젤 실험군에서만 상당한 하지 회복이 이루어져 하지 손실이 없었으며, 다른 실험군에서는 하지 회복이 부족하여 발가락, 발 또는 하지의 손실이 나타났다(도 9의 c).
다음으로, 이식 후 14일차에 채널 네트워크 하이드로젤 이식 부위에서 말단 조직(distal tissue)을 채취하고, TUNEL 분석, 헤마토실린&에오신 염색 및 마송 트리크롬 염색(Masson's trichrome staining)으로 조직학적 검사를 수행하였다.
확인 결과, 매크로채널 하이드로젤 실험군 및 하이드로젤 비실험군에서는 심각한 섬유성 조직이 형성되어 염증성 세포가 대규모로 침습된 반면, 마이크로채널 하이드로젤 실험군은 정상과 유사한 염증성 세포 집단을 보이고, 정상 사지 수준까지 현저하게 회복된 근육 조직을 나타내는 것을 확인할 수 있었다(도 10).
이러한 결과는 세포 사멸 패턴에 의해 추가로 확인할 수 있었으며, 다른 실험군과 비교하여 마이크로채널 하이드로젤 실험군에 상당히 적은 수의 TUNEL+ 세포가 존재하는 것을 확인할 수 있었다(도 11의 a). 또한, 다른 실험군과 비교하여 마이크로채널 하이드로젤 실험군에서는 CD31 및 αSMA의 유전자 발현 수준이 높았으며(도 11의 b), 이는 마이크로채널 하이드로젤이 기능성 혈관 성장을 촉진시킬 수 있음을 나타낸다.
2. 허혈성 손상 회복 기작
심하게 손상된 하지가 마이크로채널 하이드로젤에 의해 회복되는 주요 기작을 조사하였다. 먼저, 심각한 하지 허혈 마우스 모델에서 숙주 혈관과 마이크로채널 네트워크 사이의 문합성 혈액 관류를 마이크로채널 하이드로젤 이식 후 14일차에 정량 분석과 함께 마이크로CT 및 관류-기반 공초점 이미징으로 확인하였다.
확인 결과, 상단에서 하단으로 배율이 점진적으로 증가하는 마이크로CT 이미지에서, 다른 실험군과 대조적으로 마이크로채널 하이드로젤 실험군에서는 숙주 대퇴 동맥으로부터 하이드로젤로 미세한 혈관-침투가 일어난 것을 확인할 수 있었다(도 12 및 도 13).
또한, 플루오스피어(적색) 관류 기반 공초점 이미지로 확인한 결과, 마이크로채널 하이드로젤 실험군에서는 숙주 혈관과 이식된 하이드로젤의 마이크로채널 네트워크 사이에 관류 가능한 문합이 형성된 것을 명확히 알 수 있었으나, 다른 실험군에서는 문합이 형성되지 않아 적색 관류 신호를 확인할 수 없었다(도 14).
형성된 혈관의 구조 확인 결과 및 정량 분석 결과 또한 상기 결과를 뒷받침하였다(도 15의 a 및 b). 마이크로채널 하이드로젤 실험군에서는 기능적 혈관 구조의 지표인 총 분지 길이(i), 분지 수(ii), 접합 수(iii) 및 부분 면적(iv)이 다른 실험군과 비교하여 유의하게 높았으며, 정상 사지와 유사한 수준이었다(도 15의 b).
3. 대식세포의 침윤 및 분극화
초기 염증, 염증 완화, 증식 및 리모델링 과정을 거치는 상처 치료 과정에서 대식세포는 M1 표현형에서 M2 표현형으로 분극화(polarization)가 이루어진다. 이러한 과정에서 하이드로젤의 채널 크기가 대식세포의 분극화에 영향을 미치는지 하이드로젤 이식 후 14일 차에 확인하였다.
확인 결과, 항원 제시 T 세포 마커인 CD3 및 단핵세포/대식세포 마커인 CD68과 CD31의 발현 수준이 다른 실험군과 비교하여 마이크로채널 하이드로젤 실험군에서 높은 것으로 나타나, 염증성 세포가 마이크로채널 하이드로젤에 더 많이 침투되는 것을 알 수 있었다(도 16의 a).
이식된 하이드로젤에서 염증세포의 침윤을 실시간으로 추적하는 것은 불가능하기 때문에, 비보트랙-680(Vivotrack-680)으로 표지된 RAW264.7 마우스 단핵세포를 채널 네트워크 하이드로젤 이식 수술 후 3일차에 마우스의 꼬리 정맥에 주사하고, 세포 주입 24시간 후 IVIS 이미징을 수행하였다. 이미징 결과, 단핵세포는 식염수 관류군 및 하이드로젤 비실험군과 비교하여 채널 네트워크 하이드로젤 실험군, 특히 매크로채널 실험군에서 하이드로젤에 현저하게 많이 침투하는 것을 확인할 수 있었다(하이드로젤 비실험군 데이터는 포함하지 않음)(도 16의 b).
