WO2020168659A1

WO2020168659A1 - Homologous recombination empty vector for dunaliella salina chloroplasts and application thereof

Info

Publication number: WO2020168659A1
Application number: PCT/CN2019/091814
Authority: WO
Inventors: 崔玉琳; 林彬; 秦松; 初金玲; 焦绪栋
Original assignee: 中国科学院烟台海岸带研究所
Priority date: 2019-02-20
Filing date: 2019-06-19
Publication date: 2020-08-27
Also published as: CN109536525A; LU101834A1; LU101834B1; CN109536525B

Abstract

Provided are a homologous recombination empty vector for dunaliella salina chloroplasts and an application thereof. The vector comprises a promoter, a terminator, an upstream homologous arm having a base sequence represented by SEQ ID NO: 1, and a downstream homologous arm having a base sequence represented by SEQ ID NO: 2. A base sequence represented by SEQ ID NO: 5 that forms a polycistronic structure with at least one exogenous gene is inserted between the homologous arms. The vector can implement stable expression of multiple exogenous genes in chloroplasts.

Description

A kind of Dunaliella salina chloroplast homologous recombination empty vector and its application

Technical field

The invention relates to the technical field of genetic engineering, in particular to a Dunaliella salina chloroplast homologous recombination empty vector and its application.

Background technique

In the eukaryotic microalgae undergoing photosynthesis, the nucleus, chloroplasts and mitochondria all contain DNA, which constitute an independent and interconnected genetic system. Since the birth of genetic engineering technology, exogenous gene transformation technology targeting the nucleus has been widely used. However, with the progress of research, people have found that nuclear genome genetic engineering has insurmountable difficulties: 1. The efficiency of inserting foreign genes into the nuclear genome is low, and random insertion, resulting in great variability between different clones, so extensive 2. The structure and function of the nuclear genome are complex, and the insertion of foreign genes sometimes causes variation in other traits; 3. The expression efficiency of foreign genes is low, and the expression is unstable; 4. The safety and stability are not high, and foreign genes are easy diffusion. These problems severely restrict the application of exogenous gene transformation technology.

In 1988, Boynton et al. used Chlamydomonas for the first time through the gene bombardment method to achieve chloroplast transformation, making people realize that chloroplasts can be used as a new transformation expression receptor in genetic engineering. Chloroplast transformation utilizes the mechanism of DNA homologous recombination. The recipient cell chloroplast genome homologous sequence is added to the two flanks of the exogenous gene, and the exogenous DNA is inserted between the chloroplast functional genes, so as to more accurately control the insertion of the exogenous gene. In higher plants such as tobacco, chloroplast transformation has been widely used. Compared with the nuclear transformation system, the chloroplast transformation system has many advantages: it can realize the targeted integration of exogenous genes, no gene silencing phenomenon, higher exogenous gene expression efficiency and less variation.

Dunaliella salina is a kind of halophilic green microalgae, which belongs to Chlorophyta, Chlorophyceae and Halophila in taxonomy. It can reduce the intracellular sodium chloride concentration by regulating the metabolism of glycerol in the cell. Under appropriate stress conditions, the algae strain can accumulate β-carotene content, making β-carotene content more than 10% of the total dry organic matter; it also contains a large amount of protein, polysaccharides, Ca, P, Zn and other minerals. It can be seen that the algae strain has certain application value. At present, the whole genome of Dunaliella salina chloroplast genome has been sequenced, which provides sufficient basis for the genetic modification of Dunaliella salina chloroplast, but so far, the research of Dunaliella salina chloroplast transformation has just started, lacking efficient and stable chloroplast insertion sites and The endogenous high-efficiency regulatory sequence restricts the basic research and application development of the algae.

Summary of the invention

The purpose of the present invention is to provide a Dunaliella salina chloroplast homologous recombination empty vector and its application.

In order to achieve the above objectives, the technical solutions adopted by the present invention are:

A Dunaliella salina chloroplast homologous recombination empty vector, comprising a promoter and a terminator, the recombination empty vector containing the upstream homology arm of the base sequence shown in SEQ ID NO: 1 and the base shown in SEQ ID NO: 2 In the downstream homology arms of the sequence, the base sequence shown in SEQ ID NO: 5 that forms a polycistronic structure with at least one foreign gene is inserted between the homology arms.

A selection marker gene is inserted between the homology arms.

