WO2020176553A1 - Thérapie ciblant une mutation intracellulaire - Google Patents

Thérapie ciblant une mutation intracellulaire Download PDF

Info

Publication number
WO2020176553A1
WO2020176553A1 PCT/US2020/019767 US2020019767W WO2020176553A1 WO 2020176553 A1 WO2020176553 A1 WO 2020176553A1 US 2020019767 W US2020019767 W US 2020019767W WO 2020176553 A1 WO2020176553 A1 WO 2020176553A1
Authority
WO
WIPO (PCT)
Prior art keywords
fold
domain
nucleic acid
fusion polypeptide
inactive
Prior art date
Application number
PCT/US2020/019767
Other languages
English (en)
Inventor
Lee Lisheng Huang
Anthony WANG
Hainan CHEN
Basil P. Hubbard
Original Assignee
Sense Therapeutics Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Sense Therapeutics Inc. filed Critical Sense Therapeutics Inc.
Publication of WO2020176553A1 publication Critical patent/WO2020176553A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4702—Regulators; Modulating activity
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22—Ribonucleases RNAses, DNAses
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/55—Fusion polypeptide containing a fusion with a toxin, e.g. diphteria toxin
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/80—Fusion polypeptide containing a DNA binding domain, e.g. Lacl or Tet-repressor