주입된 RAW264.7 세포의 대부분은 주변 조직 부위보다 채널 네트워크 하이드로젤 이식 부위로 침투하였다. 이식한 하이드로젤 주위에서 채취한 조직의 H&E 조직학 및 CD68 면역 염색을 통해 정상군 및 식염수 관류군과 비교하여 채널 네트워크 하이드로젤 실험군에서 더 많은 대식세포를 확인할 수 있었다(도 17).
또한, 이식 후 14일차에 이식 부위에서 대식세포의 공격적 M1 및 전-혈관형성(pro-angiogenic) M2로의 분극화를 확인하였다. 확인 결과, 대식세포의 M2 분극화는 M1 분극화 패턴과 달리, 매크로채널 하이드로젤 실험군과 비교하여 마이크로채널 하이드로젤 실험군에서 더 우세하였으며, 이는 마이크로채널 하이드로젤이 상처 회복 기작에서 M2 분극화를 촉진할 수 있음을 의미한다(도 18).
또한, 체외에서 대식세포의 채널-크기 의존적 분극화를 확인하기 위해 RAW264.7 세포에 리포폴리사카라이드(LPS)를 처리하여 M1으로 활성화시키고, 활성화된 대식세포를 배지를 관류시키면서 4일 동안 매크로채널 하이드로젤 또는 마이크로채널 하이드로젤에서 배양하였다. 그 결과, 매크로채널 하이드로젤 실험군에서는 부착형 스핀들 세포 형태가 우세한 반면, 마이크로채널 하이드로젤 실험군에서는 원형의 단핵세포-유사 형태가 지배적인 것을 확인할 수 있었다(도 19). 이는 하이드로젤의 마이크로채널이 LPS-유도성 대식세포 활성화를 억제하는 것을 의미한다.
상기 결과는 M2 마커 유전자의 발현 수준에 의해 뒷받침되었다. M2 마커인 IL-10, Arg-1, CD163 및 CD206의 유전자 발현은 매크로채널 하이드로젤 실험군보다 마이크로채널 하이드로젤 실험군에서 유의하게 더 높았고, M1 마커인 IL-1β, IL-6, TNF-α, CD80 및 NOS2의 발현 경향은 M2 마커와 반대로 나타났다(도 20).
4. 내피세포의 침윤 및 내성장(ingrowth)
CD31+ 세포 침윤 및 대식세포의 M2로의 분극화가 마이크로채널 하이드로젤 실험군에서 지배적이기 때문에(도 18), 내피세포(endothelial cell; 이하, EC로 기재함)의 변화를 확인하였다.
확인 결과, EC 마커인 KDR 및 vWF(von Willebrand Factor), 혈관 평활근 세포 마커인 αSMA(α-smooth muscle actin)의 발현 수준이 매크로채널 하이드로젤 실험군보다 마이크로채널 하이드로젤 실험군에서 유의하게 높은 것을 알 수 있었다(도 21). 이러한 결과는 채널의 직경에 따라 혈관 세포의 침윤이 유도될 수 있고, 특히 마이크로채널에 혈관 세포의 침윤이 잘 일어남을 의미한다.
반면, EPC(endothelial progenitor cell) 마커인 CD34의 유전자 발현 수준은 매크로채널 하이드로젤과 마이크로채널 하이드로젤 사이에서 유의미한 차이가 나타나지 않았기 때문에, EPC는 마이크로채널 효과에서 유의미한 역할을 하지 않음을 알 수 있었다. 골격근 마커 MyoG의 유전자 발현 수준은 마이크로채널 하이드로젤 실험군보다 매크로채널 하이드로젤 실험군에서 더 높았으며, 이는 채널 크기의 증가로 인해 골격근이 침습한 것을 나타낸다(도 21).
이러한 결과는 하지 허혈 마우스 및 돼지 모델 실험 결과를 통해 추가로 확인하였다. 그 결과, 매크로채널 하이드로젤 실험군과 비교하여 마이크로채널 하이드로젤 실험군에 혈액 세포가 더 많이 존재하고(도 22 및 도 23), 혈액 확산 또한 마이크로채널 하이드로젤 실험군에서 증가하는 것을 확인할 수 있었다(도 13 및 23, 디지털 이미지). 또한, 기능성 EC(렉틴+)는 채널 직경이 좁을수록 더 많이 존재하여 매크로채널 하이드로젤 실험군과 비교하여 마이크로채널 하이드로젤 실험군에 현저하게 많이 침윤되는 것을 알 수 있었다(도 24).