At least one promoter and terminator are inserted between the upstream homology arm and the downstream homology arm; wherein the terminator is a chloroplast prokaryotic terminator.

The recombination empty vector sequentially contains an upstream homology arm, at least one promoter, a selectable marker gene, a base sequence shown in SEQ ID NO: 5 that forms a polycistronic structure with at least one foreign gene, a terminator, and Downstream homology arm.

The promoter is a promoter that regulates foreign genes;

Or, the promoter is a promoter that regulates foreign genes and a promoter that regulates selectable marker genes; wherein the promoter is the base sequence shown in SEQ ID NO: 3 and/or the base shown in SEQ ID NO: 4 sequence. The base sequence shown in SEQ ID NO: 3 and/or the base sequence shown in SEQ ID NO: 4 described above can respectively regulate foreign genes and can also regulate selectable marker genes.

The upstream homology arm is the base sequence shown in the sequence shown in SEQ ID NO:1; or, the sequence shown in SEQ ID NO:1 starts at the 3'end and extends to the 5'end to a continuous fragment not less than 500 bp ；

The downstream homology arm is the base sequence shown in the sequence shown in SEQ ID NO: 2; or, the sequence shown in SEQ ID NO: 2 starts at the 5'end and extends to the 3'end to a continuous fragment not less than 500 bp ；

The promoter is the base sequence shown in the sequence shown in SEQ ID NO: 3; or, the sequence shown in SEQ ID NO: 3 starts at the 5'end and extends to the 3'end to a continuous fragment not less than 800 bp ；

The promoter is the base sequence shown in the sequence shown in SEQ ID NO: 4; or, the sequence shown in SEQ ID NO: 4 starts at the 5'end and extends to the 3'end to a continuous fragment not less than 510 bp ；

The connecting sequence is the base sequence shown in the sequence shown in SEQ ID NO: 5; or, the sequence shown in SEQ ID NO: 5 starts at the 5'end and extends to the 3'end to a continuous fragment not less than 15 bp ；

The selectable marker gene is the glufosinate resistance gene bar gene.

An application of a Dunaliella salina chloroplast homologous recombination empty vector, and the application of the vector in Dunaliella salina chloroplast transformation.

The foreign gene is introduced into the constructed homologous recombination empty vector and then introduced into the Dunaliella salina cell, and the transgenic Dunaliella salina is obtained through culture and screening

The exogenous genes are functional protein genes, structural protein genes, nutritional protein genes, etc.; among them, functional protein genes such as fatty acid synthesis protein genes, photosynthesis-related protein genes, etc., structural protein genes such as cell membrane protein genes calmodulin Genes, metal ion binding protein genes, etc.

The advantages of the present invention:

The present invention successfully constructed a stable chloroplast expression system of Dunaliella salina. The invention can effectively recombine multiple foreign genes into the chloroplast genome of Dunaliella salina, and obtain transgenic algae strains through screening. Compared with the prior art, the present invention achieves a key breakthrough in Dunaliella salina genetic engineering technology, and has the following beneficial effects:

1. The present invention provides a chloroplast genome homologous recombination site for Dunaliella salina chloroplast transformation.

2. The present invention provides an endogenous sequence of Dunaliella salina chloroplast in which multiple exogenous genes are connected in series to form a polycistron.

3. The present invention provides efficient endogenous regulatory sequences of Dunaliella salina.

Description of the drawings

Figure 1 is a plasmid map of pMD-BKT-CRTR provided in the Examples of the Invention.

Figure 2 is an electrophoresis diagram of PCR products provided by an embodiment of the present invention (where M is a molecular marker DL2000; lane wt is a wild strain; lane bar is a positive transgenic algae strain).

Figure 3 is an electrophoresis diagram of PCR products provided by an embodiment of the present invention (where M is a molecular marker DL5000; lane wt is a wild strain; lane tf is a positive transgenic algae strain).

Figure 4 is a hybridization diagram of transgenic Dunaliella salina southern provided by an embodiment of the present invention (lane wt is a wild strain; lane tf is a positive transgenic algae strain), 1 is the hybridization result of the genome after double digestion with XhoI and EcoRI; 2 is the genome The result of hybridization after double digestion with BamHI and HindIII.

Figure 5 is a western hybridization map of the transgenic Dunaliella salina provided by an embodiment of the present invention (wherein the lane wt is a wild strain; the lane tf is a positive transgenic algae strain).

detailed description

The present invention will be further described below with reference to the drawings and embodiments.