Definitions

  • Targeting specific cells for therapeutic purposes presents an ongoing challenge. For example, targeting and inducing cell death in cancer cells can lead to unintended cell death of the non-cancerous cells due to non-specific binding of therapeutic agents such as antibodies or non specific treatment options such as chemotherapy and radiation.
  • therapeutic agents such as antibodies or non specific treatment options such as chemotherapy and radiation.
  • compositions, systems, and methods to target only specific cells for treatment purposes there remains a considerable need for compositions, systems, and methods to target only specific cells for treatment purposes.
  • compositions, systems, and methods to target specific cells carrying mutations associated with a disorder are provided herein.
  • compositions, systems, and methods to detect nucleic acid mutations and to deliver therapeutics to only the cells harboring these nucleic acid mutations in order to treat a disease or a disorder In some instances, the compositions, systems, and methods described herein aim to treat or reduce conditions related to cancer by targeting only the cancerous cells harboring nucleic acid mutations associated with cancer.
  • a therapeutic composition comprising: a first fusion polypeptide or a polynucleotide encoding the first fusion polypeptide, wherein the first fusion polypeptide comprises a first genetic sequence binding domain and a first inactive effector domain, wherein the first fusion polypeptide binds to a first genetic sequence comprising a mutation; a second fusion polypeptide or a polynucleotide encoding the second fusion polypeptide, wherein the second fusion polypeptide comprises a second genetic sequence binding domain and a second inactive effector domain, wherein the second fusion polypeptide binds to a second genetic sequence that is upstream of the first genetic sequence; and a third fusion polypeptide or a polynucleotide encoding the third fusion polypeptide, wherein the third fusion polypeptide comprises a third genetic sequence binding domain and a third inactive effector domain, wherein the third fusion polypeptide bind
  • the first genetic sequence, the second genetic sequence, or the third genetic sequence is a polynucleotide sequence.
  • the polynucleotide sequence comprises a DNA sequence.
  • the polynucleotide sequence comprises an RNA sequence.
  • the first genetic sequence, the second genetic sequence, or the third genetic sequence is a polypeptide sequence.
  • the polypeptide sequence comprises an antigen.
  • the polypeptide sequence comprises a neoantigen.
  • the first genetic sequence comprises a neoantigen.
  • the mutation is associated with a disorder.
  • the disorder is a cancer.
  • the mutation is a driver mutation.
  • the driver mutation is associated with a disorder.
  • the disorder is a cancer.
  • the first inactive effector domain, the second inactive effector domain, or the third inactive effector domain each independently comprises split portions of the one or more active effector domains.
  • the first inactive effector domain, the second inactive effector domain, or the third inactive effector domain each independently comprises a monomeric portion of a multimeric protein.
  • the one or more active effector domain is the multimeric protein.
  • the one or more active effector domain comprises caspase 1.
  • the first inactive effector domain, the second inactive effector domain, or the third inactive effector domain each independently comprise a pro-caspase 1.
  • the one or more active effector domains comprise a cytotoxic domain.
  • the cytotoxic domains comprise a pro- caspase, a toxin, a pro-drug, or a pro-apoptotic protein. In some embodiments, the cytotoxic domains comprise caspase 1. In some embodiments, the first genetic sequence binding domain, the second genetic sequence binding domain, or the third genetic sequence binding domain each independently comprises an antibody.
  • the first genetic sequence binding domain, the second genetic sequence binding domain, or the third genetic sequence binding domain is selected from the group consisting of: a CRISPR-Cas protein, a zinc finger protein, a transcription activator-like effectors (TALE) protein, a homing endonuclease, meganuclease, PUF, CIRTS, SNAP -tag, and l phage RNA binding protein.
  • the first genetic sequence binding domain, the second genetic sequence binding domain, or the third genetic sequence binding domain comprises a CRISPR-Cas protein.
  • the CRISPR-Cas protein is a catalytically-inactive Cas9 or a fragment thereof.
  • the CRISPR-Cas protein is a catalytically-inactive Casl3 or a fragment thereof. In some embodiments, the CRISPR-Cas protein is a catalytically-inactive Casl3d or a fragment thereof. In some embodiments, the one or more active effector domains induces an immunogenic cell death. In some embodiments, the one or more active effector domains induces an immune response in a subject. In some embodiments, the therapeutic composition comprises greater on- target specificity for targeting cancer cells than a composition comprising only two fusion polypeptides, each independently comprising a genetic sequence binding domain and an inactive effector domain.
  • the therapeutic composition comprises lower off-target rate for targeting non-cancer cells than a composition comprising only two fusion polypeptides, each independently comprising a genetic sequence binding domain and an inactive effector domain. In some embodiments, the therapeutic composition comprises one or more additional fusion polypeptides, each independent comprising a genetic sequence binding domain and an inactive effector domain.
  • a therapeutic system comprising: a first fusion polypeptide or a polynucleotide encoding the first fusion polypeptide, wherein the first fusion polypeptide comprises a first genetic sequence binding domain and a first inactive effector domain, wherein the first fusion polypeptide binds to a first genetic sequence comprising a mutation; a second fusion polypeptide or a polynucleotide encoding the second fusion polypeptide, wherein the second fusion polypeptide comprises a second genetic sequence binding domain and a second inactive effector domain, wherein the second fusion polypeptide binds to a second genetic sequence that is upstream of the first genetic sequence; and a third fusion polypeptide or a polynucleotide encoding the third fusion polypeptide, wherein the third fusion polypeptide comprises a third genetic sequence binding domain and a third inactive effector domain, wherein the third fusion polypeptide binds
  • the first genetic sequence, the second genetic sequence, or the third genetic sequence is a polynucleotide sequence.
  • the polynucleotide sequence comprises a DNA sequence.
  • the polynucleotide sequence comprises a RNA sequence.
  • the first genetic sequence, the second genetic sequence, or the third genetic sequence is a polypeptide sequence.
  • the polypeptide sequence comprises an antigen.
  • the polypeptide sequence comprises a neoantigen.
  • the mutation is associated with a disorder.
  • the disorder is a cancer.
  • the mutation is a driver mutation.
  • the driver mutation is associated with a disorder.
  • the disorder is a cancer.
  • the first inactive effector domain, the second inactive effector domain, or the third inactive effector domain each independently comprises a split portion of the one or more active effector domains.
  • the one or more active effector domains comprise cytotoxic domains.
  • the cytotoxic domains comprise a pro- caspase, a toxin, a pro-drug, or a pro-apoptotic protein.
  • the cytotoxic domains comprise caspase 1.
  • the first genetic sequence binding domain, the second genetic sequence binding domain, or the third genetic sequence binding domain each independently comprises an antibody.
  • the first genetic sequence binding domain, the second genetic sequence binding domain, or the third genetic sequence binding domain is selected from the group consisting of: a CRISPR-Cas protein, a zinc finger protein, a transcription activator-like effectors (TALE) protein, a homing endonuclease, meganuclease, PUF, CIRTS, SNAP -tag, and l phage RNA binding protein.
  • the first genetic sequence binding domain, the second genetic sequence binding domain, or the third genetic sequence binding domain comprises a CRISPR-Cas protein.
  • the CRISPR-Cas protein is a catalytically-inactive Cas9 or a fragment thereof.
  • the CRISPR-Cas protein is a catalytically-inactive Casl3 or a fragment thereof. In some embodiments, the CRISPR-Cas protein is a catalytically-inactive Casl3d or a fragment thereof. In some embodiments, the one or more active effector domains induces immunogenic cell death. In some embodiments, the first genetic sequence comprises a neoantigen. In some embodiments, the first inactive effector domain, the second inactive effector domain, or the third inactive effector domain each independently comprises a monomeric portion of a multimeric protein. In some embodiments, the one or more active effector domain is the multimeric protein. In some embodiments, the one or more active effector domain comprises caspase 1.
  • the first inactive effector domain, the second inactive effector domain, or the third inactive effector domain each independently comprise a pro-caspase 1.
  • the one or more active effector domains induces an immune response in a subject.
  • the therapeutic system comprises greater on-target specificity for targeting cancer cells than a system comprising only two fusion polypeptides, each independently comprising a genetic sequence binding domain and an inactive effector domain.
  • the therapeutic system comprises lower off-target rate for targeting non-cancer cells than a system comprising only two fusion polypeptides, each independently comprising a genetic sequence binding domain and an inactive effector domain.
  • the therapeutic system comprises one or more additional fusion polypeptides, each independent comprising a genetic sequence binding domain and an inactive effector domain.
  • a method of treating a disorder in a subject comprising: delivering to a cell: a first fusion polypeptide or a polynucleotide encoding the first fusion polypeptide, wherein the first fusion polypeptide comprises a first genetic sequence binding domain and a first inactive effector domain, wherein the first fusion polypeptide binds to a first genetic sequence comprising a mutation; a second fusion polypeptide or a polynucleotide encoding the second fusion polypeptide, wherein the second fusion polypeptide comprises a second genetic sequence binding domain and a second inactive effector domain, wherein the second fusion polypeptide binds to a second genetic sequence that is upstream of a 5’ end of the first genetic sequence; and a third fusion polypeptide or a
  • the third fusion polypeptide comprises a third genetic sequence binding domain and a third inactive effector domain, wherein the third fusion polypeptide binds to a third genetic sequence that is downstream of a 3’ end of the first genetic sequence, wherein binding of the first fusion polypeptide to the first genetic sequence and binding of the second fusion polypeptide to the second genetic sequence brings the first inactive effector domain and the second inactive effector domain in proximity; wherein binding of the first fusion polypeptide to the first genetic sequence and binding of the third fusion polypeptide to the third genetic sequence brings the first inactive effector domain and the third inactive effector domain in proximity; wherein proximity of the first inactive effector domain and the second inactive effector domain or the first inactive effector domain and the third inactive effector domain generates one or more active effector domains.
  • the first genetic sequence, the second genetic sequence, or the third genetic sequence is a polynucleotide sequence.
  • the polynucleotide sequence comprises a DNA sequence.
  • the polynucleotide sequence comprises a RNA sequence.
  • the first genetic sequence, the second genetic sequence, or the third genetic sequence is a polypeptide sequence.
  • the polypeptide sequence comprises an antigen.
  • the polypeptide sequence comprises a neoantigen.
  • the mutation is associated with a disorder.
  • the disorder is a cancer.
  • the mutation is a driver mutation.
  • the driver mutation is associated with a disorder.
  • the disorder is a cancer.
  • the first inactive effector domain, the second inactive effector domain, or the third inactive effector domain each independently comprise a split portion of the one or more active effector domains.
  • the one or more active effector domains comprise cytotoxic domains.
  • the cytotoxic domains comprise a pro- caspase, a toxin, a pro-drug, or a pro-apoptotic protein.
  • the cytotoxic domains comprise caspase 1.
  • the first genetic sequence binding domain, the second genetic sequence binding domain, or the third genetic sequence binding domain each independently comprises an antibody.
  • the first genetic sequence binding domain, the second genetic sequence binding domain, or the third genetic sequence binding domain is selected from the group consisting of: a CRISPR-Cas protein, a zinc finger protein, a transcription activator-like effectors (TALE) protein, a homing endonuclease, meganuclease, PUF, CIRTS, SNAP -tag, and l phage RNA binding protein.
  • the first genetic sequence binding domain, the second genetic sequence binding domain, or the third genetic sequence binding domain comprises a CRISPR-Cas protein.
  • the CRISPR-Cas protein is a catalytically-inactive Cas9 or a fragment thereof.
  • the CRISPR-Cas protein is a catalytically-inactive Casl3 or a fragment thereof. In some embodiments, the CRISPR-Cas protein is a catalytically-inactive Casl3d or a fragment thereof. In some embodiments, the one or more active effector domains induces cell death. In some embodiments, the one or more active effector domains induces an immunogenic cell death. In some embodiments, the first genetic sequence comprises a neoantigen. In some embodiments, the first inactive effector domain, the second inactive effector domain, or the third inactive effector domain each independently comprises a monomeric portion of a multimeric protein. In some embodiments, the one or more active effector domain is the multimeric protein. In some embodiments, the one or more active effector domain comprises caspase 1. In some
  • the first inactive effector domain, the second inactive effector domain, or the third inactive effector domain each independently comprise a pro-caspase 1.
  • the one or more active effector domains induces an immune response in a subject.
  • the therapeutic composition comprises greater on-target specificity for targeting cancer cells than a method comprising contacting the cell with only two fusion polypeptides, each independently comprising a genetic sequence binding domain and an inactive effector domain.
  • the therapeutic composition comprises lower off-target rate for targeting non-cancer cells than a method comprising contacting the cell with only two fusion polypeptides, each independently comprising a genetic sequence binding domain and an inactive effector domain.
  • compositions for inducing cell death comprising: a first fusion polypeptide or a polynucleotide encoding the first fusion polypeptide, wherein the first fusion polypeptide comprises a first nucleic acid binding domain and a first inactive cytotoxic domain, wherein the first fusion polypeptide binds to a first nucleic acid sequence on a target polynucleotide; a second fusion polypeptide or a polynucleotide encoding the second fusion polypeptide, wherein the second fusion polypeptide comprises a second nucleic acid binding domain and a second inactive cytotoxic domain, wherein the second fusion polypeptide binds to a second nucleic acid sequence on the target polynucleotide; and a third fusion polypeptide or a polynucleotide encoding the third fusion polypeptide, wherein the third fusion polypeptide comprises a
  • the composition comprises at least about 5% greater efficiency for inducing cell death relative to a composition that comprises two fusion polypeptides, wherein each of the two fusion polypeptides comprises a nucleic acid binding domain and an inactive cytotoxic domain.
  • the first nucleic acid sequence is a mutant nucleic acid sequence associated with a disorder.
  • the disorder is a cancer.
  • the cancer is a brain tumor, a pancreatic cancer, or a triple negative breast cancer.
  • the first nucleic acid sequence comprises a driver mutation associated with a cancer.
  • the second nucleic acid sequence is a wild-type sequence that does not comprise a mutation associated with a disorder.
  • the third nucleic acid sequence is a wild-type sequence that does not comprise a mutation associated with a disorder.
  • the second nucleic acid sequence is at least 5 nucleotide bases upstream from a 5’ end of the first nucleic acid sequence.
  • the third nucleic acid sequence is at least 5 nucleotide bases downstream from a 3’ end of the first nucleic acid sequence.
  • the first nucleic sequence, the second nucleic acid sequence, or the third nucleic acid sequence comprises a coding sequence.
  • the first nucleic sequence, the second nucleic acid sequence, or the third nucleic acid sequence comprises a non-coding sequence.
  • the composition further comprises one or more additional fusion polypeptides, each of the one or more additional fusion polypeptide comprising a nucleic acid binding domain and an inactive cytotoxic domain.
  • the active cytotoxic domain is selected from the group consisting of a pro- caspase, a toxin, a pro-drug, and a pro-apoptotic protein.
  • the active cytotoxic domain is generated by dimerization of the first inactive cytotoxic domain and the second inactive cytotoxic domain or the first inactive cytotoxic domain and the third inactive cytotoxic domain.
  • the first inactive cytotoxic domain, the second inactive cytotoxic domain, or the third inactive cytotoxic domain each independently comprises split portions of the active cytotoxic domain.
  • the first nucleic acid binding domain, the second nucleic acid binding domain, or the third nucleic acid binding domain are selected from the group consisting of: a CRISPR-Cas protein, a zinc finger protein, a
  • the first nucleic acid binding domain, the second nucleic acid binding domain, and the third nucleic acid binding domain comprise a CRISPR-Cas protein.
  • the CRISPR-Cas protein is a catalytically-inactive Cas9 or a fragment thereof.
  • the CRISPR-Cas protein is a catalytically-inactive Cas9 or a fragment thereof.
  • CRISPR-Cas protein is a catalytically-inactive Casl3 or a fragment thereof.
  • the CRISPR-Cas protein is a catalytically-inactive Casl3d or a fragment thereof.
  • the active cytotoxic domain comprises caspase 1.
  • the first inactive cytotoxic domain, the second inactive cytotoxic domain, or the third inactive cytotoxic domain each independently comprise a pro-caspase 1.
  • the composition comprises greater on-target specificity for targeting cancer cells than a composition comprising only two fusion polypeptides, each independently comprising a genetic sequence binding domain and an inactive cytotoxic domain.
  • the composition comprises lower off-target rate for targeting non-cancer cells than a composition comprising only two fusion polypeptides, each independently comprising a genetic sequence binding domain and an inactive cytotoxic domain.
  • the second nucleic acid sequence comprises a mutation associated with the cancer.
  • the third nucleic acid sequence comprises a mutation associated with the cancer.
  • a system for inducing cell death comprising: a first fusion polypeptide or a polynucleotide encoding the first fusion polypeptide, wherein the first fusion polypeptide comprises a first nucleic acid binding domain and a first inactive cytotoxic domain, wherein the first fusion polypeptide binds to a first nucleic acid sequence on a target polynucleotide; a second fusion polypeptide or a polynucleotide encoding the second fusion polypeptide, wherein the second fusion polypeptide comprises a second nucleic acid binding domain and a second inactive cytotoxic domain, wherein the second fusion polypeptide binds to a second nucleic acid sequence on the target polynucleotide; and a third fusion polypeptide or a polynucleotide encoding the third fusion polypeptide, wherein the third fusion polypeptide comprises
  • the system comprises at least 5% greater efficiency for inducing cell death relative to a system that comprises two fusion polypeptides, wherein each of the two fusion polypeptides comprises a nucleic acid binding domain and an inactive cytotoxic domain.
  • the first nucleic acid sequence is a mutant nucleic acid sequence associated with a disorder.
  • the disorder is a cancer.
  • the first nucleic acid sequence comprises a driver mutation associated with a cancer.
  • the second nucleic acid sequence is a wild-type sequence that does not comprise a mutation associated with the cancer.
  • the third nucleic acid sequence is a wild-type sequence that does not comprise a mutation associated with the cancer.
  • the second nucleic acid sequence is at least 5 nucleotide bases upstream from a 5’ end of the first nucleic acid sequence.
  • the third nucleic acid sequence is at least 5 nucleotide bases downstream from a 3’ end of the first nucleic acid sequence.
  • the first nucleic sequence, the second nucleic acid sequence, or the third nucleic acid sequence comprises a coding sequence.
  • the first nucleic sequence, the second nucleic acid sequence, or the third nucleic acid sequence comprises a non-coding sequence.
  • the system further comprises one or more additional fusion polypeptides, each of the one or more additional fusion polypeptide comprising a nucleic acid binding domain and an inactive cytotoxic domain.
  • the active cytotoxic domain is selected from the group consisting of a pro-caspase, a toxin, a pro-drug, and a pro-apoptotic protein.
  • the active cytotoxic domain is generated by dimerization of the first inactive cytotoxic domain and the second inactive cytotoxic domain or the first inactive cytotoxic domain and the third inactive cytotoxic domain.
  • the first inactive cytotoxic domain, the second inactive cytotoxic domain, or the third inactive cytotoxic domain comprises split portions of the active cytotoxic domain.
  • the first nucleic acid binding domain, the second nucleic acid binding domain, or the third nucleic acid binding domain is selected from the group consisting of: a CRISPR-Cas protein, a zinc finger protein, a transcription activator-like effectors (TALE) protein, a homing endonuclease, meganuclease, PUF, CIRTS, SNAP -tag, and l phage RNA binding protein.
  • TALE transcription activator-like effectors
  • the first nucleic acid binding domain, the second nucleic acid binding domain, and the third nucleic acid binding domain comprise a CRISPR-Cas protein.
  • the CRISPR-Cas protein is a catalytically-inactive Cas9 or a fragment thereof.
  • the CRISPR-Cas protein is a catalytically-inactive Cas9 or a fragment thereof.
  • CRISPR-Cas protein is a catalytically-inactive Casl3 or a fragment thereof.
  • the CRISPR-Cas protein is a catalytically-inactive Casl3d or a fragment thereof.
  • the active cytotoxic domain comprises caspase 1.
  • the first inactive cytotoxic domain, the second inactive cytotoxic domain, or the third inactive cytotoxic domain each independently comprise a pro-caspase 1.
  • the active cytotoxic domain induces an immune response in a subject.
  • the composition comprises greater on-target specificity for targeting cancer cells than a system comprising only two fusion polypeptides, each independently comprising a genetic sequence binding domain and an inactive cytotoxic domain.
  • the composition comprises lower off-target rate for targeting non-cancer cells than a system comprising only two fusion polypeptides, each independently comprising a genetic sequence binding domain and an inactive cytotoxic domain.
  • the second nucleic acid sequence comprises a mutation associated with the cancer.
  • the third nucleic acid sequence comprises a mutation associated with the cancer.
  • a method for treating a subject comprising: contacting a target polynucleotide in a cell with a: a first fusion polypeptide comprising a first nucleic acid binding domain and a first inactive cytotoxic domain, wherein the first fusion polypeptide binds to a first nucleic acid sequence on the target polynucleotide; a second fusion polypeptide comprising a second nucleic acid binding domain and a second inactive cytotoxic domain, wherein the second fusion polypeptide binds to a second nucleic acid sequence on the target polynucleotide; and a third fusion polypeptide comprising a third nucleic acid binding domain and a third inactive cytotoxic domain, wherein the third fusion polypeptide binds to a third nucleic acid sequence on the target polynucleotide, wherein binding of the first fusion polypeptide to the first nucleic acid sequence
  • the method comprises at least 5% greater efficiency for inducing cell death relative to a method that comprises two fusion polypeptides, wherein each of the two fusion polypeptides comprises a nucleic acid binding domain and an inactive cytotoxic domain.
  • the first nucleic acid sequence is a mutant nucleic acid sequence associated with a disorder.
  • the disorder is a cancer.
  • the first nucleic acid sequence comprises a driver mutation associated with a cancer.
  • the second nucleic acid sequence is a wild-type sequence that does not comprise a mutation associated with the cancer.
  • the third nucleic acid sequence is a wild-type sequence that does not comprise a mutation associated with the cancer.
  • the second nucleic acid sequence is at least 5 nucleotide bases upstream from a 5’ end of the first nucleic acid sequence.
  • the third nucleic acid sequence is at least 5 nucleotide bases downstream from a 3’ end of the first nucleic acid sequence.
  • the first nucleic sequence, the second nucleic acid sequence, or the third nucleic acid sequence comprises a coding sequence.
  • the first nucleic sequence, the second nucleic acid sequence, or the third nucleic acid sequence comprises a non-coding sequence.
  • the method further comprises one or more additional fusion polypeptides, each of the one or more additional fusion polypeptide comprising a nucleic acid binding domain and an inactive cytotoxic domain.
  • the active cytotoxic domain is selected from the group consisting of a pro-caspase, a toxin, a pro-drug, and a pro- apoptotic protein. In some embodiments, the active cytotoxic domain is generated by
  • the first inactive cytotoxic domain, the second inactive cytotoxic domain, or the third inactive cytotoxic domain comprises split portions of the active cytotoxic domain.
  • the first nucleic acid binding domain, the second nucleic acid binding domain, or the third nucleic acid binding domain is selected from the group consisting of: a CRISPR-Cas protein, a zinc finger protein, a transcription activator-like effectors (TALE) protein, a homing endonuclease, meganuclease, PUF, CIRTS, SNAP -tag, and l phage RNA binding protein.
  • TALE transcription activator-like effectors
  • the first nucleic acid binding domain, the second nucleic acid binding domain, and the third nucleic acid binding domain comprises a CRISPR-Cas protein.
  • the CRISPR-Cas protein is a catalytically-inactive Cas9 or a fragment thereof.
  • the CRISPR-Cas protein is a catalytically-inactive Cast 3 or a fragment thereof.
  • the CRISPR-Cas protein is a catalytically-inactive Casl3d or a fragment thereof.
  • the active cytotoxic domain comprises caspase 1.
  • the first inactive cytotoxic domain, the second inactive cytotoxic domain, or the third inactive cytotoxic domain each independently comprise a pro-caspase 1.
  • the active cytotoxic domain induces an immune response in a subject.
  • the composition comprises greater on-target specificity for targeting cancer cells than a system comprising only two fusion polypeptides, each independently comprising a genetic sequence binding domain and an inactive cytotoxic domain.
  • the composition comprises lower off-target rate for targeting non-cancer cells than a system comprising only two fusion polypeptides, each independently comprising a genetic sequence binding domain and an inactive cytotoxic domain.
  • the second nucleic acid sequence comprises a mutation associated with the cancer.
  • the third nucleic acid sequence comprises a mutation associated with the cancer.
  • a system for inducing cell death comprising: a first fusion polypeptide or a polynucleotide encoding the first fusion polypeptide, wherein the first fusion polypeptide comprises a first nucleic acid binding domain and a first inactive portion of a toxin, wherein the first fusion polypeptide binds to a first nucleic acid sequence of a target polynucleotide; and a second fusion polypeptide or a polynucleotide encoding the second fusion polypeptide, wherein the second fusion polypeptide comprises a second nucleic acid binding domain and a second inactive portion of the toxin, wherein the second fusion polypeptide binds to a second nucleic acid sequence on the target polynucleotide, wherein proximity of the first inactive portion and the second inactive portion generates the toxin that induces cell death.
  • the first nucleic acid sequence is a mutant nucleic acid sequence associated with a disorder.
  • the disorder is a cancer.
  • the first nucleic acid sequence comprises a driver mutation associated with a cancer.
  • the second nucleic acid sequence is a wild-type sequence that does not comprise a mutation associated with the cancer.
  • the second nucleic acid sequence is at least 5 nucleotide bases upstream from a 5’ end of the first nucleic acid sequence.
  • the second nucleic acid sequence is at least 5 nucleotide bases downstream from a 3’ end of the first nucleic acid sequence.
  • the first nucleic sequence or the second nucleic acid sequence comprises a coding sequence. In some embodiments, the first nucleic sequence or the second nucleic acid sequence comprises a non coding sequence. In some embodiments, the system further comprises one or more additional fusion polypeptides, each of the one or more additional fusion polypeptide comprising a nucleic acid binding domain and an inactive cytotoxic domain.
  • the toxin is selected from the group consisting of Ricin, Abrin, Mistletoe lectin, Modeccin, pokeweed antiviral protein (PAP), Saporin, Bryodinl, Bouganin, Gelonin, Diphtheria toxin (DT),
  • the toxin is generated by dimerization of the first inactive portion of the toxin and the second inactive portion of the toxin.
  • the first inactive portion of the toxin or the second inactive portion of the toxin comprises split portion of the toxin.
  • the first nucleic acid binding domain or the second nucleic acid binding domain is selected from the group consisting of: a CRISPR-Cas protein, a zinc finger protein, a transcription activator-like effectors (TALE) protein, a homing endonuclease, meganuclease, PUF, CIRTS, SNAP -tag, and l phage RNA binding protein.
  • TALE transcription activator-like effectors
  • the first nucleic acid binding domain and the second nucleic acid binding domain comprises a CRISPR-Cas protein.
  • the CRISPR-Cas protein is a catalytically-inactive Cas9 or a fragment thereof. In some embodiments, the CRISPR-Cas protein is a catalytically-inactive Casl3 or a fragment thereof. In some embodiments, the CRISPR-Cas protein is a catalytically-inactive Casl3d or a fragment thereof.
  • a method for inducing cell death comprising: contacting a cell comprising a target polynucleotide comprising a first nucleic acid sequence and a second nucleic acid sequence with: a first fusion polypeptide comprising a first nucleic acid binding domain and a first inactive portion of a toxin, wherein the first fusion polypeptide binds to the first nucleic acid sequence; and a second fusion polypeptide comprising a second nucleic acid binding domain and a second inactive portion of the toxin, wherein the second fusion polypeptide binds to the second nucleic acid sequence, wherein binding of the first fusion polypeptide to the first nucleic acid sequence and the second fusion polypeptide to the second nucleic acid sequence brings the first inactive portion and the second inactive portion in proximity with each other; wherein the proximity results in activation of the toxin in the cell, thereby inducing cell death.
  • the first nucleic acid sequence is a mutant nucleic acid sequence associated with a disorder.
  • the disorder is a cancer.
  • the first nucleic acid sequence comprises a driver mutation associated with a cancer.
  • the second nucleic acid sequence is a wild-type sequence that does not comprise a mutation associated with the cancer.
  • the second nucleic acid sequence is at least 5 nucleotide bases upstream from a 5’ end of the first nucleic acid sequence.
  • the second nucleic acid sequence is at least 5 nucleotide bases downstream from a 3’ end of the first nucleic acid sequence.
  • the first nucleic sequence or the second nucleic acid sequence comprises a coding sequence. In some embodiments, the first nucleic sequence or the second nucleic acid sequence comprises a non coding sequence. In some embodiments, the method further comprises one or more additional fusion polypeptides, each of the one or more additional fusion polypeptide comprising a nucleic acid binding domain and an inactive cytotoxic domain.
  • the toxin is selected from the group consisting of The system of claim 1, wherein the toxin is selected from the group consisting of Ricin, Abrin, Mistletoe lectin, Modeccin, pokeweed antiviral protein (PAP), Saporin, Bryodinl, Bouganin, Gelonin, Diphtheria toxin (DT), Pseudomonas exotoxin (PE), Xytolysin equinatoxin II, CytA-d-endotoxin from the bacterium Bacillus thuringiensis, Alpha-hemolysin(aHL), from S.
  • the toxin is generated by dimerization of the first inactive portion of the toxin and the second inactive portion of the toxin.
  • the first inactive portion of the toxin or the second inactive portion of the toxin comprises split portion of the toxin.
  • the first nucleic acid binding domain or the second nucleic acid binding domain is selected from the group consisting of: a CRISPR- Cas protein, a zinc finger protein, a transcription activator-like effectors (TALE) protein, a homing endonuclease, meganuclease, PUF, CIRTS, SNAP -tag, and l phage RNA binding protein.
  • the first nucleic acid binding domain and the second nucleic acid binding domain comprises a CRISPR-Cas protein.
  • the CRISPR-Cas protein is a catalytically-inactive Cas9 or a fragment thereof.
  • the TALE transcription activator-like effectors
  • CRISPR-Cas protein is a catalytically-inactive Casl3 or a fragment thereof.
  • the CRISPR-Cas protein is a catalytically-inactive Casl3d or a fragment thereof.
  • compositions for inducing cell death comprising: a first fusion polypeptide or a polynucleotide encoding the first fusion polypeptide, wherein the first fusion polypeptide comprises a first nucleic acid binding domain and a transcriptional activator that increases transcription of a target DNA sequence comprising a mutation associated with a disorder; a second fusion polypeptide or a polynucleotide encoding the second fusion polypeptide, wherein the second fusion polypeptide comprises a second nucleic acid binding domain and a first inactive cytotoxic domain, wherein the second fusion polypeptide binds to a first nucleic acid sequence on an RNA molecule transcribed from the target DNA sequence; and a third fusion polypeptide or a polynucleotide encoding the third fusion polypeptide, wherein the third fusion polypeptide comprises a third nucleic acid binding domain and a second in
  • the disorder is a cancer.
  • the target DNA sequence comprises a driver mutation associated with a cancer.
  • the first nucleic acid sequence comprises a wild-type sequence.
  • the first nucleic acid sequence comprises the mutant sequence associated with the disorder.
  • the second nucleic acid sequence comprises a wild-type sequence.
  • the second nucleic acid sequence comprises the mutant sequence associated with the disorder.
  • the composition further comprises one or more additional fusion polypeptides, each of the one or more additional fusion polypeptide comprising a nucleic acid binding domain and an inactive cytotoxic domain.
  • the active cytotoxic domain is selected from the group consisting of a pro-caspase, a toxin, a pro-drug, and a pro-apoptotic protein.
  • the active cytotoxic domain is generated by dimerization of the first inactive cytotoxic domain and the second inactive cytotoxic domain.
  • the first inactive cytotoxic domain or the second inactive cytotoxic domain comprises split portions of the active cytotoxic domain.
  • the first nucleic acid binding domain, the second nucleic acid binding domain, or the third nucleic acid binding domain are selected from the group consisting of: a CRISPR-Cas protein, a zinc finger protein, a transcription activator-like effectors (TALE) protein, a homing endonuclease, meganuclease, PUF, CIRTS, SNAP -tag, and l phage RNA binding protein.
  • TALE transcription activator-like effectors
  • the first nucleic acid binding domain, the second nucleic acid binding domain, and the third nucleic acid binding domain is a CRISPR-Cas protein. In some embodiments, the first nucleic acid binding domain is a catalytically-inactive Cas9 or a fragment thereof. In some embodiments, the second nucleic acid binding domain and the third nucleic acid binding domain is a catalytically-inactive Casl3 or a fragment thereof. In some embodiments, the second nucleic acid binding domain and the third nucleic acid binding domain is a catalytically-inactive Casl3d or a fragment thereof. In some embodiments, the active cytotoxic domain induces an immune response in a subject.
  • a system for inducing cell death comprising: a first fusion polypeptide or a polynucleotide encoding the first fusion polypeptide, wherein the first fusion polypeptide comprises a first nucleic acid binding domain and a transcriptional activator that increases transcription of a target DNA sequence comprising a mutation associated with a disorder; a second fusion polypeptide or a polynucleotide encoding the second fusion polypeptide, wherein the second fusion polypeptide comprises a second nucleic acid binding domain and a first inactive cytotoxic domain, wherein the second fusion polypeptide binds to a first nucleic acid sequence on an RNA molecule transcribed from the target DNA sequence; and a third fusion polypeptide or a polynucleotide encoding the third fusion polypeptide, wherein the third fusion polypeptide comprises a third nucleic acid binding domain and a second inactive
  • the disorder is a cancer.
  • the target DNA sequence comprises a driver mutation associated with a cancer.
  • the first nucleic acid sequence comprises a wild-type sequence.
  • the first nucleic acid sequence comprises the mutant sequence associated with the disorder.
  • the second nucleic acid sequence comprises a wild-type sequence.
  • the second nucleic acid sequence comprises the mutant sequence associated with the disorder.
  • the system further comprises one or more additional fusion polypeptides, each of the one or more additional fusion polypeptide comprising a nucleic acid binding domain and an inactive cytotoxic domain.
  • the active cytotoxic domain is selected from the group consisting of a pro-caspase, a toxin, a pro-drug, and a pro-apoptotic protein.
  • the active cytotoxic domain is generated by dimerization of the first inactive cytotoxic domain and the second inactive cytotoxic domain.
  • the first inactive cytotoxic domain or the second inactive cytotoxic domain comprises split portions of the active cytotoxic domain.
  • the first nucleic acid binding domain, the second nucleic acid binding domain, or the third nucleic acid binding domain are selected from the group consisting of: a CRISPR-Cas protein, a zinc finger protein, a transcription activator-like effectors (TALE) protein, a homing endonuclease, meganuclease, PUF, CIRTS, SNAP -tag, and l phage RNA binding protein.
  • TALE transcription activator-like effectors
  • the first nucleic acid binding domain, the second nucleic acid binding domain, and the third nucleic acid binding domain is a CRISPR-Cas protein. In some embodiments, the first nucleic acid binding domain is a catalytically-inactive Cas9 or a fragment thereof. In some embodiments, the second nucleic acid binding domain and the third nucleic acid binding domain comprises a catalytically-inactive Casl3 or a fragment thereof. In some embodiments, the second nucleic acid binding domain and the third nucleic acid binding domain comprises a catalytically-inactive Casl3d or a fragment thereof. In some embodiments, the active cytotoxic domain induces an immune response in a subject.
  • a method for treating a disorder comprising: contacting a target DNA sequence in a cell with a first fusion polypeptide comprising a first nucleic acid binding domain and a transcription activator, wherein the first fusion polypeptide increases transcription of the target DNA sequence, thereby generating an RNA sequence transcribed from the target DNA sequence; contacting the RNA sequence with a second fusion polypeptide comprising a second nucleic acid binding domain and a first inactive portion of a cytotoxic domain, wherein the second fusion polypeptide binds to a first location on the RNA sequence; and contacting the RNA sequence with a third fusion polypeptide comprising a third nucleic acid binding domain and a second inactive portion of the cytotoxic domain, wherein the third fusion polypeptide binds to a second location on the RNA sequence, wherein binding of the second and the third fusion polypeptides to the RNA sequence brings the first and second in
  • the disorder is a cancer.
  • the target DNA sequence comprises a driver mutation associated with a cancer.
  • the first nucleic acid sequence comprises a wild-type sequence.
  • the first nucleic acid sequence comprises the mutant sequence associated with the disorder.
  • the second nucleic acid sequence comprises a wild-type sequence.
  • the second nucleic acid sequence comprises the mutant sequence associated with the disorder.
  • the method further comprises one or more additional fusion polypeptides, each of the one or more additional fusion polypeptide comprising a nucleic acid binding domain and an inactive cytotoxic domain.
  • the active cytotoxic domain is selected from the group consisting of a pro-caspase, a toxin, a pro-drug, and a pro-apoptotic protein.
  • the active cytotoxic domain is generated by dimerization of the first inactive cytotoxic domain and the second inactive cytotoxic domain.
  • the first inactive cytotoxic domain or the second inactive cytotoxic domain comprises split portions of the active cytotoxic domain.
  • the first nucleic acid binding domain, the second nucleic acid binding domain, or the third nucleic acid binding domain are selected from the group consisting of: a CRISPR-Cas protein, a zinc finger protein, a transcription activator-like effectors (TALE) protein, a homing endonuclease, meganuclease, PUF, CIRTS, SNAP -tag, and l phage RNA binding protein.
  • TALE transcription activator-like effectors
  • the first nucleic acid binding domain, the second nucleic acid binding domain, and the third nucleic acid binding domain is a CRISPR-Cas protein.
  • the CRISPR-Cas protein is a catalytically-inactive Cas9 or a fragment thereof.
  • the CRISPR-Cas protein is a catalytically-inactive Casl3 or a fragment thereof.
  • the first nucleic acid binding domain is a catalytically-inactive Cas9 or a fragment thereof.
  • the second nucleic acid binding domain and the third nucleic acid binding domain comprises a catalytically-inactive Casl3 or a fragment thereof.
  • the second nucleic acid binding domain and the third nucleic acid binding domain comprises a catalytically-inactive Casl3d or a fragment thereof.
  • the active cytotoxic domain induces an immune response in a subject.
  • compositions for inducing cell death comprising: a first fusion polypeptide or a polynucleotide encoding the first fusion polypeptide, wherein the first fusion polypeptide comprises a first nucleic acid binding domain and a first inactive cytotoxic domain, wherein the first fusion polypeptide binds to a first nucleic acid sequence on a target polynucleotide, wherein the first nucleic acid sequence comprises a driver mutation associated with a cancer; and a second fusion polypeptide or a polynucleotide encoding the second fusion polypeptide, wherein the second fusion polypeptide comprises a second nucleic acid binding domain and a second inactive cytotoxic domain, wherein the second fusion polypeptide binds to a second nucleic acid sequence, wherein proximity of the first inactive cytotoxic domain and the second inactive cytotoxic domain generates an active cytotoxic domain that
  • the driver mutation is a lost function mutation.
  • the first nucleic acid sequence comprises an alternative splice variant sequence resulting from the driver mutation.
  • the target polynucleotide comprises an alternative splice variant resulting from the driver mutation.
  • the second nucleic acid sequence comprises a wild-type sequence.
  • the second nucleic acid sequence comprises a passenger mutation associated with the driver mutation and the cancer.
  • the first nucleic sequence or the second nucleic acid sequence comprises a coding sequence.
  • the first nucleic sequence or the second nucleic acid sequence comprises a non-coding sequence.
  • the composition further comprises one or more additional fusion polypeptides, each of the one or more additional fusion polypeptide comprising a nucleic acid binding domain and an inactive cytotoxic domain.
  • the active cytotoxic domain is selected from the group consisting of a pro-caspase, a toxin, a pro-drug, and a pro-apoptotic protein.
  • the active cytotoxic domain is generated by dimerization of the first inactive cytotoxic domain and the second inactive cytotoxic domain or the first inactive cytotoxic domain and the third inactive cytotoxic domain.
  • the first inactive cytotoxic domain or the second inactive cytotoxic domain comprises split portions of the active cytotoxic domain.
  • the first nucleic acid binding domain or the second nucleic acid binding domain is selected from the group consisting of: a CRISPR-Cas protein, a zinc finger protein, a transcription activator-like effectors (TALE) protein, a homing endonuclease, meganuclease, PUF, CIRTS, SNAP -tag, and l phage RNA binding protein.
  • a CRISPR-Cas protein a zinc finger protein
  • TALE transcription activator-like effectors
  • the first nucleic acid binding domain and the second nucleic acid binding domain comprise a CRISPR-Cas protein.
  • the CRISPR-Cas protein is a catalytically-inactive Cas9 or a fragment thereof.
  • the CRISPR-Cas protein is a catalytically-inactive Casl3 or a fragment thereof.
  • a system for inducing cell death comprising: a first fusion polypeptide or a polynucleotide encoding the first fusion polypeptide, wherein the first fusion polypeptide comprises a first nucleic acid binding domain and a first inactive cytotoxic domain, wherein the first fusion polypeptide binds to a first nucleic acid sequence on a target polynucleotide, wherein the first nucleic acid sequence comprises a driver mutation associated with a cancer; and a second fusion polypeptide or a polynucleotide encoding the second fusion polypeptide, wherein the second fusion polypeptide comprises a second nucleic acid binding domain and a second inactive cytotoxic domain, wherein proximity of the first inactive cytotoxic domain and the second inactive cytotoxic domain generates an active cytotoxic domain that induces cell death.
  • the second nucleic acid sequence comprises a wild-type sequence. In some embodiments, the second nucleic acid sequence comprises a passenger mutation associated with the driver mutation and the cancer. In some embodiments, the first nucleic sequence or the second nucleic acid sequence comprises a coding sequence. In some embodiments, the first nucleic sequence or the second nucleic acid sequence comprises a non-coding sequence. In some embodiments, the system further comprises one or more additional fusion polypeptides, each of the one or more additional fusion polypeptide comprising a nucleic acid binding domain and an inactive cytotoxic domain.
  • the active cytotoxic domain is selected from the group consisting of a pro- caspase, a toxin, a pro-drug, and a pro-apoptotic protein. In some embodiments, the active cytotoxic domain is generated by dimerization of the first inactive cytotoxic domain and the second inactive cytotoxic domain or the first inactive cytotoxic domain and the third inactive cytotoxic domain. In some embodiments, the first inactive cytotoxic domain or the second inactive cytotoxic domain comprises split portions of the active cytotoxic domain. In some embodiments, the first nucleic acid binding domain or the second nucleic acid binding domain is selected from the group consisting of: a CRISPR-Cas protein, a zinc finger protein, a
  • the first nucleic acid binding domain and the second nucleic acid binding domain comprise a CRISPR- Cas protein.
  • the CRISPR-Cas protein is a catalytically-inactive Cas9 or a fragment thereof.
  • the CRISPR-Cas protein is a catalytically-inactive Casl3 or a fragment thereof.
  • the driver mutation is a lost function mutation.
  • the first nucleic acid sequence comprises an alternative splice variant sequence resulting from the driver mutation.
  • the target polynucleotide comprises an alternative splice variant resulting from the driver mutation.
  • a method for treating a subject comprising: contacting a cell comprising a target polynucleotide comprising a first nucleic acid sequence and a second nucleic acid sequence with: a first fusion polypeptide comprising a first nucleic acid binding domain and a first inactive cytotoxic domain, wherein the first fusion polypeptide binds to the first nucleic acid sequence on a target polynucleotide; and a second fusion polypeptide comprising a second nucleic acid binding domain and a second inactive portion of the toxin, wherein the second fusion polypeptide binds to the second nucleic acid sequence, wherein the first nucleic acid or the second nucleic acid sequence comprise a driver mutation associated with a cancer; wherein binding of the first fusion polypeptide to the first nucleic acid sequence and the second fusion polypeptide to the second nucleic acid sequence brings the first inactive portion and the second
  • the second nucleic acid sequence comprises a wild-type sequence. In some embodiments, the second nucleic acid sequence comprises a passenger mutation associated with the driver mutation and the cancer. In some embodiments, the first nucleic sequence or the second nucleic acid sequence comprises a coding sequence. In some embodiments, the first nucleic sequence or the second nucleic acid sequence comprises a non-coding sequence. In some embodiments, the method further comprises one or more additional fusion polypeptides, each of the one or more additional fusion polypeptide comprising a nucleic acid binding domain and an inactive cytotoxic domain.
  • the active cytotoxic domain is selected from the group consisting of a pro-caspase, a toxin, a pro-drug, and a pro-apoptotic protein. In some embodiments, the active cytotoxic domain is generated by dimerization of the first inactive cytotoxic domain and the second inactive cytotoxic domain or the first inactive cytotoxic domain and the third inactive cytotoxic domain. In some embodiments, in the first inactive cytotoxic domain or the second inactive cytotoxic domain comprises split portions of the active cytotoxic domain.
  • the first nucleic acid binding domain or the second nucleic acid binding domain is selected from the group consisting of: a CRISPR-Cas protein, a zinc finger protein, a transcription activator-like effectors (TALE) protein, a homing endonuclease, meganuclease, PUF, CIRTS, SNAP -tag, and l phage RNA binding protein.
  • a CRISPR-Cas protein a zinc finger protein
  • TALE transcription activator-like effectors
  • the first nucleic acid binding domain and the second nucleic acid binding domain comprise a CRISPR-Cas protein.
  • the CRISPR-Cas protein is a catalytically-inactive Cas9 or a fragment thereof.
  • the CRISPR-Cas protein is a catalytically-inactive Casl3 or a fragment thereof.
  • the driver mutation is a lost function mutation.
  • the first nucleic acid sequence comprises an alternative splice variant sequence resulting from the driver mutation.
  • the target polynucleotide comprises an alternative splice variant resulting from the driver mutation.
  • FIG. 1 depicts illustrative steps of methods of the disclosure.
  • the methods of the disclosure can comprise one or more steps shown in the figure.
  • FIG. 2 illustrates functions of a detector protein such as dCas9.
  • FIG. 3 illustrates functions of an effector protein such as dCasl3.
  • FIG. 4 depicts an illustrative the method to detect DNA mutation to generate genetic signal by two collaborating detector proteins.
  • FIG. 5 depicts an illustrative Fas signal pathway to induce cell death process.
  • FIG. 6 illustrates two effector proteins or fusion polypeptides each comprising a dCasl3 and a procaspase 8 to initiate autocatalytic reactions to start cell death process.
  • FIG. 7 illustrates two effector proteins or fusion polypeptides each comprising a dCasl3 and a Death Domain to initiate autocatalytic reaction to start cell death process.
  • FIG. 8 illustrates two effector proteins or fusion polypeptides each comprising a dCasl3 and a DED domain to initiate autocatalytic reactions to start cell death process.
  • FIG. 9 illustrates an effector protein or first fusion polypeptide comprising a dCasl3 and a procaspase 8 and another effector protein or second fusion polypeptide comprising a rApaf-1 and a procaspase 8 to initiate catalytic reactions to start cell death process.
  • FIG. 10 illustrates two effector proteins or fusion polypeptides each comprising a dCas9, a procaspase 8, and a CID targeting a DNA mutation to initiate chemical inducer controlled autocatalytic reactions to start cell death process.
  • FIG. 11 illustrates two effector proteins or fusion polypeptides each comprising a procaspase 8 and an antibody.
  • One of the antibodies can target a mutated protein sequence.
  • Proximity of the procaspase 8 can initiate catalytic autocatalytic reactions to start cell death process.
  • FIG. 12 illustrates fusion polypeptides comprising effector domains that comprise a split toxin.
  • FIG. 13 illustrates a recombinant pro-drug system.
  • FIG. 14 illustrates two detector proteins or fusion polypeptides that selectively bind to coding and non-coding strand of a mutated DNA segment.
  • FIG. 15 illustrates phage-assisted continuous evolution (PACE) for improving DNA binding specificity.
  • FIG. 16 illustrates PACE for improving RNA binding specificity.
  • FIG. 17 illustrates a mismatching binding curve
  • FIG. 18 illustrates a gRNA truncation binding curve.
  • FIG. 19 illustrates two detector proteins selectively bind to coding and non-coding strand of the mutated DNA.
  • FIG. 20 illustrates two fusion polypeptides each comprising a dCasl3 and a procaspase 1. Proximity of the two fusion polypeptides upon binding the target nucleic acids results in activation of caspase 1.
  • FIG. 21 illustrates a trio effector embodiment of the disclosure comprising three fusion polypeptides, each of which comprises a sequence binding domain such as a nucleic acid binding domain (e.g., a dCasl3) and an inactive effector domain. Binding of the fusion polypeptides to the target sequence brings the inactive effector domains in proximity resulting in activation of the effector domain.
  • a sequence binding domain such as a nucleic acid binding domain (e.g., a dCasl3) and an inactive effector domain.
  • FIG. 22 illustrates a method of the disclosure comprising three fusion polypeptides.
  • the fusion polypeptide in the middle comprises two effector domains which can generate two therapeutic proteins relevant to the mutation targeted.
  • FIG. 23A depicts an illustrative plasmid construction for expressing B4GALNT1 RNA showing gRNA (g2 and g4) binding sites.
  • FIG. 23B illustrates gRNA binding sites separated by 5 base pairs (bp), 8 bp, 14 bp, 23 bp, or 32 bp for testing the proximity for dimerization of the effector domains to occur.
  • the figure depicts the nucleotide space distance of B4GALNT1 g2 and g4 at the B4GALNT1 mRNA substrate as shown in FIG. 23A.
  • FIG. 23C illustrates different designs of gRNAs to bind to the target of interest at various base pairs locations.
  • the figure depicts the sequence and position of B4GALNT1 gRNAs at the 5bp B4GALNT1 mRNA substrate of FIG. 23B.
  • FIG. 23D illustrates that the RNA expression was not affected by the inclusion of the separating base pairs between gRNA binding sites.
  • the figure shows mRNA expression by B4GALNT1 mRNA substrate plasmids of FIG. 23B.
  • HEK293 cells were transfected with plasmids (300 ng DNA) and after 3 days of transfection, cells were harvested, and total RNA was purified followed by cDNA synthesis and qPCR analysis of artificial B4GALNT1 mRNA expression using primers that specifically detect the artificial B4GALNT1 mRNA only.
  • the endogenous cyclophilin A (PPIA) mRNA was used to normalize the expression of artificial B4GALNT1 mRNA levels. Data showed that all five artificial
  • B4GALNT1 mRNA plasmids expressed a unique RNA molecule, respectively, at a similar level in HEK293 cells.
  • FIG. 24 depicts illustrative constructs of gRNAs for targeting the B4GALNT1 mRNA.
  • FIG. 25A and FIG. 25B illustrate results of functionality test of B4GALNT1 gRNAs.
  • HEK293 cells were transfected with plasmids as indicated (FIG. 25A WT Casl3d; FIG. 25B, WT Casl3 or nuclease dead dCasl3). After 3 days of transfection, cells were harvested, and total RNA was purified followed by cDNA synthesis and qPCR analysis of artificial B4GALNT1 mRNA expression using primers that specifically detect the artificial B4GALNT1 mRNA only. The endogenous cyclophilin A (PPIA) mRNA was used to normalize the expression of B4GALNT1 mRNA levels.
  • PPIA endogenous cyclophilin A
  • FIG. 25B illustrates that without nuclease activity, dCasl3d protein could not knockdown the target RNA.
  • FIG. 26A depicts illustrative plasmid constructs for expressing a fusion polypeptide comprising dCasl3 and Caspase 1.
  • FIG. 26B illustrates expression results for dCasl3-Caspase 1 fusion polypeptide.
  • HEK293 T cells were transfected with plasmids (300 ng DNA) as indicated for 3 days. Cells were harvested. Western blotting analysis of HA-Tag, total caspase 1, active caspase 1, and a/b tubulin was performed for the cells transfected with the constructs of FIG. 26A.
  • FIG. 27 illustrates results of luminescent measurements of caspase 1 activation when the cells were transfected by the constructs as shown in the figure.
  • the caspase 1 activation was only observed in cells transfected with both g2 and g4 gRNAs and dCasl3d-caspase 1 fusion polypeptide.
  • HEK-293 cells were co-transfected with various plasmid combinations as indicated in a 96-well plate for 3 days, followed by caspase 1 activity measurement assessed by Caspase- Glo 1 Inflammasome Assay kit.
  • One group of cells without any plasmid transfection were pre treated with Nigercin (100 ug/ml) for 2 hours prior to the caspase 1 activity assay.