마이크로채널-유도성 EC 침윤은 CD31 면역 염색 및 시험관내 내피화 (endothelialization)로 추가로 확인하였다. 확인 결과, 매크로채널 하이드로젤 실험군과 비교하여 마이크로채널 하이드로젤 실험군에서 CD31의 발현 수준이 높은 것을 알 수 있었다(도 25). 또한, GFP-HUVECs을 배지 관류 하에 마이크로채널 하이드로젤 내에서 배양한 결과, 다른 실험군과 비교하여 마이크로채널 하이드로젤 실험군에서 EC 선형화(lining), 밀착 연접(tight junction) 및 모세관-유사 발아가 더 효율적으로 일어나는 것을 확인할 수 있었다(도 26).
상기 도 16 내지 도 26의 결과로부터 본 발명의 마이크로채널 하이드로젤이 EC의 침윤 및 M2 대식세포 분극화를 촉발하여 숙수 혈관과 마이크로채널 하이드로젤 사이의 혈관 문합을 유도할 수 있음을 확인하였다.
5. 기타 생체 실험
인접한 숙주 혈관 구조가 존재하는 다른 허혈성 손상 모델에 마이크로채널 하이드로젤을 적용할 수 있는지 여부를 확인하기 위해, 상처 치료 마우스 모델에 이식하였다.
마이크로채널 하이드로젤 이식 14일 후에 상처 면적을 확인한 결과, 하지 허혈 모델에서 입증된 바와 같이, 인접한 혈관이 이식한 하이드로젤 쪽으로 자라서 마이크로채널 하이드로젤과 문합을 형성할 수 있었다. 또한, 마이크로채널 하이드로젤을 이식한 경우 비처리군(No treat) 및 비채널 하이드로젤 실험군과 비교하여 상처 봉합 과정이 가속화되는 것을 알 수 있었다(도 27 및 도 28).
상기 결과는 조직 염색 실험으로 추가로 확인하였다. 그 결과, 비처리군 및 비채널 하이드로젤 실험군과 비교하여 하이드로젤 실험군 및 정상군에서 조직 형성이 더 많이 되고(H&E), 콜라겐 함량이 더 풍부하며(마송 트리크롬 염색), 표피 형성이 촉진되고, CD31+ 세포 침윤 또한 더 많은 것을 확인할 수 있었다(도 29).
하지 허혈 및 상처 치료 모델 모두 숙주 혈관이 손상된 조직 근처에 풍부하게 존재하지만 산소 공급은 불충분한 것을 고려하여, 조건이 다른 3개의 생체 내 모델 (대장막(great omentum), 정상 하지 및 피하 조직)을 사용하여 허혈 상태 및 주변 혈관의 기계적 역할을 확인하였다. 상기 세 모델은 허혈 상태는 아니지만, 인접한 혈관의 수는 풍부(대장막), 중간(정상 사지) 및 열악(피하 조직) 수준으로 감소한다.
확인 결과, 숙주 혈관으로부터 이식된 하이드로젤로의 관류는 마이크로채널 하이드로젤 실험군에서 가장 효과적이고, CD31+ 세포 집단 또한 마이크로채널 하이드로젤 실험군에서 가장 풍부한 것을 알 수 있었다. 그러나 마이크로채널 하이드로젤 실험군의 이러한 특성은 대장막 모델에서 정상 사지 및 피하 모델로 갈수록 현저하게 감소하였고, 심지어 대장막 모델에서는 마이크로채널 하이드로젤 실험군의 하기 특성이 하지 모델보다 낮은 것으로 나타났다(도 30).
상기 결과는 H&E 이미지(도 31의 a), 마이크로채널 하이드로젤 실험군의 비교 이미지에서 추가로 확인할 수 있었다. 다른 실험군과 비교하여 마이크로채널 하이드로젤 실험군에서는 조직 내성장 및 혈액 세포 침윤 정도, CD31+ 세포 침윤 수준이 현저히 우수하였다(도 31의 b 및 c). 상기 대장막, 정상 사지 및 피하 모델에서, 비채널 하이드로젤 실험군 및 매크로채널 하이드로젤 실험군은 CD 31+ 세포가 거의 또는 전혀 없는 것으로 나타났다(도 32).
이러한 결과들은 마이크로채널 효과를 유도하는데 있어 허혈 상태 및 주변 혈관이 기계적인 역할을 하는 것을 나타낸다.