Example 1 Cloning of homologous recombination fragments of Dunaliella salina chloroplast

Design and synthesize the following two pairs of primers:

P1:5’-TTACCAGGGTTTGACATGTCTAGAA-3’

P2: 5’-TGGGCTATAGAAGATTTGAAC-3’

P3:5’-GGGAATGTAGCTCAGTTGGTAGAGC-3’

P4: 5’-TTCAGCTGTTTCGTTTTTAGAAAACT-3’

The amplification product of primers P1 and P2 is SEQ ID NO:1, which is the fragment 16S-TrnA; the amplification product of primers P3 and P4 is SEQ ID NO: 2, which is the fragment TrnI-23S (see Figure 1).

Using the total DNA of Dunaliella salina genome as a template, PCR amplification was carried out with primers Pl and P2. The reaction procedure is: 94°C 10min pre-denaturation; 94°C 1min, 60°C 90sec, 72°C 90sec, total 30 cycles; 72°C 5min extend. The PCR amplification product is about 901bp, which is the fragment 16S-trnI. After the fragment is electrophoresed on agarose gel, the PCR product is purified by gel recovery (Tiangen company kit), and is connected to pMD-18T vector (Sigma company) , The recombinant plasmid pMD16I containing the fragment 16S-trnI was obtained.

Using the total DNA of Dunaliella salina genome as a template, PCR amplification was carried out with primers P3 and P4. The reaction procedure was: 94°C 10min pre-denaturation; 94°C 1min, 60°C 90sec, 72°C 90sec, total 30 cycles; 72°C 5min extend. The PCR amplification product is about 731bp, which is the fragment trnA-23S. After the fragment is subjected to agarose gel electrophoresis, the PCR product purified by gel recovery (Tiangen kit) is connected to the pMD-18T vector (Sigma) , The recombinant plasmid pMD23A containing the trnA-23S fragment was obtained.

Example 2 Amplification and cloning of two chloroplast promoter fragments of Dunaliella salina

Design and synthesize the following two pairs of primers:

P5: 5’-ATCCGCGTAGAGTAATAGG-3’

P6: 5’-GAGCACCATTTTTACTTCTGGTGTA-3’

P7: 5’-GGATCCGCCGATCCGTGGTTTAGAGTT-3’

P8:5’-ACGTGCCCAAAGGCTAGTATTT-3’

The amplification products of primers P5 and P6 are SEQ ID NO: 3, the fragment 5'atpA, which is a promoter with chloroplast activating function derived from Dunaliella salina chloroplast; the amplification products of primers P7 and P8 are SEQ ID NO :4, the fragment 5'psbA, is a chloroplast-promoting promoter derived from Dunaliella salina chloroplast (see Figure 2).

Using the total DNA of Dunaliella salina as a template, PCR amplification was carried out with primers P5 and P6. The reaction procedure was: 94°C 10min pre-denaturation; 94°C 1min, 60°C 90sec, 72°C 90sec, 30 cycles; 72°C 5min extend. The PCR amplification product is about 943bp, which is the fragment 5'atpA. After the fragment is subjected to agarose gel electrophoresis, the PCR product purified by gel recovery (Tiangen company kit) is connected with pMD-18T vector (Sigma company) , The recombinant plasmid pMDatpA containing fragment 5'atpA was obtained.

Using the total DNA of Dunaliella salina genome as a template, PCR amplification was carried out with primers P7 and P8. The reaction procedure was: 94℃ 10min pre-denaturation; 94℃ 1min, 60℃ 90sec, 72℃ 90sec, total 30 cycles; 72℃ 5min extend. The PCR amplification product is about 511bp, which is the fragment 5'psbA. After the fragment is electrophoresed on agarose gel, the PCR product purified by gel recovery (Tiangen kit) is connected to pMD-18T vector (Sigma) , The recombinant plasmid pMDpsbA containing fragment 5'psbA was obtained.

Example 3 Construction of an empty vector of Dunaliella salina chloroplast homologous recombination

Based on the above cloning vectors pMD16I, pMD23A, pMDatpA, and pMDpsbA, the Dunaliella salina chloroplast homologous recombination vector was constructed by the homologous recombination method.