  • FIG. 28 illustrates caspase 1 activity in HEK293 cells after co-transfection of dCasl3d- caspase 1 fusion polypeptide and targeting gRNAs.
  • the methods were as described for FIG. 27.
  • Data were presented as the fold increase of luminescence intensity over the control wells which were cultured normally without any treatment.
  • the data showed that only the combination of dCasl3d-caspase 1 plus both B4GALNT1 gRNAs increased the activity of caspase 1, suggesting that the fusion protein, dCasl3d-caspase 1, is dimerized after gRNA directed Casl3 binding to the artificial B4GALNT1 mRNA.
  • FIG. 29 illustrates caspase 1 activity in HEK293 cells after co-transfection of different dCasl3d-caspase 1 fusion polypeptides.
  • HEK-293 cells were co-transfected with various plasmid combinations as indicated in the figure.
  • the effector caspase 1 protein varied with full-length, CARD domain deleted, or both CARD domain and CDL linker deleted, respectively.
  • caspase 1 activity was measured by Caspase-Glo 1 Inflammasome Assay kit.
  • One group of cells without any plasmid transfection were pre-treated with Nigercin (100 ug/ml) for 2 hours prior to the caspase 1 activity assay.
  • FIG. 30 illustrates caspase 1 activity in HEK293 cells after co-transfection of different B4GALNT1 substrate mRNA.
  • HEK-293 cells were co-transfected with various plasmid combinations as indicated in the figure.
  • Different artificial B4GALNT1 substrate mRNA constructs were utilized in this experiment. Those substrates have varied nucleotide space distance between g2 and g4 gRNAs (as illustrated in FIG. 23B).
  • caspase 1 activity was measured by Caspase-Glo 1 Inflammasome Assay kit.
  • SpectraMax iD3 plate reader after 3hrs of incubation. Data were calculated as the fold increase of luminescence intensity over the control wells which were cultured normally without any treatment. The data showed that a space distance of about 14 bp between the two gRNAs gave rise to the best activation of caspase 1 activity.
  • FIG. 31 illustrates caspase 1 activity in HEK293 cells after co-transfection of dCasl3d- caspase 1 fusion polypeptide and triple targeting gRNAs.
  • HEK-293 cells were co-transfected with various plasmid combinations as indicated in the figure. Either two gRNAs (gl and g2d or g2d and g4) or triple gRNAs (gl, g2d, g4) were used.
  • the nucleotide space distance between gl and g2d, or between g2d and g4 wasl4 bp on the artificial 5bp B4GALNT1 substrate mRNA target as illustrated in FIG. 23C).
  • caspase 1 activity was measured by Caspase-Glo 1 Inflammasome Assay kit.
  • One group of cells without any plasmid transfection were pre-treated with Nigercin (100 ug/ml) for 2 hours prior to the caspase 1 activity assay.
  • a half number of wells were added with YVAD-CHO.
  • the luminescence, which represents the activity of caspase 1 was measured using SpectraMax iD3 plate reader after 3 hours of incubation. Data were calculated as the fold increase of luminescence intensity over the control wells which were cultured normally without any treatment. The data showed that an application of triple gRNAs produced a more robust effect on caspase 1 activity.
  • FIG. 32A and FIG. 32B illustrate cell death analyses of HEK293 cells after co transfection of dCasl3d-caspase 1 fusion polypeptide and triple targeting gRNAs.
  • HEK-293 cells were co-transfected with various plasmid combinations as indicated in the figure. Either two gRNAs (gl and g2d or g2d and g4) or triple gRNAs (gl, g2d, g4) were used.
  • the nucleotide space distance between gl and g2d, or between g2d and g4 was 14 bp on the artificial 5bp B4GALNT1 substrate mRNA target as illustrated in FIG. 23C.
  • cell death assay was conducted using a real time-Glo Annexin V apoptosis and necrosis assay kit.
  • the detecting reagent was directly added to the cultured cells, and the intensity of luminescence for Annexin V binding (apoptosis, FIG. 32 A) and the intensity of fluorescence for
  • profluorescent dye-DNA binding were measured by SpectraMax iD3 plate reader, respectively, at 24 hours (FIG. 32A) and 96 hours (FIG. 32B).
  • One group of cells without any plasmid transfection were co-treated with Nigercin (20 ug/ml) before the addition of detecting reagent.
  • Data were calculated as the fold increase of luminescence or fluorescence intensity over the control wells which were cultured normally without any treatment. The data showed that an application of triple gRNAs produced a more profound effect to induce cell death.
  • FIG. 33A illustrates dCasl3d construction with a GFP reporter gene.
  • FIG. 33B illustrates the plasmid map with the insert of EGFRvIII.
  • FIG. 33C illustrates fluorescent imaging showing expression of GFP in the U87-MG cells transfected with the plasmid of FIG. 33B.
  • FIG. 34 illustrates the constructs of tandem gRNAs targeting EGFRvIII mRNA.
  • FIG. 35 illustrates EGFRvIII mRNA expression levels mediated by the gRNAs complexed with wild type Casl3d (wt Casl3d).
  • FIG. 36 illustrates GFP fluorescence of HEK293 cells after co-transfection of dCasl3d- Caspase 1 effector and EGFRvIII gRNAs.
  • FIG. 37A-B illustrate GFP fluorescence indicated cell viability of HEK293 cells after co transfection of dCasl3d-Caspase 1 effector and EGFRvIII gRNAs.
  • FIG. 38A-B illustrates caspase 1 activity in HEK293 cells after co-transfection of dCasl3d-Caspase 1 effector and EGFRvIII gRNAs.
  • FIG. 39A-B illustrates apoptosis of HEK293 cells after co-transfection of dCasl3d- Caspase 1 effector and EGFRvIII gRNAs.
  • each of the expressions“at least one of A, B and C”,“at least one of A, B, or C”,“one or more of A, B, and C”,“one or more of A, B, or C” and“A, B, and/or C” means A alone, B alone, C alone, A and B together, A and C together, B and C together, or A, B and C together.
  • the term“about” or“approximately” can mean within an acceptable error range for the particular value as determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined, e.g., the limitations of the measurement system. For example,“about” can mean within 1 or more than 1 standard deviation, per the practice in the given value. Where particular values are described in the application and claims, unless otherwise stated the term“about” should be assumed to mean an acceptable error range for the particular value.
  • the terms“increased,” or“increase” can mean an increase by a statically significant amount.
  • the terms“increased,” or“increase,” mean an increase of at least 10% as compared to a reference level, for example an increase of at least about 10%, at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90% or up to and including a 100% increase or any increase between 10-100% as compared to a reference level, standard, or control.
  • “increase” can include an increase of at least 2-fold, at least 5-fold, at least 10-fold, at least 20-fold, at least 50-fold, at least 100-fold, at least 1000-fold or more as compared to a reference level.
  • the terms,“decreased” or“decrease” can mean a decrease by a statistically significant amount.
  • “decreased” or“decrease” means a reduction by at least 10% as compared to a reference level, for example a decrease by at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90% or up to and including a 100% decrease (e.g., absent level or non-detectable level as compared to a reference level), or any decrease between 10- 100% as compared to a reference level.
  • a marker or symptom by these terms can mean a statistically significant decrease in such level.
  • the decrease can be, for example, at least 10%, at least 20%, at least 30%, at least 40% or more, and is preferably down to a level accepted as within the range of normal for an individual without a given disease.
  • Non-limiting examples of“sample” can include any material from which nucleic acids and/or proteins can be obtained. As non-limiting examples, this includes whole blood, peripheral blood, plasma, serum, saliva, mucus, urine, semen, lymph, fecal extract, cheek swab,
  • the sample can comprise tissue from the large and/or small intestine.
  • the large intestine sample can comprise the cecum, colon (the ascending colon, the transverse colon, the descending colon, and the sigmoid colon), rectum and/or the anal canal.
  • the small intestine sample can comprise the duodenum, jejunum, and/or the ileum.
  • a sample can be obtained through primary patient derived cell lines, or archived patient samples in the form of preserved samples, or fresh frozen samples.
  • a protein can refer to a full-length polypeptide as translated from a coding open reading frame, or as processed to its mature form, while a polypeptide or peptide can refer to a degradation fragment or a processing fragment of a protein that nonetheless uniquely or identifiably maps to a particular protein.
  • a polypeptide can be a single linear polymer chain of amino acids bonded together by peptide bonds between the carboxyl and amino groups of adjacent amino acid residues. Polypeptides can be modified, for example, by the addition of carbohydrate, phosphorylation, etc. Proteins can comprise one or more polypeptides.
  • the terms“fragment,” or equivalent terms can refer to a portion of a protein that has less than the full length of the protein and optionally maintains the function of the protein. Further, when the portion of the protein is blasted against the protein, the portion of the protein sequence can align, for example, at least with 80% identity to a part of the protein sequence.
  • the terms“polynucleotide,”“nucleic acid,”“oligonucleotide,” or equivalent terms can refer to molecules that comprises a polymeric arrangement of nucleotide base monomers, where the sequence of monomers defines the polynucleotide.
  • Polynucleotides can include polymers of deoxyribonucleotides to produce deoxyribonucleic acid (DNA), and polymers of ribonucleotides to produce ribonucleic acid (RNA).
  • a polynucleotide can be single or double stranded. When single stranded, the polynucleotide can correspond to the sense or antisense strand of a gene.
  • a single-stranded polynucleotide can hybridize with a complementary portion of a target polynucleotide to form a duplex, which can be a homoduplex or a
  • a polynucleotide can be produced by biological means (e.g., enzymatically), either in vivo (e.g., in a cell) or in vitro (e.g., in a cell-free system).
  • a polynucleotide can be chemically synthesized using enzyme-free systems.
  • a polynucleotide can be enzymatically extendable or enzymatically non-extendable.
  • target polynucleotide as used herein can refer to a nucleic acid or
  • a target polynucleotide which is targeted by a binding domain of the present disclosure.
  • a target polynucleotide can be DNA (e.g., endogenous or exogenous), for example, a DNA that can serve as a template to generate mRNA transcripts and/or the various regulatory regions which regulate transcription of an mRNA from a DNA template.
  • a target polynucleotide can be a portion of a larger polynucleotide, for example a chromosome or a region of a chromosome.
  • a target polynucleotide can be RNA.
  • RNA can be, for example, mRNA which can serve as template encoding for a protein.
  • a target polynucleotide comprising RNA can include or be within the various regulatory regions which regulate translation of protein from an mRNA template.
  • a target polynucleotide can encode for a gene product (e.g., DNA encoding for an RNA transcript or RNA encoding for a protein product) or comprise a regulatory sequence which regulates expression of a gene product.
  • Target polynucleotide can refer to a nucleic acid sequence on a single strand of a target nucleic acid.
  • the target polynucleotide can be a portion of a gene, a regulatory sequence, genomic DNA, cell free nucleic acid including cfDNA and/or cfRNA, cDNA, a fusion gene, and RNA including mRNA, miRNA, rRNA, and others.
  • a target polynucleotide when targeted by a binding domain, can result in altered gene expression (e.g., increased transcription or translation of a mutated gene) and/or activity.
  • a target polynucleotide can comprise a nucleic acid sequence that may not be related to any other sequence in a nucleic acid sample by a single nucleotide substitution.
  • a target polynucleotide can comprise or may be a portion of a gene sequence or a regulatory element thereof.
  • a target polynucleotide can comprise or may be a portion of an exon sequence, an intron sequence, an ex on-intron junction, splice acceptor-splice donor site, a start codon sequence, a stop codon sequence, a promoter site, an alternative promoter site, 5’ regulatory element, enhancer, 5’ UTR region, 3’ UTR region, poly adenylation site, or binding site of a polymerase, nuclease, gyrase, topoisomerase, methylase or methyl transferase, transcription factors, enhancer, or zinc finger.
  • a target polynucleotide can comprise or be a portion of a splice variant or an alternative splice variant.
  • a target polynucleotide can be present only in a cell to be targeted (e.g., a cancer cell, a diseased cell, cell infected with a microbe such as a virus or bacteria) and may be absent from normal or healthy cells.
  • a target polynucleotide can comprise or be a portion of an microorganism or a microbe, such as a virus or a bacteria.
  • a target polynucleotide can comprise or be a portion of a variant polynucleotide, for example, splice-site variant, point variant, pathogenic variant, unclassified variant, copy number variant, de novo variant, epigenetic variant, founder variant, frameshift variant, germline variant, somatic variant, missense variant, nonsense variant, or a pathogenic variant.
  • a target polynucleotide can comprise or be a portion of an alternative splice variant resulting from a driver mutation.
  • mutants can refer to a substitution of a residue within a sequence, e.g., a nucleic acid or amino acid sequence, with another residue, or a deletion or insertion of one or more residues within a sequence.
  • One or more mutations may be described by identifying the original residue followed by the position of the residue within the sequence and by the identity of the newly substituted residue.
  • Mutation can be a change or alteration in a sequence (e.g., nucleic acid sequence, genomic sequence, genetic sequence such as DNA, RNA, or protein sequence) relative to a reference sequence.
  • the reference sequence can be a wild-type sequence, a sequence of a healthy or normal cell, or a sequence that is not associated with a disease or a disorder.
  • a reference sequence can be a sequence not associated with a cancer.
  • Non limiting examples of mutations include point mutations, substitution of one or more nucleotides, deletion of one or more nucleotides, insertion of one or more nucleotides, fusion of one or more nucleotides, frame shift mutation, aberration, alternative splicing, abnormal methylation, missense mutation, conservative mutation, non-conservative mutation, nonsense mutation, splice variant, alternative splice variant, transition, transversion, de novo mutation, deleterious mutation, disease-causing mutation, epimutation, founder mutation, germline mutation, somatic mutation, predisposing mutation, splice-site mutation, or susceptibility gene mutation.
  • the mutation can be a pathogenic variant or mutation that increases an individual’s susceptibility or predisposition to a certain disease or disorder.
  • the mutation can be a driver mutation (e.g., a mutation that can confer a fitness advantage to cells in their microenvironment, thereby driving the cell lineage to cancer).
  • the driver mutation can be a lost function mutation.
  • the mutation can be a lost function mutation.
  • the mutation can be a passenger mutation (e.g., a mutation that occurs in a genome with the driver mutation and may be associated with clonal expansion).
  • the term“gene” can refer to a combination of polynucleotide elements, that when operatively linked in either a native or recombinant manner, provide some product or function.
  • the term“gene” is to be interpreted broadly, and can encompass mRNA, cDNA, cRNA and genomic DNA forms of a gene.
  • the term“gene” encompasses the transcribed sequences, including 5' and 3' untranslated regions (5 -UTR and 3'-UTR), exons and introns.
  • the transcribed region will contain“open reading frames” that encode polypeptides.
  • a“gene” comprises only the coding sequences (e.g., an“open reading frame” or“coding region”) necessary for encoding a polypeptide.
  • genes do not encode a polypeptide, for example, ribosomal RNA genes (rRNA) and transfer RNA (tRNA) genes.
  • rRNA ribosomal RNA genes
  • tRNA transfer RNA
  • the term“gene” includes not only the transcribed sequences, but in addition, also includes non-transcribed regions including upstream and downstream regulatory regions, enhancers and promoters.
  • the term“gene” can encompass mRNA, cDNA and genomic forms of a gene.
  • A“subject” can be a biological entity containing expressed genetic materials.
  • the biological entity can be a plant, animal, or microorganism, including, for example, bacteria, viruses, fungi, and protozoa.
  • the subject can be tissues, cells and their progeny of a biological entity obtained in vivo or cultured in vitro.
  • the subject can be a mammal.
  • the mammal can be a human.
  • the subject may be diagnosed or suspected of being at high risk for a disease.
  • the disease can be cancer. In some cases, the subject is not necessarily diagnosed or suspected of being at high risk for the disease.
  • in vivo can be used to describe an event that takes place in a subject’s body.
  • ex v/vo can be used to describe an event that takes place outside of a subject’s body.
  • An“ex vivo” assay may not be performed on a subject. Rather, it can be performed upon a sample separate from a subject. Ex vivo can be used to describe an event occurring in an intact cell outside a subject’s body.
  • in vitro can be used to describe an event that takes places contained in a container for holding laboratory reagent such that it is separated from the living biological source organism from which the material is obtained.
  • in vitro assays can encompass cell -based assays in which cells alive or dead are employed.
  • In vitro assays can also encompass a cell-free assay in which no intact cells are employed.
  • Treating” or“treatment” can refer to both therapeutic treatment and prophylactic or preventative measures, wherein the object is to prevent or slow down (lessen) a targeted pathologic condition or disorder.
  • Those in need of treatment include those already with the disorder, as well as those prone to have the disorder, or those in whom the disorder is to be prevented.
  • a therapeutic benefit may refer to eradication or amelioration of symptoms or of an underlying disorder being treated. Also, a therapeutic benefit can be achieved with the eradication or amelioration of one or more of the physiological symptoms associated with the underlying disorder such that an improvement is observed in the subject, notwithstanding that the subject may still be afflicted with the underlying disorder.
  • a prophylactic effect can include delaying, preventing, or eliminating the appearance of a disease or condition, delaying or eliminating the onset of symptoms of a disease or condition, slowing, halting, or reversing the progression of a disease or condition, or any combination thereof.
  • a subject at risk of developing a particular disease, or to a subject reporting one or more of the physiological symptoms of a disease may undergo treatment, even though a diagnosis of this disease may not have been made.
  • compositions, systems or methods for targeting and binding a genetic sequence in a cell are compositions, systems or methods for inducing an effect in a cell.
  • the compositions, systems or methods comprise: a first fusion polypeptide or a polynucleotide encoding the first fusion polypeptide, wherein the first fusion polypeptide comprises a first genetic sequence binding domain and a first inactive effector domain, wherein the first fusion polypeptide binds to a first genetic sequence comprising a mutation; a second fusion polypeptide or a polynucleotide encoding the second fusion polypeptide, wherein the second fusion polypeptide comprises a second genetic sequence binding domain and a second inactive effector domain, wherein the second fusion polypeptide binds to a second genetic sequence that is upstream of a 5’ end of the first nucleic acid sequence; and a third
  • compositions, systems, or methods for targeting nucleic acid mutations in cells can deliver therapies or therapeutic effects to the cells targeted for the nucleic acid mutations.
  • therapeutic compositions comprising: a first fusion polypeptide or a polynucleotide encoding the first fusion polypeptide, wherein the first fusion polypeptide comprises a first nucleic acid binding domain and a first inactive effector domain, wherein the first fusion polypeptide binds to a first nucleic acid sequence comprising a mutation;
  • the second fusion polypeptide or a polynucleotide encoding the second fusion polypeptide wherein the second fusion polypeptide comprises a second nucleic acid binding domain and a second inactive effector domain, wherein the second fusion polypeptide binds to a second nucleic acid sequence that is upstream of a 5’ end of the first nucleic acid sequence; and a third fusion polypeptide or a polynucleotide encoding the third fusion polypeptide, wherein the third fusion polypeptide comprises a third nucleic acid binding domain and a third inactive effector domain, wherein the third fusion polypeptide binds to a third nucleic acid sequence that is downstream of a 3’ end of the first nucleic acid sequence, wherein proximity of the first inactive effector domain and the second inactive effector domain or the first inactive effector domain and the third inactive effector domain generates one or more active effector domains.
  • the effector domains can be cyto
  • compositions, systems, or methods can induce cytotoxicity or cell death.
  • the compositions, systems, or methods comprise a first fusion polypeptide or a polynucleotide encoding the first fusion polypeptide, wherein the first fusion polypeptide comprises a first nucleic acid binding domain and a first inactive cytotoxic domain, wherein the first fusion polypeptide binds to a first nucleic acid sequence on a target
  • a second fusion polypeptide or a polynucleotide encoding the second fusion polypeptide wherein the second fusion polypeptide comprises a second nucleic acid binding domain and a second inactive cytotoxic domain, wherein the second fusion polypeptide binds to a second nucleic acid sequence on the target polynucleotide; and a third fusion polypeptide or a polynucleotide encoding the third fusion polypeptide, wherein the third fusion polypeptide comprises a third nucleic acid binding domain and a third inactive cytotoxic domain, wherein the third fusion polypeptide binds to a third nucleic acid sequence on the target polynucleotide, wherein proximity of the first inactive cytotoxic domain and the second inactive cytotoxic domain or the first inactive cytotoxic domain and the third inactive cytotoxic domain generates an active cytotoxic domain that induces cell death.
  • compositions, systems, or methods for inducing cell death or cytotoxicity by delivering to targeted cells a toxin can comprise: a first fusion polypeptide or a polynucleotide encoding the first fusion polypeptide, wherein the first fusion polypeptide comprises a first nucleic acid binding domain and a first inactive portion of a toxin, wherein the first fusion polypeptide binds to a first nucleic acid sequence of a target polynucleotide; and a second fusion polypeptide or a polynucleotide encoding the second fusion polypeptide, wherein the second fusion polypeptide comprises a second nucleic acid binding domain and a second inactive portion of the toxin, wherein the second fusion polypeptide binds to a second nucleic acid sequence on the target polynucleotide, wherein proximity of the first inactive portion
  • compositions, systems, or methods for activating transcription of a mutated DNA to generate a mutant RNA comprising the targeted mutation and subsequently targeting the mutant RNA transcript to induce cell death or cytotoxicity comprise: a first fusion polypeptide or a polynucleotide encoding the first fusion polypeptide, wherein the first fusion polypeptide comprises a first nucleic acid binding domain and a polypeptide (e.g., transcriptional activator) that increases transcription of a target DNA sequence comprising a mutation associated with a disorder; a second fusion polypeptide or a polynucleotide encoding the second fusion
  • the second fusion polypeptide comprises a second nucleic acid binding domain and a first inactive cytotoxic domain, wherein the second fusion polypeptide binds to a first nucleic acid sequence on an RNA molecule transcribed from the target DNA sequence; and a third fusion polypeptide or a polynucleotide encoding the third fusion polypeptide, wherein the third fusion polypeptide comprises a third nucleic acid binding domain and a second inactive cytotoxic domain, wherein the third fusion polypeptide binds to a second nucleic acid sequence on the RNA molecule transcribed from the target DNA sequence, wherein proximity of the first inactive cytotoxic domain and the second inactive cytotoxic domain generates an active cytotoxic domain that induces cell death.
  • compositions, systems, or methods for targeting mutations such as driver mutations associated with a disease or a disorder.
  • compositions, systems, or methods for inducing cell death or cytotoxicity in the cells with the targeted nucleic acid mutations are also described herein.
  • the compositions, systems, or methods comprise a first fusion polypeptide or a polynucleotide encoding the first fusion polypeptide, wherein the first fusion polypeptide comprises a first nucleic acid binding domain and a first inactive cytotoxic domain, wherein the first fusion polypeptide binds to a first nucleic acid sequence comprising a mutation (e.g., driver mutation) associated with a cancer; and a second fusion polypeptide or a polynucleotide encoding the second fusion polypeptide, wherein the second fusion polypeptide comprises a second nucleic acid binding domain and a second inactive cytotoxic domain, wherein the second fusion polypeptide binds to a second nucleic acid sequence, wherein proximity of the first inactive cytotoxic domain and the second inactive cytotoxic domain generates an active cytotoxic domain that induces cell death.
  • a mutation e.g., driver mutation
  • compositions, systems, or methods comprising a fusion polypeptide.
  • a fusion polypeptide can comprise a binding domain.
  • the binding domain can be a nucleic acid or polynucleotide binding domain.
  • the binding domain can be a peptide or polypeptide binding domain.
  • a fusion polypeptide can comprise an effector domain.
  • a fusion polypeptide can be an effector polypeptide (or effector protein or effector fusion polypeptide) comprising a binding domain and an effector domain.
  • a fusion polypeptide can be a detector polypeptide (or detector protein or detector fusion polypeptide) comprising a binding domain and a polypeptide that increases transcription of a target polynucleotide.
  • the components of a fusion polypeptide can be fused at their N-terminus, C-terminus or an internal location to other components of the fusion polypeptide.
  • the effector domain can be at a N-terminus, C-terminus or an internal location of the binding domain.
  • the domain that increases transcription of a target polynucleotide can be at a N-terminus, C- terminus, or an internal location of the binding domain.
  • the components of a fusion polypeptide can be fused by a linker sequence. In some cases, there may be no linker between two or more components of a fusion polypeptide.
  • a fusion polypeptide can additionally comprise a targeting sequence to direct transport of a polypeptide to which the targeting sequence is linked to a specific region of a cell, for example, one or more nuclear localization signals (NLS).
  • NLS nuclear localization signals
  • An NLS can be a monopartite sequence or a bipartite sequence.
  • the compositions, systems, or methods comprise two or more fusion polypeptides.
  • the compositions, systems, or methods comprise three or more fusion polypeptides.
  • the compositions, systems, or methods comprise 4, 5, 6, 7, 8, 9, 10, or more fusion polypeptides.
  • compositions, systems, or methods comprising a fusion polypeptide comprising a binding domain and an effector domain.
  • the binding domain can be a genetic sequence binding domain that binds to a genetic sequence.
  • the genetic sequence can be DNA, RNA, or a protein sequence.
  • the genetic sequence can comprise a mutation associated with a disorder such as a cancer.
  • the binding domain can bind to a nucleic acid sequence or a protein sequence.
  • the binding domain can be a nucleic acid binding domain.
  • the binding domain can be polypeptide binding domain.
  • the binding domain is a nucleic acid binding domain that binds to a nucleic acid sequence on a target polynucleotide.
  • the nucleic acid binding domain can be a nucleic acid guided-nucleic acid binding domain (e.g. RNA guided).
  • the nucleic acid guided-nucleic acid binding domain can selectively target and bind to nucleic acid sequences on target polynucleotides.
  • the target polynucleotide can comprise a genetic polymorphism or a variant. In some instances, the genetic polymorphism or variant can be associated with a disease or a disorder.
  • the nucleic acid binding domain comprises a CRISPR-Cas
  • a CRISPR-Cas polypeptide can be, for example, Class 1 CRISPR-associated (Cas) polypeptides, Class 2 Cas polypeptides, type I Cas polypeptides, type II Cas polypeptides, type III Cas polypeptides, type IV Cas polypeptides, type V Cas polypeptides, and type VI, CRISPR- associated RNA binding proteins, or a functional fragment thereof.
  • Cas Class 1 CRISPR-associated polypeptides
  • Class 2 Cas polypeptides Class 2 Cas polypeptides
  • type I Cas polypeptides type II Cas polypeptides
  • type III Cas polypeptides type IV Cas polypeptides
  • type V Cas polypeptides type V Cas polypeptides
  • type VI CRISPR-associated RNA binding proteins
  • Cas polypeptides suitable for use with the present disclosure can include Cas9, Casl2, Casl3, Cpfl (or Casl2a), c2cl, C2c2 (or Casl3a), Casl3b, Casl3c, Casl3d, c2c3, Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cas5e (CasD), Cas6, Cas6e, Cas6f, Cas7, Cas8a, Cas8al , Cas8a2, Cas8b, Cas8c, Csnl, Csxl2, Cas 10, CaslOd, CaslO, CaslOd, CasF, CasG, CasH, Csyl, Csy2, Csy3, Csel (CasA), Cse2 (CasB), Cse3 (CasE), Cse4 (CasC), Cscl, Cs
  • the nucleic acid-guided nucleic acid binding domain comprises a catalytically inactivated Cas9 (dCas9), any derivative thereof; any variant thereof; or any fragment thereof.
  • dCas9 catalytically inactivated Cas9
  • the nucleic acid-guided nucleic acid binding domain comprises a catalytically inactivated Casl2 (dCasl2), any derivative thereof; any variant thereof; or any fragment thereof.
  • dCasl2 catalytically inactivated Casl2
  • the nucleic acid-guided nucleic acid binding domain comprises a catalytically inactivated Casl3 (dCasl3); , any derivative thereof; any variant thereof; or any fragment thereof.
  • dCasl3 catalytically inactivated Casl3
  • ZFN zinc finger nucleases
  • TALEN transcription activator-like effector nucleases
  • RBP RNA-binding proteins
  • pAgo prokaryotic Argonaute
  • aAgo archaeal Argonaute
  • eAgo eukaryotic Argonaute
  • CIRT PUF, homing endonuclease, or any functional fragment thereof.
  • the nucleic acid sequences can comprise coding sequence, non coding sequence, or a combination thereof.
  • the nucleic acid sequences on the target polynucleotides can independently comprise at least one, two, three, four, five, ten, or more mutations.
  • the mutations can directly cause diseases or disorders.
  • the mutations can contribute to causes of the diseases or disorders.
  • the target polynucleotides can be deoxyribonucleic acid (DNA).
  • the DNA sequences can be single-stranded or doubled-stranded.
  • the target polynucleotides can be ribonucleic acid (RNA).
  • the RNA sequences can be mRNA, rRNA, SRP RNA, tRNA, tmRNA, snRNA, snoRNA, gRNA, aRNA, crRNA, IncRNA, miRNA, ncRNA, piRNA, siRNA, or shRNA.
  • the target polynucleotide is an mRNA.
  • the nucleic acid guided-nucleic acid binding domain can be complexed with a guide nucleic acid.
  • a guide nucleic acid can comprise a nucleic-acid targeting region that comprises a complementary sequence to a nucleic acid sequence on the target polynucleotide to confer the sequence specificity of CRISPR/Cas-gRNA complex-dependent targeting.
  • the guide nucleic acid can comprise two separate nucleic acid molecules, which can be referred to as a double guide nucleic acid or a single nucleic acid molecule, which can be referred to as a single guide nucleic acid (e.g., sgRNA).
  • the guide nucleic acid is a single guide nucleic acid comprising a fused CRISPR RNA (crRNA) and a transactivating crRNA (tracrRNA).
  • the guide nucleic acid is a single guide nucleic acid comprising a crRNA.
  • the guide nucleic acid is a single guide nucleic acid comprising a crRNA but lacking a tracRNA.
  • the guide nucleic acid is a double guide nucleic acid comprising non-fused crRNA and tracrRNA.
  • An exemplary double guide nucleic acid can comprise a crRNA-like molecule and a tracrRNA- like molecule.
  • An exemplary single guide nucleic acid can comprise a crRNA- like molecule.
  • An exemplary single guide nucleic acid can comprise a fused crRNA-like molecule and a tracrRNA-like molecule.
  • a crRNA can comprise the nucleic acid-targeting segment (e.g., spacer region) of the guide nucleic acid and a stretch of nucleotides that can form one half of a double-stranded duplex of the Cas protein-binding segment of the guide nucleic acid.
  • nucleic acid-targeting segment e.g., spacer region
  • a tracrRNA can comprise a stretch of nucleotides that forms the other half of the double- stranded duplex of the Cas protein-binding segment of the gRNA.
  • a stretch of nucleotides of a crRNA can be complementary to and hybridize with a stretch of nucleotides of a tracrRNA to form the double-stranded duplex of the Cas protein-binding domain of the guide nucleic acid.
  • the crRNA and tracrRNA can hybridize to form a guide nucleic acid.
  • the crRNA can also provide a single-stranded nucleic acid targeting segment (e.g., a spacer region) that hybridizes to a target nucleic acid recognition sequence (e.g., protospacer).
  • a target nucleic acid recognition sequence e.g., protospacer.
  • the sequence of a crRNA, including spacer region, or tracrRNA molecule can be designed to be specific to the species in which the guide nucleic acid is to be used.
  • the nucleic acid-targeting region of a guide nucleic acid can be between 18 to 72 nucleotides in length.
  • the nucleic acid-targeting region of a guide nucleic acid (e.g., spacer region) can have a length of from about 12 nucleotides to about 100 nucleotides.
  • the nucleic acid-targeting region of a guide nucleic acid can have a length of from about 12 nucleotides (nt) to about 80 nt, from about 12 nt to about 50 nt, from about 12 nt to about 40 nt, from about 12 nt to about 30 nt, from about 12 nt to about 25 nt, from about 12 nt to about 20 nt, from about 12 nt to about 19 nt, from about 12 nt to about 18 nt, from about 12 nt to about 17 nt, from about 12 nt to about 16 nt, or from about 12 nt to about 15 nt.
  • nt nucleotides
  • the DNA-targeting segment can have a length of from about 18 nt to about 20 nt, from about 18 nt to about 25 nt, from about 18 nt to about 30 nt, from about 18 nt to about 35 nt, from about 18 nt to about 40 nt, from about 18 nt to about 45 nt, from about 18 nt to about 50 nt, from about 18 nt to about 60 nt, from about 18 nt to about 70 nt, from about 18 nt to about 80 nt, from about 18 nt to about 90 nt, from about 18 nt to about 100 nt, from about 20 nt to about 25 nt, from about 20 nt to about 30 nt, from about 20 nt to about 35 nt, from about 20 nt to about 40 nt, from about 20 nt to about 45 nt, from about 20 nt to about 50 nt, from about 20 ntt,
  • the length of the nucleic acid-targeting region can be at least 5, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30 or more nucleotides.
  • the length of the nucleic acid-targeting region (e.g., spacer sequence) can be at most 5, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30 or more nucleotides.
  • the nucleic acid-targeting region of a guide nucleic acid (e.g., spacer) is 20 nucleotides in length. In some embodiments, the nucleic acid-targeting region of a guide nucleic acid is 19 nucleotides in length. In some embodiments, the nucleic acid-targeting region of a guide nucleic acid is 18 nucleotides in length. In some embodiments, the nucleic acid-targeting region of a guide nucleic acid is 17 nucleotides in length. In some embodiments, the nucleic acid-targeting region of a guide nucleic acid is 16 nucleotides in length.
  • the nucleic acid-targeting region of a guide nucleic acid is 21 nucleotides in length. In some embodiments, the nucleic acid-targeting region of a guide nucleic acid is 22 nucleotides in length.
  • the nucleotide sequence of the guide nucleic acid that is complementary to a nucleotide sequence (target sequence) of the target nucleic acid can have a length of, for example, at least about 12 nt, at least about 15 nt, at least about 18 nt, at least about 19 nt, at least about 20 nt, at least about 25 nt, at least about 30 nt, at least about 35 nt or at least about 40 nt.
  • the nucleotide sequence of the guide nucleic acid that is complementary to a nucleotide sequence (target sequence) of the target nucleic acid can have a length of from about 12 nucleotides (nt) to about 80 nt, from about 12 nt to about 50 nt, from about 12 nt to about 45 nt, from about 12 nt to about
  • nt from about 20 nt to about 50 nt, or from about 20 nt to about 60 nt.
  • a protospacer sequence of a target polynucleotide can be identified by identifying a PAM within a region of interest and selecting a region of a desired size upstream or downstream of the PAM as the protospacer.
  • a corresponding spacer sequence can be designed by determining the complementary sequence of the protospacer region.
  • a spacer sequence can be identified using a computer program (e.g., machine readable code).
  • the computer program can use variables such as predicted melting temperature, secondary structure formation, and predicted annealing temperature, sequence identity, genomic context, chromatin accessibility, % GC, frequency of genomic occurrence, methylation status, presence of SNPs, and the like.
  • the percent complementarity between the nucleic acid-targeting sequence (e.g., spacer sequence) and the target nucleic acid (e.g., protospacer) can be at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100%.
  • the percent complementarity between the nucleic acid-targeting sequence and the target nucleic acid can be at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% over about 20 contiguous nucleotides.
  • the Cas protein-binding segment of a guide nucleic acid can comprise two stretches of nucleotides (e.g., crRNA and tracrRNA) that are complementary to one another.
  • the two stretches of nucleotides (e.g., crRNA and tracrRNA) that are complementary to one another can be covalently linked by intervening nucleotides (e.g., a linker in the case of a single guide nucleic acid).
  • the crRNA and the tracrRNA can be covalently linked via the 3’ end of the crRNA and the 5’ end of the tracrRNA.
  • tracrRNA and crRNA can be covalently linked via the 5’ end of the tracrRNA and the 3’ end of the crRNA.
  • the Cas protein binding segment of a guide nucleic acid can have a length of from about 10 nucleotides to about 100 nucleotides, e.g., from about 10 nucleotides (nt) to about 20 nt, from about 20 nt to about 30 nt, from about 30 nt to about 40 nt, from about 40 nt to about 50 nt, from about 50 nt to about 60 nt, from about 60 nt to about 70 nt, from about 70 nt to about 80 nt, from about 80 nt to about 90 nt, or from about 90 nt to about 100 nt.
  • the Cas protein binding segment of a guide nucleic acid can have a length of from about 15 nucleotides (nt) to about 80 nt, from about 15 nt to about 50 nt, from about 15 nt to about 40 nt, from about 15 nt to about 30 nt or from about 15 nt to about 25 nt.
  • the dsRNA duplex of the Cas protein-binding segment of the guide nucleic acid can have a length from about 6 base pairs (bp) to about 50 bp.
  • the dsRNA duplex of the protein-binding segment can have a length from about 6 bp to about 40 bp, from about 6 bp to about 30 bp, from about 6 bp to about 25 bp, from about 6 bp to about 20 bp, from about 6 bp to about 15 bp, from about 8 bp to about 40 bp, from about 8 bp to about 30 bp, from about 8 bp to about 25 bp, from about 8 bp to about 20 bp or from about 8 bp to about 15 bp.
  • the dsRNA duplex of the Cas protein-binding segment can have a length from about from about 8 bp to about 10 bp, from about 10 bp to about 15 bp, from about 15 bp to about 18 bp, from about 18 bp to about 20 bp, from about 20 bp to about 25 bp, from about 25 bp to about 30 bp, from about 30 bp to about 35 bp, from about 35 bp to about 40 bp, or from about 40 bp to about 50 bp.
  • the dsRNA duplex of the Cas protein-binding segment may have a length of 36 base pairs.
  • the percent complementarity between the nucleotide sequences that hybridize to form the dsRNA duplex of the protein-binding segment can be at least about 60%.
  • the percent complementarity between the nucleotide sequences that hybridize to form the dsRNA duplex of the protein-binding segment can be at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, or at least about 99%.
  • the percent complementarity between the nucleotide sequences that hybridize to form the dsRNA duplex of the protein-binding segment can be at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, or at least about 99%.
  • complementarity between the nucleotide sequences that hybridize to form the dsRNA duplex of the protein-binding segment is 100%.
  • the linker (e.g., that links a crRNA and a tracrRNA in a single guide nucleic acid) can have a length of from about 3 nucleotides to about 100 nucleotides.
  • the linker can have a length of from about 3 nucleotides (nt) to about 90 nt, from about 3 nucleotides (nt) to about 80 nt, from about 3 nucleotides (nt) to about 70 nt, from about 3 nucleotides (nt) to about 60 nt, from about 3 nucleotides (nt) to about 50 nt, from about 3 nucleotides (nt) to about 40 nt, from about 3 nucleotides (nt) to about 30 nt, from about 3 nucleotides (nt) to about 20 nt or from about 3 nucleotides (nt) to about 10 nt.
  • the linker can have a length of from about 3 nt to about 5 nt, from about 5 nt to about 10 nt, from about 10 nt to about 15 nt, from about 15 nt to about 20 nt, from about 20 nt to about 25 nt, from about 25 nt to about 30 nt, from about 30 nt to about 35 nt, from about 35 nt to about 40 nt, from about 40 nt to about 50 nt, from about 50 nt to about 60 nt, from about 60 nt to about 70 nt, from about 70 nt to about 80 nt, from about 80 nt to about 90 nt, or from about 90 nt to about 100 nt.
  • the linker of a DNA- targeting RNA is 4 nt.
  • Guide nucleic acids of the disclosure can include modifications or sequences that provide for additional desirable features (e.g., modified or regulated stability; subcellular targeting;
  • RNA e.g., a 5' cap (a 7- methylguanylate cap (m7G)); a 3' polyadenylated tail (a 3' poly(A) tail); a riboswitch sequence (e.g., to allow for regulated stability and/or regulated accessibility by proteins and/or protein complexes); a stability control sequence; a sequence that forms a dsRNA duplex (a hairpin)); a modification or sequence that targets the RNA to a subcellular location (e.g., nucleus, mitochondria,
  • a subcellular location e.g., nucleus, mitochondria,
  • chloroplasts and the like
  • a modification or sequence that provides for tracking e.g., direct conjugation to a fluorescent molecule, conjugation to a moiety that facilitates fluorescent detection, a sequence that allows for fluorescent detection, and so forth
  • a modification or sequence that provides a binding site for proteins e.g., proteins that act on DNA, including transcriptional activators, transcriptional repressors, DNA methyl transferases, DNA
  • a guide nucleic acid can comprise one or more modifications (e.g., a base modification, a backbone modification), to provide the nucleic acid with a new or enhanced feature (e.g., improved stability).
  • a guide nucleic acid can comprise a nucleic acid affinity tag.
  • a nucleoside can be a base-sugar combination. The base portion of the nucleotide can be a heterocyclic base. The two most common classes of such heterocyclic bases are the purines and the pyrimidines.
  • Nucleotides can be nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside.
  • the phosphate group can be linked to the 2', the 3', or the 5' hydroxyl moiety of the sugar.
  • the phosphate groups can covalently link adjacent nucleosides to one another to form a linear polymeric compound.
  • the respective ends of this linear polymeric compound can be further joined to form a circular compound; however, linear compounds can be suitable.
  • linear compounds may have internal nucleotide base complementarity and may therefore fold in a manner as to produce a fully or partially double- stranded compound.
  • the phosphate groups may commonly be referred to as forming the internucleoside backbone of the guide nucleic acid.
  • the linkage or backbone of the guide nucleic acid can be a 3' to 5' phosphodiester linkage.
  • a guide nucleic acid can comprise a modified backbone and/or modified intemucleoside linkages.
  • Modified backbones can include those that retain a phosphorus atom in the backbone and those that do not have a phosphorus atom in the backbone.
  • Suitable modified guide nucleic acid backbones containing a phosphorus atom therein can include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates such as 3'- alkylene phosphonates, 5'-alkylene phosphonates, chiral phosphonates, phosphinates, phosphoramidates including 3 '-amino phosphoramidate and aminoalkylphosphoramidates, phosphorodiamidates, thionophosphoramidates, thionoalkylphosphonates,
  • thionoalkylphosphotriesters having normal 3'-5' linkages, 2'-5' linked analogs, and those having inverted polarity wherein one or more internucleotide linkages is a 3' to 3', a 5' to 5' or a 2' to 2' linkage.
  • Suitable guide nucleic acids having inverted polarity can comprise a single 3' to 3' linkage at the 3 '-most intemucleotide linkage (such as a single inverted nucleoside residue in which the nucleobase is missing or has a hydroxyl group in place thereof).
  • salts e.g., potassium chloride or sodium chloride
  • mixed salts e.g., sodium chloride
  • a guide nucleic acid can comprise a morpholino backbone structure.
  • a nucleic acid can comprise a 6-membered morpholino ring in place of a ribose ring.
  • a phosphorodiamidate or other non-phosphodiester internucleoside linkage replaces a phosphodiester linkage.
  • a guide nucleic acid can comprise polynucleotide backbones that are formed by short chain alkyl or cycloalkyl intemucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic intemucleoside linkages. These can include those having morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones;
  • formacetyl and thioformacetyl backbones methylene formacetyl and thioformacetyl backbones; riboacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH2 component parts.
  • a guide nucleic acid can comprise a nucleic acid mimetic.
  • the term“mimetic” can be intended to include polynucleotides wherein only the furanose ring or both the furanose ring and the intemucleotide linkage are replaced with non-furanose groups, replacement of only the furanose ring can also be referred as being a sugar surrogate.
  • the heterocyclic base moiety or a modified heterocyclic base moiety can be maintained for hybridization with an appropriate target nucleic acid.
  • One such nucleic acid can be a peptide nucleic acid (PNA).
  • the sugar- backbone of a polynucleotide can be replaced with an amide containing backbone, in particular an aminoethylglycine backbone.
  • the nucleotides can be retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone.
  • the backbone in PNA compounds can comprise two or more linked aminoethylglycine units which gives PNA an amide containing backbone.
  • the heterocyclic base moieties can be bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone.
  • a guide nucleic acid can comprise linked morpholino units (morpholino nucleic acid) having heterocyclic bases attached to the morpholino ring.
  • Linking groups can link the morpholino monomeric units in a morpholino nucleic acid.
  • Non-ionic morpholino-based oligomeric compounds can have less undesired interactions with cellular proteins.
  • Morpholino- based polynucleotides can be non-ionic mimics of guide nucleic acids.
  • a variety of compounds within the morpholino class can be joined using different linking groups.
  • a further class of polynucleotide mimetic can be referred to as cyclohexenyl nucleic acids (CeNA).
  • the furanose ring normally present in a nucleic acid molecule can be replaced with a cyclohexenyl ring.
  • CeNA DMT protected phosphoramidite monomers can be prepared and used for oligomeric compound synthesis using phosphoramidite chemistry.
  • the incorporation of CeNA monomers into a nucleic acid chain can increase the stability of a DNA/RNA hybrid.
  • CeNA oligoadenylates can form complexes with nucleic acid complements with similar stability to the native complexes.
  • a further modification can include Locked Nucleic Acids (LNAs) in which the 2'- hydroxyl group is linked to the 4' carbon atom of the sugar ring thereby forming a 2'-C,4'-C- oxymethylene linkage thereby forming a bicyclic sugar moiety.
  • LNAs Locked Nucleic Acids
  • the linkage can be a methylene (-CH2-), group bridging the 2' oxygen atom and the 4' carbon atom wherein n is 1 or 2.
  • a guide nucleic acid can comprise one or more substituted sugar moieties.
  • Suitable polynucleotides can comprise a sugar substituent group selected from: OH; F; 0-, S-, or N-alkyl; 0-, S-, or N-alkenyl; 0-, S- or N-alkynyl; or O-alkyl -O-alkyl, wherein the alkyl, alkenyl and alkynyl may be substituted or unsubstituted Cl to CIO alkyl or C2 to CIO alkenyl and alkynyl.
  • n and m are from 1 to about 10.
  • a sugar substituent group can be selected from: Cl to CIO lower alkyl, substituted lower alkyl, alkenyl, alkynyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, S02CH3, 0N02, N02, N3, NH2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of an guide nucleic acid, or a group for improving the pharmacodynamic properties of an guide nucleic acid, and other substituents having similar properties.
  • a suitable modification can include T -methoxy ethoxy (2'- 0-CH2 CH20CH3, also known as 2’-0-(2-methoxyethyl) or 2’- MOE, an alkoxyalkoxy group).
  • a further suitable modification can include 2’-dimethylaminooxyethoxy, (a 0(CH2)20N(CH3)2 group, also known as 2’-DMAOE), and T - dimethylaminoethoxyethoxy (also known as 2’-0- dimethyl-amino-ethoxy-ethyl or T- DMAEOE), 2 , -0-CH2-0-CH2-N(CH3)2.
  • T- sugar substituent groups may be in the arabino (up) position or ribo (down) position.
  • a suitable T- arabino modification is 2’-F.
  • Similar modifications may also be made at other positions on the oligomeric compound, particularly the 3’ position of the sugar on the 3’ terminal nucleoside or in 2’-5’ linked nucleotides and the 5’ position of 5’ terminal nucleotide.
  • Oligomeric compounds may also have sugar mimetics such as cyclobutyl moieties in place of the
  • a guide nucleic acid may also include nucleobase (or“base”) modifications or substitutions.
  • “unmodified” or“natural” nucleobases can include the purine bases, (e.g. adenine (A) and guanine (G)), and the pyrimidine bases, (e.g. thymine (T), cytosine (C) and uracil (El)).
  • Modified nucleobases can include tricyclic pyrimidines such as phenoxazine cytidine(lH- pyrimido(5,4-b)(l,4)benzoxazin-2(3H)-one), phenothiazine cytidine (lH-pyrimido(5,4- b)(l,4)benzothiazin-2(3H)-one), G-clamps such as a substituted phenoxazine cytidine (e.g.
  • Heterocyclic base moieties can include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2- aminopyridine and 2-pyridone.
  • Nucleobases can be useful for increasing the binding affinity of a polynucleotide compound. These can include 5-substituted pyrimidines, 6- azapyrimidines and N-2, N-6 and 0-6 substituted purines, including 2-aminopropyladenine, 5- propynyluracil and 5- propynyl cytosine. 5-methylcytosine substitutions can increase nucleic acid duplex stability by 0.6-1.2° C and can be suitable base substitutions (e.g., when combined with 2'-0-methoxyethyl sugar modifications).
  • a modification of a guide nucleic acid can comprise chemically linking to the guide nucleic acid one or more moieties or conjugates that can enhance the activity, cellular distribution or cellular uptake of the guide nucleic acid.
  • moieties or conjugates can include conjugate groups covalently bound to functional groups such as primary or secondary hydroxyl groups.
  • Conjugate groups can include, but are not limited to, intercalators, reporter molecules, polyamines, polyamides, polyethylene glycols, polyethers, groups that enhance the
  • Conjugate groups can include, but are not limited to, cholesterols, lipids, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and dyes.
  • Groups that enhance the pharmacodynamic properties include groups that improve uptake, enhance resistance to degradation, and/or strengthen sequence- specific hybridization with the target nucleic acid.
  • Groups that can enhance the pharmacokinetic properties include groups that improve uptake, distribution, metabolism or excretion of a nucleic acid.
  • Conjugate moieties can include but are not limited to lipid moieties such as a cholesterol moiety, cholic acid a thioether, (e.g., hexyl-S-tritylthiol), a thiocholesterol, an aliphatic chain (e.g., dodecandiol or undecyl residues), a phospholipid (e.g., di-hexadecyl-rac-glycerol or triethylammonium l,2-di-0-hexadecyl-rac-glycero-3-H-phosphonate), a polyamine or a polyethylene glycol chain, or adamantane acetic acid, a palmityl moiety, or an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety.
  • lipid moieties such as a cholesterol moiety, cholic acid a thioether, (e
  • a fusion polypeptide or a polynucleotide encoding the fusion polypeptide can be introduced into the cells for targeting mutations and for delivering
  • At least one binding domain can be fused to at least one effector domain.
  • a binding domain can be fused with at least two, three, four, five, ten, or more effector domains.
  • the effector domains can be inactive when fused to the binding domains.
  • the inactive effector domains can be activated when each of the fused inactive effector domain come into close proximity or direct contact due to the binding domains targeting and binding the nucleic acid sequences on the target polynucleotides in the cells.
  • compositions, systems or methods of the disclosure comprise three or more fusion polypeptides (e.g., comprising a nucleic acid binding domain) that target and bind three of more nucleic acid sequences on a target polynucleotide, for example, a first, second and third nucleic acid sequence.
  • the second nucleic acid sequence is at least 5 nucleotide bases upstream from a 5’ end of the first nucleic acid sequence.
  • the second nucleic acid sequence is at least: 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16,
  • the third nucleic acid sequence is at least 5 nucleotide bases downstream from a 3’ end of the first nucleic acid sequence. In some embodiments, the third nucleic acid sequence is at least: 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotide bases downstream from a 3’ end of the first nucleic acid sequence.
  • compositions, systems or methods of the disclosure comprise two or more fusion polypeptides (e.g., comprising a nucleic acid binding domain) that target and bind three of more nucleic acid sequences on a target polynucleotide, for example, a first and a second nucleic acid sequence.
  • the second nucleic acid sequence is at least 5 nucleotide bases upstream from a 5’ end of the first nucleic acid sequence.
  • the second nucleic acid sequence is at least: 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16,
  • the second nucleic acid sequence is at least 5 nucleotide bases downstream from a 3’ end of the first nucleic acid sequence. In some embodiments, the second nucleic acid sequence is at least: 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotide bases downstream from a 3’ end of the first nucleic acid sequence.
  • compositions, systems or methods of the disclosure comprise at least two nucleic acid guided-nucleic acid binding domains to target at least two nucleic acids on the target polynucleotide.
  • the at least two nucleic acid guided-nucleic acid binding domains can be guided by the guide nucleic acids (e.g. gRNA) to at least two gRNA bindings sites on the at least two nucleic acid sequences on the target polynucleotide.
  • the at least two gRNA binding sites can be separated by at least 1 nt to 10,000 nt.
  • the at least two gRNA binding sites can be separated by at least 1 nt to 2 nt, 1 nt to 3 nt, 1 nt to 4 nt, 1 nt to 5 nt, 1 nt to 10 nt, 1 nt to 20 nt, 1 nt to 50 nt, 1 nt to 100 nt, 1 nt to 500 nt, 1 nt to 1,000 nt, 1 nt to 10,000 nt, 2 nt to 3 nt, 2 nt to 4 nt, 2 nt to 5 nt, 2 nt to 10 nt,
  • the at least two gRNA binding sites can be separated by at least 1 nt, 2 nt, 3 nt, 4 nt, 5 nt, 10 nt, 20 nt, 50 nt, 100 nt, 500 nt, 1,000 nt, or 10,000 nt. In some embodiments, the at least two gRNA binding sites can be separated by at least 1 nt, 2 nt, 3 nt, 4 nt, 5 nt, 10 nt, 20 nt, 50 nt, 100 nt, 500 nt, or 1,000 nt.
  • the at least two gRNA binding sites can be separated by at most 2 nt, 3 nt, 4 nt, 5 nt, 10 nt, 20 nt, 50 nt, 100 nt, 500 nt, 1,000 nt, or 10,000 nt.
  • the at least two nucleic acid guided-nucleic acid binding domains can be guided by the guide nucleic acids (e.g. gRNA) to at least two bindings sites on the at least two nucleic acids on the target polynucleotide, where the at least two gRNA binding sites can be separated by at most 1 nt to 10,000 nt.
  • guide nucleic acids e.g. gRNA
  • the at least two gRNA binding sites can be separated by at most 1 nt to 2 nt, 1 nt to 3 nt, 1 nt to 4 nt, 1 nt to 5 nt, 1 nt to 10 nt, 1 nt to 20 nt, 1 nt to 50 nt, 1 nt to 100 nt, 1 nt to 500 nt, 1 nt to 1,000 nt, 1 nt to 10,000 nt, 2 nt to 3 nt, 2 nt to 4 nt, 2 nt to 5 nt, 2 nt to 10 nt, 2 nt to 20 nt, 2 nt to 50 nt, 2 nt to 100 nt, 2 nt to 500 nt,
  • the at least two gRNA binding sites can be separated by at most 1 nt, 2 nt, 3 nt, 4 nt, 5 nt, 10 nt, 20 nt, 50 nt, 100 nt, 500 nt, 1,000 nt, or 10,000 nt.
  • the at least two gRNA binding sites can be separated by at most at least 1 nt, 2 nt, 3 nt, 4 nt, 5 nt, 10 nt, 20 nt, 50 nt, 100 nt, 500 nt, or 1,000 nt. In some embodiments, the at least two gRNA binding sites can be separated by at most at most 2 nt, 3 nt, 4 nt, 5 nt, 10 nt, 20 nt, 50 nt, 100 nt, 500 nt, 1,000 nt, or 10,000 nt.
  • compositions, systems or methods of the disclosure comprise three or more nucleic acid guided-nucleic acid binding domains fused to three or more effector domains to target and bind to three nucleic acids on the target polynucleotide.