Claims (12)

  1. 생체적합성 고분자로 이루어진 하이드로젤; 및
    상기 하이드로젤 내부에 형성되고, 유체가 관류하는 복수개의 마이크로채널을 포함하며,
    상기 복수개의 마이크로채널은 서로 연결되어 3차원 네트워크를 형성하고, 각각의 마이크로채널은 3차원 방향으로 200 ㎛ 이내에 존재하는 하이드로젤 구조체.
  2. 제1항에 있어서, 상기 생체적합성 고분자는 젤라틴, 알지네이트, 폴리에틸렌글리콜, 폴리디메틸실록산, 콜라겐, 키틴, 키토산, 케라틴, 셀룰로스, 피브로넥틴, 엘라스틴, 피브리노겐, 피브로모듈린, 라미닌, 테나신(tenacin), 비트로넥틴, 히알루론산, 헤파린, 콜라겐, 젤라틴, 콘드로이틴황산, 펙틴, 실크 프로테인, 실크 피브로인 및 그들의 유도체, 아가로스, 폴리락틱산, 폴리글리콜산, 폴리락틱산과 폴리글리콜산의 공중합체(PLGA), 폴리카프로락톤, 폴리(폴리(에틸렌옥사이드)테레프탈레이트-co-부틸렌테레프탈레이트, 폴리포스포에스터, 폴리포스파젠, 폴리안하이드라이드, 폴리오르쏘에스터 (및 폴리(프로필렌푸마레이트) 디아크릴레이트로 이루어진 군에서 선택되는 것인, 하이드로젤 구조체.
  3. 제1항에 있어서, 상기 하이드로젤은 1000 내지 3000 Pa의 탄성 계수를 갖는 것인, 하이드로젤 구조체.
  4. 제1항에 있어서, 상기 마이크로채널은 5 내지 50 ㎛ 직경인 것인, 하이드로젤 구조체.
  5. 제1항에 있어서, 상기 하이드로젤 구조체는 마이크로채널과 연결되어 유체가 관류하는 유입 채널 및 유출 채널을 추가로 포함하는 것인, 하이드로젤 구조체.
  6. 제1항에 따른 하이드로젤 구조체; 및
    상기 하이드로젤 구조체에 봉입된 이식용 목적 물질을 포함하는 생체내 이식용 조성물.
  7. 제6항에 있어서, 상기 이식용 목적 물질은 세포, 스페로이드, 오가노이드, 생체에서 분리된 조직, 단백질, 핵산, 펩티드, 지질, 나노입자, 약물 및 화합물로 이루어진 군에서 선택되는 것인, 생체내 이식용 조성물.
  8. (a) 3차원 섬유 다발을 포함하는 틀에 하이드로젤 용액을 공급하는 단계;
    (b) 상기 하이드로젤 용액을 가교시키는 단계; 및
    (c) 가교된 하이드로젤에서 3차원 섬유 다발을 제거하는 단계를 포함하는 제1항에 따른 하이드로젤 구조체의 제작 방법.
  9. 제8항에 있어서, 상기 3차원 섬유 다발은 5 내지 50 ㎛ 직경인 것인, 제1항에 따른 하이드로젤 구조체의 제작 방법.
  10. 제8항에 있어서, 상기 3차원 섬유 다발은 자극 감응성 고분자로 이루어진 것인, 제1항에 따른 하이드로젤 구조체의 제작 방법.
  11. 제10항에 있어서, 상기 자극 감응성 고분자는 에틸렌- co-비닐 아세테이트, 에틸렌- co-비닐 알코올, 폴리(2-하이드록시에틸 메타크릴레이트), 키토산-폴리(에틸렌 옥사이드), 폴리(아크릴산)-폴리(에틸렌 옥사이드), 폴리(2-하이드록시에틸 메타크릴레이트), 폴리(아크릴아미드- co-말레산), 폴리(N-이소프로필아크릴아미드), 폴리-N-비닐카프로락탐, 폴리메타크릴산, 하이드록시프로필셀룰로오스, 폴리비닐메틸에테르, 폴리(2-하이드로메타크릴산), 폴리(N-이소프로필아크릴아미드), 폴리(N,N-디에틸아크릴아미드), 폴리(N-디에틸메타크릴아미드), 폴리(메틸비닐에테르), 폴리(2-에톡시에틸비닐에테르), 폴리(N-비닐카프로락탐), 폴리(N-비닐이소부틸아민), 폴리(N-비닐-n-부틸아민) 및 폴리푸마르산으로 이루어진 군으로부터 선택되는 것인, 제1항에 따른 하이드로젤 구조체의 제작 방법.
  12. 제9항에 있어서, 상기 단계 (c)는 3차원 섬유 다발을 졸(sol)화시켜 이루어지는 것인, 제1항에 따른 하이드로젤 구조체의 제작 방법.
PCT/KR2020/004210 2019-03-28 2020-03-27 마이크로채널 네트워크가 형성된 하이드로젤 구조체 WO2020197323A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2019-0036000 2019-03-28
KR20190036000 2019-03-28