Design and synthesize the following six pairs of primers:

P9: tagcctttgggcacgtATGAGCCCAGAACGACGCC

P10: ctgagctacattcccTCATCAAATCTCGGTGACGGG

P15: tgctcctcgagCTGCTTGTGAAGTTTGGAAAGAAA

P16: tgctcctcgagCTGCTTGTGAAGTTTGGAAAGAAA

P17: catgattacgaattcggatccTTACCAGGGTTTGACATGTCTAGAA

P18:gcggatTGGGCTATAGAAGATTTGAAC

P19: gatgaGGGAATGTAGCTCAGTTGGTAGAGC

P20: acgacggccagtgccaagcttTTCAGCTGTTTCGTTTTTAGAAAACT

P21: tatagcccaATCCGCGTAGAGTAATAGG

P22: aagcagctcgagGAGCACCATTTTTACTTCTGGTGTA

P23: tatgaccatgattacgaattcGGATCCGCCGATCCGTGGTTTAGAGTT

P24: tcatACGTGCCCAAAGGCTAGTATTT

Among them, the amplified product of primers P9 and P10 is the fragment bar, which is the glufosinate resistance gene; the amplified product of primers P15 and P16 is the fragment rbcL, which is a terminator with chloroplast termination function derived from the chloroplast of Dunaliella salina; The amplification products of P17 and P18 are the upstream of the fragment 16S-TrnA; the amplification products of the primers P19 and P20 are the downstream of the fragment TrnI-23S; the amplification products of the primers P21 and P22 are the fragment 5'atpA; the amplification of the primers P23 and P24 The product is the fragment 5'psbA.

Using the plasmid PSVB (Cui Yulin, Jiang Peng, Wang Jinfeng, Li Fuchao, Chen Yingjie, Zheng Guoting, Qin Song. 2012. Chinese Journal of Oceanology and Limnology, 30(3): 471-475.) as a template, primer P9 Perform PCR amplification with P10, the reaction program is: 94°C 10min pre-denaturation; 94°C 1min, 60°C 90sec, 72°C 90sec, total 30 cycles; 72°C 5min extension. The PCR amplification product is about 570bp. After the fragment is subjected to agarose gel electrophoresis, the purified PCR product is obtained by gel recovery (Tiangen company kit), which is the fragment bar.

Using the total DNA of Dunaliella salina genome as a template, PCR amplification was carried out with primers P15 and P16. The reaction procedure was: 94℃ 10min pre-denaturation; 94℃ 1min, 60℃ 90sec, 72℃ 90sec, total 30 cycles; 72℃ 5min extend. The PCR amplification product is about 272bp. After the fragment is subjected to agarose gel electrophoresis, the purified PCR product is obtained by gel recovery (Tiangen company kit), which is the fragment rbcL.

Using plasmid pMD16I as a template, PCR amplification was performed with primers P17 and P18. The reaction procedure was: 94°C 10min pre-denaturation; 94°C 1min, 60°C 90sec, 72°C 90sec, 30 cycles; 72°C 5min extension. The PCR amplification product is about 901bp. After the fragment is subjected to agarose gel electrophoresis, the purified PCR product is obtained by gel recovery (Tiangen company kit), which is the fragment 16S-TrnA.

Using plasmid pMD23A as a template, PCR amplification was performed with primers P19 and P20. The reaction procedure was: 94°C 10min pre-denaturation; 94°C 1min, 60°C 90sec, 72°C 90sec, 30 cycles; 72°C 5min extension. The PCR amplification product is about 731bp. After the fragment is subjected to agarose gel electrophoresis, the purified PCR product is obtained by gel recovery (TrnI-23S), which is the fragment TrnI-23S.

Using plasmid pMDatpA as a template, PCR amplification was performed with primers P21 and P22. The reaction procedure was: 94°C 10min pre-denaturation; 94°C 1min, 60°C 90sec, 72°C 90sec, 30 cycles in total; 72°C 5min extension. The PCR amplification product is about 943bp. After the fragment is subjected to agarose gel electrophoresis, the purified PCR product is obtained by gel recovery (Tiangen company kit), which is the fragment 5'atpA.

Using plasmid pMDpsbA as a template, PCR amplification was performed with primers P23 and P24. The reaction procedure was: 94°C 10min pre-denaturation; 94°C 1min, 60°C 90sec, 72°C 90sec, 30 cycles; 72°C 5min extension. The PCR amplification product is about 511 bp. After the fragment is subjected to agarose gel electrophoresis, the purified PCR product is obtained by gel recovery (Tiangen company kit), which is the fragment 5'psbA.