  • the three nucleic acid guided-nucleic acid binding domains are each independently guided by a guide nucleic acid (e.g. gRNA) to target three gRNA binding sites on the three nucleic acid sequences on the target polynucleotide.
  • a guide nucleic acid e.g. gRNA
  • the second gRNA binding site can be at least 1 nt, 2 nt, 5 nt, 10 nt, 20 nt, 50 nt, 100 nt, 500 nt, 1,000 nt, or 10,000 nt upstream from a 5’ end of the first gRNA binding site. In some embodiments, the second gRNA binding site can be at most 1 nt, 2 nt, 5 nt, 10 nt, 20 nt, 50 nt, 100 nt, 500 nt, 1,000 nt, or 10,000 nt upstream from a 5’ end of the first gRNA binding site.
  • the second gRNA binding site can be at least 1 nt, 2 nt, 5 nt, 10 nt, 20 nt, 50 nt, 100 nt, 500 nt, 1,000 nt, or 10,000 nt downstream from a 3’ end of the first gRNA binding site. In some embodiments, the second gRNA binding site can be at most 1 nt, 2 nt, 5 nt, 10 nt, 20 nt, 50 nt, 100 nt, 500 nt, 1,000 nt, or 10,000 nt downstream from a 3’ end of the first gRNA binding site.
  • the third gRNA binding site can be at least 1 nt, 2 nt, 5 nt, 10 nt, 20 nt, 50 nt, 100 nt, 500 nt, 1,000 nt, or 10,000 nt upstream from a 5’ end of the first gRNA binding site. In some embodiments, the third gRNA binding site can be at most 1 nt, 2 nt, 5 nt,
  • the third gRNA binding site can be at least 1 nt, 2 nt, 5 nt, 10 nt, 20 nt, 50 nt, 100 nt, 500 nt, 1,000 nt, or 10,000 nt downstream from a 3’ end of the first gRNA binding site.
  • the third gRNA binding site can be at most 1 nt, 2 nt, 5 nt, 10 nt, 20 nt, 50 nt, 100 nt, 500 nt, 1,000 nt, or 10,000 nt downstream from a 3’ end of the first gRNA binding site.
  • At least two nucleic acid guided-nucleic acid binding domains each independently fused with an effector domain can be introduced into a cell to target and bind to a target polynucleotide. In some cases, at least two nucleic acid guided-nucleic acid binding domains each independently fused with an effector domain can deliver therapeutics or therapeutic effects into a cell. In some embodiments, three nucleic acid guided-nucleic acid binding domains each fused with an effector domain can be introduced into a cell to target and bind to a target polynucleotide.
  • the three nucleic acid guided-nucleic acid binding domains each fused with an inactive effector domain can be introduced into a cell to deliver therapeutics or therapeutic effects via the activation of the effector domains when the effector domains are in close proximity or in direct contact due to the binding domains binding to the target polynucleotide.
  • the targeting of the target polynucleotide with three or more fusion polypeptides each comprising a binding domain can be more specific or accurate than the targeting of the same target polynucleotide with only two fusion polypeptides each comprising a binding domain.
  • the specificity of targeting of the target polynucleotide with three nucleic acid guided-nucleic acid binding domain fusions compared to the specificity of targeting of the target polynucleotide with only two nucleic acid guided-nucleic acid binding domain fusions can be increased by about 0.1 fold to about 1,000 fold.
  • the specificity of targeting of the target polynucleotide with three nucleic acid guided-nucleic acid binding domains compared to the specificity of targeting of the target polynucleotide with only two nucleic acid guided-nucleic acid binding domains can be increased by about 0.1 fold to about 0.2 fold, about 0.1 fold to about 0.5 fold, about 0.1 fold to about 1 fold, about 0.1 fold to about 5 fold, about 0.1 fold to about 10 fold, about 0.1 fold to about 20 fold, about 0.1 fold to about 50 fold, about 0.1 fold to about 100 fold, about 0.1 fold to about 500 fold, about 0.1 fold to about 1,000 fold, about 0.2 fold to about 0.5 fold, about 0.2 fold to about 1 fold, about 0.2 fold to about 5 fold, about 0.2 fold to about 10 fold, about 0.2 fold to about 20 fold, about 0.2 fold to about 50 fold, about 0.2 fold to about 100 fold, about 0.2 fold to about 500 fold, about 0.2 fold to about 1,000 fold, about 0.5 fold to about
  • the specificity of targeting of the target polynucleotide with three nucleic acid guided-nucleic acid binding domain fusions compared to the specificity of targeting of the target polynucleotide with only two nucleic acid guided-nucleic acid binding domain fusions can be increased by about 0.1 fold, about 0.2 fold, about 0.5 fold, about 1 fold, about 5 fold, about 10 fold, about 20 fold, about 50 fold, about 100 fold, about 500 fold, or about 1,000 fold.
  • the specificity of targeting of the target polynucleotide with three nucleic acid guided-nucleic acid binding domains compared to the specificity of targeting of the target polynucleotide with only two nucleic acid guided-nucleic acid binding domains can be increased by at least about 0.1 fold, about 0.2 fold, about 0.5 fold, about 1 fold, about 5 fold, about 10 fold, about 20 fold, about 50 fold, about 100 fold, or about 500 fold.
  • the specificity of targeting of the target polynucleotide with three nucleic acid guided-nucleic acid binding domains compared to the specificity of targeting of the target polynucleotide with only two nucleic acid guided-nucleic acid binding domains can be increased by at most about 0.2 fold, about 0.5 fold, about 1 fold, about 5 fold, about 10 fold, about 20 fold, about 50 fold, about 100 fold, about 500 fold, or about 1,000 fold.
  • the therapeutic effects of the three or more nucleic acid guided- nucleic acid binding domains each independently fused with an effector domain based on the targeting and binding of the targeted polynucleotide can be increased when compared to the therapeutic effects of only two nucleic acid guided-nucleic acid binding domains each independent fused with an effector domain.
  • the therapeutic effect is cell death of the diseased cells, such as cancer cells.
  • the therapeutic efficiency of the three nucleic acid guided-nucleic acid binding domain fusions is greater compared to the therapeutic efficiency of only two nucleic acid guided-nucleic acid binding domain fusions and may be greater by, for example, about 0.1 fold to about 1,000 fold.
  • the therapeutic efficiency of the three or more nucleic acid guided-nucleic acid binding domain fusions compared to the efficiency of only two nucleic acid guided-nucleic acid binding domain fusions can be greater by about 0.1 fold to about 0.2 fold, about 0.1 fold to about 0.5 fold, about 0.1 fold to about 1 fold, about 0.1 fold to about 5 fold, about 0.1 fold to about 10 fold, about 0.1 fold to about 20 fold, about 0.1 fold to about 50 fold, about 0.1 fold to about 100 fold, about 0.1 fold to about 500 fold, about 0.1 fold to about 1,000 fold, about 0.2 fold to about 0.5 fold, about 0.2 fold to about 1 fold, about 0.2 fold to about 5 fold, about 0.2 fold to about 10 fold, about 0.2 fold to about 20 fold, about 0.2 fold to about 50 fold, about 0.2 fold to about 100 fold, about 0.2 fold to about 500 fold, about 0.2 fold to about 1,000 fold, about 0.5 fold to about 1 fold, about 0.5 fold to about 5 fold, about 0.2 fold to about 10 fold, about
  • the therapeutic efficiency of the three or more nucleic acid guided-nucleic acid binding domain fusions compared to the therapeutic efficiency of only two nucleic acid guided-nucleic acid binding domain fusion can be increased by about 0.1 fold, about 0.2 fold, about 0.5 fold, about 1 fold, about 5 fold, about 10 fold, about 20 fold, about 50 fold, about 100 fold, about 500 fold, or about 1,000 fold.
  • the therapeutic efficiency of the three or more nucleic acid guided-nucleic acid binding domain fusions compared to the therapeutic efficiency of only two nucleic acid guided-nucleic acid binding domain fusions can be increased by at least about 0.1 fold, about 0.2 fold, about 0.5 fold, about 1 fold, about 5 fold, about 10 fold, about 20 fold, about 50 fold, about 100 fold, or about 500 fold.
  • the therapeutic efficiency of the three or more nucleic acid guided-nucleic acid binding domain fusions compared to the therapeutic efficiency of only two nucleic acid guided-nucleic acid binding domain fusions can be increased by at most about 0.2 fold, about 0.5 fold, about 1 fold, about 5 fold, about 10 fold, about 20 fold, about 50 fold, about 100 fold, about 500 fold, or about 1,000 fold.
  • the systems, methods, or compositions of the disclosure comprising three of more fusion polypeptides can comprise greater efficiency for inducing cell death relative to a composition that comprises two fusion polypeptides.
  • the systems, methods, or compositions of the disclosure comprising three of more fusion polypeptides can comprise greater efficiency for inducing cell death relative to a composition that comprises two fusion polypeptides.
  • the systems, methods, or compositions of the disclosure comprising three of more fusion polypeptides e.g., effector fusion polypeptides comprising a binding domain and an effector domain
  • polypeptides can comprise at least about 5% greater efficiency for inducing cell death relative to a composition that comprises two fusion polypeptides.
  • the systems, methods, or compositions of the disclosure comprising three of more fusion polypeptides can comprise at least about: 1 %, 2%, 3%, 4%, 5%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 99% greater efficiency for inducing cell death relative to a composition that comprises two fusion polypeptides.
  • the systems, methods, or compositions of the disclosure comprising three of more fusion polypeptides can comprise greater specificity (e.g., for targeting a desired nucleic acid sequence vs an off target; targeting a cancer cell vs a normal cell) relative to a composition that comprises two fusion polypeptides.
  • the systems, methods, or compositions of the disclosure comprising three of more fusion polypeptides can comprise at least about: 1 %, 2%, 3%, 4%, 5%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 99% greater specificity (e.g., for targeting a desired nucleic acid sequence vs an off target, or targeting a cancer cell vs a normal cell) relative to a composition that comprises two fusion polypeptides.
  • the peptide sequences on the target polypeptide comprise antigens or a fragment thereof. In some cases, these antigens can be associated with a disease or a disorder. In some cases, these antigens can be expressed by cancer cells. In some embodiments, the peptide sequences on the target polypeptide comprise neoantigens a fragment thereof associated with a disease or a disorder. In some instances, these neoantigens can be expressed by cancer cells. In some cases, the peptide sequence binding domains can be antibodies. In some cases, the peptide sequence binding domains can be antibody fragments.
  • Illustrative peptide sequence binding domains can include monovalent Fab’, a divalent Fab2, F(ab)' 3 fragment, single-chain variable fragment (scFv), bis-scFv, (scFv)2, diabody, minibody, nanobody, triabody, tetrabody, disulfide stabilized Fv protein ("dsFv”), single-domain antibody (sdantibody), Ig NAR, camelid antibody or binding fragment thereof, bispecific antibody or biding fragment thereof, or a chemically modified derivative thereof.
  • monovalent Fab a divalent Fab2, F(ab)' 3 fragment, single-chain variable fragment (scFv), bis-scFv, (scFv)2, diabody, minibody, nanobody, triabody, tetrabody, disulfide stabilized Fv protein ("dsFv”), single-domain antibody (sdantibody), Ig NAR, camelid antibody or binding fragment thereof, bispecific antibody or biding fragment thereof, or
  • the effector domains fused to the peptide sequence binding domains can be introduced into a cell to deliver therapeutics or therapeutic effects.
  • the fused effectors can be inactive and can be activated when the inactive effector domains are in close proximity or in direct contact to another inactive effector domain due to the binding domains binding to the target peptide sequence.
  • the compositions, systems or methods of the disclosure comprise at least two peptide sequence binding domains each independently fused with an effector domain to target and bind to a target peptide sequence on a target polypeptide.
  • At least two peptide sequence binding domains each independently fused with an effector domain can deliver therapeutics or therapeutic effects into the cell.
  • three or more peptide sequence binding domains each fused with an effector domain can be introduced into a cell to target and bind to a target peptide sequence.
  • the three or more peptide sequence binding domains each fused with an inactive effector domain can be introduced into a cell to deliver therapeutics or therapeutic effects via the activation of the effector domains when the effector domains are in close proximity or in direct contact due to the peptide sequence binding domains binding to the target peptide sequence on a target polypeptide.
  • the targeting of the target peptide sequence on a target polypeptide with three or more peptide sequence binding domains can be more specific or accurate than the targeting of the same target peptide sequences on the target polypeptide with only two peptide sequence binding domains.
  • the specificity of targeting of the target peptide sequence with three or more peptide sequence binding domains compared to the specificity of targeting of the target peptide sequence with only two peptide sequence binding domains can be increased by about 0.1 fold to about 1,000 fold.
  • the specificity of targeting of the target peptide sequence with three or more peptide sequence binding domains compared to the specificity of targeting of the target peptide sequence with only two peptide sequence binding domains can be increased by about 0.1 fold to about 0.2 fold, about 0.1 fold to about 0.5 fold, about 0.1 fold to about 1 fold, about 0.1 fold to about 5 fold, about 0.1 fold to about 10 fold, about 0.1 fold to about 20 fold, about 0.1 fold to about 50 fold, about 0.1 fold to about 100 fold, about 0.1 fold to about 500 fold, about 0.1 fold to about 1,000 fold, about 0.2 fold to about 0.5 fold, about 0.2 fold to about 1 fold, about 0.2 fold to about 5 fold, about 0.2 fold to about 10 fold, about 0.2 fold to about 20 fold, about 0.2 fold to about 50 fold, about 0.2 fold to about 100 fold, about 0.2 fold to about 500 fold, about 0.2 fold to about 1,000 fold, about 0.5 fold to about 1 fold, about 0.5 fold to about 5 fold, about 0.2 fold to about 10 fold, about
  • the specificity of targeting of the target peptide sequence on a target polypeptide with three or more peptide sequence binding domains compared to the specificity of targeting of the target peptide sequence with only two peptide sequence binding domains can be increased by about 0.1 fold, about 0.2 fold, about 0.5 fold, about 1 fold, about 5 fold, about 10 fold, about 20 fold, about 50 fold, about 100 fold, about 500 fold, or about 1,000 fold.
  • the specificity of targeting of the target peptide sequence on a target polypeptide with three or more peptide sequence binding domains compared to the specificity of targeting of the target peptide sequence with only two peptide sequence binding domains can be increased by at least about 0.1 fold, about 0.2 fold, about 0.5 fold, about 1 fold, about 5 fold, about 10 fold, about 20 fold, about 50 fold, about 100 fold, or about 500 fold.
  • the specificity of targeting of the target peptide sequence on a target polypeptide with three or more peptide sequence binding domains compared to the specificity of targeting of the target peptide sequence with only two peptide sequence binding domains can be increased by at most about 0.2 fold, about 0.5 fold, about 1 fold, about 5 fold, about 10 fold, about 20 fold, about 50 fold, about 100 fold, about 500 fold, or about 1,000 fold.
  • the therapeutics or therapeutic effects delivered by the three or more peptide sequence binding domains each independent fused with an effector domain based on the targeting and binding of the targeted peptide sequence on a target polypeptide can be increased when compared to the therapeutics or therapeutic effects delivered by only two peptide sequence binding domains each independent fused with an effector domain.
  • the therapeutic effect can be cell death of the diseased cells, such as cancer cells.
  • the efficiency of delivering the therapeutics or therapeutic effects by the three or more peptide sequence binding domains compared to the efficiency of delivering the
  • the efficiency of delivering the therapeutics or therapeutic effects by the three or more peptide sequence binding domains compared to the efficiency of delivering the therapeutics or therapeutic effects by only two peptide sequence binding domains can be increased by about 0.1 fold to about 0.2 fold, about 0.1 fold to about 0.5 fold, about 0.1 fold to about 1 fold, about 0.1 fold to about 5 fold, about 0.1 fold to about 10 fold, about 0.1 fold to about 20 fold, about 0.1 fold to about 50 fold, about 0.1 fold to about 100 fold, about 0.1 fold to about 500 fold, about 0.1 fold to about 1,000 fold, about 0.2 fold to about 0.5 fold, about 0.2 fold to about 1 fold, about 0.2 fold to about 5 fold, about 0.2 fold to about 10 fold, about 0.2 fold to about 20 fold, about 0.2 fold to about 50 fold, about 0.2 fold to about 100 fold, about 0.2 fold to about 500 fold, about 0.2 fold to about 500 fold, about 0.1 fold to about 1,000 fold, about 0.2 fold to about 0.5 fold, about 0.2 fold to about 1 fold, about
  • the efficiency of delivering the therapeutics or therapeutic effects by the three or more peptide sequence binding domains compared to the efficiency of delivering the therapeutics or therapeutic effects by only two peptide sequence binding domains can be increased by about 0.1 fold, about 0.2 fold, about 0.5 fold, about 1 fold, about 5 fold, about 10 fold, about 20 fold, about 50 fold, about 100 fold, about 500 fold, or about 1,000 fold.
  • the efficiency of delivering the therapeutics or therapeutic effects by the three or more peptide sequence binding domains compared to the efficiency of delivering the therapeutics or therapeutic effects by only two peptide sequence binding domains can be increased by at least about 0.1 fold, about 0.2 fold, about 0.5 fold, about 1 fold, about 5 fold, about 10 fold, about 20 fold, about 50 fold, about 100 fold, or about 500 fold. In some embodiments, the efficiency of delivering the therapeutics or therapeutic effects by the three or more peptide sequence binding domains compared to the efficiency of delivering the
  • therapeutics or therapeutic effects by only two peptide sequence binding domains can be increased by at most about 0.2 fold, about 0.5 fold, about 1 fold, about 5 fold, about 10 fold, about 20 fold, about 50 fold, about 100 fold, about 500 fold, or about 1,000 fold.
  • the target polynucleotide or the target polypeptide comprises at least one, two, three, four, five, ten, or more mutations.
  • the target polynucleotide can comprise coding sequence, non-coding sequence, or a combination there.
  • the combinations comprise one nucleic acid binding domain fusion and one peptide sequence binding domain fusion.
  • the combinations comprise three or more binding domain fusions, each can independently be a nucleic acid binding domain fusion or a peptide sequence binding domain fusion.
  • the combined three or more binding domains can each independently be fused with an effector domain.
  • the combined three or more binding domain fusions can each independently fused with an inactive effector domain, where the inactive effector domains can be activated via close proximity or by direct contact to another inactive effector domain due to the domain fusions binding to both target polynucleotide and target polypeptide sequence.
  • the targeting with the combination of three or more binding domain fusions can be more specific or accurate than the targeting with only two binding domain fusions.
  • the specificity of targeting with three or more binding domain fusions compared to the specificity of targeting with only two binding domain fusion domains can be increased by about 0.1 fold to about 1,000 fold.
  • the specificity of targeting of with three or more binding domain fusions compared to the specificity of targeting with only two binding domain fusions can be increased by about 0.1 fold to about 0.2 fold, about 0.1 fold to about 0.5 fold, about 0.1 fold to about 1 fold, about 0.1 fold to about 5 fold, about 0.1 fold to about 10 fold, about 0.1 fold to about 20 fold, about 0.1 fold to about 50 fold, about 0.1 fold to about 100 fold, about 0.1 fold to about 500 fold, about 0.1 fold to about 1,000 fold, about 0.2 fold to about 0.5 fold, about 0.2 fold to about 1 fold, about 0.2 fold to about 5 fold, about 0.2 fold to about 10 fold, about 0.2 fold to about 20 fold, about 0.2 fold to about 50 fold, about 0.2 fold to about 100 fold, about 0.2 fold to about 500 fold, about 0.2 fold to about 1,000 fold, about 0.5 fold to about 1 fold, about 0.5 fold to about 5 fold, about 0.5 fold to about 10 fold, about 0.2 fold to about 20 fold, about 0.2 fold to about 50 fold,
  • the specificity of targeting with three or more or more binding domain fusions compared to the specificity of targeting with only two binding domain fusions can be increased by about 0.1 fold, about 0.2 fold, about 0.5 fold, about 1 fold, about 5 fold, about 10 fold, about 20 fold, about 50 fold, about 100 fold, about 500 fold, or about 1,000 fold. In some embodiments, the specificity of targeting with three or more binding domain fusions compared to the specificity of targeting with only two binding domain fusions can be increased by at least about 0.1 fold, about 0.2 fold, about 0.5 fold, about 1 fold, about 5 fold, about 10 fold, about 20 fold, about 50 fold, about 100 fold, or about 500 fold.
  • the specificity of targeting of with three or more binding domain fusions compared to the specificity of targeting of with only two binding domain fusions can be increased by at most about 0.2 fold, about 0.5 fold, about 1 fold, about 5 fold, about 10 fold, about 20 fold, about 50 fold, about 100 fold, about 500 fold, or about 1,000 fold.
  • the therapeutics or therapeutic effects delivered by the three or more binding domains each independent fused with an effector domain based on the targeting and binding of both target polynucleotide and peptide sequence can be increased when compared to the therapeutics or therapeutic effects delivered by only two binding domains each
  • the therapeutic effect is cell death of the diseased cells, such as cancer cells.
  • the efficiency of delivering the therapeutics or therapeutic effects by the three or more binding domain fusions compared to the efficiency of delivering the therapeutics or therapeutic effects by only two binding domain fusions can be increased by about 0.1 fold to about 1,000 fold.
  • the efficiency of delivering the therapeutics or therapeutic effects by the three or more binding domain fusions compared to the efficiency of delivering the therapeutics or therapeutic effects by only two binding domain fusions can be increased by about 0.1 fold to about 0.2 fold, about 0.1 fold to about 0.5 fold, about 0.1 fold to about 1 fold, about 0.1 fold to about 5 fold, about 0.1 fold to about 10 fold, about 0.1 fold to about 20 fold, about 0.1 fold to about 50 fold, about 0.1 fold to about 100 fold, about 0.1 fold to about 500 fold, about 0.1 fold to about 1,000 fold, about 0.2 fold to about 0.5 fold, about 0.2 fold to about 1 fold, about 0.2 fold to about 5 fold, about 0.2 fold to about 10 fold, about 0.2 fold to about 20 fold, about 0.2 fold to about 50 fold, about 0.2 fold to about 100 fold, about 0.2 fold to about 500 fold, about 0.2 fold to about 1,000 fold, about 0.5 fold to about 1 fold, about 0.5 fold to about 5 fold, about 0.5 fold to about 10 fold, about 0.2 fold to about
  • the efficiency of delivering the therapeutics or therapeutic effects by three or more binding domain fusions compared to the efficiency of delivering the therapeutics or therapeutic effects by only two binding domains fusions can be increased by about 0.1 fold, about 0.2 fold, about 0.5 fold, about 1 fold, about 5 fold, about 10 fold, about 20 fold, about 50 fold, about 100 fold, about 500 fold, or about 1,000 fold.
  • the efficiency of delivering the therapeutics or therapeutic effects by the three or more binding domain fusions compared to the efficiency of delivering the therapeutics or therapeutic effects by only two binding domain fusions can be increased by at least about 0.1 fold, about 0.2 fold, about 0.5 fold, about 1 fold, about 5 fold, about 10 fold, about 20 fold, about 50 fold, about 100 fold, or about 500 fold.
  • the efficiency of delivering the therapeutics or therapeutic effects by the three or more binding domain fusions compared to the efficiency of delivering the therapeutics or therapeutic effects by only two binding domain fusions can be increased by at most about 0.2 fold, about 0.5 fold, about 1 fold, about 5 fold, about 10 fold, about 20 fold, about 50 fold, about 100 fold, about 500 fold, or about 1,000 fold.
  • the therapeutic effect comprises cytotoxicity in a cell.
  • the therapeutic effect comprises cell death.
  • the therapeutic effect can be inflammation.
  • the therapeutic effect can be an immune response.
  • the cell can be a diseased cell (e.g., cancer cell) or a cell comprising the targeted mutation associated with a disorder.
  • a fusion polypeptide (e.g., at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, or more fusion polypeptides) of the disclosure can generate an immune response, induce cell death, induce cytotoxicity, induce apoptosis, lead to inflammation, or a combination thereof in a cell.
  • a fusion polypeptide (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, or more fusion polypeptides) of the disclosure can generate an immune response, induce cell death, induce cytotoxicity, induce apoptosis, lead to inflammation, or a combination thereof in a population of cells.
  • the cell or population of cells can comprise one or mutations associated with a disorder.
  • the fusion polypeptide comprises an effector domain in an inactive state.
  • the inactive effector domain when activated, induces cell death, cytotoxicity, an immune response or a combination thereof.
  • the inactive effector domain can be fused to a nucleic acid binding domain or a peptide sequence binding domain.
  • An inactive effector domain can be a split portion of an effector domain that is activated when the split portions combine.
  • An inactive effector domain can be a monomer of a multimeric (e.g., dimer, trimer) effector domain that is activated when the multimer (e.g., dimer or trimer) is formed.
  • an effector domain can be activated when the inactive effector domains come together in close proximity or in direct contact with each other , for example split portions coming together or multimerization of inactive effector domains.
  • An effector domain can comprise a cytotoxic protein.
  • An effector domain can comprise a protein that induces cell death.
  • An effector domain can comprise a protein that induces an immune response.
  • An effector domain can comprise an immunogenic protein.
  • An effector domain can comprise a pro-apoptotic protein.
  • effector domains suitable for use with the fusion polypeptides of the disclosure include: FAS, FASLG, TNFRSFIOA, TNFRSF10B, TNFRSFIOC,
  • TNFRSF10D TNFRSFl lB
  • TNFSFIO TNFRSFIA
  • TNFRSFIA TNF
  • FADD CFLAR
  • Caspases CASP1, CASP2, CASP3, CASP4, CASP5, CASP6, CASP7, CASP8, CASP9, CASP10, CASP14, IAPs family, NAIP, BIRC2, BIRC3, XIAP, BIRC5, BIRC6, BIRC7, BCL2, MCL1, BCL2L1, BCL2L2, BCL2A1, BCL2L10, BAX, BAK1, BAK, BOK, BH3-only members, BID, BCL2L11, BMF, BAD, BIK, HRK, PMAIP1, BNIP3, BNIP3L, BCL2L14, BBC3, BCL2L12, BCL2L13, APAFl, Cytochrome C, DIABLO, HTRA2, AIFMl, ENDOG, or fragments thereof.
  • the effector domain comprises a caspase.
  • caspases include Caspase 1, Caspase 2, Caspase 3, Caspase 4, Caspase 5, Caspase 6, Caspase 7, Caspase 8, Caspase 9, Caspase 10, Caspase 11, Caspase 12, Caspase 13, Caspase 14, or a fragment thereof.
  • the effector domain comprises a caspase 1.
  • the effector domain can be a toxin or a fragments of a toxin.
  • Illustrative toxins can include Ricin, Abrin, Mistletoe lectin, Modeccin, pokeweed antiviral protein (PAP), Saporin, Bryodinl, Bouganin, Gelonin, Diphtheria toxin (DT), Pseudomonas exotoxin (PE), Xytolysin equinatoxin II, CytA-d-endotoxin from the bacterium Bacillus thuringiensis
  • the effector domains can comprise a protein that convert a prodrug into a toxic compound.
  • the effector domain can comprise a prodrug.
  • Illustrative proteins that can convert prodrugs can include thymidine kinase, penicillin-V-amidase, penicillin-G- amidase, beta-lactamase, carboxypeptidase A, linamarase (also referred to as b-glucosidase), the E. coli gpt gene product, the E.
  • coli Deo gene product a cytosine deaminase, a VSV-tk, IL-2, nitroreductase (NR), carboxyl esterase, beta-glucuronidase, cytochrome p450, beta-galactosidase, diphtheria toxin A-chain (DT-A), carboxypeptide G2 (CPG2), purine nucleoside phosphorylase (PNP), or deoxycytidine kinase (dCK).
  • NR nitroreductase
  • carboxyl esterase beta-glucuronidase
  • CPG2 carboxypeptide G2
  • PNP purine nucleoside phosphorylase
  • dCK deoxycytidine kinase
  • Illustrative prodrugs that can be converted can include FHBG (9-[4-fluoro-3-(hydroxymethyl)butyl]guanine), FHPG (9-([3-fluoro-l-hydroxy- propoxy]methyl)guanine), FGCV (fluoroganciclovir), FPCV (fluoropenciclovir), FIAU (l-(2'- deoxy-2'-fluoro-l-P-D-arabinofuranosyl)-5-iodouracil), FEAU (fluoro-5-ethyl-l-beta-D- arabinofuranosyluracil), FMAU (fluoro-5-methyl-l-beta-D-arabinofuranosyluracil), FHOMP (6- ((l-fluoro-3-hydroxypropan-2-yloxy)methyl)-5-methylpryrimidine-2,4(lH,3H)-dione), ganciclovir, valganciclovir, acycl
  • oxidoreductase 6-methoxypurine arabinoside for VZV-TK; 5-fluorocytosine for cytosine deaminase; doxorubicin for beta-glucuronidase; CB1954 and nitrofurazone for nitroreductase; or N-(Cyanoacetyl)-L-phenylalanine or N-(3-chloropropionyl)-L-phenylalanine for
  • the effectors domain can comprise compounds, small molecules, or other agents that can induce cytotoxicity.
  • Such effector domains can include radioisotopes, vinca alkaloids such as the vinblastine, vincristine and vindesine sulfates, adriamycin, bleomycin sulfate, carboplatin, cisplatin, cyclophosphamide, cytarabine, dacarbazine, dactinomycin, duanorubicin hydrochloride, doxorubicin hydrochloride, etoposide, fluorouracil, lomustine, mechlororethamine hydrochloride, melphalan, mercaptopurine, methotrexate, mitomycin, mitotane, pentostatin, pipobroman, procarbaze hydrochloride, streptozotocin, taxol, thioguanine, flourouracil (5-FU), cap
  • pentostatin/Nipent fludarabine phosphate, cladribine (2-CdA, 2-chlorodeoxyadenosine), floxuridine (5-fluoro-2), ribonucleotide Reductase Inhibitor (RNR), cyclophosphamide/Cytoxan (BMS), neosar, ifosfamide, thiotepa, BCNU- 1 ,3-bis(2-chloroethyl)-l-nitosourea, 1 ,-(2- chloroethyl)-3-cyclohexyl-lnitrosourea, methyl CCNU, hexamethylmelamine, busulfan, procarbazine HCL, dacarbazine (DTIC), chlorambucil, melphalan, cisplatin (Cisplatinum, CDDP), carboplatin, oxaliplatin, bendamustine, carmustine,
  • the effector domain can comprise antibodies or immune checkpoint modulators.
  • targets for antibodies or immune checkpoint modulators include PD-L1, PD-L2, PD-1, CTLA-4, LAG3, B7-H3; KIR; CD137; PS; 0X40; GITR; TIM3, CD52, CD30, CD20, CD33, CD27, ICOS, BTLA (CD272), CD160, 2B4, LAIRl, TIGHT, LIGHT, DR3, CD226, CD2, or SLAM.
  • the effector domain comprises a transcription factor or a transcriptional activators.
  • transcription factors or transcription activators can include GAL4, VP 16, VP64, p65 subdomain (NFkappaB), and VP64-p65-Rta (VPR).
  • the effector domain comprises a transcriptional repressor or an inhibitor of a transcriptional repressor.
  • At least one, two, three, four, five, or more effector domains can be fused to a binding domain. In some embodiments, at least one, two, three, four, five, or more effector domains can introduced into a cell. In some embodiments, the effector domains can be inactive prior to the targeting and the binding of the binding domains to the target polynucleotide or target polypeptide sequence. In some embodiments, the effector domains can be activated when one of the inactive effector domain is in close proximity or direct contact with another inactive effector domain.
  • the inactive effector domains can be activated when two or more of the inactive effector domains are within about 0.01 nm to about 5,000 nm distance from each other. In some embodiments, the inactive effector domains can be activated when two or more of the inactive effector domains are within about 0.01 nm to about 0.05 nm, about 0.01 nm to about 0.1 nm, about 0.01 nm to about 0.5 nm, about 0.01 nm to about 1 nm, about 0.01 nm to about 5 nm, about 0.01 nm to about 10 nm, about 0.01 nm to about 50 nm, about 0.01 nm to about 100 nm, about 0.01 nm to about 500 nm, about 0.01 nm to about 1,000 nm, about 0.01 nm to about 5,000 nm, about 0.05 nm to about 0.1 nm, about 0.05 nm to about 0.1 nm, about 0.05 nm
  • the inactive effector domains can be activated when two or more of the inactive effector domains are within about 0.01 nm, about 0.05 nm, about 0.1 nm, about 0.5 nm, about 1 nm, about 5 nm, about 10 nm, about 50 nm, about 100 nm, about 500 nm, about 1,000 nm, or about 5,000 nm.
  • the inactive effector domains can be activated when two or more of the inactive effector domains are within at least about 0.01 nm, about 0.05 nm, about 0.1 nm, about 0.5 nm, about 1 nm, about 5 nm, about 10 nm, about 50 nm, about 100 nm, about 500 nm, or about 1,000 nm. In some
  • the inactive effector domains can be activated when two or more of the inactive effector domains are within at most about 0.05 nm, about 0.1 nm, about 0.5 nm, about 1 nm, about 5 nm, about 10 nm, about 50 nm, about 100 nm, about 500 nm, about 1,000 nm, or about 5,000 nm.
  • the inactive effector domains can be activated when two or more of the inactive effector domains are within at least about 0.01 nm to about 5,000 nm. In some embodiments, the inactive effector domains can be activated when two or more of the inactive effector domains are within at least about 0.01 nm to about 0.05 nm, about 0.01 nm to about 0.1 nm, about 0.01 nm to about 0.5 nm, about 0.01 nm to about 1 nm, about 0.01 nm to about 5 nm, about 0.01 nm to about 10 nm, about 0.01 nm to about 50 nm, about 0.01 nm to about 100 nm, about 0.01 nm to about 500 nm, about 0.01 nm to about 1,000 nm, about 0.01 nm to about 5,000 nm, about 0.05 nm to about 0.1 nm, about 0.05 nm to about 0.5 n
  • the inactive effector domains can be activated when two or more of the inactive effector domains are within at least about 0.01 nm, about 0.05 nm, about 0.1 nm, about 0.5 nm, about 1 nm, about 5 nm, about 10 nm, about 50 nm, about 100 nm, about 500 nm, about 1,000 nm, or about 5,000 nm.
  • the inactive effector domains can be activated when two or more of the inactive effector domains are within at least at least about 0.01 nm, about 0.05 nm, about 0.1 nm, about 0.5 nm, about 1 nm, about 5 nm, about 10 nm, about 50 nm, about 100 nm, about 500 nm, or about 1,000 nm.
  • the inactive effector domains can be activated when two or more of the inactive effector domains are within at least at most about 0.05 nm, about 0.1 nm, about 0.5 nm, about 1 nm, about 5 nm, about 10 nm, about 50 nm, about 100 nm, about 500 nm, about 1,000 nm, or about 5,000 nm.
  • the inactive effector domains can be activated when two or more of the inactive effector domains are within at most about 0.01 nm to about 5,000 nm. In some embodiments, the inactive effector domains can be activated when two or more of the inactive effector domains are within at most about 0.01 nm to about 0.05 nm, about 0.01 nm to about 0.1 nm, about 0.01 nm to about 0.5 nm, about 0.01 nm to about 1 nm, about 0.01 nm to about 5 nm, about 0.01 nm to about 10 nm, about 0.01 nm to about 50 nm, about 0.01 nm to about 100 nm, about 0.01 nm to about 500 nm, about 0.01 nm to about 1,000 nm, about 0.01 nm to about 5,000 nm, about 0.05 nm to about 0.1 nm, about 0.05 nm to about 0.5 n
  • the inactive effector domains can be activated when two or more of the inactive effector domains are within at most about 0.01 nm, about 0.05 nm, about 0.1 nm, about 0.5 nm, about 1 nm, about 5 nm, about 10 nm, about 50 nm, about 100 nm, about 500 nm, about 1,000 nm, or about 5,000 nm.
  • the inactive effector domains can be activated when two or more of the inactive effector domains are within at most at least about 0.01 nm, about 0.05 nm, about 0.1 nm, about 0.5 nm, about 1 nm, about 5 nm, about 10 nm, about 50 nm, about 100 nm, about 500 nm, or about 1,000 nm.
  • the inactive effector domains can be activated when two or more of the inactive effector domains are within at most at most about 0.05 nm, about 0.1 nm, about 0.5 nm, about 1 nm, about 5 nm, about 10 nm, about 50 nm, about 100 nm, about 500 nm, about 1,000 nm, or about 5,000 nm.
  • At least two binding domain each independently fused with an effector domain can be introduced into a cell to target and bind to a target polynucleotide or a target polypeptide sequence. In some cases, at least two binding domains each independently fused with an effector domain can induce cell death, cytotoxicity, immune response or a combination thereof in a cell.
  • three or more binding domains each independently fused with an effector domain can be introduced into a cell to target and bind to a target polynucleotide or a target peptide sequence.
  • the three or more binding domains each independently fused with an inactive effector domain can be introduced into a cell to induce cell death, cytotoxic effects, immune response or a combination thereof in a cell.
  • the cell death, cytotoxic effects, or immune response can occur via the activation of the effector domains when the effector domains are in close proximity or in direct contact with each other due to the binding domains binding to the target polynucleotide or target polypeptide.
  • the targeting with three or more binding domain fusions can be more specific at identifying and inducing cell death or cytotoxicity in cells harboring genetic mutations.
  • the targeting with three or more binding domain fusions can be more specific at identifying and inducing cell death or cytotoxicity in cells harboring genetic mutations. In some embodiments, the targeting with three or more binding domain fusions, as opposed to targeting with only two binding domain fusions, can be more specific at identifying and inducing cell death or cytotoxicity in cells harboring genetic mutations. In some embodiments, the targeting with three or more binding domain fusions, as opposed to targeting with only two binding domain fusions, can be more specific at identifying and inducing cell death or cytotoxicity in cells harboring genetic mutations.
  • the specificity of inducing cell death or cytotoxicity with three or more binding domain fusions compared to only two binding domain fusions can be increased by about 0.1 fold to about 10,000 fold.
  • the targeting with three or more binding domain fusions, as opposed to targeting with only two binding domain fusions, can be more specific at identifying and inducing cell death or cytotoxicity in cells harboring genetic mutations.
  • the specificity of inducing cell death or cytotoxicity with three or more binding domain fusions compared to only two binding domain fusions can be increased by about 0.1 fold to about 0.5 fold, about 0.1 fold to about 1 fold, about 0.1 fold to about 5 fold, about 0.1 fold to about 10 fold, about 0.1 fold to about 50 fold, about 0.1 fold to about 100 fold, about 0.1 fold to about 500 fold, about 0.1 fold to about 1,000 fold, about 0.1 fold to about 5,000 fold, about 0.1 fold to about 10,000 fold, about 0.5 fold to about 1 fold, about 0.5 fold to about 5 fold, about 0.5 fold to about 10 fold, about 0.5 fold to about 50 fold, about 0.5 fold to about 100 fold, about 0.5 fold to about 500 fold, about 0.5 fold to about 1,000 fold, about 0.5 fold to about 5,000 fold, about 0.5 fold to about 10,000 fold, about 1 fold to about 5 fold, about 1 fold to about 10 fold, about 1 fold to about 50 fold, about 1 fold to about 100 fold, about 1 fold to about 500 fold, about 1 fold to
  • the targeting with three or more binding domain fusions can be more specific at identifying and inducing cell death or cytotoxicity in cells harboring genetic mutations.
  • the specificity of inducing cell death or cytotoxicity with three or more binding domain fusions compared to only two binding domain fusions can be increased by about 0.1 fold, about 0.5 fold, about 1 fold, about 5 fold, about 10 fold, about 50 fold, about 100 fold, about 500 fold, about 1,000 fold, about 5,000 fold, or about 10,000 fold.
  • the targeting with three or more binding domain fusions can be more effective at inducing cell death or cytotoxicity in cells harboring genetic mutations as determined by proapoptotic or caspase activity assays.
  • the proapoptotic or caspase activities induced by the targeting of the three or more binding domain fusions compared to targeting with only two binding domain fusions can be increased by about 0.1 fold to about 10,000 fold.
  • the proapoptotic or caspase activities induced by the targeting of the three or more binding domain fusions compared to targeting with only two binding domain fusions can be increased by about 0.1 fold to about 0.5 fold, about 0.1 fold to about 1 fold, about 0.1 fold to about 5 fold, about 0.1 fold to about 10 fold, about 0.1 fold to about 50 fold, about 0.1 fold to about 100 fold, about 0.1 fold to about 500 fold, about 0.1 fold to about 1,000 fold, about 0.1 fold to about 5,000 fold, about 0.1 fold to about 10,000 fold, about 0.5 fold to about 1 fold, about 0.5 fold to about 5 fold, about 0.5 fold to about 10 fold, about 0.5 fold to about 50 fold, about 0.5 fold to about 100 fold, about 0.5 fold to about 500 fold, about 0.5 fold to about 1,000 fold, about 0.5 fold to about 5,000 fold, about 0.5 fold to about 10,000 fold, about 1 fold to about 5 fold, about 1 fold to about 10 fold, about 1 fold to about 50 fold, about 1 fold to about 100 fold, about 1 fold to about 5
  • the proapoptotic or caspase activities induced by the targeting of the three or more binding domain fusions compared to targeting with only two binding domain fusions can be increased by about 0.1 fold, about 0.5 fold, about 1 fold, about 5 fold, about 10 fold, about 50 fold, about 100 fold, about 500 fold, about 1,000 fold, about 5,000 fold, or about 10,000 fold.
  • the proapoptotic or caspase activities induced by the targeting of the three or more binding domain fusions compared to targeting with only two binding domain fusions can be increased by at least about 0.1 fold, about 0.5 fold, about 1 fold, about 5 fold, about 10 fold, about 50 fold, about 100 fold, about 500 fold, about 1,000 fold, or about 5,000 fold.
  • the proapoptotic or caspase activities induced by the targeting of the three or more binding domain fusions compared to targeting with only two binding domain fusions can be increased by at most about 0.5 fold, about 1 fold, about 5 fold, about 10 fold, about 50 fold, about 100 fold, about 500 fold, about 1,000 fold, about 5,000 fold, or about 10,000 fold.
  • the targeting with three or more binding domain fusions can be more effective at killing cells harboring genetic mutations.
  • number of cells killed by the targeting with three or more binding domain fusions compared to targeting with only two binding domain fusions can be increased by about 0.1 fold to about 10,000 fold hi some embodiments, number of cells killed by the targeting with three or more binding domain fusions compared to targeting with only two binding domain fusions can be increased by about 0.1 fold to about 0.5 fold, about 0.1 fold to about 1 fold, about 0.1 fold to about 5 fold, about 0.1 fold to about 10 fold, about 0.1 fold to about 50 fold, about 0.1 fold to about 100 fold, about 0.1 fold to about 500 fold, about 0.1 fold to about 1,000 fold, about 0.1 fold to about 5,000 fold, about 0.1 fold to about 10,000 fold, about 0.5 fold to about 1 fold, about 0.5 fold to about 5 fold, about 0.5 fold to about 10 fold, about 0.5 fold to about 50
  • number of cells killed by the targeting with three or more binding domain fusions compared to targeting with only two binding domain fusions can be increased by about 0.1 fold, about 0.5 fold, about 1 fold, about 5 fold, about 10 fold, about 50 fold, about 100 fold, about 500 fold, about 1,000 fold, about 5,000 fold, or about 10,000 fold. In some embodiments, number of cells killed by the targeting with three or more binding domain fusions compared to targeting with only two binding domain fusions can be increased by at least about 0.1 fold, about 0.5 fold, about 1 fold, about 5 fold, about 10 fold, about 50 fold, about 100 fold, about 500 fold, about 1,000 fold, or about 5,000 fold.
  • number of cells killed by the targeting with three or more binding domain fusions compared to targeting with only two binding domain fusions can be increased by at most about 0.5 fold, about 1 fold, about 5 fold, about 10 fold, about 50 fold, about 100 fold, about 500 fold, about 1,000 fold, about 5,000 fold, or about 10,000 fold.
  • the targeting with three or more binding domain fusions can generate a greater immune response compared with targeting with only two binding domain fusions.
  • the immune response generated by three or more binding domain fusions compared to an immune response generated by only two binding domain fusions can be increased by about 0.1 fold to about 10,000 fold.
  • the immune response generated by three or more binding domain fusions compared to an immune response generated by only two binding domain fusions can be increased by about 0.1 fold to about 0.5 fold, about 0.1 fold to about 1 fold, about 0.1 fold to about 5 fold, about 0.1 fold to about 10 fold, about 0.1 fold to about 50 fold, about 0.1 fold to about 100 fold, about 0.1 fold to about 500 fold, about 0.1 fold to about 1,000 fold, about 0.1 fold to about 5,000 fold, about 0.1 fold to about 10,000 fold, about 0.5 fold to about 1 fold, about 0.5 fold to about 5 fold, about 0.5 fold to about 10 fold, about 0.5 fold to about 50 fold, about 0.5 fold to about 100 fold, about 0.5 fold to about 500 fold, about 0.5 fold to about 1,000 fold, about 0.5 fold to about 5,000 fold, about 0.5 fold to about 10,000 fold, about 1 fold to about 5 fold, about 1 fold to about 10 fold, about 1 fold to about 50 fold, about 1 fold to about 100 fold, about 1 fold to about 500 fold, about 1 fold to about 100 fold,
  • the immune response generated by three or more binding domain fusions compared to an immune response generated by only two binding domain fusions can be increased by about 0.1 fold, about 0.5 fold, about 1 fold, about 5 fold, about 10 fold, about 50 fold, about 100 fold, about 500 fold, about 1,000 fold, about 5,000 fold, or about 10,000 fold. In some embodiments, the immune response generated by three or more binding domain fusions compared to an immune response generated by only two binding domain fusions can be increased by at least about 0.1 fold, about 0.5 fold, about 1 fold, about 5 fold, about 10 fold, about 50 fold, about 100 fold, about 500 fold, about 1,000 fold, or about 5,000 fold.
  • the immune response generated by three or more binding domain fusions compared to an immune response generated by only two binding domain fusions can be increased by at most about 0.5 fold, about 1 fold, about 5 fold, about 10 fold, about 50 fold, about 100 fold, about 500 fold, about 1,000 fold, about 5,000 fold, or about 10,000 fold.
  • compositions, systems, or methods comprising a combination of a detector fusion polypeptide and an effector fusion polypeptide.
  • the detector fusion polypeptide can comprise a first nucleic acid binding domain and a polypeptide that increases transcription of a target DNA sequence comprising a mutation associated with a disorder resulting in a mutant RNA transcript.
  • the effector fusion polypeptide can comprise a binding domain that binds to the mutant RNA transcript or a mutant protein translated from the mutant RNA transcript, and an effector domain that upon activation results in a therapeutic effect.
  • one or more detector polypeptides can target and bind to the target polynucleotide and induce transcription of the target polynucleotide.
  • one or more effector fusion polypeptides can target and bind the transcripts of the target
  • the targeting and binding of the effector polypeptides to the transcripts of the target polynucleotide can activate the effector domains.
  • the activated effector domains can induce cell death, cytotoxicity, immune response, or a combination thereof.
  • the polypeptide that increases transcription of a target DNA sequence comprises a transcription factor or a transcriptional activators.
  • transcription factors or transcription activators can include GAL4, VP 16, VP64, p65 subdomain (NFkappaB), and VP64-p65-Rta (VPR).
  • the disclosure provides two or more detector polypeptides, each comprising a split or inactive portion of a transcription factor or transcription activator.
  • the split transcription factors or transcription activators can be activated when the two or more detector polypeptides bind to the target polynucleotide bringing the split or inactive domains in close proximity or direct contact.
  • the binding and targeting of the nucleic acid binding domains fused to effector domains comprising transcription activators can increase transcription of the target polynucleotide compared to the transcription level of the target polynucleotide neither targeted nor bound by the nucleic acid binding domains.
  • the targeting by the nucleic acid binding domains fused to effector domains comprising the transcription activators can increase transcriptions of the target polynucleotide by about 0.1 fold to about 100,000 fold.
  • the targeting by the nucleic acid binding domains fused to effector domains comprising the transcription activators can increase transcriptions of the target polynucleotide by about 0.1 fold to about 0.5 fold, about 0.1 fold to about 1 fold, about 0.1 fold to about 5 fold, about 0.1 fold to about 10 fold, about 0.1 fold to about 50 fold, about 0.1 fold to about 100 fold, about 0.1 fold to about 500 fold, about 0.1 fold to about 1,000 fold, about 0.1 fold to about 5,000 fold, about 0.1 fold to about 10,000 fold, about 0.1 fold to about 100,000 fold, about 0.5 fold to about 1 fold, about 0.5 fold to about 5 fold, about 0.5 fold to about 10 fold, about 0.5 fold to about 50 fold, about 0.5 fold to about 100 fold, about 0.5 fold to about 500 fold, about 0.5 fold to about 1,000 fold, about 0.5 fold to about 5,000 fold, about 0.5 fold to about 10,000 fold, about 0.5 fold to about 100,000 fold, about 1 fold to about 5 fold, about 1 fold to about 10 fold, about 0.5 fold to about 100
  • the targeting by the nucleic acid binding domains fused to effector domains comprising the transcription activators can increase transcriptions of the target polynucleotide by about 0.1 fold, about 0.5 fold, about 1 fold, about 5 fold, about 10 fold, about 50 fold, about 100 fold, about 500 fold, about 1,000 fold, about 5,000 fold, about 10,000 fold, or about 100,000 fold.
  • the targeting by the nucleic acid guided-nucleic acid binding domains fused to effector domains comprising the transcription activators can increase transcriptions of the target polynucleotide by at least about 0.1 fold, about 0.5 fold, about 1 fold, about 5 fold, about 10 fold, about 50 fold, about 100 fold, about 500 fold, about 1,000 fold, about 5,000 fold, or about 10,000 fold. In some cases, the targeting by the nucleic acid binding domains fused to effector domains comprising the transcription activators can increase transcriptions of the target polynucleotide by at most about 0.5 fold, about 1 fold, about 5 fold, about 10 fold, about 50 fold, about 100 fold, about 500 fold, about 1,000 fold, about 5,000 fold, about 10,000 fold, or about 100,000 fold.
  • the effector domains comprising the transcription activators can induce transcriptions of the target polynucleotide.
  • the target can induce transcriptions of the target polynucleotide.
  • polynucleotides comprise coding strands.
  • the target polynucleotides comprise non-coding strands.
  • the induction of transcriptions of the target polynucleotide can require the binding of at least two binding domains each independently fused with an effector domain comprising a full length or a split transcription activator.
  • a different binding domain fused with effector domains comprising domains that can induce cell death or cytotoxicity can target and bind the increased mRNA transcripts of the target polynucleotide, thereby inducing cell death or cytotoxicity only in cells harboring the increased mRNA transcripts.
  • compositions, systems, or methods for identifying and targeting a target polynucleotide, a target polypeptide, or a combination thereof in a cell comprises genetic polymorphisms or variants that are not associated with a disease or a disorder.
  • the target polynucleotide or target polypeptide comprise genetic polymorphism or variants that is associated with a disease or a disorder.
  • the target polynucleotide comprises nucleic acid mutations.
  • the mutations can be silent mutations or mutations that cause diseases or disorders.
  • the mutations can be driver mutations for a disease or a disorder. In some cases, the driver mutations can be oncogenic.
  • the mutations can be passenger mutations.
  • the disease or disorder can be cancer.
  • compositions, systems, or methods comprise delivering therapeutics or therapeutic effects to the targeted cells harboring driver mutations that cause cancer.
  • the compositions, systems, or methods comprise a first binding domain (e.g., a nucleic acid binding domain or a protein binding domain) fused to a first effector domain (e.g., an inactive cytotoxic domain), where the first binding domain binds to a first nucleic acid sequence on the target polynucleotide or a first peptide sequence on the target polypeptide.
  • the first nucleic acid sequence on the target polynucleotide or first peptide sequence on the target polypeptide can comprise a driver mutation associated with a cancer.
  • a second binding domain e.g., a nucleic acid binding domain or a protein binding domain
  • a second effector domain e.g., second inactive cytotoxic domain
  • a second binding domain e.g., second inactive cytotoxic domain
  • binding domains to the target sequences brings the first and second effector domains into proximity.
  • the proximity of the first effector and second effector domains e.g., each comprising an inactive cytotoxic domain
  • an active effector e.g., cytotoxic domain that induces cell death, cytotoxicity, immune response, or a combination thereof in a cancer cell.
  • Non-limiting cancer or cancer cells that can be targeted and treated with the
  • compositions, systems, or methods described herein can include: Acanthoma, Acinic cell carcinoma, Acoustic neuroma, Acral lentiginous melanoma, Acrospiroma, Acute eosinophilic leukemia, Acute lymphoblastic leukemia, Acute megakaryoblastic leukemia, Acute monocytic leukemia, Acute myeloblastic leukemia with maturation, Acute myeloid dendritic cell leukemia, Acute myeloid leukemia, Acute promyelocytic leukemia, Adamantinoma, Adenocarcinoma, Adenoid cystic carcinoma, Adenoma, Adenomatoid odontogenic tumor, Adrenocortical carcinoma, Adult T-cell leukemia, Aggressive NK-cell leukemia, AIDS-Related Cancers, AIDS- related lymphoma, Alveolar soft part sarcoma, Ameloblastic fibroma, Anal cancer, Anaplastic large cell lymph
  • Bronchioloalveolar carcinoma Brown tumor, Burkitf s lymphoma, Cancer of Unknown Primary Site, Carcinoid Tumor, Carcinoma, Carcinoma in situ, Carcinoma of the penis, Carcinoma of Unknown Primary Site, Carcinosarcoma, Castleman's Disease, Central Nervous System
  • Cholangiocarcinoma Chondroma, Chondrosarcoma, Chordoma, Choriocarcinoma, Choroid plexus papilloma, Chronic Lymphocytic Leukemia, Chronic monocytic leukemia, Chronic myelogenous leukemia, Chronic Myeloproliferative Disorder, Chronic neutrophilic leukemia, Clear-cell tumor, Colon Cancer, Colorectal cancer, Craniopharyngioma, Cutaneous T-cell lymphoma, Degos disease, Dermatofibrosarcoma protuberans, Dermoid cyst, Desmoplastic small round cell tumor, Diffuse large B cell lymphoma, Dysembryoplastic neuroepithelial tumor, Embryonal carcinoma, Endodermal sinus tumor, Endometrial cancer, Endometrial Uterine Cancer, Endometrioid tumor, Enteropathy-associated T-cell lymphoma, Ependymoblastoma, Ependymoma, Epithelioid
  • Esthesioneuroblastoma Ewing Family of Tumor, Ewing Family Sarcoma, Ewing's sarcoma, Extracranial Germ Cell Tumor, Extragonadal Germ Cell Tumor, Extrahepatic Bile Duct Cancer, Extramammary Paget's disease, Fallopian tube cancer, Fetus in fetu, Fibroma, Fibrosarcoma, Follicular lymphoma, Follicular thyroid cancer, Gallbladder Cancer, Gallbladder cancer, Ganglioglioma, Ganglioneuroma, Gastric Cancer, Gastric lymphoma, Gastrointestinal cancer, Gastrointestinal Carcinoid Tumor, Gastrointestinal Stromal Tumor, Gastrointestinal stromal tumor, Germ cell tumor, Germinoma, Gestational choriocarcinoma, Gestational Trophoblastic Tumor, Giant cell tumor of bone, Glioblastoma multiforme, Glioma, Gliomatosis
  • Hemangioblastoma Hemangiopericytoma, Hemangiosarcoma, Hematological malignancy, Hepatocellular carcinoma, Hepatosplenic T-cell lymphoma, Hereditary breast-ovarian cancer syndrome, Hodgkin Lymphoma, Hodgkin's lymphoma, Hypopharyngeal Cancer, Hypothalamic Glioma, Inflammatory breast cancer, Intraocular Melanoma, Islet cell carcinoma, Islet Cell Tumor, Juvenile myelomonocytic leukemia, Kaposi Sarcoma, Kaposi's sarcoma, Kidney Cancer, Klatskin tumor, Krukenberg tumor, Laryngeal Cancer, Laryngeal cancer, Lentigo maligna melanoma, Leukemia, Leukemia, Lip and Oral Cavity Cancer, Liposarcoma, Lung cancer, Luteoma, Lymphangioma, Lymphangiosarcoma, Lymphoepithelio
  • Mesothelioma Malignant peripheral nerve sheath tumor, Malignant rhabdoid tumor, Malignant triton tumor, MALT lymphoma, Mantle cell lymphoma, Mast cell leukemia, Mediastinal germ cell tumor, Mediastinal tumor, Medullary thyroid cancer, Medulloblastoma, Medulloblastoma, Medulloepithelioma, Melanoma, Melanoma, Meningioma, Merkel Cell Carcinoma,
  • Metastatic urothelial carcinoma Mixed Mullerian tumor, Monocytic leukemia, Mouth Cancer, Mucinous tumor, Multiple Endocrine Neoplasia Syndrome, Multiple Myeloma, Multiple myeloma, Mycosis Fungoides, Mycosis fungoides, Myelodysplastic Disease, Myelodysplastic Syndromes, Myeloid leukemia, Myeloid sarcoma, Myeloproliferative Disease, Myxoma, Nasal Cavity Cancer, Nasopharyngeal Cancer, Nasopharyngeal carcinoma, Neoplasm, Neurinoma, Neuroblastoma, Neuroblastoma, Neurofibroma, Neuroma, Nodular melanoma, Non-Hodgkin Lymphoma, Non-Hodgkin lymphoma, Nonmelanoma Skin Cancer, Non-Small Cell Lung Cancer, Ocular oncology, Oligoastrocytoma, Oligodendroglioma, Oncocytoma, Optic nerve she
  • Osteosarcoma Osteosarcoma, Ovarian Cancer, Ovarian cancer, Ovarian Epithelial Cancer, Ovarian Germ Cell Tumor, Ovarian Low Malignant Potential Tumor, Paget's disease of the breast, Pancoast tumor, Pancreatic Cancer, Pancreatic cancer, Papillary thyroid cancer, Papillomatosis, Paraganglioma, Paranasal Sinus Cancer, Parathyroid Cancer, Penile Cancer, Perivascular epithelioid cell tumor, Pharyngeal Cancer, Pheochromocytoma, Pineal Parenchymal Tumor of Intermediate