Publications (1)

Publication Number Publication Date
WO2020197323A1 true WO2020197323A1 (ko) 2020-10-01

Family

ID=72610677

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2020/004210 WO2020197323A1 (ko) 2019-03-28 2020-03-27 마이크로채널 네트워크가 형성된 하이드로젤 구조체

Country Status (2)

Country Link
KR (1) KR20200115342A (ko)
WO (1) WO2020197323A1 (ko)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113018511A (zh) * 2021-02-25 2021-06-25 淮阴工学院 一种矿化纤维增强三维多孔支架及其制备方法与应用
CN115569237A (zh) * 2022-10-19 2023-01-06 上海交通大学医学院附属第九人民医院 一种血管网络生物支架及其制备方法、用途

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2023096371A1 (ko) * 2021-11-24 2023-06-01 연세대학교 산학협력단 종양 조직 배양용 종양 조직 모델
KR20240025813A (ko) 2022-08-19 2024-02-27 서울대학교산학협력단 인공 잎 구조체

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20140142278A (ko) * 2012-03-06 2014-12-11 더 유에이비 리서치 파운데이션 삼차원, 예비맥관화, 조작 조직 구조체, 조직 구조체의 제조 방법 및 사용 방법
KR20160028592A (ko) * 2014-09-03 2016-03-14 한국원자력연구원 인간 중간엽 줄기 세포의 3차원적 공간 부착 및 골분화를 돕는 섬유상 입자가 도입된 알지네이트 하이드로젤
KR20180018000A (ko) * 2016-08-12 2018-02-21 연세대학교 산학협력단 주사 가능한 3차원 나노섬유 스캐폴드 및 이의 제조방법
KR20180027398A (ko) * 2017-12-14 2018-03-14 연세대학교 산학협력단 3차원 스페로이드 배양을 통한 기능 강화 선조직 유래 선줄기세포의 분리 방법

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20140142278A (ko) * 2012-03-06 2014-12-11 더 유에이비 리서치 파운데이션 삼차원, 예비맥관화, 조작 조직 구조체, 조직 구조체의 제조 방법 및 사용 방법
KR20160028592A (ko) * 2014-09-03 2016-03-14 한국원자력연구원 인간 중간엽 줄기 세포의 3차원적 공간 부착 및 골분화를 돕는 섬유상 입자가 도입된 알지네이트 하이드로젤
KR20180018000A (ko) * 2016-08-12 2018-02-21 연세대학교 산학협력단 주사 가능한 3차원 나노섬유 스캐폴드 및 이의 제조방법
KR20180027398A (ko) * 2017-12-14 2018-03-14 연세대학교 산학협력단 3차원 스페로이드 배양을 통한 기능 강화 선조직 유래 선줄기세포의 분리 방법