The pMD-18T vector was digested with EcoRI and HindIII, and then ligated with the obtained 5'psdA, bar, and 16S-TrnA to obtain a recombinant plasmid pPBI containing the Dunaliella salina promoter, glufosinate resistance gene, and homologous arm gene. The recombinant plasmid pPBI obtained above was digested with BamHI, and then ligated with trnA-23S, 5'atpA, and rbcL after digestion to obtain a recombinant plasmid containing Dunaliella salina promoter, homology arm and glufosinate resistance gene pSARPBI.

Insert the base sequence shown in SEQ ID NO: 5 that can form a polycistronic structure with at least one exogenous gene into this vector pSARPBI to obtain a recombinant empty vector; one or more exogenous genes are introduced into Dunaliella salina After the chloroplast, the expression of foreign genes can be realized. Among them, the base sequence shown in SEQ ID NO: 5 is inserted into the vector through the introduced foreign gene; for example, the addition of sequence 5 between two foreign genes to form a polycistronic structure can realize the integration of multiple foreign genes. Co-expression.

In addition, the selective resistance gene in the recombination empty vector can be inserted in the manner described in the above-mentioned embodiment, and can also be inserted when the foreign gene is inserted.

Example 4

The application of the vector in Dunaliella salina chloroplast transformation is obtained according to the above-mentioned embodiment; the following two key genes for astaxanthin synthesis in Haematococcus pluvialis are used as exogenous genes, and the vector is inserted into Dunaliella salina, The activity of the vector is detected by detecting the expression and function of these two foreign genes.

Expression of key genes for astaxanthin synthesis in Dunaliella salina chloroplast

1. Vector construction

Design and synthesize the following two pairs of primers:

P11:

P12: tgatggtgatgatgcat

TCATGCCAAGGCAGGCAC (Italic in the frame is the sequence shown in SEQ ID NO: 5)

P13: atgcatcatcaccatcaccatCTGTCGAAGCTGCAGTCAATCA

P14: aaacttcacaagcagctcgagCTACCGCTTGGACCAGTCCA

The amplified product of primers P11 and P12 is the fragment bkt, which is the foreign gene β-carotene ketolase; the amplified product of primers P13 and P14 is the fragment crtr-b, which is the foreign gene β-carotene hydroxylase.

Using the Haematococcus pluvialis genome as a template, PCR amplification was carried out with primers P11 and P12. The reaction procedure was: 94°C 10min pre-denaturation; 94°C 1min, 60°C 90sec, 72°C 90sec, 30 cycles; 72°C 5min extend. The PCR amplification product is about 978bp. After the fragment is subjected to agarose gel electrophoresis, the purified PCR product is obtained by gel recovery (Tiangen company kit), which is the fragment bkt.

Using the Haematococcus pluvialis genome as a template, PCR amplification was carried out with primers P13 and P14. The reaction procedure was: 94°C 10min pre-denaturation; 94°C 1min, 60°C 90sec, 72°C 90sec, total 30 cycles; 72°C 5min extend. The PCR amplification product is about 900bp. After the fragment is subjected to agarose gel electrophoresis, the purified PCR product is obtained by gel recovery (Tiangen company kit), which is the fragment crtr-b.

The Dunaliella salina chloroplast homologous recombination empty vector pSARPBI vector was digested with XhoI, and then ligated with the obtained bkt and crtr-b to obtain the Dunaliella salina chloroplast expression vector pMD-BKT-CRTR (see Figure 1 for the plasmid map).

2. Transformation of Dunaliella salina

1h before transformation, take the logarithmic growth phase of Dunaliella salina with a concentration of about 5.0×105 cell ml-1, centrifuge at 6000g for 5 minutes, discard the supernatant, and adjust the concentration to 1×10 ⁸ cell ml with the salina culture solution ^-1 . Then take 0.2ml of algae liquid and apply it to the center of the solid culture plate, which is a circle with a diameter of about 3cm. The coated flat plate is placed in a clean bench for use.

Preparation of microparticle bomb: Take 50μl gold powder suspension (containing about 3mg gold powder) and add 5μl plasmid pMD-BKT-CRTR (plasmid concentration>= 1μgμl ^-1 ), 50μl 2.5M CaCl2, 20μl 0.1M spermidine while vortexing. Then continue to vortex for 3 minutes. Centrifuge for 5-6 sec and discard the supernatant. Then it was washed twice with 250μl of absolute ethanol, and finally resuspended with 60μl of absolute ethanol. Such a tube of particles coated with plasmid can be used for 5-6 bombardments.