  • Somatostatinoma Soot wart, Spinal Cord Tumor, Spinal tumor, Splenic marginal zone lymphoma, Squamous cell carcinoma, Stomach cancer, Superficial spreading melanoma, Supratentorial Primitive Neuroectodermal Tumor, Surface epithelial-stromal tumor, Synovial sarcoma, T-cell acute lymphoblastic leukemia, T-cell large granular lymphocyte leukemia, T-cell leukemia, T-cell lymphoma, T-cell prolymphocytic leukemia, Teratoma, Terminal lymphatic cancer, Testicular cancer, Thecoma, Throat Cancer, Thymic Carcinoma, Thymoma, Thyroid cancer, Transitional Cell Cancer of Renal Pelvis and Ureter, Transitional cell carcinoma, Urachal cancer, Urethral cancer, Urogenital neoplasm, Uterine sarcoma, Uveal melanoma, Vaginal Cancer, Vemer Morrison syndrome, Verrucous
  • the targeted cancer cell represents a subpopulation within a cancer cell population, such as a cancer stem cell.
  • the cancer is a brain tumor, a pancreatic cancer, or a triple negative breast cancer.
  • the present disclosure relates to a precision therapeutic strategy for the treatment of cancer and other diseases caused by genetic mutations or other forms of aberrations (e.g. insertion of foreign genomic nucleic acids).
  • the majority of human diseases can arise due to a genetic alteration, either in a single gene (monogenic disease), or in multiple concerted genes (polygenic diseases). Over 10,000 monogenic diseases have been described to date, affecting more than 1 in 100 individuals worldwide.
  • Polygenic diseases such as cancer,
  • HIV infectious diseases
  • Influenza can carry a genetic component, as these retroviruses transduce their own genetic information permanently into infected cells.
  • viral infection has resulted in the integration of human endogenous retroviral (HERV) elements which comprise roughly 8% of our entire genome and provide an evolutionary history of past infections of the human species.
  • HERV human endogenous retroviral
  • cancer another complex polygenic disease
  • Surgical resection for solid tumors aims to remove as many tumor cells as safely possible.
  • infiltrative tumors can be impossible to fully remove without extensive collateral damage to normal structures and cells.
  • High-energy radiation therapy induces lethal DNA damage to rapidly dividing cells, particularly cancer cells.
  • DNA repair capabilities can also be relatively impaired in many cancer cell types, and so while radiation therapy preferentially kills cancer cells, normal structures and cells again face varying levels of collateral damage.
  • conventional chemotherapy can induce cell death via induction of genetic damage, and due to its incomplete selectivity, can lead to damage and toxicity to healthy cells and tissues
  • Immunotherapy can be new treatment paradigm for cancer.
  • the immune system is capable of highly selective targeting cells in a precise manner, a property that other modalities of cancer treatment lack.
  • the human immune system can selectively identify and kill foreign cells.
  • Immunotherapies can aim to activate the patient’s native immune system and reprogram it to recognize and attack cancer cells.
  • immune cells can be trained to recognize the proteins (called antigens) that distinguish tumor cells from normal cells.
  • Antigens proteins
  • Targeting tumor associated antigens can eliminate tumor cells, while also killing some normal cells that express the same antigens. It can be preferable to identify tumor specific antigens (e.g., neoantigens), so that immune targeting cannot affect the normal cells.
  • Neoantigens can be those protein peptide segments transcribed from tumor-defining gene mutations, and thus can be tumor-specific. There can be many different mutations present among individual cancer cells; the ones ubiquitous among all cancer cells can be considered to be trunk mutations, and can potentially present attractive targets for therapy.
  • peptide vaccines and tumor lysate peptides can be used to vaccinate patients.
  • dendritic cells can be primed with the tumor peptides, and this strategy can be used for, for example, brain tumor patients with glioblastoma.
  • Neoantigens must be expressed on the major histocompatibility complexes (MHC).
  • MHC major histocompatibility complexes
  • a genetically engineered Polio virus can be used in glioblastoma patients, with the aim to infect CD155- expressing glioma cells.
  • bacterial genes for cytosine deaminase can be delivered via a virus (murine leukemia virus - MLV) into cancer cells.
  • the MLV virus can specifically replicate in dividing cells, preferentially in cells with defective immunity (e.g. malignant cells), enabling selectivity for cancer cells.
  • the 5-flurorouracil can have potent cytotoxic effects because it can metabolize to 5-fluorouridine, 5'- triphosphate and 5-fluoro-2'-deoxyuridine 5 '-monophosphate, which can result in inhibition of both RNA and DNA synthesis.
  • This technique can be effective in the context of, for example, glioblastoma patients.
  • inducible caspase enzymes e.g. iCasp9
  • iCasp9 can be used for suicide- cancer cell therapy, by introducing these apoptosis-simulating enzymes into cancerous cells via onco-targeting viruses.
  • Gene editing systems such as zinc finger nucleases (ZFNs), transcription activator like effector nucleases (TALENs), and CRISPR/Cas systems can have the ability to not only detect particular genetic changes, but also to edit them in a precise manner.
  • CRISPR/Cas can enable disruption of virtually any gene in an organism in a precise manner.
  • the system can employ a Cas protein, , which can be guided by a guide nucleic acid, comprising a programmable sequence complementary to the desired target nucleic acid.
  • CRISPR/Cas recognition can be mediated through recognition of a protospacer adjacent motif (PAM) sequence (e.g., 5’NGG’3 in wild type S. Pyogenes Cas9) on the target nucleic acid.
  • PAM protospacer adjacent motif
  • the crRNA and tracrRNA can be covalently fused to form a single guide RNA (sgRNA).
  • sgRNA single guide RNA
  • Cas protein can be programmed to bind and optionally cleave a target sequence.
  • nuclease inactivating protein mutations e.g., at D10A and H840A in a wild type S. pyogenes Cas9, can result in an inactive version of the system which is still capable of binding to nucleic acid in a sequence specific manner (e.g., dCas9).
  • Cas polypeptides e.g., nuclease dead or nickase
  • Cas polypeptides can be fused to various effector domains to carry out a wide variety of genetic and transcriptional operations, ranging from activation and repression of genes, to performing editing of individual bases (e.g., base editing) in a sequence-specific manner.
  • Casl3 can be employed in identifying and detecting specific RNA sequences. Casl3 can be used for performing RNA editing in a sequence-specific manner. Cas 13 can recognize RNA sequences through the use of a programmable single guide RNA; catalytically inactive versions of this system can also be utilized with the disclosure. [0194] Due to their ability to recognize a specific sequence of DNA or RNA, CRISPR systems can be used to treat monogenic diseases, ranging from sickle cell anemia, to hemophilia and cystic fibrosis, genetic diseases, and diseases related to viruses such as HIV and coronavirus, as well as various cancers.
  • the molecular changes which manifest in genetic disease can occur inside cells at the nucleic acid (DNA, RNA) level.
  • DNA, RNA nucleic acid
  • the ability to read the mutations that result in disease, and target them at the level of nucleic acids, can revolutionize the therapeutic index of numerous treatments by helping to distinguish healthy vs. diseased cells at the most fundamental level.
  • the paradigms described herein can use gene engineering technologies, such as Zinc fingers, TALENs, and CRISPR-Cas technologies. These technologies can identify gene mutations in living cells and target the associated genes for disruption (genetic knockout), or editing via endogenous homologous recombination repair. Fusions of catalytically inactive versions of these proteins to effectors, transcription of various target genes can be controlled, as well as chromatin state. Using the Casl3 system, RNA sequences can be targeted for precise binding or editing. Thus, these technologies can provide opportunities for distinguishing between healthy and diseased cellular state at the molecular level.
  • gene engineering technologies such as Zinc fingers, TALENs, and CRISPR-Cas technologies. These technologies can identify gene mutations in living cells and target the associated genes for disruption (genetic knockout), or editing via endogenous homologous recombination repair. Fusions of catalytically inactive versions of these proteins to effectors, transcription of various target genes can be controlled, as well as chromatin state.
  • the present disclosure can leverage this ability to sense aberrant mutations in DNA and/or RNA in nucleic acids within a cell in the context of cancer to formulate a novel smart cancer therapeutic.
  • One variant of the disclosure can include making use of two types of proteins: one is the detector protein which is comprised of a genetic sequence binding domain (e.g. DNA binding domain - DBD) and effector protein A, and a second detector protein (binding to a genetic sequence); DBD conjugated to effector protein B. More specifically the genetic sequence binding domain can target the mutated or variant of genetic sequences where the genetic sequences can be DNA or RNA. Operationally, the first fusion protein can bind to a mutated genetic sequence while the second fusion protein can bind to another genetic sequence close to the said mutated genetic sequence.
  • a genetic sequence binding domain e.g. DNA binding domain - DBD
  • DBD binding to a genetic sequence
  • DBD binding to a genetic sequence
  • the genetic sequence binding domain can target the mutated or variant of genetic sequences where the genetic sequences can be DNA or RNA.
  • the first fusion protein can bind to a mutated genetic sequence while the second fusion protein can bind to another genetic sequence close to the
  • Interaction of the two effectors (A & B) due to the close proximity between the two nucleic acid binding domains can enable a functional interaction between the two proteins.
  • This interaction can be: split enzyme complementation, activation of one component by the other, or similar functional protein-protein interactions which can mount a cellular effect. Specificity can occur because in cancer cells both the targeted mutation sequence and the targeted normal sequence nearby are present, therefore activation of the effector domains can be possible, whereas in the normal cell the absence of the mutated sequence can prevent activation of effector domain. This can allow for mutations within cancer cells to be detected and targeted in a precise manner vs. their normal cell counterparts.
  • the complementation of the fusion proteins can result in a toxic effect on cells causing death of the cancer cells. Since the cognate mutations are not present in healthy cells, complementation does not occur, and these cells cannot be killed.
  • a single activated effector protein (two effectors A & B interacting) can cause cell death, while in other instances multiple effector complexes can be activated to induce cell death.
  • detector proteins can be used to promote the transcription of the mutated DNA to generate some number copies of mutated RNA. Briefly, the detector protein can bind to mutated DNA, and the activator domain can be used to recruit DNA transcription or polymerase machinery to the location to transcribe the genetic region containing the mutated DNA to create many copies of DNA or RNA .
  • the targeted genetic sequence can be a DNA sequence with mutations, or an RNA sequence with mutations.
  • a number of different natural and synthetic DNA-binding recognition proteins can be used: Zinc Fingers, TALEs,
  • CRISPR-Cas systems such as dCas9 (catalytically inactive versions so as not to cut the DNA) and dCasl2 (Cpfl), and other similar proteins. Synthetic or evolved variants of these domains can also be used such as evoCas9, Cas9-HF1, or eSp-Cas9.
  • dCas9 variants for binding to mutated RNA sequences, dCas9 variants, dCasl3 family variants, and synthetic systems such as CIRTS, and similar sequence specific RNA binding domains can be used protein and other classes of RNA binding proteins can be used.
  • CRISPR-Cas here can refer to the CRISPR-Cas protein complexed with its associated targeting guide RNA.
  • a separate embodiment of this approach can involve targeting a mutated protein sequence in a similar manner using an antibody or scFv domain.
  • two Antibody- effector conjugates can be employed with one targeting a normal fold on the protein surface, and a second targeting an aberrant fold due to amino acid mutation(s). Complementation of the two attached effector proteins can again induce a toxic response leading to cell death.
  • the activated recombinant pro-effector domain to cause cell death can be a recombinant toxin such a Psuedomonas exotoxin A (PE3), DTA toxin; a cell death enzyme such as procaspase 1, caspase 2, caspase 3, or caspase 11; a key protein in a cell death signal pathways, such as death domain (DD), and Fas associated death domain (FADD) in the Fas apoptosis cell death pathways; the mixed lineage kinase domain-like pseudokinase (LMKL) of necroptosis pathway.
  • PE3 Psuedomonas exotoxin A
  • DTA DTA toxin
  • a cell death enzyme such as procaspase 1, caspase 2, caspase 3, or caspase 11
  • DD death domain
  • FADD Fas associated death domain
  • LLKL mixed lineage kinase domain-like pseudokinase
  • transcription activators SunTag, SAM, VP64, GAIA, VPR
  • KREB repressors
  • epigenetic modulators such methylation modulators and acylation modulators can be used to achieve epigenetic regulation.
  • tumor cells can be sampled by biopsy or blood sample from a patient (a human or an animal).
  • DNA sequencing can be performed to identify the DNA mutations of the given tumor by comparing the sequencing data of normal cells in the same patient to identify a mutation profile.
  • Bioinformatic analysis can be performed to identify the likely cancer driver mutations which can be the focus of the therapeutic targeting.
  • sequence specific DNA binding domains e.g., Zinc finger, TALE, or CRISPR-Cas
  • the nucleic acid binding domains can be engineered to target sequences as described above and linked to their respective pro-effector domains (A and B).
  • the nucleic acid binding domains (targeting DNA or RNA) have the capability of binding with high specificity to and discrimination to the mutated sequence vs. a wild-type (non-mutated) sequence. This can be achieved using highly specific engineered variants of these DNA or RNA binding domains, as well as chemically modified guide RNAs (in the context of CRISPR-Cas systems.
  • the two fusion architectures can be packaged and delivered into cancerous and healthy cells via nucleofection, lipid based transfection, or a variety of viral delivery techniques (e.g. lentivirus, adenovirus, AAV). Selective activation of the system only in cells containing the mutated sequence can result in the activation of the toxic effector domain, leading to cell death while preserving the health of normal cells.
  • signal amplification can be performed to achieve the desired level of cellular toxicity to the cancerous cells.
  • a detector protein can find and selectively bind to suitable locations of the mutated DNA sequences (bind to mutated genetic sequences but not wild-type ones).
  • attached activator domains of the detector protein such as transcriptional activators like VP64
  • transcriptional activators like VP64 can initiate transcription of the mutated sequence to generate multiple copies (in this case of RNA). This allows a genetic event in a single piece of nucleic acid to be amplified to dramatically, relaxing any limitations due to potency, collaboratively activate the transcription of the mutated gene to generate detection signals in form mutated RNA sequences or mutated proteins sequences.
  • Mutated DNA/RNA sequences as signal sequences and the detector protein’s function can detect the presence of a nucleic acid mutation and generate multiple copies through copying or transcription.
  • a set of effector proteins can be used.
  • the DNA/RNA-binding proteins fused to effector proteins would then be delivered into cells to initiate the therapeutic process.
  • the pro-effector domains can be dimerized (or interact to complement one another) to become an activated effector domain and initiate downstream therapeutic effects to the cells and the host.
  • one of preferred therapeutic processes is to selectively eradicate the mutated cells and keep the host healthy.
  • a preferred method of making the detector proteins is to design the binding domain to be a Crispr associated protein dCas9 (catalytically dead) with a gRNA which protospacer DNA sequence containing a cancer driver mutation.
  • the activation domain can be designed to be a DNA transcription activator such as SunTag activator.
  • Such detector proteins can bind to the mutated segment of the DNA to promote the generation of mutated genetic sequence signals, in this case, multiple copies of RNA. In some cases, such detector proteins can produce a first signal.
  • a preferred method of amplifying the detection signal is using one detector protein that has dCas9 as binding domain which gRNA sequence selectively bind to un mutated sequence of the coding strand of the targeted mutated DNA segment, and another detector protein having a dCas9 as binding domain which gRNA sequence selectively binds to the non-coding strand of the mutated DNA segment.
  • the effector domain of the detector protein can be a DNA transcription activator such as SunTag, SAM, VP64, GAIA, VPR.
  • the combined effect of blocking of the transcription of the un-mutated DNA sequence and activating transcription of the mutated DNA sequence can result in highly specific detection signals. In some cases, such detector proteins can produce a second signal as opposed to the first signal.
  • one way to utilize the mutated genetic sequence signals is to construct effector proteins based on dCas9, dCasl2, CIRTS, PUF, zinc finger and Talen and their variants.
  • the effector protein can have a binding domain and a pro-effector domain.
  • the binding domain of the effector protein can selectively bind to mutated signal sequences.
  • the pro- effector domain of the effector protein can be a procaspases such as procaspase 1, 2, 8, 9, 10 and other recombinant toxic proteins such as PE3.
  • the induced proximity of two procaspases by selective binding to the signal sequence can enable autocatalytic reactions to further initiate cascade processes leading to cell death.
  • the amplification stage may not be necessary, and can be skipped.
  • one way to utilize the mutated sequence signals such as RNA signal as substrate for cell kill in Fas pathway can be RNA sequence inherent in the cell
  • RNA endogenously mutated RNA
  • amplified RNA amplified RNA
  • DISC death-induce signaling complex
  • Fas cell death pathway comprising dCasl3, dCas9 variant and other RNA binding proteins that is complexed to death domains(DD), and Fas associated death domain (FADD), initiator procaspases such as procaspase 2, 8, 10.
  • DD death domains
  • FADD Fas associated death domain
  • initiator procaspases such as procaspase 2, 8, 10.
  • the induced proximity of two procaspases by targeted binding to the mutated RNA signal sequence can enable autocatalytic reactions between the two procaspases to further initiate cascade processes to cause cell death.
  • one way to utilize the mutated protein signals as substrate for cell kill in Fas path way can be to construct a death-inducing signaling complex (DISC) in the Fas cell death pathway comprising protein sequence recognizing proteins such as antibody or scFv construct linked to death domains(DD), Fas associated death domain (FADD), and initiator procaspases such as procaspase 2, 8, 10.
  • DD death domains
  • FADD Fas associated death domain
  • initiator procaspases such as procaspase 2, 8, 10.
  • one way to utilize the mutated protein signal to kill cell with immunogenic consideration is to train or prime immune cells such as dendritic cells, T cells to recognize such protein peptides so that they can target the cells expressing the mutated protein peptides to administrate cell death.
  • the pro-effector domain using the N-terminal of the LMKL protein, so that the LMKL induced cell death is necroptosis, which can be characterized by breakage of cell membrane releasing cellular contents resulting an immunogenic cell death.
  • a virus expressing operon linked between two DNA binding proteins, such as dCas9 proteins, bound to the mutated DNA segments can be constructed.
  • the transcription of such operon can be activated to generate viral RNA and then viral proteins.
  • MHC receptor gene can also activated to express the viral antigen on the tumor cells.
  • Host immune cells can readily recognize or trained to recognize the viral signals and
  • the enzyme becomes active.
  • Treatment of both healthy and cancerous cells with the pro-drug can then enable selective killing of the cancerous cells in which the pro drug converting enzyme (comprised of effectors A and B) has been activated.
  • effectors can act as a theragnostic for diagnostic and subsequent therapeutic applications.
  • effector domains can comprise pieces of a reporter gene (e.g. fluorescent, IR-responsive, X-ray responsive, colorimetric, etc.), which can detect cells in which a mutation is present. Reports can be sensitive or facilitate subsequent toxic reactions in response to IR, X-ray, or other signals. Or, similar to a prodrug, they can convert benign treatment signals (fluorescence), into a toxic signal (through decay of a fluorescent activated effector) in mutated cells.
  • a reporter gene e.g. fluorescent, IR-responsive, X-ray responsive, colorimetric, etc.
  • nucleic acid binding domain (NABD-A) and nucleic acid binding domain (NABD)-B to a mutate sequence within a cancer cell can generate a holo-bacterial or viral epitope to be targeted by the immune system.
  • This epitope can be targeted to the cellular surface through a variety of means.
  • Other methods for linking recognition of the mutated intracellular DNA sequence to expression of an antigenic epitope on the cell surface can also be used.
  • rational mutation design can be used to design binding proteins to improve the specificity of cancer cell killing while preserving normal cells.
  • direct evolution can be used on binding proteins to improve the specificity of cancer cell killing while preserving normal cells.
  • rational designs can be used to design two collaborating binding proteins on one cancer mutation to improve the specificity of cancer cell killing while preserving normal cells.
  • a multiplexed approach or multiplexing can be used to target multiple cancer mutations simultaneously to improve specificity of cancer cell killing while preserving normal cells.
  • the systems, methods, and compositions of the disclosure can be used as a prophylactic, a therapeutic, or a combination thereof.
  • This method of intracellular nucleic acid mutation targeting can provide an effective therapy and prophylactic for cancer whether the DNA mutations are inherited or acquired, and can potentially be used as a complementary treatment to current standards of care.
  • Cancer can be caused by uncontrolled cell growth. There are three main classes of homeostasis maintaining genes in human, malfunction of which function can lead to
  • oncogenesis They are proto-oncogenes, tumor suppressor genes, and DNA repair genes.
  • Proto oncogenes are involved in normal cell growth and division. When these genes are altered they become hyperactive and cause cells to grow and survive when they should not.
  • Proto-oncogenes when mutated can turn into oncogenes, promoting oncogenesis and uncontrolled levels of growth rather than healthy cell growth.
  • Tumor suppressor genes work in a similar fashion by inhibiting cell growth, ensuring growth does not exceed its limits and turn cancerous. When alterations to these genes occur, cells can begin to grow in an uncontrolled manner.
  • An oncogenesis process can result from a mutation in a proto-oncogene, which can cause cells to grow abnormally aggressive.
  • tumor suppressor Normally such abnormal growth can be suppressed by tumor suppressor. But if at the same time the tumor suppressor genes is also mutated, this can result in a lost function, which can cause uncontrolled growth, i.e. tumor growth. That is why two such mutations may be needed for oncogenesis, and these first two mutations can be the driver mutations of this particular tumor.
  • the two mutations can occur, for example, because a DNA repair gene is malfunctioning with a mutation, allowing other genes to become mutated from DNA damages.
  • three mutations may form the driver mutation for this type of tumor.
  • tumor evolves, it can become heterogeneric with different clonal expansions.
  • the driver mutations will be in all the clonal lineages; therefore by targeting the driver mutation all the clonal lineages can be targeted. This can be important, because for traditional radiation therapies, chemotherapies, conventional targeting therapies, and immunotherapies, quite often some tumor lineages can acquire additional mutations to give them ability to evade the treatment.
  • the treatment can be effective to all the clonal lineages of a given cancer.
  • Such ability to target cells with driver mutations and yet not affecting cells without the targeted mutations can be an advantage over the conventional cancer therapies currently on the market.
  • DNA repair genes are heavily involved in preventing cancer growth and persistence of mutations. As cells of the system experience routine exposure to perturbations such as extreme temperature cycles, chemical, radiation, and UV, or purely random error in cell cycles, chemical changes occur to DNA resulting in genetic damage (this is mirrored in RNA). While DNA repair mechanism attempt to correct mutations, sometimes they are unsuccessful, leading to permanent mutations which accumulate. When mutations reside in the three classes of the genes, especially n proto-oncogenes and tumor suppressors, there is a good chance that cancer can develop.
  • cancer results when there is an activating mutation in proto-oncogene or a suppressive mutation in a tumor suppressor.
  • ZFNs zinc-finger nucleases
  • TALEN transcription activator-like effector nucleases
  • HDR homology directed repair
  • transcription of key genes can be altered by using nonnaturally occurring and engineered enzymes with DNA binding domains, such as the tetracycline repressor, Gal4, zinc-fingers or the TALE proteins fused to transcription activator and repressor domains.
  • single point mutations or single nucleotide polymorphisms can be directed altered or corrected using base editing technology.
  • base editing There are still a few challenges for base editing, in particular with relation to its application to cancer therapy: 1. off-target effects can be a concern because editing is changing the DNA sequence; 2. Cancer cells typically have many point mutations and it is hard to correct them all; 3. Even if one can correct all the point mutations, other types of mutations and deficiencies in cellular genetic and epigenetic functions in the cancer cell can still propel cancer cells to grow abnormally.
  • the current disclosure can address all of these unmet challenges.
  • the disclosed method of cancer therapy is based on the use of sequence specific nucleic acid binding domains (NABDs) derived from commonly used gene editing tools such as Zinc fingers, TALEs/TALENs, CRISPR-Cas systems, meganuclease domains, synthetic systems such as CIRTS and their naturally occurring or evolved variants.
  • NABDs sequence specific nucleic acid binding domains
  • the DNA-binding properties of these enzymes are being harnessed, therefore, in the case of systems where a catalytic activity is present (e.g. the endonuclease domain of Cas9), the catalytically dead variants of the proteins (e.g. dCas9) are being used.
  • the proposed therapies are to utilize the programable genetic sequence targeting capabilities of the gene editing tools to detect mutations within the nucleic acids of cells (DNA/RNA), and initiate a therapeutic response (such as cell death) in response to them.
  • the key advancement of this approach can be that it links a DNA/RNA binding event (which is used to detect a mutation), to a therapeutic modality such as killing of the cell.
  • a system can be designed to comprise two proteins, each compromised of a nucleic acid binding domain (NABD) from a gene editing system each attached to effector proteins (A and B).
  • NABD nucleic acid binding domain
  • One of these is designed or programmed to bind to a mutated segment of a genetic sequence, and the other binds to a genetic sequence in proximity to the mutated segment.
  • the effector proteins are in fact pro-effectors which are inactive individually, but become active when complementation occurs (due to proximity of the two domains being brought together).
  • the close proximity of the two pro-effector domains activates catalytic or other functional activity when their tethered NABD bind in proximity. In instances where the two NABD domains do not bind near each other (e.g. a mutated target sequence is not present), complementation of the effector domains does not occur.
  • the mutated genetic sequence can be DNA sequence, RNA sequence and protein sequence.
  • Zinc Fingers, TALEs, CRISPR-Cas systems such as dCas9 and dCasl2 (Cpfl) and other classes of DNA binding proteins can be used - these include evolved or improved variants of the aforementioned (see brief description)
  • CRISPR-Cas systems such as dCas9 and dCasl2 (Cpfl) and other classes of DNA binding proteins
  • the new CIRTS protein, MS2 RNA-binding domain, Pumilio homology domains, and other relevant sequence-specific RNA binding proteins can be used.
  • CRISPR-Cas here refers to the CRISPR-Cas protein complexed with associated targeting gRNA.
  • antibody or scFv and other protein binding domains can be used.
  • the major therapeutic effect from the current embodiments can be derived from cell death of mutated cells to cure cancer or prevent cancer.
  • the activated effector domain can be a recombinant toxin such a psueodmonase arginosa exotoxin PE3 (PE3 toxin), DTA toxin.
  • a single activated toxin can achieve cell death, making it a suitable effector for detection of DNA mutations (potentially without the need for signal amplification).
  • Other cell death enzymes such as procaspase 1, caspase 2, caspase 8, caspase 9, and caspase 10 can also be used as effector domains.
  • Some proteins in cell death signal pathways can be used as well, such as death domain (DD), and Fas associated death domain(FADD) in the Fas apoptosis cell death pathways.
  • DD death domain
  • FADD Fas associated death domain
  • pseudokinase(LMKL) can also be used as an effector domain besides the caspase 1 domain.
  • effector domains can include: gene suppression with the effector domain being a transcriptional suppressor (e.g.
  • KREB KREB
  • functions on DNA or chromatin by combining elements of DNA nucleases, ribonucleases, repressor protein, or epigenetic modulators (histones and DNA methylation, acylations of histones, etc).
  • Gene activation can be achieved by using effector domain that encompass activity of transcription activators such as the SunTag, SAM, VP64, GAL4, or VPR.
  • the cell death potency of the complemented effectors cannot be sufficient to achieve death based on target detection of only one or two copies of mutated nucleic acid sequence (e.g. in human diploid cells on DNA).
  • amplification can be used to boost the number of template copies.
  • mutations can be detected in the corresponding RNA, of which thousands of copies exist.
  • the multiple copies of the mutated genetic sequences (in RNA) enable more cell death enzymes to be used for effector domains for the effector protein of current embodiments.
  • the transcription level of the mutated RNA templates can be low, and can even at minimal level for effector protein to be effective, therefore, as outlined above, signal amplification can be necessary; this can be achieved using a detector amplifying fusion protein.
  • the function of the detector amplifying fusion protein is to detect and identify mutated genetic sequence in cancer cells and to generate multiple copies of the genetic sequence (or signal) when a target mutation is found.
  • a detector protein can have a nucleic acid binding domain and an effector domain.
  • the binding domain comprised of one of the gene editing binding domains described above (e.g. zinc fingers, dCas9) can be programmed to bind to the mutated target DNA sequence, and recruit a transcription activator effector or polymerase effector (e.g. DNA polymerase or similar) to the sequence in order to produce multiple copies and amplify the signal. Typically this can involve recruitment of a transcriptional activator complex to generate thousands of RNA copies (and subsequent protein sequences). Amplification can be further increased by using multiple different detector amplifying fusion proteins targeting multiple signal sequences (to increase specificity).
  • detector proteins are delivered to the cancer cells in vitro or in vivo by viral vector delivery systems or nanoparticle delivery systems; other systems can also be used including nucleofection or cationic lipid or polymer delivery vehicles.
  • the effector proteins can have a nucleic acid binding domain and an effector domain.
  • the binding domain has the sequence information to find the signal sequence, and the effector domain can initiate therapeutic effects in cells or vivo once the effector protein finds and binds to the genetic signal sequences. In some embodiments, one of these effects is to initiate apoptosis in mutated cells.
  • the therapeutic deployment of the disclosure can start with biopsy or a sample of the host to obtain cancer and normal cells to perform whole genome sequencing and identify the mutation profile. If amplification is deemed to be required (based on cancer type and state of the cells), a set of detector amplifying fusion proteins can be designed and fabricated to target the mutated sequence of a driver mutation (or several). These proteins can be delivered to the cells in form of a DNA sequence (or as a ribonucleoprotein complex if appropriate) in a viral vector (or delivery vector). Next, the NABD-effector proteins can be expressed in the cells to identify and activate a therapeutic effect in cells in which the mutant NA signal sequence is found.
  • the first step may not be necessary, and delivery of the NABD-effector proteins can be performed directly.
  • the flow chart for the process is shown in FIG. 1. There can be two decision points in the process - improving precision of the process. In the full process (involving amplification), decision can be made by both the amplifying detector fusion proteins (at the DNA level) and subsequently at the RNA level by the NABD-effector molecules. Once the mutated DNA is recognized and verified by identifying corresponding mutated RNA, a cell death process can be executed.
  • Zinc finger can be designed to recognize an 18bp sequence of DNA— a sequence long enough to specify a unique address in any genome. By attaching activator domains to ZFs, it can be possible to design specific transcription factors for specific genes. ZFs can be used to target either DNA or RNA sequences. In addition, zinc fingers can be used to identify and detect DNA sequences - by the assembly of green fluorescence protein and beta-lactamase. Also attachment of zinc finger domains to nucleases can enable gene engineering to be performed. Thus, these domains can be used as the nucleic acid binding domains for both the detector amplification proteins as well as in the context of the NABD-effector molecules.
  • TALEs are also sequence-specific DNA-binding proteins which can be used as nucleic acid binding domains (similar to ZFs).
  • TALE (transcription activator-like) effectors are proteins secreted by Xanthomonas bacteria via their special secretion system when they infect various plants. These proteins can bind to promotors in the host plant and activate expression of plant genes that aid bacterial infections. They recognize plant DNA sequences through a central repeat domain comprising of ⁇ 34 amino acid repeats. TALE domains can be engineered to target a desired sequence through alteration of the key repeat variable diresidues (RVDs) at positions 12 and 13.
  • RVDs key repeat variable diresidues
  • CRISPR/Cas systems can mediate recognition of DNA or RNA through an RNA template (rather than via protein interactions), which can make reprogramming them much easier. Therefore, they can be used as a preferred source of Nucleic acid detection for the current disclosure.
  • CRISPR clustered regularly interspaced short palindromic repeats
  • Cas enzymes derived from DNA fragments from viruses that have previously encountered and stored in the bacteria’s foreign DNA library and are used as their adaptive immune defense to detect and destroy DNA from similar viruses during subsequent encounters.
  • These repeats are processed by Cas enzymes and subsequently delivered to other Cas enzymes which use the information encoded in them to seek out and destroy complementary sequences on invading bacteriophages, providing adaptive immunity.
  • This natural adaptive immune system of prokaryotes can be repurposed as a genome editing tool.
  • the disclosure provides a CRISPR/Cas9 derived from
  • the CRISPR/Cas9 systems employs a Cas9 DNA endonuclease, which is guided by a CRISPR RNA, containing a, for example, 20-bp programmable sequence complementary to the desired target DNA and a trans-activating crRNA (tracrRNA), which acts as a bridge between the crRNA and endonuclease.
  • Cas9 DNA recognition can be mediated through inherent binding of the nuclease to a protospacer adjacent motif (PAM) sequence (5’NGG’3 in S. Pyogenes Cas9) on the target DNA, followed by hybridization of the 20-bp complementary sequence in the crRNA.
  • PAM protospacer adjacent motif
  • the crRNA and tracrRNA can be covalently fused to fonn a single guide RNA (sgRNA).
  • sgRNA single guide RNA
  • Cas9 can scans DNA by randomly associating and dissociating along a DNA strand until it encounters a PAM. Once it binds to a PAM location, the interaction with the PAM motif can weaken and separate the double strand DNA. Cas9 then checks if the protospacer sequence it carries is a match to the DNA sequence adjacent to the PAM. If the match is confirmed between the targeting nucleotide RNA and the non-coding strand of DNA, a conformational change in Cas9 occurs which activates the two nuclease domains (NHN and RuvC).
  • the HNH domain cleaves the non-coding strand of the DNA at 3 nucleotides upstream of PAM, while the RuvC domain cleaves the coding strand of the DNA.
  • This DNA editing capability enables gene silencing, gene repair.
  • Cas9 can be programmed to bind and cleave any DNA target sequence.
  • nuclease inactivating protein mutations at D10A and H840A result in an inactive version of the system which is still capable of binding to DNA in a sequence specific manner (dCas9).
  • dCas9 sequence specific manner
  • nickase Cas9 have been fused to various effector domains to carry out a wide variety of genetic and transcriptional operations, ranging from activation and repression of genes, to performing editing of individual bases (“base editing”) in a sequence-specific manner.
  • base editing a sequence-specific manner.
  • the CRISPR/Cas9 is more flexible to target different gene sequences.
  • specificity of CRISPR/Cas system is improved by using strategies such as chemically-modified guide RNAs, as well as engineered variants of the protein with enhanced specificity.
  • single-base resolution can be achieved.
  • the catalytically dead version of Cas9 is ideally suited for targeting mutated DNA and triggering an associated therapeutic effect.
  • FIG. 2 shows the function of dCas9 where dCas9 protein 201 is associated with gRNA 210 which has an RNA loop handler 211 that binds to the dCas9 protein, and a protospacer 212 is complementary to the targeted DNA 220.
  • Gene activator 230 is attached to the dCas9 to promote transcription of the gene. The transcription is performed by an RNA polymerase 240. The transcription of the mutated DNA generates the mutated RNA sequence 250.
  • dCas9 can be used to target mutations, preferably driver mutations in tumor cells. Instead of attempting to edit it back to normal, dCas9 can be used to create mutation detection signals to trigger therapeutic effects.
  • the detector amplification protein in FIG. 1 can have a dCas9 with a gRNA as the nucleic acid binding domain and a gene activator as its effector domain. RNA sequence binding domains
  • RNA targeting proteins and domains are naturally available as compared with DNA targeting proteins.
  • a family of proteins, Pumilio (Pum) and FBF (PUF) have been shown to bind RNA and have canonical functions as suppressors of posttranscriptional regulation. The suppression function is mediated through recruitment of deadenylase to mRNA, inhibiting translation initiation factors and their interaction with 5’ cap, which results in changes to the ribonucleoprotein structure and effects on translation elongation and termination.
  • PUF Natural forms of PUF can bind to adenine, guanine, and uracil, but not cytosine. With directed evolution, PUF can be engineered to be able to bind to all four RNA nucleotides. These domains have been used to construct an engineered splicing factors to regulate alternative splicing, target virtually any RNA transcript (4.3billion), and visualize mRNAs through recruitment of recombinant green fluorescence protein.
  • CRISPR-CAS RNA targeting system Casl3 can provide a convenient and specific means of binding to RNA in a sequence-specific manner. Similar to effect of Cas9 on targeted DNA, Casl3 can cleave a targeted RNA sequence that is complementary to the 20-bp sequence found within its RNA gRNA sequence. The cleavage is mediated by catalytic residues in its two HEPN domains. Importantly, upon activation, Casl3 can display collateral and non-specific RNA cleavage activity. However, this has not been noted in mammalian cells.
  • Casl3 variants exist, and many of these are applicable to the current embodiments (as well as related homologs and orthologs of different names): Casl3a, Casl3b, Casl3c, or Casl3d.
  • RNA nucleic acid binding domain similar to dCas9, mutations in the HEPN domain can be made to disable the catalytic cleaving ability while retaining the RNA binding capability of the Casl3.
  • This RNA targeting binding capability of dCasl3 is used in the current application to respond to the signal resulting from the initial amplification phase of dCas9, or can be used directly if no amplification is required.
  • Such a dCasl3 with a gRNA can be used as the nucleic acid binding domain of the effector protein in FIG. 1 while the effector domain can be a cell death inducing protein.
  • CIRTS CRISPR-Cas inspired RNA target system
  • CIRTS is comprised of (1) an RNA hairpin-binding domain that selectively binds to a specific RNA structure displayed on an engineered gRNA, (2) a gRNA that features both the structure that interacts with the engineered hairpin binding domain and sequence with complementarity to the target RNA of interest, (3) a charged domain that could bind to the target sequence of the gRNA non- specifically to stabilize and protect the gRNA prior to target engagement, and (4) an effector domain that can exert influence on the targeted RNA sequence that is complementary bound to the gRNA sequence. Because the CIRTS is small, being only 341 amino acids in size as compared with 930 aa for Casl3d it can be more amenable to delivery by viral vectors.
  • gRNA based RNA targeting can be used with other types of proteins, for example, SNAP -AD AR RNA editing tool, wherein the RNA binding domain can be a SNAP -tag protein complexed with a special gRNA called GB-gRNA, gRNA carries a chemical tag, 0 6 -benzelguanine.
  • SNAP -tag domain is directly evolved from the human 0 6 -alkylguanine- DNA alkyltransferase.
  • One advantage of this size of the protein is that it is small, about 200aa.
  • gRNA can also be small with 20nt length. Editing speed performed by this RNA editing protein complex can be quicker than Crispr based protein complex. It is conceivable that the SNAP -tag with BG-gRNA could be used as genetic sequence binding domain of current disclosure where the SNAP -tag can be fused to the effector domain such as a pro-Caspase.
  • a lN-ADAR protein complexed with a gRNA can be used for gRNA based RNA targeting.
  • the gRNA is a special type featured with a box B stem loop.
  • the ADAR RNA editing domain is fused with a l phage RNA binding protein, lN.
  • the lN can be complexed with boxB-gRNA and can be used as RNA binding domain of the effector protein of the current disclosure.
  • an antibody can be used to target a mutated protein sequence.
  • An antibody is a protein produced by immune cells to target pathogenic or foreign protein particles.
  • An example of an antibody is an immunoglobulin, a Y shape protein where the tips of the Y are the binding site for antigens of foreign proteins.
  • the antibody can engage the immune cells to attack foreign invaders or infected cells.
  • an antibody can be used to bind mutated protein sequences (peptides) or altered conformational surfaces on a protein resulting from the amino acid substitutions, for the purpose of the current embodiments.
  • VDJ recombination imparts the binding site of an antibody with variance for a variety of targets.
  • the binding domain is called Fv.
  • the Fv domains on an antibody can be linked to form single chained Fv (scFvs), which retain the antigen specific properties but are smaller in size then the unlinked counterparts.
  • scFvs can be used as the protein binding domains for the effector or detector proteins.
  • Fas cell death signaling pathway starts with the Fas ligand binding to Fas receptor on the cell surface causing aggregation of Fas cytoplasmic domains, termed‘death domains’ (DDs); Fas associated death domains (FADD ) are recruited to the site and bind to the DDs exposing its death effector domain(DED); procaspase 8 is also recruited to this death induced signaling complex DISC site; the induced proximity between two procaspase 8 initiates autocatalytic reactions resulting in an active form of caspase 8. The activated caspase 8 then further induces apoptosis leading to cell death.
  • DDs Fas cytoplasmic domains
  • Fas associated death domains FADD
  • procaspase 8 is also recruited to this death induced signaling complex DISC site; the induced proximity between two procaspase 8 initiates autocatalytic reactions resulting in an active form of caspase 8.
  • the activated caspase 8 then further induces apoptosis
  • This Fas signaling pathway can be utilized in the current embodiments to achieve high specificity in killing tumor cells.
  • the key enzymes in the Fas signaling pathway to initiate the catalytic reaction leading to apoptosis are the caspases. Therefore one NABD therapeutic effector protein design is dCasl3 with the gRNA as binding domain and a procaspase 8 as the effector domain.
  • the detector amplification protein comprised of dCas9 with a gRNA as it binding domain can search the genome to find and bind to the mutated DNA segment that is matched with the gRNA sequence.
  • the activator on the dCas9 can recruit the necessary enzymes to perform the transcription of the recognized gene, generating some quantity of RNA containing the mutated RNA sequences.
  • the effector protein of dCas 13 -procaspase 8 can bind to the mutated RNA sequence in such a way, i.e.
  • the DNA mutation profile of the patient can be obtained by biopsy or by blood sampling using next generation of genome sequencing. Usually there are a few to over a hundred mutations in tumor cells. The genetic makeup of tumors is heterogeneous, but a handful of mutations are present in all the tumor cells of a particular patient. These mutations are the driver mutation meaning they are the initiators of the tumor. By targeting these driver mutations, it is possible in theory to eradicate all the tumor cells.
  • the mutation detector amplification protein can be designed. Numerous NABD tools can be used. One choice can be dCas9 (e.g. SpCas9 or
  • the PAM of the gRNA can be the PAM downstream to the mutated DNA position of a driver mutation. Preferably the mutation position is within 10 nucleotides, adjacent to the PAM.
  • the 20 nt targeting RNA sequence can contain the targeted driver DNA mutation.
  • the PAM availability for different mutation locations can be expanded by looking at some engineered orthogonal of the Cas enzymes.
  • the dCas9 is fused with transcription activator such as VP64, VP64-P65, VPR, VP64-Rta, SunTag, GAL4, SAM. When dCas9 is placed inside tumor cell, it can find the targeted DNA and bind to it. Once it is bind to the mutated DNA, it can recruit transcription factors to the boost the transcription of the gene. This step can result in signal amplification, if required.
  • the effect of the activation varies. It can be characterized the ideal genomic region to target gRNAs for effective repression in K562 human myeloid leukemia cells. CRISPRi worked best using gRNAs that direct dCas9-KRAB to a window of -50 bp to +300 bp relative to the TSS of a gene, with a maximum effect observed in the 50-100 bp region downstream of the TSS. There can be transcription variation along the position of the gRNA on the DNA with respect to the TATA and TSS sites.
  • dCas9 If it is challenging to recruit dCas9 to the appropriate location to activate transcription, alternatives such as variants or other nucleic acid (NA) binding domains can be used instead (e.g. ZFs or TALEs). Furthermore, to improve specificity, it is proposed to incorporate both a detector amplification protein with an activator function and a detector amplification protein with a blocking function. dCas9 with SunTag collaborative with stopper dCas9 as detectors
  • a detector protein having a binding domain dCas9 with a gRNA that can bind to the coding strand of the DNA having the un-mutated DNA sequence in a driver mutation location.
  • This dCas9 design can bind to and block the transcription of the gene in a normal cell, but cannot bind to the mutated DNA, and therefore allow transcription of the mutated gene to happen.
  • This system can be used as a blocker protein.
  • the activation domain can be the effector domain of the blocker protein.
  • a second detector protein has a gRNA designed to bind to the non-coding strand DNA at a location with respect to the TSS to have the optimized transcription activation for the targeted gene.
  • the blocker detector protein is introduced the cells first to allow the binding of the blocker protein to the normal cells. Then introduce the detector protein with activator can be introduced to promote the expression of the targeted gene or targeted locus.
  • two detector proteins collaboratively recognize the mutated gene to promote transcription, generating the mutated genetic sequence signals later used for initiating therapeutic process in mutated cells while without generating signals in normal cells. As shown in FIG.
  • detection protein 401 is a dCas9 having a gRNA 402 that is targeting to bind to the coding strand (non-template strand) of wide type (non-mutated state) DNA in the segment of the mutated DNA gene sequence 410. Because this is bind to the coding strand of the DNA, it can stop the transcription of the gene to silence the gene expression. Binding to the wild type DNA means there can be no expression of the targeted gene for the normal cells while allowing the mutated gene to be transcribed.
  • Protein 420 is a dCas9 with an SunTag activator domain 423 fused to it.
  • the dCas9 has a gRNA 421 that targets to a position along the gene sequence respecting to the TSS site that is most efficient in activating the transcription of the mutated gene.
  • the collaborative effect from the two proteins activates RNA polymerase 430 to have efficient transcription of the mutated gene in tumor cells to create multiple copies of the mutated genetic sequences 440, which can be mutated RNA and mutated protein peptides. Due to the blocking effects, no transcription of the corresponding gene, and no mutated signal is resulted in normal cells. Also noted that it is possible to do transcription in forward and reverse direction, This can give more flexibility in design considering the limitation on the PAM availability, the distance to the TSS sites etc. In this collaborative fashion between two detector proteins, signals are generated in form of genetic sequences signaling that mutated DNA sequence is found. This genetic sequence signal can be used to initiate therapeutic processes.
  • mutated RNA is transcribed from the mutated DNA, they can be used to start the next therapeutic processes- one of which is inducing cell death process.
  • the effector proteins need to be able recognize RNA.
  • One candidate is dCasl3, which can be used in target the RNA signal sequence, although dCas9 can also be engineered to work with RNA.
  • Fas signaling pathway As cell death is a major therapeutic process for cancer therapies, two apoptosis pathways can be considered. One of them is Fas signaling pathway, while the other is mitochondrial pathway. Fas signal pathway involve caspases activating or NF-kB activating complexes caspases are a family of protease enzymes playing essential roles in programmed cell death. Activation of them can cause cascade reactions leading to cell death. There are two sub groups of caspases, one is the effector caspases such as caspase 3, 6,7, the other group is initiator caspases such as caspase 2, 8, 9 and 10.
  • FIG.5 shows the typical Fas signaling initiation process in apoptosis.
  • Fas receptor 501 has extra cellular domain 502 and intracellular domain 503.
  • the intracellular domain is death domain (DD).
  • DD death domain
  • FADDs Fas Associated Death Domain
  • FADD comprises a DD domain 511 and a death effector domain DED 510.
  • procaspases 520 are brought to close proximity this way.
  • the proximity of two initiator procaspases can trigger autocatalytic process to cleave and mature the procaspase to active caspase 530 that is capable to initiate cell death signal cascade.
  • Such a caspase mediated cell death signal pathway is used in current DNA targeting therapies. Examples are provided below. dCas!3 with procaspase 8 as effectors
  • Caspase 8 which is initiator caspase in FAS signal pathway, is activated by dimerization of the two inactive native monomeric procaspase 8 and auto catalytic cleaving.
  • procaspase configuration of the procaspase is a large protease linked with a small protease, and there is a tandem DED domains linked to the large protease.
  • trimerization of intracellular DD domain of the receptor is resulted to recruit FADD from the cytoplasm.
  • the increased concentration of FADD is in turn able to bind to recruited procaspase 8 via DED-DED binding.
  • the tandem DED domains between two procaspases can cross-swapped to tangled forming dimeric unit. The dimerization is followed by auto catalytic reactions to cleave the procaspases 8 into an active caspase 8.
  • the active caspase 8 can signal apoptosis.
  • procaspase 8 can be modified such that a dCasl3 can be attached to the long segment of the procaspase 8 in place of the tandem DED domains.
  • FIG. 6 shows the current design configuration.
  • Mutated RNA sequence signal 601 is transcribed from mutated DNA, preferably by the detector proteins described above.
  • Two effector proteins are used, 611 and 612.
  • the binding domains are dCasl3 and the effector domain are procaspase 8.
  • the gRNA 621 of dCasl3 611 is designed to target the mutated RNA that is transcribed from the dCas9 docked at the targeted DNA site. That means the gRNA 621 can be complementary to the mutated segment of RNA 601.
  • a second effector protein can need to be attached to the same RNA signal sequence, preferably close to the first detector protein.
  • gRNA 622 of the second Cas-caspase can target the RNA segment adjacent to the mutated RNA segment.
  • the proximity of these procasepases8 domain 631 and 632 initiates an auto catalytic reaction to activate caspase 8 640, starting apoptosis process.
  • Initiators such as caspase 10, caspase 9 and caspase 1 can be activated the same way as caspase 8. From immunogenic point of consideration, it is preferable to use caspase 1. This is because it was found the caspase 1 is an initiator for highly inflammatory pyroptosis cell death. Pyroptosis is cell death that is characterized with membrane break down that leaking cell contents to intercellular space. The release of Damage Associated Molecular Patterns (DAMPs) such as ATP, DNA, and ASC oligomers can recruit immune cells to area to clean up the death cells, also released are inflammatory cytokines such as tumor necrosis factor, IL-6, IL-8, IFNs, and IRFs to stimulate inflammatory response in the cell death area.
  • DAMPs Damage Associated Molecular Patterns
  • immune cells such as T cells, B cell, Dendritic cell, NK cells, macrophages can be recruited to the cell death site by the inflammatory cytokines.
  • the B cell and DC can uptake some neoantigens, other tumor associated or tumor specific antigens from the discharge from the pyroptosis tumor cell deaths, they can present the neoantigens to prime T cells to guide the T cell to track down the nearby tumor cells that have not been transfected by the therapeutic compositions of the disclosure but expressing the tumor associated antigens, tumor specific antigens or neoantigens.
  • Fas receptor molecule is a 319-animo acid type 1 transmembrane glycoprotein.
  • the extracellular domain has 157 amino acids and transmembrane and cytoplasmic domains have 17 and 145 amino acids.
  • the intracellular domain there is an 80-animo acid region is the“death domain”.
  • the receptors aggregate so that the intracellular domains forms a complex‘pentagon shape’ comprised of 5 death domains.
  • This Fas DD complex can recruit and interact with FADD’s DD domains.
  • FADD in turn to activate procaspase 8 or 10 to start the apoptosis cascade.
  • FIG. 7 shows the Cas-DD configuration.
  • dCasl3 701 has a gRNA 711 that target mutated single RNA strand 720.
  • the gRNA 711 associated with dCasl3 701 can target the mutated RNA segment 721, while the gRNA 712 on dCasl3 702 can target the segment 722 next to it.
  • DD domain 720 are attached to dCasl3 701 and dCasl3 702.
  • the aggregation of the DD domain in the region recruits FADD 730 and procaspase 8 740 to the form the Cas-DISC complex.
  • the proximity between the two procaspase 8 triggers the autocatalytic reaction to cleave and mature the caspase 8 750.
  • the active caspase 750 is then initiate cascade cell death signal to cause apoptosis.
  • DD domains to be attached to the dCasl3s used need to be distributed rationally. If the threshold to generate the cascade effect is aggregation of 3 death domains, then number of designs of gRNA can be two.
  • the dCasl3 targeting the mutated nucleotide can carry two DD domains while the other dCasl3 binds to neighbor mRNA sequence can carry one DD domain. This can give the dCasl3 targeting the mutated mRNA sequence have major weight to trigger the apoptosis cascade.
  • the number of gRNA designs can be three, one targeting the RNA segment that has the mutated nucleotide, while the other two can target the segments nearby.