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
GUTEKUNST, S. B. ET AL.: "3D Hydrogels Containing Interconnected Microchannels of Subcellular Size for Capturing Human Pathogenic Acanthamoeba Castellanii", ACS BIOMATERIALS SCIENCE & ENGINEERING 2019, vol. 5, no. 4, 10 January 2019 (2019-01-10), pages 1784 - 1792, XP055743506 *
LEE J. B. ET AL.: "Microchannel network hydrogel induced ischemicblood perfusion connection", NATURE COMMUNICATIONS 2020(ELECTRONIC PUBLICATION, vol. 11, no. 615, 30 January 2020 (2020-01-30), pages 1 - 14, Retrieved from the Internet <URL:https:/7doi.org/10.1038/s41467-020-14480-0> *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113018511A (zh) * 2021-02-25 2021-06-25 淮阴工学院 一种矿化纤维增强三维多孔支架及其制备方法与应用
CN113018511B (zh) * 2021-02-25 2022-05-17 淮阴工学院 一种矿化纤维增强三维多孔支架及其制备方法与应用
CN115569237A (zh) * 2022-10-19 2023-01-06 上海交通大学医学院附属第九人民医院 一种血管网络生物支架及其制备方法、用途
CN115569237B (zh) * 2022-10-19 2024-04-19 上海交通大学医学院附属第九人民医院 一种血管网络生物支架及其制备方法、用途

Also Published As

Publication number Publication date
KR20200115342A (ko) 2020-10-07

Similar Documents

Publication Publication Date Title
WO2020197323A1 (ko) 마이크로채널 네트워크가 형성된 하이드로젤 구조체
Wei et al. A self-healing hydrogel as an injectable instructive carrier for cellular morphogenesis
Zhu et al. Injectable conductive gelatin methacrylate/oxidized dextran hydrogel encapsulating umbilical cord mesenchymal stem cells for myocardial infarction treatment
Moulisová et al. Engineered microenvironments for synergistic VEGF–Integrin signalling during vascularization
Kim et al. Injectable multifunctional microgel encapsulating outgrowth endothelial cells and growth factors for enhanced neovascularization
Mishra et al. Effect of prevascularization on in vivo vascularization of poly (propylene fumarate)/fibrin scaffolds
Lai et al. Tailored design of electrospun composite nanofibers with staged release of multiple angiogenic growth factors for chronic wound healing
Bian et al. Evaluation of poly (3-hydroxybutyrate-co-3-hydroxyhexanoate) conduits for peripheral nerve regeneration
Lee et al. Microchannel network hydrogel induced ischemic blood perfusion connection
US6380154B1 (en) Synthetic proteins for in vivo drug delivery and tissue augmentation
Cai et al. Capturing dynamic biological signals via bio-mimicking hydrogel for precise remodeling of soft tissue
Xu et al. Living microneedle patch with adipose‐derived stem cells embedding for diabetic ulcer healing
Zhou et al. Coadministration of platelet-derived growth factor-BB and vascular endothelial growth factor with bladder acellular matrix enhances smooth muscle regeneration and vascularization for bladder augmentation in a rabbit model
Lee et al. Self-aligned myofibers in 3D bioprinted extracellular matrix-based construct accelerate skeletal muscle function restoration
US20110293722A1 (en) Hydrogel sponges, methods of producing them and uses thereof
Kobayashi et al. Orthogonally oriented scaffolds with aligned fibers for engineering intestinal smooth muscle
Torres et al. Microvascular engineering: dynamic changes in microgel-entrapped vascular cells correlates with higher vasculogenic/angiogenic potential
Steiner et al. Enhanced vascularization and de novo tissue formation in hydrogels made of engineered RGD-tagged spider silk proteins in the arteriovenous loop model
Kollmar et al. Experimental liver metastasis: standards for local cell implantation to study isolated tumor growth in mice
Shi et al. Adaptive gelatin microspheres enhanced stem cell delivery and integration with diabetic wounds to activate skin tissue regeneration
Zhang et al. Wound dressing gel with resisted bacterial penetration and enhanced re-epithelization for corneal epithelial-stromal regeneration
Chen et al. Bladder acellular matrix conjugated with basic fibroblast growth factor for bladder regeneration
JP2021185153A (ja) 核酸ベースの治療法の標的送達の組成物
WO2023221152A1 (zh) 具有心脏损伤修复功能的智能水凝胶及其制备方法和应用
Zhang et al. Conductive hydrogels with hierarchical biofilm inhibition capability accelerate diabetic ulcer healing

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20778849

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 20778849

Country of ref document: EP

Kind code of ref document: A1