Under aseptic conditions (in the ultra-clean workbench), bombardment with a high-pressure helium gene gun.

After bombardment, the algae cells were cultured on a solid culture plate under dark conditions for 8 hours, and then transferred to the Dunaliella salina culture solution for a further 40 hours to restore the cell growth state.

3. Screening and identification of Dunaliella salina

The Dunaliella salina cells after the recovery culture are transferred to the selective culture medium to kill the untransformed algae cells. The selective culture medium is the culture medium of Dunaliella salina containing 15μg ml ^-1 glufosinate. After 15 days, the culture solution was centrifuged at 6000g for 5 minutes, and the supernatant was discarded. The collected algae bodies were spread on a solid culture plate containing 15 μg ml ^-1 glufosinate to disperse and grow resistant algal cells to obtain resistant single algal colonies. After about 20 days of culture, single algae colonies grew on the plate. Then the single algae colonies were picked out and streaked onto a solid culture plate containing 5 μg ml ^-1 Dingxin to further purify the resistant algae colonies and enhance resistance. After 20 days, the single algae were picked and dropped into the culture solution to continue to culture for about 20 days, centrifuged at 6000g for 5 minutes, and collected the algae body, each algae body wet weight >=100mg, and then placed in liquid nitrogen to freeze for later use.

Extract the total genomic DNA of the transgenic Dunaliella salina for molecular identification. First, use PCR to identify the integration of the plasmid. The upstream primer used in PCR is bar for, the downstream primer is bar rev, and the product is bar gene. 94°C for 1min, 60°C for 90sec, 72°C for 90sec, a total of 30 cycles; 72°C for 5min extension. The PCR product is about 570 bp (see Figure 2). This fragment was amplified in part of the resistant Dunaliella salina genome, but it was not found in untransformed Dunaliella salina.

Then design and synthesize primers near the 3'end of SEQ ID NO: 1 and the 5'end of SEQ ID NO: 2 respectively. The primer sequences are as follows:

con-16s for:TTACCAGGGTTTGACATGTCTAGAA;

con-23s rev: TTCAGCTGTTTCGTTTTTAGAAAACT.

This pair of primers con-16s for and con-23s rev amplify a fragment including 16S-23S from the total DNA of the wild-type Dunaliella salina genome, with a length of about 1630bp; in the homogenized total DNA of the transgenic Dunaliella salina genome , A fragment of 16S-TrnA-atpA-bkt-crtr-b-rbcL-psbA-bar-TrnI-23S was amplified, and the length was about 5800bp.

The whole genome DNA of the positive transgenic algae was used as a template, and the primers con-16s for and con-23s-rev were used for PCR amplification. The PCR reaction program is: 94°C 1min, 60°C 90sec, 72°C 90sec, a total of 30 cycles; 72°C 5min extension. The PCR product separated by electrophoresis has two bands, one is about 1630bp, the other is about 5800bp (see Figure 3). The longer band indicates that the bar gene and the two foreign genes have been inserted into the Dunaliella salina chloroplast genome by homologous recombination, and the insertion site is the spacer between the fragments SEQ ID NO: 1 and SEQ ID NO: 2 position.

The transgenic Dunaliella salina samples with positive PCR results should continue to be identified by Southern hybridization. The total genomic DNA of each sample is at least 4μg. Genomic DNA was first subjected to random double digestion, and there were two groups: XhoI and EcoRI double digestion at 37°C for 2 hours; BamHI and HindIII double digestion at 37°C for 2 hours. Southern hybridization probes are derived from a sequence of the digoxigenin-labeled plasmid pMD-BKT-CRTR bar, bkt, and crtr-b genes. The hybridization results showed that in the genome of some glufosinate-resistant algae strains, a band of about 1300bp and a band of 1000bp appeared after bar hybridization, and a band of about 1800bp and 4000bp appeared after bkt hybridization, crtr After -b hybridization, a band of about 1800 bp and a band of 4000 bp appeared, which were the same size as the band after the plasmid digestion, but the untransformed algae strain did not have this band in the genome (see Figure 4), which indicates In some positive strains, the plasmid pMD-BKT-CRTR has been integrated into the chloroplast genome.