  • the Cas-DD targeting the mutated segment can have 3 DD domains while the other two Cas-DD can have one DD domain.
  • proximity inducing effect could be higher than 5 DD configurations, the rational distribution of the DD domains take the speed of aggregation of the FADD and the Procaspases to generate the momentum of apoptosis signal cascade can need to be optimized.
  • DED domains along the Fas signal chain can also be utilized in the current embodiments to target cells with mutated DNA.
  • FADD DED domains can be directly linked on a dCasl3.
  • Such effector protein is called Cas-DED complex.
  • dCasl3 801 has a gRNA 811 that targets mutated single RNA strand 820. It is possible design several dCasl3 with different gRNA to target different locations of the mutated RNA.
  • gRNA 811 associated with dCasl3 801 can target the mutated RNA segment 821, while the gRNA 812 on dCasl3 802 can target the segment 822 next to it.
  • DED domain 820 are attached to dCasl3 801 and dCasl3 802.
  • the aggregation of the DED domains in the region recruits procaspases 8 840 to the form the Cas-DISC complex.
  • the proximity between the two procaspase 8 triggers the autocatalytic reaction to cleave and mature the caspase 8 850.
  • the active caspase 850 is then initiate cascade cell death signal to cause apoptosis for the mutated cells.
  • dCasl3 can be linked or fused to all the elements in the death fold, which includes Death Domain (DD), Death effector domain (DED), and caspase recruitment domain (CARD) and Pyrin Domain (PYD).
  • DD Death Domain
  • DED Death effector domain
  • CARD caspase recruitment domain
  • PYD Pyrin Domain
  • caspase 9 is initiator caspase response to the intercellular stress signals.
  • the activation of the caspase 9 involves the release of Cytochrome C from mitochondria, attachment of the
  • Cytochrome C with Apaf-1 and attachment of dATP with Apaf-1 make the Apaf-1 active.
  • a procaspase 9 encounter active Apaf-1, there can be autocatalytic reaction to cleave and activate caspase 9.
  • the activated caspase 9 can initiate cascade events leading to apoptosis.
  • a dCasl3 is bind to a recombinant Apaf-1 (rApaf-1), and dCasl3 bind to a procaspase 9.
  • FIG. 9 shows the Cas- Apaf-1 configuration.
  • dCasl3 901 has a gRNA 911 that target mutated single RNA strand 920.
  • gRNA 911 associated with dCasl3 901 can target the mutated RNA segment 921, while the gRNA 912 on dCasl3 902 can target the segment 922 next to it.
  • rApaf-1 930 is a three segment unit attached to dCasl3 901 and procaspase 9 940 is attached to dCasl3 902.
  • procaspase 9 940 is attached to dCasl3 902.
  • the proximity between rApaf-1 and procaspase 9 triggers the autocatalytic reaction to cleave and mature the caspase 9 950.
  • the active caspase 9 950 is then initiate cascade cell death signal to cause apoptosis.
  • Fas signal pathway there is an adaptor molecule-receptor interacting protein(RIP) and caspase 2 pathway. In that case, it is also possible to use procaspase 2 to start the apoptosis process.
  • the mutated DNA is detected by detector protein with targeting domain comprising of a dCas9 with the corresponding gRNA targeting the mutated DNA.
  • the activator domain of the detector protein can promote the transcription of the corresponding mutated DNA, generating some quantity of mutated RNA signal sequence.
  • the mutated RNA signal sequence is then used as harboring place, or substrate to create proximity that is needed for autocatalytic reactions by procaspases.
  • the induction of proximity can be by direct linking of two caspases together by dCasl3 which recognize and bind to the mutated RNA signal sequences, or initiator caspases are recruited by cluster of death domains linked together by dCasl3 which recognize and bind to the mutated RNA.
  • the RNA is served as a substrate for creating the distributed the death inducing suicide complex (DDISC), as compared to the naturally DISC, where the apoptosis cascade signal is generated.
  • DDISC distributed the death inducing suicide complex
  • Caspase 2 and caspase 8 also appear in nuclei, therefore it is possible to just use on dCas9 to target the mutated DNA segment.
  • a dCas9 can be fused with a procaspase 8 to form a combined detector and effector protein.
  • the gRNA of this effector protein can target the mutated DNA segment.
  • a second dCas9 can target a DNA segment that is close to the mutated DNA segment, again it can be fused with a procaspase 8.
  • This effector protein can have the combined functions of detector proteins and effector protein. The forced proximity when binding of the two effector proteins to a mutated DNA sequence can enable the two procaspase 8 to perform autocatalytic reaction.
  • dCas9 1001 is designed to target a mutated DNA segment in the DNA sequence; while dCas9 1002 is targeting a segment physically adjacent the first segment, considering position on the geometry of the histone, not necessarily linearly adjacent along the DNA sequence 1010.
  • procaspase 8 1021 is attached to dCas9 1001 via a chemical induce dimerization binding domains CID 1031. lot of choice of CID, one of simple one is API 903.
  • the inducing chemical 1032 connects the link.
  • procaspase 8 1022 is attached to dCas9 1002 via the CID junction as well.
  • RNA are generated and tRNA can translate the RNA into the corresponding protein peptides.
  • One of the protein peptides can also carry the mutated nucleotide. It is then possible to target the mutated protein segment with antibody that is designed to target the mutation protein peptides.
  • Antibody can be obtained by routinely target most of the cancer antigens. The challenges of the using the antibody for typical immune therapies is requirement of the T cell receptor to be able to pick up the antigen and the need for the cancer cells to express the antigens that the T cells can target and also the binding affinity of the MHC of the peptides. The use of the antibody can avoid some of the challenges.
  • the antibody specific to the mutated protein can be used to link with an initiator caspase, in the same way a dCasl3 is used described above to create an effector protein.
  • antibody 1101 is targeting the protein segment 1111 on the translated protein 1110 that has the mutated nucleotide, while antibody 1102 targeting segment 1112. Both antibodies are linked to a procaspase 8 1120.
  • procaspases8 can have autocatalytic reaction to activate caspase 8 1130.
  • the active caspase 8 can initiate cascade events leading to apoptosis. scFv with procaspase 8 as effector
  • the scFv segment of the antibody can be used instead of a whole antibody.
  • the mutated protein targeting scFv can be obtained by evolution engineering. The binding specificity of most antibodies is retained when the Fv portion of the antibody is used.
  • the Fv fragment constitutes the variable portion of the heavy chain linked to the variable portion of the light chain. Linking the two chains is accomplished either with a flexible peptide linker or the introduction of a novel disulfide bond.
  • There are existing libraries of scFv and antibodies that have the binding domain for different peptides routinely used in the labs to detect mutation proteins in different laboratory experiments such as immune fluorescence, immune histochemistry etc.
  • Those antibodies for targeting mutations can be used for targeting domain of detector proteins and the effector proteins in current embodiments.
  • an antibody was identified with high affinity and high specificity targeting G34R mutation in pediatric brain tumor.
  • Such antibody, and its scFv portion can be used in the current disclosed embodiments as shown below.
  • the current embodiments empower the existing antibody libraries, typically used in lab tests, to benefit cancer patients. Recent development on the antibody Phage Display library enables the design of antibodies with various functions, therefore can in return to enable more powerful therapeutic effect the current disclosed embodiments can provide.
  • the effector proteins are based on those in Fas cell death signaling pathway.
  • Fas cell death signaling pathway As mentioned above that NF-kB activating complexes are also used in Fas cell death signaling, it is also possible to utilize the protein components in that pathway for the current therapeutic application to response to the detection signals to initiate cell death.
  • Over all cell death pathways include the Apoptotic cell death, Necrotic cell death, Autophagic cell death. It is obvious that the protein elements used necrotic cell death and autophagic cell death pathways can be utilized as effector domain in effector proteins in current disclosed intracellular cancer therapies.
  • Casl3 is RNA targeting enzyme that can bind to the targeted single strand RNA and cleave the RNA, and it can be activated after it cleaves the targeted RNA. After it is activated, it cleaves randomly RNA in the cell that could lead to cell death. It is hypothesized that such random cleaving is the ultraistic last defense mechanism for the bacterial cells against viral infection. It is the key to generate a good quantity of mRNA targets for a lot of Casl3 to self- activate by cleaving the targeted RNA. Therefore, another embodiment of the current embodiments to use dCas9 as effector protein to target the transcribed RNA by selectively activate the transcription of the mutations in the tumor cells. Such embodiment is shown FIG.
  • Casl3 301 with a gRNA 310 which has a scaffold 311 that attach to Casl3.
  • the protospacer 312 of the gRNA targets the mutated RNA segment of the RNA sequence 320.
  • Casl3 binds to the RNA sequence, it cleaves the RNA at locations 330 on both sides of the protospacer. After its first cleaves it will continue to cleave RNA randomly causing cell death.
  • Casl3 can perform random cut after the initial activation cleave up to 10 4 . Activating transcription of a mutated gene can generate substantial amount of random cleaving of RNA. It is found average 33-66 mutations in a cancer, some over 100 mutations. Among the mutations, 2 to 8 of them are driver mutations. It is preferable to have a large set of gRNA to target the driver mutations to have large enough quantity of the transcribed RNA that Casl3 can target, to create a momentum to cause cell death.
  • the random cleaving and the recombinant activation of Caspase or toxins can be combined.
  • One approach is to have an effector protein to be a wild type, dCasl3a fused with a pro-Caspasel, it is delivered to the cells with gRNA that binds to a segment of a mutated genetic sequence. Later transfected to the cells will be the second effector protein that is a combo of a wild type Casl3a fused with a pro-Caspasel together with a gRNA complementary to the mutated segment of the same genetic sequence the first effector protein binding to.
  • the pro-Caspasel can be activated by autocatalytic effect which further causes cell death with pyroptosis pathway.
  • the wild type Casl3a is auto-activated as well by cleaving the targeted RNA sequence. After the activation, the Casl3a will cleave up to 10 L 4 RNA sequence therefore help create disruption of the normal protein synthesis function of the cells to accelerate the cell death the recombinant Caspase 1 are executing.
  • dCasl3a 2012 is fused with procaspase 1 2032, it binds to an RNA sequence 2001 first.
  • the binding of the dCasl3a won’t activate the enzyme to cleave the RNA 2001.
  • the later transfected or later translated wild type Casl3a 2022 can bind to the mutated segment of the RNA sequence 2001.
  • the close proximity of the procaspase 2031 and 2032 can induce autocatalytic activation to produce an active caspase 2040.
  • the wild type Casl3a 2041 which can randomly cleave RNAs it encounters.
  • dCasl3d 2111, dCasl3d 2112 and dCasl3d 2113 are fused to procaspase 9 2131, caspase 9 2132 and caspase 9 2133 respectively.
  • dCasl3d 2111 binds to the mutated segment of the targeted genetic sequence 2101.
  • dCasl3d 2112 and dCasl3d 2113 bind on either side of the dCasl3d 2111 along the genetic sequence 3201. The close proximity of the procaspases enables them to
  • procaspase 9 2131 have a chance to dimerized with procaspase 9 2132 to form caspase 9 2141 also have a chance to dimerize with procaspase 9 2133 to form caspase 9 2142, increase the chance of activating the caspase to execute the cell death.
  • the effector protein at the center can be a fused protein of a wild type Casl3d and procaspase 9.
  • the other two effector proteins are still with dCasl3d and procaspase 9.
  • the two effectors with dCasl3d can be allowed to bind to the target sequence first. The distance between them is long enough that the procaspase 9 won’t be able to dimerize. And then the effector with wild type Casl3d binds to the mutated segment of the targeted sequence.
  • the binding of the wild type Casl3d enable the dimerization of the procaspases to activate the caspase for inducing cell death, and at the same time the binding of the wild type Casl3d to the recognized RNA sequence activates the Casl3d to cleave the targeted sequence and other RNA sequence it encounters.
  • the collateral cleaving of RNA in the cell can accelerate the cell death process initiated by caspase 9.
  • two effector domains bound to the middle mutation sequence binding domain are used as shown in FIG. 22.
  • dCasl3d 2222 is fused to two effectors 2232.
  • dCasl3d 2223 is fused to effector 2233.
  • dCasl3d 2212 is fused to effector 2234.
  • dCasl3d 2222 binds to the mutated segment of the targeted genetic sequence 2201.
  • dCasl3d 2212 and dCasl3d 2213 bind on either side of the dCasl3d 2222 along the genetic sequence 2201.
  • the close proximity of the two middle effectors 3332 to either effectors 2234 and 2233 can lead to dimerization or complexing of the two middle effectors 2232 with 2234 and/or 2233 to create the possibility of two therapeutic proteins or compounds.
  • Recombinant toxins can be used to induce cell death once the mutated genetic sequences are detected.
  • Immunotoxins can be designed and utilized to fight cancer, where antibody is fused with bacterial toxin to target cancer cells.
  • the toxin which can be, for example, a bacterial or plant protein toxin can be chosen for its potent cell-killing activity. This potency is derived from the Protein domain of the toxin.
  • Bacterial toxins that can be used for constructing cancer therapeutics are, for example, diphtheria toxin and Pseudomonas exotoxin , or ricin.
  • Pseudomonas Exotoxin A(PE3) is the most toxic virulence factor of the pathogenic bacterium Pseudomonas aeruginosa, one PE molecule can kill one cell.
  • the 37kDa PE fragment exerts its enzymatic activity and ADP-ribosylates the eukaryotic elongation factor-2 (eEF -2) on the ribosomes.
  • the ADP-ribosylation inactivates eEF-2 therefore disrupting the protein synthesis in the cell. Due to the inability to translate proteins, apoptosis and cell death result.
  • Split PE3 toxin can be designed and tested so that there is no effect when a split domain is used, and toxicity is recovered in recombinant of the split PE3 fragments. Therefore here PE3 recombinant toxin can be used for the pro-effector domain in the effector proteins.
  • FIG. 12 The use of recombinant toxin is shown in FIG. 12, where 1220 is mutated genetic sequence, with 1221 to be mutated segment and 1222 wild type segment nearby. 1201 is dCasl3d, and 1212 is dCasl3d as well.
  • Split PE3/a 1231 is linked with a dCasl3 1201. While 1232 is split PE3/b linked with dCasl3d 1202. Binding of the dCasl3 to the target genetic sequence is guided by gRNA 1211 targeting mutated segment 1221, and gRNA 1212 targeting the nearby segment 1222.
  • the separation between the gRNA 1221 and 1222 is preferable to be about 15 nucleotides.
  • the flexibility of the linkers can be sufficient for the split toxins to be recombine efficiently.
  • the close proximity between the PE3/a and PE3/b allow them to recombine to be activated.
  • the activation of the PE toxin can affect the protein synthesis machinery to haul the protein production leading to cell death.
  • the binding genetic sequence is an RNA sequence
  • this complex is mobile, more so compared with that from DNA sequence, allowing the recombinant toxin to engage the protein synthesis machinery in the cytoplasm to interfere the protein production to cause cell death.
  • the PE toxin is an example of bacterial toxin, one can also use plant base toxins like ricin, and other cytotoxic toxins.
  • NABD cytosine deaminase
  • they can be attached to benign pro-drug converting enzymes which induce toxicity in the presence of an added small molecule.
  • a classic example of this is the ability of cytosine deaminase convert the non-toxic antifungal compound 5-fluorocytosine into the toxic metabolite 5-fluorouracil which has been shown to be active in killing cancer cells.
  • two dCasl3 NABDs which each be fused to one-half of a split pro-drug converting enzyme (for example - cytosine deaminase domain A and B).
  • FIG. 12 also depict the situation of a such recombinant pro-drug system. Where the 1231 is the split cytosine deaminase, and 1232 is the other half of the cytosine deaminase.
  • the recombinant active cytosine deaminase therefore can effects on pro-drug 5-fluorocytosine 1241 to turn it into active form to cause cell death.
  • prodrug pairs are Thymidine kinase/ganciclovir, carboxypeptidase G2/nitrogen mustard, and purine nucleoside phosphorylase/6-methylpurine deoxyriboside.
  • NTR nitroreductase
  • CB 1954 5-(aziridin-l- yl)-2,4-dinitrobenzamide
  • effectors can act as a theragnostic for diagnostic and subsequent therapeutic applications.
  • effector domains can comprise pieces of a reporter gene (e.g. fluorescent, IR-responsive, X-ray responsive, colorimetric, etc.), which can detect cells in which a mutation is present. Reports can be sensitive or facilitate subsequent toxic reactions in response to IR, X-ray, or other signals. Or, similar to a prodrug, they can convert benign treatment signals (fluorescence), into a toxic signal (through decay of a fluorescent activated effector) in mutated cells.
  • a reporter gene e.g. fluorescent, IR-responsive, X-ray responsive, colorimetric, etc.
  • nucleic acid binding domain (NABD-A) and nucleic acid binding domain (NABD)-B to a mutate sequence within a cancer cell can generate a holo-bacterial or viral epitope to be targeted by the immune system.
  • This epitope can be targeted to the cellular surface through a variety of means.
  • Other methods for linking recognition of the mutated intracellular DNA sequence to expression of an antigenic epitope on the cell surface can also be used.
  • nucleic acid binding domain (NABD-A) and nucleic acid binding domain (NABD)-B to a mutate sequence within a cancer cell can generate a holo-bacterial or viral epitope to be targeted by the immune system.
  • This epitope can be targeted to the cellular surface through a variety of means. For example recruitment of the two domains together can result in a signal peptide sequence or protease cleavage consensus sequence.
  • mutations are transcribed to the RNA level. Additional mutations can arise at the RNA level due to slippage of the RNA polymerase (or other insults).
  • a single nucleotide mutation at the DNA level can be transcribed to be a single nucleotide mutation on an RNA, and also possibly an errant spliced mRNA mutation at the RNA level. Therefore there are additional types of genetic aberrations such as truncations, intron retention types of mutations, etc. generated at the RNA level. In fact, intron retentions are found to be a major mutation in tumor suppressor genes.
  • amino acid substations are linked directly with mutations in the RNA sequence, but possible additional substitutions can result from problems with the ribosomal translation process e.g. mis-incorporation or a new amino acid).
  • the mutated genetic sequence can be generated differential affinity binding to the mutated genetic sequence compared with un-mutated sequence for mutations resulted in reading frame shift, such as insertion, deletion, translocation, fusion, alternative spliced mRNA, or errant spliced mRNA. Because these mutations can create a large mismatch of the targeted sequence, even half to more of the nucleotides in the target sequence can be displaced, discrimination of these sequences vs. the wild-type sequences is relatively easy (high discrimination). Thus, these large genetic changes make excellent target mutations.
  • the therapeutic method can create a high death rate in these mutated cells while preserving the unmutated cells.
  • the targeting protein binds to a genetic sequence that is not exactly complementary to the gRNA target sequence, off target effects can occur. Specificity is important, and it is challenging to have high specificity (on vs. off-target) when considering sequences with only a single mismatch.
  • the guiding molecule can be designed to target the mutated DNA sequence. For example, this could be a single nucleotide mutation which results in activation of an oncogene, or a translocation which generates a fusion protein that is oncogenic potential.
  • the guide should not target the healthy, or wild-type/unmutated gene sequence at that particular loci. Thus, it is important to achieve excellent selectivity between the mutated sequence (target), and the wild-type sequence (off target), to which no binding or activity should occur.
  • Rational protein engineering approaches can improve the inherent DNA binding specificity of Cas systems such as Cas9, reducing their off-target DNA binding and cleavage.
  • the basis for this engineered Cas9 variants is a decrease in the binding potential between the Cas9 and the non-template strand DNA, which weakens the overall binding strength and thereby partially abrogates binding to off-target sequences (while maintaining on-target activity).
  • This approach can result in on/off target activity of 60%/30% (worst case) and 60%/0)% (best case) for sequences with single nucleotide mismatches. For example, the sequence
  • GGT GAGT GAGTGCGT GCGGG is different from the wild type GGTGAGTGAGTGTGCGGG by only one nucleotide T to C. The difference in activity on these sequences using the evolved variant is 60% . There are other sequences that have only one nucleotide mismatched in which the activity drops to almost zero.
  • Cas9 can be modified to improve specificity by reducing ancillary hydrogen bonds made by four SpCas9 residues (N497, R661, Q695, Q926) to the phosphate backbone of the target DNA. The goal of this strategy is to weaken the binding energy so that binding to off-target sequences is lessened.
  • the improved version of the SpCas9,SpCas9-HFl results in off target indels in human cells that are statistically indistinguishable from the background level of indels observed in samples from control transfections.
  • mutations in the REC3 domain of Cas9 can also greatly improve specificity. Mutating 4 residues of REC3 domain and two residues in the linker between HNH and RuvC domain can improve the specificity of the cleavage by the Cas9 variant. By replacing the residue in Cluster 1 (N692A/M694A/Q695A/H698A with alanine, Cas9 variant has greater specificity against single mismatch at positions 1 through 18 of the gRNA. The name of this Cas9 variant is HypaCas9.With proper design, it is possible to have a high on/off target selectivity ratio with this particular cancer therapy.
  • Computational design can also aid in improving target discrimination.
  • the on/off ratio should correlate to the binding strength between the gRNA and the targeted strand of the DNA. Therefore, for a given driver mutation profile of a patient, a computer program is used to search for the combination of mutation, gRNA sequence, the type of proteins (different Crispr Cas systems and their variants) that has the best on/off ratio on the binding strength between the mutated and wild type DNA sequences.
  • This computer program can be designed to cover all possible human cancer mutations.
  • altering the structure of composition of gRNAs may be another strategy to improve Cas9 specificity. For example, addition of two
  • gRNA - I l l - guanine nucleotides to the 5' end of gRNA can increase specificity of Cas9 by up to 660-fold.
  • Incorporation of chemically-modified nucleotides into gRNAs can vastly improve specificity.
  • Using DNA nucleotides instead of RNA nucleotides in the gRNA molecule can improve specificity and improve stability.
  • incorporation of locked nucleic acids (LNAs) or bridged nucleic acids (BNAs) at specific positions within a crRNA cab vastly improve Cas9 specificity and even allow for virtual perfect single mismatch discrimination.
  • LNAs locked nucleic acids
  • BNAs bridged nucleic acids
  • BNA-modified crRNAs can improve Cas9 mismatch discrimination in vitro and in cells by more than 10,000-fold.
  • the on/off ratio can be improved by the collaborative nature of the method as described herein.
  • the on/off ratio in the detector process can be multiplied by the on/off ratio in the effector process.
  • the dual nature of the detection system (requiring binding of two separate Cas molecules), can inherently improve specificity. For example, off-target engagement would be a multiple of the off-target engagement of each separate Cas protein (this dramatically reducing the overall off-target activity of the system).
  • Both detector proteins can have a targeting segment that include the mutated information.
  • the double strand nature of the DNA provides two mutated sequences to allow two detection events to happen. This allow two attempts to find the high specificity binding, and have a collaborative mechanism to improve the specificity.
  • the gRNA that target the coding strand can match the wild type DNA, while the gRNA targeting the non coding strand can target the mutated DNA.
  • One collaborating effort can be that the dCas9 with gRNA that binds to the coding strand functions as a blocker protein to block the transcription of gene.
  • the dCAs9 with gRNA that targets the non-coding strand of DNA can be linked with an activator domain to activate the transcription of the mutated gene.
  • either one of the detector protein has a high specificity, i.e. having high on/off ratio at the mutated nucleotide, the mutation can be targeted to generate mutation signal sequence while not affecting normal cells with un-mutated DNA. For example, FIG.
  • dCas9 1401 has a gRNA that selectively bind to the coding sequence of the un-mutated sequence of the DNA. In operation, it can block the transcription of the gene it binds to. So the un-mutated cell cannot transcribe the gene targeted. Also seen a dCas9 1421 linked with an activator 1423, the gRNA 1422 matches the mutated sequence of the non-coding strand of DNA. The binding of this protein to the targeted mutated gene can activate the transcription of the gene to generate mutated signal sequence.
  • the two detector proteins collaboratively improve the specificity.
  • dCas9 After dCas9 binds to a gRNA, there is conformational changes in the dCas9 so that the complex is ready to search for DNA sites that is complementary to the gRNA.
  • Target search and recognition require the presence of conserved PAM sequence and the pairing between the 20nt spacer sequence and the target DNA sequence.
  • the PAM sequence can be crucial for the discrimination between self and nonself sequences, and single mutations in the PAM can disable dCas9 binding. Such a highly rejection property of PAM can be used to target mutation.
  • dCas9 orthologues and their variants such that targeted cancer mutation is either within the PAM or in the nearest few nucleotides where mismatching of one nucleotide can disable the binding of the detector protein to the site.
  • target mutations occur within a putative PAM sequence of a gene
  • optimal on/off-target discrimination can be leveraged.
  • Cas systems appear to show the greatest ability
  • Cas9 discrimination of single nucleotide mismatches can be strongest within the first 10-12bp of the 3’ end of the crRNA, known as the seed sequence. Therefore, preferentially targeting mutated sequences which overlap with PAM and seed regions can be attempted to maximize on/off-target discrimination.
  • the effect of mismatches within the PAM or in the seed region is greater than the effect of mismatches distal to the PAM.
  • the sequence of the mutation being considered for targeting purposes is TGGAGGGGTGA where the tumor sequence is TGGAAGGGTGA.
  • the PAM is NGG, therefore it is possible to use AGG as in the wild type sequence as the PAM, as shown in italic bulk fonts in the list below: TGGAGGGGTGA.
  • the spacer sequence of the gRNA is AAGAGUGCGCCCUCUACUGG.
  • the mutation from G to A can shift the PAM to the right resulting in a complete mismatch of the spacer sequence and consequently, a loss of binding.
  • the dCas9 can bind to the un- mutated DNA, and no binding for mutated DNA.
  • the detector protein dCas9 can act as a transcription blocker.
  • the mutated A with the next GG can also be a PAM.
  • the spacer sequence of the gRNA be AGAGUGCGCCCUCUACUGGA, such that dCas9 can be bind to the mutated DNA sequence while not binding to wild type, un-mutated DNA sequence. Because the whole sequence is shifted due to mutation, the On/Off ratio can be high. This gives great flexibility of targeting the G34R mutation, either target the mutated sequence or un-mutated sequence.
  • NGG PAM cannot cover the mutations positions.
  • Other Cas9 types or variants can be used to have more suitable PAM at a particular mutation location.
  • the mutation TP53 R273C is a typical mutation in many cancers.
  • NGG PAM near this location. Therefore, a Cas9 variant would need to be applied to target this region.
  • the PAM GCG is indicated in bold font.
  • the sequence GGACGGAACAGCUUUGAGGU is the protospacer of the gRNA.
  • the mutation of the P53 R273C can be from GCG to GTG at the PAM location. Since GCG is the PAM and GTG is not recognized as a PAM by this enzyme, dCas9 can bind to the wild type gene sequence and not to the mutated gene sequence, allowing for discrimination between healthy and cancerous cells.
  • the treatment plan for G34R can be viewed as off the shelve treatment for all the patients with this tumor type, while the treatment plan including the p53 R273C can be personalized treatment.
  • p53 R273C is also a mutation hot spot for different kind of cancer, therefore the treatment plan for this mutation can also be made off the shelve.
  • PACE is based on the direct evolution method, where host E. coli cells as the engine for the evolution have two plasmid Accessary Plasmid (AP), and Mutagenesis Plasmid (MP).
  • AP has gene encodes protein III of infectious bacteria phage M13 which is conditionally transcribed.
  • the condition of the producing protein III from AP is provided by the SP plasmid carried in by infectious phage.
  • SP is evolving by MP. the resulting SP will conditionally enable AP
  • MP encode the low-fidelity Escherichia coli ⁇ E coli) DNA polymerase III components that has reduced proof reading capability therefore increase the mutation rate for DNA replications.
  • the continue evolving of the SP will optimize the protein feature encoded by SP to fit well to the condition set by AP.
  • the lagoon continuous format of PACE enables quick results.
  • DNA binding domain (DBD) to be evolved is linked to a w subunit of bacterial RNA polymerase(RNAP).
  • a targeted DNA sequence is placed upstream of a minimal lac promoter to induce transcription of a phage gene III-luciferase reporter.
  • the DBD+RNAP unit is packaged in selection phage (SP) construct, the DNA+operator-gene III is packaged in an accessary plasmid (AP), Therefore the DBD domain that binds well to the targeted DNA sequence specifically will enable transcription of gene III of the phage to produce protein pill for phage propagation, allowing positive selection of the DBD domain that selectively bind to the targeted DNA.
  • a series of negative selection APs in which binding of the DBD+RNAP to an off-target DNA sequence induces expression of gene Ill-neg from a minimal lac promoter. Both positive and negative evolution can be applied simultaneously to obtain DBD domain with high specificity binding to the target DNA sequence.
  • PACE can be applied to Cas9 to create variants to broaden PAM recognition and high specificity for DNA binding.
  • the PAM recognized can be NG, GAA, GAT.
  • a PACE system can be designed to evolve Cas9 protein and gRNA to optimize the binding to the mutated DNA sequence for a driver mutation in caner.
  • the AP plasmid encodes PAM and target DNA sequence recognized by the SP encoded dCas9 variant. Binding of dCas9 to the target DNA sequence will recruit RNA polymerase machinery to the encoded minimal Lac protom er site by the w domain. The assembly of RNA polymerase to AP plasmid will trigger the express of the encoded gene III of the infectious phage.
  • Also encoded in AP can be the gRNA complementary to the target DNA sequence.
  • the target DNA sequence contains a cancer mutation; therefore the expression of the gene III depends on the binding of the dCas9 specifically to the mutated DNA sequence.
  • MP6 of the mutagenesis plasmid from can be used to create variant in the dCas9 so that during the course evolution, the specificity of the dCas9 variant binding to the target mutated DNA sequence will increases.
  • the gRNA sequence is encoded in the SP plasmid instead of the AP plasmid therefore the gRNA sequence can also be optimized from the evolution.
  • APw Accessary Plasmid
  • the gene III is coded so that when dCas9 binds to the target DNA sequence, mutated protein III is expressed to discriminating the dCas9 variant that binds to the wild type DNA sequence.
  • the un-mutated nucleotide will be the three nucleotide other than the mutated one.
  • a Theophylline inducible riboswitch can be used to fine tune the evolution converging process.
  • FIG. 15 depicts such PACE design.
  • E Coli bacteria 1511 is used for host cell to perform the evolution.
  • the host cells are transfected by mutagenesis plasmid 1521 and accessary plasmid with mutated sequence(APm) 1522 and accessary plasmid with wild type sequence(APw) 1523.
  • the bacterial phage 1531 which DNA is encoding plasmid specificity plasmid (SP) 1532.
  • SP plasmid specificity plasmid
  • SP plasmid 1532 encodes with w domain of RNAP, dCas9 and a linker between them.
  • APm plasmid 1522 encodes PAM sequence, and the mutated target sequence, promoter, genelll for the bacterial phage, and gRNA for the dCas9.
  • the w domain will recruit RNA polymerase to transcribe the pill gene and to create the pill protein so that the bacteria phage can be assembled completely together with other phage proteins transcribed by SP plasmid.
  • the completed infectious phage can exit the host cells 1512 to be able to infect other cells to propagate the dCas9 clone that binds to the mutated sequence, typically with single nucleotide mutation.
  • the dCas9+ w +gRNA binds to the PAM and the wild type DNA sequence from the APw plasmid, it will promote the transcription of the plllneg gene which produce a non-function pill protein.
  • This non-function pill protein cause the assembled phage not being able to come out from the host cells and therefore cannot come out to infect other cells, therefore suppress the dCas9 clone that binds to the wild type DNA sequence.
  • the mutagenesis plasmid introduce mutations in the dCas9 and the positive and negative selection will produce dCas9 variants that have good on/off binding ratio targeting the single nucleotide mutation.
  • RNA binding domain can be a dCasl3, because there is no activation function for the RNA binding because the transcription already happen. Therefore the RNA design for the positive selection operation will be non-translatable as transcribed by RNA polymerase, targeted binding of dCasl3 or other targeting binding domain will enable the translation. For the negative selection, it will be similar to DNA situation that binding of the dCasl3 or other targeting binding domain will suppress the translation.
  • the host E-Coli cells 1611 are transfected with MP plasmid 1621 to create mutagenesis in the phage propagation.
  • SP plasmid 1632 encodes a dCasl3 and all the phage Ml 3 gene except pill gene.
  • APw plasmid 1623 encodes a wild type target DNA sequence, and ribosome binding sequence RBS and pill gene.
  • Also encoded in the APw is gRNA sequence that complements the mutated target DNA sequence.
  • APm plasmid 1622 encodes a dCasl3 inducer switch, which is at off stage as transcribed. Encoded after the switch is a ribosome binding sequence and a pill gene sequence.
  • the RBS is a SD sequence.
  • gRNA sequence that complements the mutated target DNA sequence is a dCasl3 and all the phage Ml 3 gene except pill gene.
  • the host cells are transfected by mutagenesis plasmid 1621 and accessary plasmid with mutated sequence(APm) 1622 and accessary plasmid with wild type
  • sequence(APw) 1623 Also in the system is the bacterial phage 1631 which DNA is encoding plasmid specificity plasmid (SP) 1632.
  • SP plasmid specificity plasmid
  • the APw 1623 produces gRNA to work with dCasl3 to bind to dCasl3 inducer switch to positively select the dCasl3 that is binding to the mutated target RNA sequence that is transcribed from the APm plasmid 1622.
  • the inducer switch to switch from the default off state to on state to allow ribosome to access to the ribosome binding site to perform the translation of pill protein to allow the phage 1632 to be assembled to exit the host cells 1612 and propagate the dCasl3 clone that binds well to the mutated target RNA sequence.
  • the dCasl3 binds to the wild type target sequence on the mRNA transcribed from the APw plasmid 1623, it will block or reduce the translation of the mRNA from APw to obtain the pill protein to be able to propagate the phages and the dCasl3 clone, therefore negatively select the dCasl3 that binds to the wild type, un-mutated DNA sequence.
  • the evolved dCasl3 have high specificity to bind to mutated RNA sequence while not binding to wild type RNA sequence.
  • inducer switch it is proposed here to use a Crispr Cas based inducer switch.
  • a typical beacon switch is a stem loop RNA where two end of the RNA linked with a fluorophore and a quencher. Because of light emitted from fluorophore is absorbed by the quencher, not light is release from the beacon. By binding a complementary sequence to the stem loop will cause conformational change in the stem loop to straight line separating the fluorophore and the quencher, the light emitted from the fluorophore will be able released and detected.
  • This structure is used to detect genetic sequences in different biological application.
  • a beacon 1641 that the target sequence to be encoded in the stem loop, and the RBS is encoded on one side of the stem of the beacon and coding sequence is downstream the RBS.
  • the distance between the RBS and the stem of the beacon is preferred to be within 13nt so that the close proximity of the stem loop hinder the access to the RBS by ribosome. Therefore inhibit the translation of the coding sequence in the RNA.
  • the dCasl3 1650 binds to the target sequence on the loop, it causes the loop to conformational straighten and disengages the stem portion of the beacon to expose the RBS to be accessed by ribosome.
  • the binding of the dCasl3 to the beacon switch will enable the translation of the pill to expand the phage clone with the dCasl3 selectively bind to the mutated target RNA sequence.
  • Toehold switch has a single strand RNA on the 5’ end as the initiate hybridization point for interaction of the trigger RNA to the riboregulatory.
  • the toehold switch 1642 is a stem loop structure with long stem, where the target RNA sequence is at the 5’end of the structure.
  • the RBS is on the heel of the stem loop. It can also be on the stem where it is shield the access from ribosome.
  • Examples here use dCasl3 as genetic sequence binding protein to be optimized.
  • RNA binding PACE system can work with different kinds of RNA binding proteins such as PUL.
  • the binding probability of an effector protein to a target genetic sequence can be a function of number of mismatches between the target genetic sequence and the gRNA.
  • the probability of binding can be 100%, and one mismatch(wild type sequence) can abolish the binding resulting zero percent.
  • the probability of binding can fall on a transition curve from 100% binding to 0% binding as function of number of mismatching nucleotides.
  • the goal for design of the gRNA is such that the incorporating targeted mutation nucleotide can bring the binding probability from poor binding (or none) to strong binding.
  • FIG. 17 depicts the ideal curve situation in which one mismatch can drop the binding percentage from 100% to 0%. If the gRNA design to match the mutated sequence with single nucleotide mutation, the wild type sequence can have one mismatch to the gRNA. However, in the typical transition curve shown in the FIG. 17, one mismatch can drop the mutation from 100% to 90%, while the second mismatch can drop to 10%. [0333] It is also conceivable that adding one more nucleotide into the gRNA that is different from the wild type sequence besides the targeted cancer mutation, could improve specificity.
  • the binding probability to the targeted mutated sequence would be the on rate, while the binding probability to the wild type normal sequence would be the off rate.
  • the goal of this design would be to maximize the separation of the on and off rate.
  • the effect of the second mutation can also be improved by a third mismatch on the gRNA.
  • the second and third mismatches can be done using all 4 type of nuclear acids for DNA, and uracil, and LNA, BNA, or attaching other chemical groups to the mismatch nucleotide on the gRNA. Again computer algorithms are used to find out the best choice for the second variant nucleotide. The goal would be to achieve On/off ratio larger than 10.
  • incorporation of chemically modified nucleotides in parallel could greatly improve mismatch discrimination in this regard.
  • DNA binding specificity and DNA cleavage specificity may not be fully coupled Cas9 cleavage can be substantially more specific than its binding. Since the embodiments of the disclosure involve catalytically dead variants of Cas (dCas), DNA-binding specificity rather than cleavage specificity is the primary concern. There can be a tradeoff between cleaving efficiency and the binding specificity when truncating gRNAs; decreasing the gRNA spacer from 20 to 14 can dramatically decrease cleavage activity, yet preserves DNA binding activity. Taking this into account, the gRNA can be designed such that it is at the lower limit of binding affinity, i.e.
  • this one can be the truncated binding curve, where the truncation can decrease the binding affinity to the target sequence, and abolish it on the mismatched sequences.
  • square dot line is a curve for typical truncation binding probability. At a gRNA length of 12, the binding probability is at 75% with the gRNA matched to the mutated genetic sequence. A mismatch at the binding site can drop the probability to 10%. Ideally, the system could be configured so as to drop the efficiency from 90% to 5%.
  • DNA-binding domains including zinc fingers and TALEs. Both of these DNA-binding domains can show single nucleotide mismatch capabilities example for the canonical ZF domain Zif268, even a single base pair substitution in the DNA-binding sequence can reduce the relative signal/background ration by 10-fold. Thus, both ZFs and TALEs could represent alternative DNA-binding domains for use.
  • the current disclosed detector protein detection strategy can also be applied to improve immune therapies involving inter cellular signaling.
  • Immune cells depend on expression of tumor antigens to identify cancer cells.
  • Tumor specific (neo) antigens are peptides translated from the mutated genes of a given tumor. These peptides carry information resulting from DNA mutations and are expressed on the surface of the cells. These mutated protein peptides can be presented by MHC I or MHC II on the cancer cells. Immune cells can recognize the mutated peptides as foreign and attack the tumor cells.
  • Dendritic cells are primed or trained to recognize mutated peptides.
  • DC cells are obtained from the patient to be treated.
  • tumor lysate can be used to co-culture with DC cells to train the DC cells.
  • the DC cell can digest and present the peptides including neo peptides.
  • the peptides presented by DC cells can be the same peptides that are presented in cancer cells of the same patient.
  • the mature DC cells are then administrated to patient in turn to prime the T cells in vivo so that they can target the cancer cells that present the mutated protein peptides.
  • the expression of neo antigens can depend on the cell cycle that the tumor cancer cells are in. For example, some proteins are only needed during G phase and some are only in S phase. Therefore, the quantity of neo antigens can fluctuate during the cell cycle. This fluctuation issue can be medicated by the current disclosure.
  • the detector proteins can identify and bind to the mutated DNA to activate the transcription of the mutated gene, creating many copies of mutated genetic signal sequences that can presented on MCH receptors. Such process ensures some quantity of the neo antigens for immune cells to target, less dependent on the cell cycle status of the tumor cells. This improves the chance for immune cells to catch the expressed neo antigens.
  • Another embodiment of the current disclosure is to boost the expression of antigens from a mutated cell for which antibodies or other immunotherapy treatments are already available.
  • therapies such as immunotherapy efforts that already target some proteins or receptors on the cancer cells.
  • Cas9 can be split into two separate protein components. The split halves can be introduced into the cell separately. Subsequently, these fragments can be recombined via dimerization using CID system of Rapamycin, FRB and FKBP. The recombined Cas9 functions similar to the wild-type protein.
  • CD 19 is an antigen that is in acute lymphoblastic leukemia and is a current target for CAR-T cell therapy. Moreover, one could induce the expression of CD 19 in cancerous cells that would not normally express this protein, rendering them targets for CAR-T cell therapy.
  • this mutation signal sequence can be used as substrate for dimerization.
  • One item to dimerized is a split dCas9 1952 linked with a scFv 1951 which can recognize and bind to a segment on the mutation signal sequence 1940.
  • the other one is a split dCas9 1962 linked with a scFv 1961 which recognize and bind to a segment on the same mutation signal sequence 1440.
  • dCas9 1962 also linked with an activator 1971.
  • the gRNA 1981 has the PAM and protospacer sequence that target the gene loci that codes CD 19 receptors.
  • the present embodiments would induce expressing of CD 19 from its endogenous promoter (while not having this effect in cells without the target mutation). Subsequently, the expressed CD 19 on the cell surface could be used as a target for existing CAR-T cell therapies.
  • delivery and efficiency considerations can include: trio
  • tissue specific targeting delivery vehicles e.g., AAV tropism, cell penetrating peptides CPP peptides, exome guided, exome particles
  • EVADE administration/minimized immune response to the delivery
  • the method by which the therapeutic is delivered can have an effect on its effectiveness and toxicity.
  • Traditional systematic administration methods, oral, in vein, and muscle injection are suitable for chemical drugs.
  • small molecule drugs are administered orally (given that many of them are bioavailable). While this delivery method is quick, cheap, and convenient, it does have some drawbacks, including effects on the liver and off-target effects of the drugs on non-target tissues. Furthermore, some small molecules have limited tissue penetrance and bioavailability. Drug particles are distributed and metabolized all throughout the body Given these limitations, it is clear that a huge amount of drug often needs to be delivered to have an efficacy in the system.
  • delivery vehicles to transport the system either in protein or nucleic acid form into cells.
  • delivery of the detector and effector protein systems to host can be using a lentivirus vector, adeno-associated virus (AAV) vector, or nanoparticles.
  • AAV adeno-associated virus
  • AAV can be used due to its small size, minimum immune response.
  • the system can be delivered as proteins.
  • AAVs can sometimes induce an immune response which decreases their effectiveness.
  • the immune response from the host can reduce the effectiveness of the treatment.
  • Other methods for delivery include protein based delivery methods where the entire RNP complex is delivered to cells via a cationionic polymer or lipid based transfection reagent, or via a cell permeable peptide (e.g. TAT), or similar cell-penetrating peptides or proteins (e.g.
  • Exosomes and microvesicles can afford another method of delivery fully functional, gRNA loaded, Cas fusion proteins into cells. Depending on the state of the cancer cells, in the idle stage of the cell cycle, the transcription and translation machinery can be impaired (not allow for the system to be expressed in situ). By delivering the system as a full RNP complex, this problem can be avoided. Extracellular vesicles can deliver therapeutic payloads. A similar scheme was further utilized by using an Arrestin domain containing protein 1 (ARRDC1) as membrane associated protein.
  • ARRDC1 Arrestin domain containing protein 1
  • ARRDC1 is capable of creating ARRDC1 -mediated microvesicle (ARMM) escaping from a cell. Instead of using dimerizing domains to associate the payload protein, they directly fused the payload protein to the ARRDC1 protein.
  • p53 protein fused to ARRDC1 can be encapsulated in a micro vesicle ARMM.
  • Fused p53 protein delivered by ARMM to a receiving cell can perform the intended protein function in the receiving cell.
  • micro vesicle can have good delivery efficiency, on average a receiving cell received 3.1c10 L 6 proteins from 5.8c10 L 3 ARMM vesicles.
  • Use of ARMM for delivery of Cas9 with gRNA for gene editing can be used.
  • an effector protein in an exosome can be an assembly of an engineered protein of dCasl3d fused a procaspase 9 and a gRNA.
  • a set of such exosomes can be used to target different segment of a mutated RNA sequence.
  • Exosome can be delivered to the receiving cell by endocytic process. When the effector proteins are released from the exosome, they can bind to the mutated RNA target to allow the activation of the caspase 9 (or alternative effector) to induce cell death.
  • Routes of entry for protein or viral based delivery methods could include direct injection into the blood stream, inhalation (in the case of lung tumors or tissues in that area), or local administration via topical routes.
  • organ-specific delivery vehicles can be used.
  • leukemia affects the blood and bone marrow
  • lymphomas tends to affect the lymph nodes. They can all affect thymus, spleen, tonsils. There are about 600 lymph nodes in the body, and one spleen, one thymus, two tonsils. It is relatively easy to target the artery of the spleen, thymus and tonsils.
  • systemic administration can be used to treat metastasis by killing off cancerous cells throughout the body as they travel through the system. Due to the size requirement, there can be needs to split the proteins so that they can be delivered partially and the recombined in the cells by chemically induced dimerization.
  • the dimerization of dCas9 can be just as efficient as the normal dCas9.
  • CRISPR/Cas9 delivery can be performed in single adenoviral vector that devoid of viral genes making more space for delivering cargo.
  • a clinically relevant high-capacity adenoviral vectors HCAdV
  • HCAdV high-capacity adenoviral vectors
  • intermediate plasmids for either constitutive Cas9 expression via the truncated hybrid chicken beta actin promotor (CBh) promotor or inducible expression using the TetOn3G system.
  • CBh truncated hybrid chicken beta actin promotor
  • TetOn3G TetOn3G
  • the intermediate shuttle plasmids allow the introduction of several gRNAs for multiplex.
  • This high capacity adenoviral vector system can be used in the present embodiments, to deliver the detector protein and effector proteins to cancer patients.
  • RNA based Cas sensors In the context of RNA based Cas sensors, occlusion of the mRNA sequence by endogenous proteins, such as the ribosome, could block targeted sensing of a mutation. In order to alleviate this issue, partial inhibition of the ribosome or other RNA binding proteins could be performed to facilitate mutation detection. For example, drugs such as cycloheximide could be used to displace the ribosome from RNAs to facilitate detection by the Cas sensing system.
  • cancer treatment for example: cancer treatment; cancer prevention; and chronic diseases treatment;
  • the treatment can also be used for viral diseases or other genetic diseases in which culling of a particular subset of cells is desired.
  • mutation targets there are many different type of mutations that can be targeted, e.g., indel, single substitution mutation, or missense mutation.
  • Single nucleotide mutation is the most common one, about 95% of the cases with 5% of the cases are indels.
  • 91% are missense, which related to cancer.
  • Other mutations such as translation, deletions are found in cancer as well.
  • Targeted cancer therapies can be drugs or other substances that block the growth and spread of cancer by interfering with specific molecules ("molecular targets") that are involved in the growth, progression, and spread of cancer.
  • Targeted cancer therapies are sometimes called “molecularly targeted drugs,” “molecularly targeted therapies,” “precision medicines,” or similar names.
  • the biomarkers for the cancer are over expression of some receptors such as over expression of EGFR in glioblastomas, CD 19 is the biomarker for B cell lymphomas, over expression of CD47 in many tumors.
  • CD 19 is the biomarker for B cell lymphomas, over expression of CD47 in many tumors.
  • each of those car T is targeting one of the receptor associated with cancer type.
  • the receptors targeted are not tumor specific, therefore there are on target side effects, i.e. collateral damage to the normal tissue expressing the same receptors.
  • the success of Car-T therapies is limited to only a very subset of cancer patients.
  • the driver mutations of a given cancer can be targeted.
  • the biomarker for the treatment is the mutated sequence of the cancer either in the DNA, RNA or protein formats. Since current gene targeting technologies such as ZFNs, TALE, and CRISPR can be used to target any DNA sequence in the human genome, therefore the current mutation technology can be used to target any cancer, any mutated cells.
  • the disclosure can be used to target, for example, target mutated genetic sequence to kill cancer cells to provide treatment for cancer patients; target putative cancer driver mutations to eliminate mutated cells in a healthy host to prevent or delay the possible onset of a cancer; act as a prophylactic to prevent metastasis of cancers; and target infected cells with genetic signatures of viruses/microbes/other parasites [0358]
  • target mutated genetic sequence to kill cancer cells to provide treatment for cancer patients
  • target putative cancer driver mutations to eliminate mutated cells in a healthy host to prevent or delay the possible onset of a cancer
  • target infected cells with genetic signatures of viruses/microbes/other parasites [0358]
  • As a human ages due to the stresses experienced in time, there can be mutations accumulated in vivo. There are some hot spot in tissues and in genetic locations that mutations of which can result in cancers.
  • More than two mutations can form a cancer: one mutation that promote uncontrolled growth-oncogene mutation, and one mutation that cause the loss of tumor suppression function- a tumor suppressor gene mutation.
  • the housekeeping DNA repairing gene mutations enhances the chance to have the two mutations to happen much higher.
  • Target genetic sequence of foreign viral or infectious elements in a host can eliminate the cells infected by the virus and infectious elements to cure the infectious diseases.
  • Target the putative mutations collaborative mutations to eliminate the somatic mutated cells in a healthy host can prevent or delay the possible onset of a chronic or age relative disease that is triggered or enhance by somatic mutations.
  • gRNA For mutation targeting therapies, it is relatively straight forward to design a gRNA to have a high discrimination ratio for translocation, nucleotide addition and deletion types of mutation. If the gRNA is a match with the mutated sequence with the mutation junction at the center of the gRNA protospacer sequence, then half of the sequence can be mismatched. The on/off ratio can be high. This scenario would lend itself to very high specificity targeting of cancer cells.
  • EGFR epidermal growth factor receptor
  • It is a member of ErbB receptors of 4 member of receptor tyrosine kinases. It is found to be amplified in 40% of the malignant gliomas.
  • the amplified genes are frequently deleted portions of some extra cytoplas ic domains of the receptor, resulting in frame rearrangement in tumor specific extra cellular domains.
  • the intrinsic property of the EGFR is the ability of phosphorylate tyrosine residues, triggering proliferative response.
  • the mutation of the receptor can be responsible for the aggressive growth of the mutated cell. EGFR mutation can manifest itself in different ways of promoting cell growth, one is over express on the cell surface to be activated by otherwise limiting quantities of EGF ligands other growth factors to promote cell growth, and other way is that the receptor is mutated in such a way, that it is only partially or not at all regulated by growth factors.
  • the receptor extra cellular domain is disappeared for this kind of mutation, there cannot be extracellular targets for immune cells, therefore it is a challenge for immunotherapy. Yet the current therapeutic process can target them regardless.
  • the histone H3F3 A G34R mutation is one of a subgroup of mutations known to lead to pediatric glioblastoma.
  • the location distribution of the tumor for the particular patient sequence above is in the brain, while mutations in histone H3F3 A K27M were identified in tumors situated in the midline area of the central nervous system.
  • the targeted DNA is a driver mutation in the childhood form of the brain cancer Glioblastoma.
  • One driver mutation is histone gene H3F3 A G34R, it is on chromosome 1 position having the wild type sequence below.
  • H3F3 A gene There are three different exon arrangement in human H3F3 A gene as shown below. Where all of them share the same arrangement at the G34R location. The DNA and protein sequences of these are included below:
  • the top row is the sequence of the coding DNA strand reading from 5’ to 3’.
  • the second row is the transcribed amino acid sequence.
  • the third row is the non-coding DNA strand, reading 5’ to 3’ from right to left.
  • the AAG coded for Lysine(K) has been mutated to ATG Methionine (M). This is a frequent mutation in pediatric brain tumors.