The transgenic Dunaliella salina samples with positive PCR results should continue to be identified by western hybridization. Western hybridization uses mouse anti-His IgG and goat anti-mouse IgG combined with horseradish peroxidase (HRP) to identify expressed proteins. The hybridization results showed that a band of 39.85kDa and a band of 32.85kDa appeared after the hybridization, which was the same size as the foreign gene protein, but the untransformed algae strain did not have this band in the genome (see Figure 5). It shows that in some positive algae strains, the foreign protein has been expressed.

The above examples show that the two key genes for astaxanthin synthesis have been successfully co-expressed in Dunaliella salina chloroplasts using the vector of the present invention, which proves the ability of the vector of the present invention to regulate the expression of foreign genes in Dunaliella salina chloroplasts , Can realize the expression of various protein genes.

At the same time, the above characteristics can also be achieved by replacing foreign genes with the following functional protein genes, structural protein genes, and nutritional protein genes. The functional protein genes such as fatty acid synthesis protein genes, photosynthesis-related protein genes, etc., structural protein genes Such as cell membrane protein gene calmodulin gene, metal ion binding protein gene, etc., nutrient protein gene such as neuropeptide gene.

Sequence Listing

Claims

An empty vector for homologous recombination of Dunaliella salina chloroplast, comprising a promoter and a terminator, characterized in that: the empty recombination vector contains the upstream homology arm of the base sequence shown in SEQ ID NO: 1 and SEQ ID NO: 2 In the downstream homology arm of the base sequence, the base sequence shown in SEQ ID NO: 5 that forms a polycistronic structure with at least one foreign gene is inserted between the homology arms.
The empty vector for homologous recombination of Dunaliella salina chloroplast according to claim 1, characterized in that a selectable marker gene is inserted between the homology arms.
The Dunaliella salina chloroplast homologous recombination empty vector according to claim 1 or 2, characterized in that: at least one promoter and terminator are inserted between the upstream homology arm and the downstream homology arm; wherein the terminator is a chloroplast Prokaryotic terminator.
The empty vector for homologous recombination of Dunaliella salina chloroplast according to claim 3, wherein the empty recombination vector contains an upstream homology arm, at least one promoter, a selectable marker gene, and at least one foreign gene in sequence. The base sequence, terminator, and downstream homology arm shown in SEQ ID NO: 5 of the cistronic structure.
The empty vector of Dunaliella salina chloroplast homologous recombination according to claim 4, wherein the promoter is a promoter that regulates foreign genes;

Or, the promoter is a promoter that regulates foreign genes and a promoter that regulates selectable marker genes; wherein the promoter is the base sequence shown in SEQ ID NO: 3 and/or the base shown in SEQ ID NO: 4 sequence.
The empty vector of Dunaliella salina chloroplast homologous recombination according to claim 1, wherein the upstream homology arm is the base sequence shown in the sequence shown in SEQ ID NO:1; or, SEQ ID NO:1 The sequence shown starts at the 3'end and extends to the 5'end to a continuous fragment of not less than 500 bp;

The downstream homology arm is the base sequence shown in the sequence shown in SEQ ID NO: 2; or, the sequence shown in SEQ ID NO: 2 starts at the 5'end and extends to the 3'end to a continuous fragment not less than 500 bp ；

The promoter is the base sequence shown in the sequence shown in SEQ ID NO: 3; or, the sequence shown in SEQ ID NO: 3 starts at the 5'end and extends to the 3'end to a continuous fragment not less than 800 bp ；

The promoter is the base sequence shown in the sequence shown in SEQ ID NO: 4; or, the sequence shown in SEQ ID NO: 4 starts at the 5'end and extends to the 3'end to a continuous fragment not less than 510 bp ；

The connecting sequence is the base sequence shown in the sequence shown in SEQ ID NO: 5; or, the sequence shown in SEQ ID NO: 5 starts at the 5'end and extends to the 3'end to a continuous fragment not less than 15 bp ；

The selectable marker gene is the glufosinate resistance gene bar gene.
An application of the Dunaliella salina chloroplast homologous recombination empty vector of claim 1 in Dunaliella salina chloroplast transformation.
The application according to claim 7, characterized in that the foreign gene is introduced into the constructed empty vector of homologous recombination and then introduced into Dunaliella salina cells, and the transgenic Dunaliella salina is obtained after culture and screening.