  • the GGG codes for Glycine(G). This is the mutation for this particular patient representing another cohort of pediatric brain tumor patients.
  • the mutation G34R called out in the diagram above (shown as bold italic G >R).
  • the single nucleotide mutation that results in the G to R substitution is GGG to CGG.
  • K27M and G34R have distinct characteristics - the G34 mutations are found predominantly in supratentorial non midline tumors, while the K27 mutations occur in more than 70% of diffuse intrinsic pontine gliomas DIPG as well as in mid brain tumors.
  • the senor dCas9 can be loaded with a gRNA that binds to the coding strand of the mutated DNA.
  • the PAM can be the GGG on the non-coding strand, and the gRNA protospacer sequence can match to the wild type DNA sequence without mutation shown in under the line sequence:
  • the dCas9 activator complex can have a gRNA targeting the best location of the DNA segment to activate the transcription of the locus that contains the mutated segment of the DNA. Because the stopper dCas9 stop the RNA polymerase to transcribe the non-mutated DNA, only the mutated DNA is transcribed.
  • the mutant DNA sequence in corresponding segment is TCTACTGGAAGGGTGAAGAAA.
  • the transcribed RNA segment can be
  • UCUACUGGAAGGGUGAAGAAA can be recognized and bound to by effector proteins such as dCasl3.
  • the DNA for the mutation TP53 R273C is listed below.
  • the mutation is at 272th codon CGT for Arginine(R) mutated to TGT for Cysteine(C).
  • the coding strand sequence and the non-coding strand sequence sandwich the amino acid sequence.
  • the stopper dCas9 can have the gRNA binds to the coding strand of the mutated
  • the PAM can be the CGG on the non-coding strand, and the gRNA protospacer sequence can match to the wild type DNA sequence without mutation is shown in under lined sequence CGAAACUCCACGCACAAACA.
  • the dCas9 with activator can have a gRNA targeting the best location of the DNA segment to activate the transcription of the locus that containing the mutated segment of the DNA. Because the stopper dCas9 stop the RNA polymerase to transcribe the non-mutated DNA, only mutated DNA got transcribed.
  • the mutated DNA sequence in corresponding segment is CTTTGAGGTGTGTGTTTGTG.
  • the transcribed RNA segment can be
  • CUUUGAGGUGUGUGUUUGUG can be recognized and bind to by the effector Proteins such as dCasl3.
  • the existing antibody can be used to link with a procaspase 8, delivered by adenoviral vector to a patient to effect therapeutic effects.
  • the patient in the case study above could be treated using a dCasl3 sensor complex fused to subunits of a split death effector such as a toxin.
  • B4GALNT1 (beta-l,4-N-acetyl-galactosaminyltransferase 1) is an enzyme involved in the biosynthesis of G(M2) and G(D2) glycosphingolipids. B4GALNT1 disfunctions or mutations have been linked to glioma, thyroid cancer, lung cancer, colorectal cancer, head and neck cancer, stomach cancer, liver cancer, renal cancer, urothelial cancer, prostate cancer, testis cancer, cervical cancer, endometrial cancer, ovarian cancer, melanoma, and lymphoma. In some cases, B4GALNT1 can promote or sustain tumor growth by inducing angiogenesis.
  • B4GALNT1 can be a cancer treatment.
  • plasmid constructs FIG. 23A
  • FIG. 23B, FIG. 23C, and Table 1 gRNA binding sites were separated by 5 bp, 8 bp, 14 bp, 23 bp, or 32 bp on the mRNA substrate and were designed to be bound by multiple gRNAs (Table 2).
  • Plasmid contained an artificial N-terminal fragment (243- 270 bp) of B4GALNT1 mRNA linked to a V5-Tag.
  • the gene expression was controlled by CMV protomer, and all of the sequences of B4GALNT1 with various lengths of separation were in-frame without premature stop codon. As shown in FIG. 23A, two gRNA sequences (g2, g4) are present, with a distance apart varied by 5 to 32 bp.
  • HEK-293 cells were transfected with 300ng of the plasmids as indicated for 3 days and subjected to qPCR analysis of gene expression of B4GALNT1 RNA levels using primers (B4 sub-F2 / B4GLNT1-R) which was specific for exogenous B4GALNT1 detection.
  • the endogenous cyclophilin A (PPIA) mRNA was used to normalize the expression of artificial B4GALNT1 mRNA levels.
  • the varying lengths of separation between gRNA binding sites did not result in differences of B4GALNT1 expressions levels (FIG. 23D) as all five artificial B4GALNT1 mRNA plasmids expressed the unique BEGALNT1 RNA molecule, respectively, at a similar levels in HEK293 cells.
  • Exemplary constructs of gRNAs targeting the B4GALNT1 mRNA were shown in FIG. 24.
  • HEK293 cells were transfected with plasmids as indicated (FIG. 25A, WT Casl3d; FIG. 25B, WT Casl3 or nuclease dead dCasl3). After 3 days of transfection, cells were harvested, and total RNA was purified followed by cDNA synthesis and qPCR analysis of artificial B4GALNT1 mRNA expression using primers that specifically detect the artificial B4GALNT1 mRNA only. The endogenous cyclophilin A (PPIA) mRNA was used to normalize the expression of B4GALNT1 mRNA levels.
  • PPIA endogenous cyclophilin A
  • gRNAs could mediate WT Casl3d to knock down the artificial B4GALNT1 mRNA levels (FIG. 25A), indicating that those gRNAs were effective to bind to the RNA targets and associate with the Casl3d protein. Without nuclease activity, dCasl3d protein could not knockdown the target RNA levels (FIG. 25B).
  • HEK-293 cells were transfected with plasmid constructs (300 ng DNA) of dCasl3 fused with caspase 1 (FIG. 26 A) for 3 days.
  • the constructs contained either full length caspase 1, caspase 1 with caspase activation and recruitment domain (CARD) deleted, and caspase 1 with CARD and CARD domain linker (CDL) deleted (Table 3).
  • GFP lane was cells transfected with dCasl3-RX-T2A-eGFP.
  • HA-tag cell signaling, HA-Tag (C29F4) Rabbit mAh, #3724, 1 : 1000
  • total caspase 1 cell signaling, Caspase 1 (D7F10) Rabbit mAh, #3866, 1 : 1000
  • active caspase 1 cell signaling, Cleaved Caspase 1 (Asp297) (D57A2) Rabbit mAh, #4199, 1 : 1000
  • a/b-tubulin cell signaling, a/B- Tubulin Antibody, #2148, 1 : 1000
  • transfected cells were then harvested for Western blotting analysis of HA-Tag, total caspase 1, active caspase 1, and a/b tubulin (FIG. 26B). Transfections of these constructions all produced a fusion protein recognized by caspase 1 antibody.
  • the molecular weight of the fusion protein was about 148-160 kD, larger than the native caspase 1 which usually was around 48 kD.
  • HEK-293 cells were co-transfected with various plasmid combinations as indicated in a 96-well plate for 3 days, followed by caspase 1 activity measurement assessed by Caspase-Glo® 1 Inflammasome Assay kit (Promega #G995 1 )
  • Caspase-Glo® 1 Inflammasome Assay kit Promega #G995 1
  • One group of cells without any plasmid transfection were pre-treated with Nigericin (100 ug/ml) for 2 hrs prior to the caspase 1 activity assay.
  • a half number of wells were added with YVAD-CHO, a caspase 1 specific inhibitor.
  • the luminescence which represented the activity of caspase 1 activity, was measured using
  • FIG. 28 showed that only the combination of dCasl3d-caspase 1 plus both B4GLNT1 gRNAs increased the activity of caspase 1, suggesting that the fusion protein, dCasl3d-caspase 1, could be activated after gRNA directed Casl3 binding to the artificial B4GALNT1 mRNA.
  • the elevation of caspase 1 activity was dose dependent and inhibited by YVAD-CHO, a specific caspase 1 inhibitor.
  • HEK-293 cells were co-transfected with various plasmid combinations as indicated.
  • the effector caspase 1 protein varied with full-length, CARD domain deleted, or both CARD domain and CDL linker deleted, respectively.
  • caspase 1 activity was measured by Caspase-Glo® 1 Inflammasome Assay kit (Promega #G9951).
  • Nigericin 100 ug/ml
  • a half number of wells were added with YVAD-CHO, a caspase 1 specific inhibitor.
  • the luminescence which represents the activity of caspase 1 activity, was measured using SpectraMax iD3 plate reader after 3hrs of incubation.
  • HEK-293 cells were co-transfected with various plasmid combinations as indicated.
  • Different artificial B4GALNT1 substrate mRNA constructs (caspase 1 protein varied with full- length, CARD domain deleted, or both CARD domain and CDL linker deleted, respectively) were utilized in this experiment. Those substrates had varied nucleotide space distance between g2 and g4 gRNAs (as shown in FIG. 23).
  • caspase 1 activity was measured by Caspase-Glo® 1 Inflammasome Assay kit (Promega #G9951).
  • FIG. 30 showed that a space distance of about 14 bp between two gRNAs gave rise to the best activation of caspase 1 activity.
  • HEK-293 cells were co-transfected with various plasmid combinations as indicated below. Either two gRNAs (gl and g2d or g2d and g4) or triple gRNAs (gl, g2d, g4) were used. The nucleotide space distance between gl and g2d, or between g2d and g4 isl4 bp on the artificial 5bp B4GALNT1 substrate mRNA target (FIG. 23).
  • caspase 1 activity was measured by Caspase-Glo® 1 Inflammasome Assay kit (Promega #G995 1 )
  • Caspase-Glo® 1 Inflammasome Assay kit Promega #G995 1
  • Nigericin 100 ug/ml
  • a half number of wells were added with YVAD-CHO, a caspase 1 specific inhibitor.
  • the luminescence which represents the activity of caspase 1 activity, was measured using SpectraMax iD3 plate reader after 3hrs of incubation.
  • HEK-293 cells were co-transfected with various plasmid combinations as indicated below. Either two gRNAs (gl and g2d or g2d and g4) or triple gRNAs (gl, g2d, g4) were used. The nucleotide space distance between gl and g2d, or between g2d and g4 isl4 bp on the artificial 5bp B4GALNT1 substrate mRNA target (FIG. 23B). After 3 days of transfection, cell death assay was conducted using a real-time-Glo Annexin V apoptosis and necrosis assay kit (Promega #JA1011).
  • the detecting reagent was directly added to the cultured cells, and the intensity of luminescence for Annexin V binding (apoptosis, FIG. 32A) and the intensity of fluorescence for profluorescent dye-DNA binding (necrosis, FIG. 32B) were measured by SpectraMax iD3 plate reader, respectively, at 24 hrs (FIG. 32A) and 96 hrs (FIG. 32B).
  • One group of cells without any plasmid transfection were co-treated with Nigericin (20 ug/ml) before the addition of detecting reagent.
  • EGFR Epidermal growth factor receptor
  • EGFRvI is a mutant form of EGFR that has an N-terminal deletion.
  • EGFRvII is a mutant form of EGFR, where exons 14 and 15 are deleted.
  • EGFRvIII is a mutant form of EGFR, where exons 2 through 7 are deleted.
  • EGFRvIV and EGFRvV are mutant forms of EGFR, where exons 25 through 27 and exons 25 through 28 are respectively deleted.
  • EGFRvII and EGFRvIII are oncogenic.
  • FIG. 33A and FIG. 33B illustrate the dCasl3d plasmid construct which the human EGFRvIII coding sequence was inserted.
  • FIG. 33C shows expression of the GFP reporter in U87-MG cells (the glioblastoma cell line) transfected with the EGFRvIII plasmid.
  • the plasmid sequence of the EGFRvIII plasmid can be found in Table 4. Table 4. Plasmid sequence for expressing human EGFRvIII-eGFP mRNA
  • FIG. 34 illustrates the compositions and binding sites of each of the ten gRNAs.
  • Table 6 illustrates the distance (measured in base pairs or bp) separating the bound gRNAs.
  • “mut gRNA” denotes the gRNA targeting and binding to the mutated sites of the EGFRvIII.
  • “Left gRNA” denotes the gRNA targeting and binding to a site that is upstream from the 5’ end of the “mut gRNA” site.
  • “Right gRNA” denotes the gRNA targeting and binding to a site that is downstream from the 3’ end of the“mut gRNA” site.
  • HEK293 cells were transfected with various gRNA plasmid plus wt Casl3d plasmid and EGFRvIII plasmid s as indicated. After 3 days of transfection, cells were harvested, and total RNA was purified followed by cDNA synthesis and qPCR analysis of EGFRvIII mRNA expression using primers that specifically detect the EGFRvIII mRNA only. The endogenous cyclophilin A (PPIA) mRNA was used to normalize the expression of EGFRvIII mRNA levels.
  • PPIA endogenous cyclophilin A
  • HEK-293 cells were co-transfected with various plasmid combinations as indicated below.
  • dCasl3-casol denotes the plasmid construct of dCasl3 fused to caspase 1.
  • Two sets of EGFRvIII gRNA combinations either gl/g6/gl0 or g3/g6/g9, in duet or triple format, were tested. Control was untransfected cells. After transfection, GFP + cells derived from EGFRvIII- T2A-EGFP plasmid expression were imaged by fluorescence microscopy.
  • FIG. 36 showed that after gRNA directed dCasl3d-Caspase 1 (dCasl3-caspl) targeting on EGFRvIII RNA, GFP signaling in GFP + cells appeared weaker and sparse, indicating that the cell viability was reduced. The reduction of the GFP signal was especially more pronounce in the cells transfected with three gRNAs (bottom two panels of FIG. 36) compared to cells transfected with only two gRNAs.
  • Example 11 GFP fluorescence indicated cell viability of HEK293 cells after co-transfection of dCasl3d-Caspase 1 effector and EGFRvIII gRNAs
  • HEK-293 cells were co-transfected with various plasmid combinations as indicated below.
  • Two sets of EGFRvIII gRNA combinations either gl/g6/gl0 (FIG. 37A) or g3/g6/g9 (FIG. 37B), in duet or triple format, were tested. After transfection, GFP fluorescence intensity was measured every day for 3 days.
  • the combination of three gRNAs in either gl/g6/gl0 or g3/g6/g9 group could suppress the increase of the GFP signals compared to cells not transfected with the dCasl3-caspase 1 fusion plasmids or cells transfected with only gRNAs. Both FIG.
  • FIG. 37A and FIG. 37B also show that the suppression effect was dose-dependent as seen with the further reduction of GFP signal in cells transfected with 800ng of dCAsl3d-CASPASE 1 fusion plasmids compared to cells transfected with 600 ng of the same plasmids.
  • HEK-293 cells were co-transfected with various plasmid combinations as indicated. Two sets of EGFRvIII gRNA combinations, either gl/g6/gl0 (FIG. 38A) or g3/g6/g9 (FIG. 38B), in duet or triple format, were tested. After 3 days of transfection, caspase 1 activity was measured by Caspase-Glo® 1 Inflammasome Assay kit (Promega #G9951). One group of cells without any plasmid transfection were pre-treated with Nigercin (100 ug/ml) for 2 hrs prior to the caspase 1 activity assay. A half number of wells were added with YVAD-CHO, a caspase 1 specific inhibitor. The luminescence, which represents the activity of caspase 1 activity, was measured using SpectraMax iD3 plate reader after 3hrs of incubation.
  • FIG. 38A and FIG. 38B showed that cells transfected with triple gRNAs could produce a more robust activation of caspase 1 activity than cells transfected with duet gRNAs. These effects were abolished when the cells were treated with YVAD-CHO, an inhibitor of caspase 1.
  • Example 13 Apoptosis of HEK293 cells after co-transfection of dCasl3d-Caspase 1 effector and EGFRvIII gRNAs
  • HEK-293 cells were co-transfected with various plasmid combinations as indicated below. Two sets of EGFRvIII gRNA combinations, either gl/g6/gl0 (FIG. 39A) or g3/g6/g9 (FIG. 39B), in duet or triple format, were tested. After 3 days of transfection, cell death assay was conducted using a real-time-Glo Annexin V apoptosis assay kit (Promega #JA1011). The detecting reagent was directly added to the cultured cells, and the intensity of luminescence for Annexin V binding (apoptosis) measured by SpectraMax iD3 plate reader, respectively, at 24 hrs. One group of cells without any plasmid transfection were co-treated with Nigercin (20 ug/ml) before the addition of detecting reagent.
  • FIG. 39A and FIG. 39B showed that cells transfected with triple gRNAs produced a more profound effects of cell apoptosis compared to cells transfected with only two gRNAs.
  • Embodiment 1 A therapeutic composition comprising: a first fusion polypeptide or a polynucleotide encoding the first fusion polypeptide, wherein the first fusion polypeptide comprises a first genetic sequence binding domain and a first inactive effector domain, wherein the first fusion polypeptide binds to a first genetic sequence comprising a mutation; a second fusion polypeptide or a polynucleotide encoding the second fusion polypeptide, wherein the second fusion polypeptide comprises a second genetic sequence binding domain and a second inactive effector domain, wherein the second fusion polypeptide binds to a second genetic sequence that is upstream of the first genetic sequence; and a third fusion polypeptide or a polynucleotide encoding the third fusion polypeptide, wherein the third fusion polypeptide comprises a third genetic sequence binding domain and a third inactive effector domain, wherein the third fusion polypeptide binds to a third genetic sequence that
  • Embodiment 2 The therapeutic composition of Embodiment 1, wherein the first genetic sequence, the second genetic sequence, or the third genetic sequence is a polynucleotide sequence.
  • Embodiment 3 The therapeutic composition of Embodiment 2, wherein the
  • polynucleotide sequence comprises a DNA sequence.
  • Embodiment 4 The therapeutic composition of Embodiment 2, wherein the
  • polynucleotide sequence comprises an RNA sequence.
  • Embodiment 5 The therapeutic composition of Embodiments 1-4, wherein the first genetic sequence, the second genetic sequence, or the third genetic sequence is a polypeptide sequence.
  • Embodiment 6 The therapeutic composition of Embodiment 5, wherein the polypeptide sequence comprises an antigen.
  • Embodiment 7 The therapeutic composition of Embodiment 5, wherein the polypeptide sequence comprises a neoantigen.
  • Embodiment 8 The therapeutic composition of Embodiments 1-7, wherein the first genetic sequence comprises a neoantigen.
  • Embodiment 9 The therapeutic composition of Embodiments 1-8, wherein the mutation is associated with a disorder.
  • Embodiment 10 The therapeutic composition of Embodiment 9, wherein the disorder is a cancer.
  • Embodiment 11 The therapeutic composition of Embodiments 1-10, wherein the mutation is a driver mutation.
  • Embodiment 12 The therapeutic composition of Embodiment 11, wherein the driver mutation is associated with a disorder.
  • Embodiment 13 The therapeutic composition of Embodiment 12, wherein the disorder is a cancer.
  • Embodiment 14 The therapeutic composition of Embodiments 1-13, wherein the first inactive effector domain, the second inactive effector domain, or the third inactive effector domain each independently comprises split portions of the one or more active effector domains.
  • Embodiment 15 The therapeutic composition of Embodiments 1-14, wherein the first inactive effector domain, the second inactive effector domain, or the third inactive effector domain each independently comprises a monomeric portion of a multimeric protein.
  • Embodiment 16 The therapeutic composition of Embodiments 1-15, wherein the one or more active effector domain is the multimeric protein.
  • Embodiment 17 The therapeutic composition of Embodiments 1-16, wherein the one or more active effector domain comprises caspase 1.
  • Embodiment 18 The therapeutic composition of Embodiments 1-17, wherein the first inactive effector domain, the second inactive effector domain, or the third inactive effector domain each independently comprise a pro-caspase 1.
  • Embodiment 19 The therapeutic composition of Embodiments 1-18, wherein the one or more active effector domains comprise a cytotoxic domain.
  • Embodiment 20 The therapeutic composition of Embodiment 19, wherein the cytotoxic domains comprise a pro-caspase, a toxin, a pro-drug, or a pro-apoptotic protein.
  • Embodiment 21 The therapeutic composition of Embodiment 19, wherein the cytotoxic domains comprise caspase 1.
  • Embodiment 22 The therapeutic composition of Embodiments 1-21, wherein the first genetic sequence binding domain, the second genetic sequence binding domain, or the third genetic sequence binding domain each independently comprises an antibody.
  • Embodiment 23 The therapeutic composition of Embodiments 1-22, wherein the first genetic sequence binding domain, the second genetic sequence binding domain, or the third genetic sequence binding domain is selected from the group consisting of: a CRISPR-Cas protein, a zinc finger protein, a transcription activator-like effectors (TALE) protein, a homing endonuclease, meganuclease, PUF, CIRTS, SNAP -tag, and l phage RNA binding protein.
  • TALE transcription activator-like effectors
  • Embodiment 24 The therapeutic composition of Embodiments 1-23, wherein the first genetic sequence binding domain, the second genetic sequence binding domain, or the third genetic sequence binding domain comprises a CRISPR-Cas protein.
  • Embodiment 25 The therapeutic composition of Embodiment 24, wherein the CRISPR- Cas protein is a catalytically-inactive Cas9 or a fragment thereof.
  • Embodiment 26 The therapeutic composition of Embodiment 24, wherein the CRISPR- Cas protein is a catalytically-inactive Casl3 or a fragment thereof.
  • Embodiment 27 The therapeutic composition of Embodiment 24, wherein the CRISPR- Cas protein is a catalytically-inactive Casl3d or a fragment thereof.
  • Embodiment 28 The therapeutic composition of Embodiments 1-27, wherein the one or more active effector domains induces an immunogenic cell death.
  • Embodiment 29 The therapeutic composition of Embodiments 1-28, wherein the one or more active effector domains induces an immune response in a subject.
  • Embodiment 30 The therapeutic composition of Embodiments 1-29, wherein the therapeutic composition comprises greater on-target specificity for targeting cancer cells than a composition comprising only two fusion polypeptides, each independently comprising a genetic sequence binding domain and an inactive effector domain.
  • Embodiment 31 The therapeutic composition of Embodiments 1-30, wherein the therapeutic composition comprises lower off-target rate for targeting non-cancer cells than a composition comprising only two fusion polypeptides, each independently comprising a genetic sequence binding domain and an inactive effector domain.
  • Embodiment 32 The therapeutic composition of Embodiments 1-31, comprising one or more additional fusion polypeptides, each independent comprising a genetic sequence binding domain and an inactive effector domain.
  • Embodiment 33 A therapeutic system comprising: a first fusion polypeptide or a polynucleotide encoding the first fusion polypeptide, wherein the first fusion polypeptide comprises a first genetic sequence binding domain and a first inactive effector domain, wherein the first fusion polypeptide binds to a first genetic sequence comprising a mutation; a second fusion polypeptide or a polynucleotide encoding the second fusion polypeptide, wherein the second fusion polypeptide comprises a second genetic sequence binding domain and a second inactive effector domain, wherein the second fusion polypeptide binds to a second genetic sequence that is upstream of the first genetic sequence; and a third fusion polypeptide or a polynucleotide encoding the third fusion polypeptide, wherein the third fusion polypeptide comprises a third genetic sequence binding domain and a third inactive effector domain, wherein the third fusion polypeptide binds to a third genetic sequence
  • Embodiment 34 The therapeutic system of Embodiment 33, wherein the first genetic sequence, the second genetic sequence, or the third genetic sequence is a polynucleotide sequence.
  • Embodiment 35 The therapeutic system of Embodiment 34, wherein the polynucleotide sequence comprises a DNA sequence.
  • Embodiment 36 The therapeutic system of Embodiment 34, wherein the polynucleotide sequence comprises a RNA sequence.
  • Embodiment 37 The therapeutic system of Embodiments 33-35, wherein the first genetic sequence, the second genetic sequence, or the third genetic sequence is a polypeptide sequence.
  • Embodiment 38 The therapeutic system of Embodiment 37, wherein the polypeptide sequence comprises an antigen.
  • Embodiment 39 The therapeutic system of Embodiment 37, wherein the polypeptide sequence comprises a neoantigen.
  • Embodiment 40 The therapeutic system of Embodiments 33-39, wherein the mutation is associated with a disorder.
  • Embodiment 41 The therapeutic system of Embodiment 40, wherein the disorder is a cancer.
  • Embodiment 42 The therapeutic system of Embodiments 33-41, wherein the mutation is a driver mutation.
  • Embodiment 43 The therapeutic system of Embodiment 42, wherein the driver mutation is associated with a disorder.
  • Embodiment 44 The therapeutic system of Embodiment 43, wherein the disorder is a cancer.
  • Embodiment 45 The therapeutic system of Embodiments 33-44, wherein the first inactive effector domain, the second inactive effector domain, or the third inactive effector domain each independently comprises a split portion of the one or more active effector domains.
  • Embodiment 46 The therapeutic system of Embodiments 33-45, wherein the one or more active effector domains comprise cytotoxic domains.
  • Embodiment 47 The therapeutic system of Embodiment 46, wherein the cytotoxic domains comprise a pro-caspase, a toxin, a pro-drug, or a pro-apoptotic protein.
  • Embodiment 48 The therapeutic system of Embodiment 47, wherein the cytotoxic domains comprise caspase 1.
  • Embodiment 49 The therapeutic system of Embodiments 33-48, wherein the first genetic sequence binding domain, the second genetic sequence binding domain, or the third genetic sequence binding domain each independently comprises an antibody.
  • Embodiment 50 The therapeutic system of Embodiments 33-49, wherein the first genetic sequence binding domain, the second genetic sequence binding domain, or the third genetic sequence binding domain is selected from the group consisting of: a CRISPR-Cas protein, a zinc finger protein, a transcription activator-like effectors (TALE) protein, a homing endonuclease, meganuclease, PUF, CIRTS, SNAP -tag, and l phage RNA binding protein.
  • TALE transcription activator-like effectors
  • Embodiment 51 The therapeutic system of Embodiment 50, wherein the first genetic sequence binding domain, the second genetic sequence binding domain, or the third genetic sequence binding domain comprises a CRISPR-Cas protein.
  • Embodiment 52 The therapeutic system of Embodiment 51, wherein the CRISPR-Cas protein is a catalytically-inactive Cas9 or a fragment thereof.
  • Embodiment 53 The therapeutic system of Embodiment 51, wherein the CRISPR-Cas protein is a catalytically-inactive Casl3 or a fragment thereof.
  • Embodiment 54 The therapeutic system of Embodiment 53, wherein the CRISPR-Cas protein is a catalytically-inactive Casl3d or a fragment thereof.
  • Embodiment 55 The therapeutic system of Embodiments 33-54, wherein the one or more active effector domains induces immunogenic cell death.
  • Embodiment 56 The therapeutic system of Embodiments 33-55, wherein the first genetic sequence comprises a neoantigen.
  • Embodiment 57 The therapeutic system of Embodiments 33-56, wherein the first inactive effector domain, the second inactive effector domain, or the third inactive effector domain each independently comprises a monomeric portion of a multimeric protein.
  • Embodiment 58 The therapeutic system of Embodiments 33-57, wherein the one or more active effector domain is the multimeric protein.
  • Embodiment 59 The therapeutic system of Embodiments 33-58, wherein the one or more active effector domain comprises caspase 1.
  • Embodiment 60 The therapeutic system of Embodiments 33-59, wherein the first inactive effector domain, the second inactive effector domain, or the third inactive effector domain each independently comprise a pro-caspase 1.
  • Embodiment 61 The therapeutic system of Embodiments 33-60, wherein the one or more active effector domains induces an immune response in a subject.
  • Embodiment 62 The therapeutic system of Embodiments 33-61, wherein the therapeutic system comprises greater on-target specificity for targeting cancer cells than a system
  • fusion polypeptides comprising only two fusion polypeptides, each independently comprising a genetic sequence binding domain and an inactive effector domain.
  • Embodiment 63 The therapeutic system of Embodiments 33-62, wherein the therapeutic system comprises lower off-target rate for targeting non-cancer cells than a system comprising only two fusion polypeptides, each independently comprising a genetic sequence binding domain and an inactive effector domain.
  • Embodiment 64 The therapeutic system of Embodiments 33-63, comprising one or more additional fusion polypeptides, each independent comprising a genetic sequence binding domain and an inactive effector domain.
  • Embodiment 65 A method of treating a disorder in a subject, the method comprising: delivering to a cell: a first fusion polypeptide or a polynucleotide encoding the first fusion polypeptide, wherein the first fusion polypeptide comprises a first genetic sequence binding domain and a first inactive effector domain, wherein the first fusion polypeptide binds to a first genetic sequence comprising a mutation; a second fusion polypeptide or a polynucleotide encoding the second fusion polypeptide, wherein the second fusion polypeptide comprises a second genetic sequence binding domain and a second inactive effector domain, wherein the second fusion polypeptide binds to a second genetic sequence that is upstream of a 5’ end of the first genetic
  • Embodiment 66 The method of Embodiment 65, wherein the first genetic sequence, the second genetic sequence, or the third genetic sequence is a polynucleotide sequence.
  • Embodiment 67 The method of Embodiment 66, wherein the polynucleotide sequence comprises a DNA sequence.
  • Embodiment 68 The method of Embodiment 66, wherein the polynucleotide sequence comprises a RNA sequence.
  • Embodiment 69 The method of Embodiments 65-68, wherein the first genetic sequence, the second genetic sequence, or the third genetic sequence is a polypeptide sequence.
  • Embodiment 70 The method of Embodiment 69, wherein the polypeptide sequence comprises an antigen.
  • Embodiment 71 The method of Embodiment 69, wherein the polypeptide sequence comprises a neoantigen.
  • Embodiment 72 The method of Embodiments 65-71, wherein the mutation is associated with a disorder.
  • Embodiment 73 The method of Embodiment 72, wherein the disorder is a cancer.
  • Embodiment 74 The method of Embodiments 65-73, wherein the mutation is a driver mutation.
  • Embodiment 75 The method of Embodiment 74, wherein the driver mutation is associated with a disorder.
  • Embodiment 76 The method of Embodiment 75, wherein the disorder is a cancer.
  • Embodiment 77 The method of Embodiments 65-76, wherein the first inactive effector domain, the second inactive effector domain, or the third inactive effector domain each independently comprise a split portion of the one or more active effector domains.
  • Embodiment 78 The method of Embodiments 65-77, wherein the one or more active effector domains comprise cytotoxic domains.
  • Embodiment 79 The method of Embodiment 78, wherein the cytotoxic domains comprise a pro-caspase, a toxin, a pro-drug, or a pro-apoptotic protein.
  • Embodiment 80 The method of Embodiment 79, wherein the cytotoxic domains comprise caspase 1.
  • Embodiment 81 The method of Embodiments 65-80, wherein the first genetic sequence binding domain, the second genetic sequence binding domain, or the third genetic sequence binding domain each independently comprises an antibody.
  • Embodiment 82 The method of Embodiments 65-81, wherein the first genetic sequence binding domain, the second genetic sequence binding domain, or the third genetic sequence binding domain is selected from the group consisting of: a CRISPR-Cas protein, a zinc finger protein, a transcription activator-like effectors (TALE) protein, a homing endonuclease, meganuclease, PUF, CIRTS, SNAP -tag, and l phage RNA binding protein.
  • TALE transcription activator-like effectors
  • Embodiment 83 The method of Embodiment 82, wherein the first genetic sequence binding domain, the second genetic sequence binding domain, or the third genetic sequence binding domain comprises a CRISPR-Cas protein.
  • Embodiment 84 The method of Embodiment 83, wherein the CRISPR-Cas protein is a catalytically-inactive Cas9 or a fragment thereof.
  • Embodiment 85 The method of Embodiment 84, wherein the CRISPR-Cas protein is a catalytically-inactive Casl3 or a fragment thereof.
  • Embodiment 86 The method of Embodiment 84, wherein the CRISPR-Cas protein is a catalytically-inactive Casl3d or a fragment thereof.
  • Embodiment 87 The method of Embodiments 65-86, wherein the one or more active effector domains induces cell death.
  • Embodiment 88 The method of Embodiments 65-87, wherein the one or more active effector domains induces an immunogenic cell death.
  • Embodiment 89 The method of Embodiments 65-88, wherein the first genetic sequence comprises a neoantigen.
  • Embodiment 90 The method of Embodiments 65-89, wherein the first inactive effector domain, the second inactive effector domain, or the third inactive effector domain each independently comprises a monomeric portion of a multimeric protein.
  • Embodiment 91 The method of Embodiments 65-90, wherein the one or more active effector domain is the multimeric protein.
  • Embodiment 92 The method of Embodiments 65-91, wherein the one or more active effector domain comprises caspase 1.
  • Embodiment 93 The method of Embodiments 65-92, wherein the first inactive effector domain, the second inactive effector domain, or the third inactive effector domain each independently comprise a pro-caspase 1.
  • Embodiment 94 The method of Embodiments 65-93, wherein the one or more active effector domains induces an immune response in a subject.
  • Embodiment 95 The method of Embodiments 65-94, wherein the therapeutic composition comprises greater on-target specificity for targeting cancer cells than a method comprising contacting the cell with only two fusion polypeptides, each independently comprising a genetic sequence binding domain and an inactive effector domain.
  • Embodiment 96 The method of Embodiments 65-95, wherein the therapeutic composition comprises lower off-target rate for targeting non-cancer cells than a method comprising contacting the cell with only two fusion polypeptides, each independently comprising a genetic sequence binding domain and an inactive effector domain.
  • Embodiment 97 The method of Embodiments 65-96, comprising contacting the cell with one or more additional fusion polypeptides, each independently comprising a genetic sequence binding domain and an inactive effector domain.
  • Embodiment 98 A composition for inducing cell death, the composition comprising: a first fusion polypeptide or a polynucleotide encoding the first fusion polypeptide, wherein the first fusion polypeptide comprises a first nucleic acid binding domain and a first inactive cytotoxic domain, wherein the first fusion polypeptide binds to a first nucleic acid sequence on a target polynucleotide; a second fusion polypeptide or a polynucleotide encoding the second fusion polypeptide, wherein the second fusion polypeptide comprises a second nucleic acid binding domain and a second inactive cytotoxic domain, wherein the second fusion polypeptide binds to a second nucleic acid sequence on the target polynucleotide; and a third fusion polypeptide or a polynucleotide encoding the third fusion polypeptide, wherein the third fusion polypeptide comprises a third nucleic acid
  • Embodiment 99 The composition of Embodiment 98, wherein the composition comprises at least about 5% greater efficiency for inducing cell death relative to a composition that comprises two fusion polypeptides, wherein each of the two fusion polypeptides comprises a nucleic acid binding domain and an inactive cytotoxic domain.
  • Embodiment 100 The composition of Embodiments 98-99, wherein the first nucleic acid sequence is a mutant nucleic acid sequence associated with a disorder.
  • Embodiment 101 The composition of Embodiment 100, wherein the disorder is a cancer.
  • Embodiment 102 The composition of Embodiment 100, wherein the cancer is a brain tumor, a pancreatic cancer, or a triple negative breast cancer.
  • Embodiment 103 The composition of Embodiment 98-102, wherein the first nucleic acid sequence comprises a driver mutation associated with a cancer.
  • Embodiment 104 The composition of Embodiments 98-103, wherein the second nucleic acid sequence is a wild-type sequence that does not comprise a mutation associated with a disorder.
  • Embodiment 105 The composition of Embodiments 98-104, wherein the third nucleic acid sequence is a wild-type sequence that does not comprise a mutation associated with a disorder.
  • Embodiment 106 The composition of Embodiments 98-105, wherein the second nucleic acid sequence is at least 5 nucleotide bases upstream from a 5’ end of the first nucleic acid sequence.
  • Embodiment 107 The composition of Embodiments 98-106, wherein the third nucleic acid sequence is at least 5 nucleotide bases downstream from a 3’ end of the first nucleic acid sequence.
  • Embodiment 108 The composition of Embodiments 98-107, wherein the first nucleic sequence, the second nucleic acid sequence, or the third nucleic acid sequence comprises a coding sequence.
  • Embodiment 109 The composition of Embodiments 98-108, wherein the first nucleic sequence, the second nucleic acid sequence, or the third nucleic acid sequence comprises a non coding sequence.
  • Embodiment 110 The composition of Embodiments 98-109, wherein the composition further comprises one or more additional fusion polypeptides, each of the one or more additional fusion polypeptide comprising a nucleic acid binding domain and an inactive cytotoxic domain.
  • Embodiment 111 The composition of Embodiments 98-110, wherein the active cytotoxic domain is selected from the group consisting of a pro-caspase, a toxin, a pro-drug, and a pro- apoptotic protein.
  • Embodiment 112 The composition of Embodiments 98-111, wherein the active cytotoxic domain is generated by dimerization of the first inactive cytotoxic domain and the second inactive cytotoxic domain or the first inactive cytotoxic domain and the third inactive cytotoxic domain.
  • Embodiment 113 The composition of Embodiments 98-112, wherein the first inactive cytotoxic domain, the second inactive cytotoxic domain, or the third inactive cytotoxic domain, each independently comprises split portions of the active cytotoxic domain.
  • Embodiment 114 The composition of Embodiments 98-113, wherein the first nucleic acid binding domain, the second nucleic acid binding domain, or the third nucleic acid binding domain are selected from the group consisting of: a CRISPR-Cas protein, a zinc finger protein, a transcription activator-like effectors (TALE) protein, a homing endonuclease, meganuclease, PUF, CIRTS, SNAP -tag, and l phage RNA binding protein.
  • TALE transcription activator-like effectors
  • Embodiment 115 The composition of Embodiments 98-114, wherein the first nucleic acid binding domain, the second nucleic acid binding domain, and the third nucleic acid binding domain comprise a CRISPR-Cas protein.
  • Embodiment 116 The composition of Embodiment 115, wherein the CRISPR-Cas protein is a catalytically-inactive Cas9 or a fragment thereof.
  • Embodiment 117 The composition of Embodiment 116, wherein the CRISPR-Cas protein is a catalytically-inactive Casl3 or a fragment thereof.
  • Embodiment 118 The composition of Embodiment 117, wherein the CRISPR-Cas protein is a catalytically-inactive Casl3d or a fragment thereof.
  • Embodiment 119 The composition of Embodiments 98-118, wherein the active cytotoxic domain comprises caspase 1.
  • Embodiment 120 The composition of Embodiments 98-119, wherein the first inactive cytotoxic domain, the second inactive cytotoxic domain, or the third inactive cytotoxic domain each independently comprise a pro-caspase 1.
  • Embodiment 121 The composition of Embodiments 98-120, wherein the active cytotoxic domain induces an immune response in a subject.
  • Embodiment 122 The composition of Embodiments 98-121, wherein the composition comprises greater on-target specificity for targeting cancer cells than a composition comprising only two fusion polypeptides, each independently comprising a genetic sequence binding domain and an inactive cytotoxic domain.
  • Embodiment 123 The composition of Embodiments 98-122, wherein the composition comprises lower off-target rate for targeting non-cancer cells than a composition comprising only two fusion polypeptides, each independently comprising a genetic sequence binding domain and an inactive cytotoxic domain.
  • Embodiment 124 The composition of Embodiments 98-123, wherein the second nucleic acid sequence comprises a mutation associated with the cancer.
  • Embodiment 125 The composition of Embodiments 98-124, wherein the third nucleic acid sequence comprises a mutation associated with the cancer.
  • Embodiment 126 A system for inducing cell death, the system comprising: a first fusion polypeptide or a polynucleotide encoding the first fusion polypeptide, wherein the first fusion polypeptide comprises a first nucleic acid binding domain and a first inactive cytotoxic domain, wherein the first fusion polypeptide binds to a first nucleic acid sequence on a target
  • a second fusion polypeptide or a polynucleotide encoding the second fusion polypeptide wherein the second fusion polypeptide comprises a second nucleic acid binding domain and a second inactive cytotoxic domain, wherein the second fusion polypeptide binds to a second nucleic acid sequence on the target polynucleotide; and a third fusion polypeptide or a polynucleotide encoding the third fusion polypeptide, wherein the third fusion polypeptide comprises a third nucleic acid binding domain and a third inactive cytotoxic domain, wherein the third fusion polypeptide binds to a third nucleic acid sequence on the target polynucleotide, wherein proximity of the first inactive cytotoxic domain and the second inactive cytotoxic domain or the first inactive cytotoxic domain and the third inactive cytotoxic domain generates an active cytotoxic domain that induces cell death.
  • Embodiment 127 The system of Embodiment 126, wherein the system comprises at least 5% greater efficiency for inducing cell death relative to a system that comprises two fusion polypeptides, wherein each of the two fusion polypeptides comprises a nucleic acid binding domain and an inactive cytotoxic domain.
  • Embodiment 128 The system of Embodiments 126-127, wherein the first nucleic acid sequence is a mutant nucleic acid sequence associated with a disorder.
  • Embodiment 129 The system of Embodiment 128, wherein the disorder is a cancer.
  • Embodiment 130 The system of Embodiment 129, wherein the first nucleic acid sequence comprises a driver mutation associated with a cancer.
  • Embodiment 131 The system of Embodiment 130, wherein the second nucleic acid sequence is a wild-type sequence that does not comprise a mutation associated with the cancer.
  • Embodiment 132 The system of Embodiment 130, wherein the third nucleic acid sequence is a wild-type sequence that does not comprise a mutation associated with the cancer.
  • Embodiment 133 The system of Embodiments 126-131, wherein the second nucleic acid sequence is at least 5 nucleotide bases upstream from a 5’ end of the first nucleic acid sequence.
  • Embodiment 134 The system of Embodiments 126-133, wherein the third nucleic acid sequence is at least 5 nucleotide bases downstream from a 3’ end of the first nucleic acid sequence.
  • Embodiment 135. The system of Embodiments 126-134, wherein the first nucleic sequence, the second nucleic acid sequence, or the third nucleic acid sequence comprises a coding sequence.
  • Embodiment 136 The system of Embodiments 126-135, wherein the first nucleic sequence, the second nucleic acid sequence, or the third nucleic acid sequence comprises a non coding sequence.
  • Embodiment 137 The system of Embodiments 126-136, wherein the system further comprises one or more additional fusion polypeptides, each of the one or more additional fusion polypeptide comprising a nucleic acid binding domain and an inactive cytotoxic domain.
  • Embodiment 138 The system of Embodiments 126-137, wherein the active cytotoxic domain is selected from the group consisting of a pro-caspase, a toxin, a pro-drug, and a pro- apoptotic protein.
  • Embodiment 139 The system of Embodiments 126-138, wherein the active cytotoxic domain is generated by dimerization of the first inactive cytotoxic domain and the second inactive cytotoxic domain or the first inactive cytotoxic domain and the third inactive cytotoxic domain.
  • Embodiment 140 The system of Embodiments 126-139, wherein the first inactive cytotoxic domain, the second inactive cytotoxic domain, or the third inactive cytotoxic domain comprises split portions of the active cytotoxic domain.
  • Embodiment 141 The system of Embodiments 126-140, wherein the first nucleic acid binding domain, the second nucleic acid binding domain, or the third nucleic acid binding domain is selected from the group consisting of: a CRISPR-Cas protein, a zinc finger protein, a transcription activator-like effectors (TALE) protein, a homing endonuclease, meganuclease, PUF, CIRTS, SNAP -tag, and l phage RNA binding protein.
  • TALE transcription activator-like effectors
  • Embodiment 142 The system of Embodiment 141, wherein the first nucleic acid binding domain, the second nucleic acid binding domain, and the third nucleic acid binding domain comprise a CRISPR-Cas protein.
  • Embodiment 143 The system of Embodiment 142, wherein the CRISPR-Cas protein is a catalytically-inactive Cas9 or a fragment thereof.
  • Embodiment 144 The system of Embodiment 142, wherein the CRISPR-Cas protein is a catalytically-inactive Casl3 or a fragment thereof.
  • Embodiment 145 The system of Embodiment 144, wherein the CRISPR-Cas protein is a catalytically-inactive Casl3d or a fragment thereof.
  • Embodiment 146 The system of Embodiments 126-145, wherein the active cytotoxic domain comprises caspase 1.
  • Embodiment 147 The system of Embodiments 126-146, wherein the first inactive cytotoxic domain, the second inactive cytotoxic domain, or the third inactive cytotoxic domain each independently comprise a pro-caspase 1.
  • Embodiment 148 The system of Embodiments 126-147, wherein the active cytotoxic domain induces an immune response in a subject.
  • Embodiment 149 The system of Embodiments 126-148, wherein the composition comprises greater on-target specificity for targeting cancer cells than a system comprising only two fusion polypeptides, each independently comprising a genetic sequence binding domain and an inactive cytotoxic domain.
  • Embodiment 150 The system of Embodiments 126-149, wherein the composition comprises lower off-target rate for targeting non-cancer cells than a system comprising only two fusion polypeptides, each independently comprising a genetic sequence binding domain and an inactive cytotoxic domain.
  • Embodiment 151 The system of Embodiments 126-150, wherein the second nucleic acid sequence comprises a mutation associated with the cancer.
  • Embodiment 152 The system of Embodiments 126-151, wherein the third nucleic acid sequence comprises a mutation associated with the cancer.
  • Embodiment 153 A method for treating a subject, the method comprising:
  • a target polynucleotide in a cell with a: a first fusion polypeptide comprising a first nucleic acid binding domain and a first inactive cytotoxic domain, wherein the first fusion polypeptide binds to a first nucleic acid sequence on the target polynucleotide; a second fusion polypeptide comprising a second nucleic acid binding domain and a second inactive cytotoxic domain, wherein the second fusion polypeptide binds to a second nucleic acid sequence on the target polynucleotide; and a third fusion polypeptide comprising a third nucleic acid binding domain and a third inactive cytotoxic domain, wherein the third fusion polypeptide binds to a third nucleic acid sequence on the target polynucleotide, wherein binding of the first fusion polypeptide to the first nucleic acid sequence and binding of the second fusion polypeptide to the second nucleic acid sequence brings the first inactive cyto
  • Embodiment 154 The method of Embodiment 153, wherein the method comprises at least 5% greater efficiency for inducing cell death relative to a method that comprises two fusion polypeptides, wherein each of the two fusion polypeptides comprises a nucleic acid binding domain and an inactive cytotoxic domain.
  • Embodiment 155 The method of Embodiments 153-154, wherein the first nucleic acid sequence is a mutant nucleic acid sequence associated with a disorder.
  • Embodiment 156 The method of Embodiment 155, wherein the disorder is a cancer.
  • Embodiment 157 The method of Embodiment 156, wherein the first nucleic acid sequence comprises a driver mutation associated with a cancer.
  • Embodiment 158 The method of Embodiment 157, wherein the second nucleic acid sequence is a wild-type sequence that does not comprise a mutation associated with the cancer.
  • Embodiment 159 The method of Embodiment 157, wherein the third nucleic acid sequence is a wild-type sequence that does not comprise a mutation associated with the cancer.
  • Embodiment 160 The method of Embodiments 153-159, wherein the second nucleic acid sequence is at least 5 nucleotide bases upstream from a 5’ end of the first nucleic acid sequence.
  • Embodiment 161. The method of Embodiments 153-160, wherein the third nucleic acid sequence is at least 5 nucleotide bases downstream from a 3’ end of the first nucleic acid sequence.
  • Embodiment 162 The method of Embodiments 153-161, wherein the first nucleic sequence, the second nucleic acid sequence, or the third nucleic acid sequence comprises a coding sequence.
  • Embodiment 163 The method of Embodiments 153-162, wherein the first nucleic sequence, the second nucleic acid sequence, or the third nucleic acid sequence comprises a non coding sequence.
  • Embodiment 164 The method of Embodiments 153-163, wherein the method further comprises one or more additional fusion polypeptides, each of the one or more additional fusion polypeptide comprising a nucleic acid binding domain and an inactive cytotoxic domain.
  • Embodiment 165 The method of Embodiments 153-164, wherein the active cytotoxic domain is selected from the group consisting of a pro-caspase, a toxin, a pro-drug, and a pro- apoptotic protein.
  • Embodiment 166 The method of Embodiments 153-165, wherein the active cytotoxic domain is generated by dimerization of the first inactive cytotoxic domain and the second inactive cytotoxic domain or the first inactive cytotoxic domain and the third inactive cytotoxic domain.
  • Embodiment 167 The method of Embodiments 153-166, wherein the first inactive cytotoxic domain, the second inactive cytotoxic domain, or the third inactive cytotoxic domain comprises split portions of the active cytotoxic domain.
  • Embodiment 168 The method of Embodiments 153-167, wherein the first nucleic acid binding domain, the second nucleic acid binding domain, or the third nucleic acid binding domain is selected from the group consisting of: a CRISPR-Cas protein, a zinc finger protein, a transcription activator-like effectors (TALE) protein, a homing endonuclease, meganuclease, PUF, CIRTS, SNAP -tag, and l phage RNA binding protein.
  • TALE transcription activator-like effectors
  • Embodiment 169 The method of Embodiments 153-168, wherein the first nucleic acid binding domain, the second nucleic acid binding domain, and the third nucleic acid binding domain comprises a CRISPR-Cas protein.
  • Embodiment 170 The method of Embodiment 169, wherein the CRISPR-Cas protein is a catalytically-inactive Cas9 or a fragment thereof.
  • Embodiment 171 The method of Embodiment 169, wherein the CRISPR-Cas protein is a catalytically-inactive Casl3 or a fragment thereof.
  • Embodiment 172 The method of Embodiment 169, wherein the CRISPR-Cas protein is a catalytically-inactive Casl3d or a fragment thereof.
  • Embodiment 173 The method of Embodiments 153-172, wherein the active cytotoxic domain comprises caspase 1.
  • Embodiment 174 The method of Embodiments 153-173, wherein the first inactive cytotoxic domain, the second inactive cytotoxic domain, or the third inactive cytotoxic domain each independently comprise a pro-caspase 1.
  • Embodiment 175. The method of Embodiment 153-174, wherein the active cytotoxic domain induces an immune response in a subject.
  • Embodiment 176 The method of Embodiments 153-175, wherein the composition comprises greater on-target specificity for targeting cancer cells than a system comprising only two fusion polypeptides, each independently comprising a genetic sequence binding domain and an inactive cytotoxic domain.
  • Embodiment 177 The method of Embodiments 153-176, wherein the composition comprises lower off-target rate for targeting non-cancer cells than a system comprising only two fusion polypeptides, each independently comprising a genetic sequence binding domain and an inactive cytotoxic domain.
  • Embodiment 178 The method of Embodiments 153-177, wherein the second nucleic acid sequence comprises a mutation associated with the cancer.
  • Embodiment 179 The method of Embodiments 153-178, wherein the third nucleic acid sequence comprises a mutation associated with the cancer.
  • Embodiment 180 A composition for inducing cell death, the composition comprising: a first fusion polypeptide or a polynucleotide encoding the first fusion polypeptide, wherein the first fusion polypeptide comprises a first nucleic acid binding domain and a first inactive portion of a toxin, wherein the first fusion polypeptide binds to a first nucleic acid sequence of a target polynucleotide; and a second fusion polypeptide or a polynucleotide encoding the second fusion polypeptide, wherein the second fusion polypeptide comprises a second nucleic acid binding domain and a second inactive portion of the toxin, wherein the second fusion polypeptide binds to a second nucleic acid sequence on the target polynucleotide, wherein proximity of the first inactive portion and the second inactive portion generates the toxin that induces cell death.
  • Embodiment 181 The composition of Embodiment 180, wherein the first nucleic acid sequence is a mutant nucleic acid sequence associated with a disorder.
  • Embodiment 182 The composition of Embodiment 181, wherein the disorder is a cancer.
  • Embodiment 183 The composition of Embodiments 180-182, wherein the first nucleic acid sequence comprises a driver mutation associated with a cancer.
  • Embodiment 184 The composition of Embodiments 180-183, wherein the second nucleic acid sequence is a wild-type sequence that does not comprise a mutation associated with the cancer.
  • Embodiment 185 The composition of Embodiments 180-184, wherein the second nucleic acid sequence comprises a mutation.
  • Embodiment 186 The composition of Embodiments 180-185, wherein the second nucleic acid sequence is at least 5 nucleotide bases upstream from a 5’ end of the first nucleic acid sequence.
  • Embodiment 187 The composition of Embodiments 180-186, wherein the second nucleic acid sequence is at least 5 nucleotide bases downstream from a 3’ end of the first nucleic acid sequence.
  • Embodiment 188 The composition of Embodiments 180-187, wherein the first nucleic sequence or the second nucleic acid sequence comprises a coding sequence.
  • Embodiment 189 The composition of Embodiments 180-188, wherein the first nucleic sequence or the second nucleic acid sequence comprises a non-coding sequence.
  • Embodiment 190 The composition of Embodiments 180-189, wherein the composition further comprises one or more additional fusion polypeptides, each of the one or more additional fusion polypeptide comprising a nucleic acid binding domain and an inactive cytotoxic domain.
  • Embodiment 191 The composition of Embodiments 180-190, wherein the toxin is selected from the group consisting of a Ricin, Abrin, Mistletoe lectin, Modeccin, pokeweed antiviral protein (PAP), Saporin, Bryodinl, Bouganin, Gelonin, Diphtheria toxin (DT),
  • the toxin is selected from the group consisting of a Ricin, Abrin, Mistletoe lectin, Modeccin, pokeweed antiviral protein (PAP), Saporin, Bryodinl, Bouganin, Gelonin, Diphtheria toxin (DT),
  • PE Pseudomonas exotoxin
  • Xytolysin equinatoxin II CytA-d-endotoxin from the bacterium Bacillus thuringiensis, Alpha-hemolysin(aHL), from S. aureus, Anthrax toxin from Bacillus anthracis Photorhabdus luminescence, and TccC3 toxin.
  • Embodiment 192 The composition of Embodiments 180-191, wherein the toxin is generated by dimerization of the first inactive portion of the toxin and the second inactive portion of the toxin.
  • Embodiment 193 The composition of Embodiments 180-192, wherein the first inactive portion of the toxin or the second inactive portion of the toxin are each independently split portions of the toxin.
  • Embodiment 194 The composition of Embodiments 180-193, wherein the first nucleic acid binding domain or the second nucleic acid binding domain is selected from the group consisting of: a CRISPR-Cas protein, a zinc finger protein, a transcription activator-like effectors (TALE) protein, a homing endonuclease, meganuclease, PUF, CIRTS, SNAP -tag, and l phage RNA binding protein.
  • TALE transcription activator-like effectors
  • Embodiment 195 The composition of Embodiments 180-194, wherein the first nucleic acid binding domain and the second nucleic acid binding domain comprises a CRISPR-Cas protein.
  • Embodiment 196 The composition of Embodiment 195, wherein the CRISPR-Cas protein is a catalytically-inactive Cas9 or a fragment thereof.
  • Embodiment 197 The composition of Embodiment 195, wherein the CRISPR-Cas protein is a catalytically-inactive Casl3 or a fragment thereof.
  • Embodiment 198 The composition of Embodiment 195, wherein the CRISPR-Cas protein is a catalytically-inactive Casl3d or a fragment thereof.
  • Embodiment 199 The composition of Embodiment 180-198, wherein the toxin is PE
  • Embodiment 200 A system for inducing cell death, the system comprising: a first fusion polypeptide or a polynucleotide encoding the first fusion polypeptide, wherein the first fusion polypeptide comprises a first nucleic acid binding domain and a first inactive portion of a toxin, wherein the first fusion polypeptide binds to a first nucleic acid sequence of a target
  • the second fusion polypeptide comprises a second nucleic acid binding domain and a second inactive portion of the toxin, wherein the second fusion polypeptide binds to a second nucleic acid sequence on the target polynucleotide, wherein proximity of the first inactive portion and the second inactive portion generates the toxin that induces cell death.
  • Embodiment 201 The system of Embodiment 200, wherein the first nucleic acid sequence is a mutant nucleic acid sequence associated with a disorder.
  • Embodiment 202 The system of Embodiment 201, wherein the disorder is a cancer.
  • Embodiment 203 The system of Embodiments 200-202, wherein the first nucleic acid sequence comprises a driver mutation associated with a cancer.
  • Embodiment 204 The system of Embodiments 200-203, wherein the second nucleic acid sequence is a wild-type sequence that does not comprise a mutation associated with the cancer.
  • Embodiment 205 The system of Embodiments 200-204, wherein the second nucleic acid sequence is at least 5 nucleotide bases upstream from a 5’ end of the first nucleic acid sequence.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biochemistry (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Toxicology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

L'invention concerne des compositions, des systèmes et des procédés pour induire des effets thérapeutiques par ciblage de mutations intracellulaires associées à un trouble. Les compositions, les systèmes et les procédés de l'invention peuvent comprendre des polypeptides de fusion comprenant un domaine de liaison qui se lie à une séquence cible et un domaine effecteur.
PCT/US2020/019767 2019-02-25 2020-02-25 Thérapie ciblant une mutation intracellulaire WO2020176553A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201962922212P 2019-02-25 2019-02-25
US62/922,212 2019-02-25

Publications (1)

Publication Number Publication Date
WO2020176553A1 true WO2020176553A1 (fr) 2020-09-03

Family

ID=72240159

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2020/019767 WO2020176553A1 (fr) 2019-02-25 2020-02-25 Thérapie ciblant une mutation intracellulaire

Country Status (1)

Country Link
WO (1) WO2020176553A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2023164482A3 (fr) * 2022-02-23 2023-10-26 The Johns Hopkins University Traitement pour maladie d'expansion à répétition nucléotidique

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050221384A1 (en) * 2001-04-26 2005-10-06 Avidia Research Institute Combinatorial libraries of monomer domains
US20100047179A1 (en) * 2006-10-27 2010-02-25 Trustees Of Boston University Targeted split biomolecular conjugates for the treatment of diseases, malignancies and disorders, and methods of their production
US20130171181A1 (en) * 2010-01-04 2013-07-04 Kj Biosciences Llc Dps fusion proteins for use in vaccines and diagnostics
US20190024086A1 (en) * 2016-09-07 2019-01-24 Flagship Pioneering Innovations V, Inc. Methods and compositions for modulating gene expression

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050221384A1 (en) * 2001-04-26 2005-10-06 Avidia Research Institute Combinatorial libraries of monomer domains
US20100047179A1 (en) * 2006-10-27 2010-02-25 Trustees Of Boston University Targeted split biomolecular conjugates for the treatment of diseases, malignancies and disorders, and methods of their production
US20130171181A1 (en) * 2010-01-04 2013-07-04 Kj Biosciences Llc Dps fusion proteins for use in vaccines and diagnostics
US20190024086A1 (en) * 2016-09-07 2019-01-24 Flagship Pioneering Innovations V, Inc. Methods and compositions for modulating gene expression

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
DAVOD ET AL.: "Constructing and transient expression of a gene cassette containing edible vaccine elements and shigellosis, anthrax and cholera recombinant antigens in tomato", MOLECULAR BIOLOGY REPORTS, vol. 45, no. 6, 22 September 2018 (2018-09-22), pages 2237 - 2246, XP036644939, DOI: 10.1007/s11033-018-4385-3 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2023164482A3 (fr) * 2022-02-23 2023-10-26 The Johns Hopkins University Traitement pour maladie d'expansion à répétition nucléotidique

Similar Documents

Publication Publication Date Title
Meyer et al. Cell‐specific aptamers as emerging therapeutics
Foster et al. Purification of mRNA encoding chimeric antigen receptor is critical for generation of a robust T-cell response
US11186825B2 (en) Compositions and methods for evaluating and modulating immune responses by detecting and targeting POU2AF1
EP3368689B1 (fr) Compositions d'évaluation et de modulation des réponses immunitaires à l'aide de signatures génétiques de cellules immunitaires
Mercier et al. Selection of nucleic acid aptamers targeting tumor cell-surface protein biomarkers
ES2875747T3 (es) Proteínas quiméricas y métodos de inmunoterapia
US11180730B2 (en) Compositions and methods for evaluating and modulating immune responses by detecting and targeting GATA3
US20200016202A1 (en) Modulation of novel immune checkpoint targets
WO2017069958A2 (fr) Modulation de nouvelles cibles de points de contrôle immunitaires
CN108603230A (zh) 基因表达的调节与蛋白质表达失调的筛选
CA2803525A1 (fr) Siarn cible contre un aptamere pour inhiber une degradation a mediation par un non-sens
KR20210010853A (ko) 서열 특이적인 생체내 세포 표적화
JP2022513586A (ja) 抗ｌｉｖ１免疫細胞癌療法
WO2022256620A1 (fr) Nouvelles cibles pour améliorer l'immunité antitumorale
WO2020176553A1 (fr) Thérapie ciblant une mutation intracellulaire
CN115485385A (zh) 用于使肿瘤细胞对免疫疗法敏感的方法和组合物
US20220340906A1 (en) Methods and compositions for the treatment of cancer
US20220363767A1 (en) Hla-h, hla-j, hla-l, hla-v and hla-y as therapeutic and diagnostic targets
KR20210116861A (ko) 압타머기반 입자 및 이의 제조방법
Chen et al. Synthetic immunity to break down the bottleneck of cancer immunotherapy
JP7422128B2 (ja) 配列特異的なインビボ細胞標的化
Zhang et al. INAUGURAL ARTICLE by a Recently Elected Academy Member: Immunotherapy for breast cancer using EpCAM aptamer tumor-targeted gene knockdown
Li Aptamers for Targeting EBV-associated Nasopharyngeal Carcinoma
US20210155928A1 (en) Rna-aided immunotherapeutics
KR20210116860A (ko) 압타머기반 입자 및 이의 제조방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20763720

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 20763720

Country of ref document: EP

Kind code of ref document: A1