CN110747225B

CN110747225B - Scenedesmus obliquus chloroplast homologous recombination empty vector and application thereof

Info

Publication number: CN110747225B
Application number: CN201911341803.2A
Authority: CN
Inventors: 崔玉琳; 王康; 任家利; 秦松
Original assignee: Yantai Institute of Coastal Zone Research of CAS
Current assignee: Yantai Institute of Coastal Zone Research of CAS
Priority date: 2019-12-24
Filing date: 2019-12-24
Publication date: 2020-04-28
Anticipated expiration: 2039-12-24
Also published as: CN110747225A

Abstract

The invention relates to the technical field of genetic engineering, in particular to a Scenedesmus obliquus chloroplast homologous recombination empty vector and application thereof. The vector comprises upstream and downstream homologous arms, a promoter and a terminator are arranged between the homologous arms, and a base sequence shown in SEQ ID NO.6 of a polycistronic structure formed by at least one exogenous gene is inserted between the promoter and the terminator; wherein, the upstream homologous arm contains a base sequence shown in SEQ ID NO. 1, and the downstream homologous arm contains a base sequence shown in SEQ ID NO. 2. The homologous recombinant empty vector of scenedesmus obliquus chloroplast can realize stable expression of a plurality of exogenous genes in chloroplast.

Description

Scenedesmus obliquus chloroplast homologous recombination empty vector and application thereof

Technical Field

The invention relates to the technical field of genetic engineering, in particular to a Scenedesmus obliquus chloroplast homologous recombination empty vector and application thereof.

Background

Scenedesmus obliquus (C. obliquus)Scenedesmus obliquus) Is a freshwater unicellular eukaryotic green alga, belonging to the phylum Chlorophyta, class Chlorophyta, order Chlorococcales, family Scenedesmaceae, and generally consisting of 2 or 4 cells in a definite population. The algae cells are spindle-shaped or oval, and the two ends are sharp; the free surfaces of the cells on both outer sides of the population are sometimes concave and sometimes rise; cell wall flattening; the cell width is 3-6 mu m, and the cell length is 13-16 mu m; the population width of 4 cells was 12-24 μm. The cells contain a nucleoprotein and a perichromosomal. The photosynthesis pigments are mainly chlorophyll a, chlorophyll b, lutein and carotenoids. Under normal conditions, the algae cells are grass green and reproduce in nutrient-rich still water in a manner similar to that of a parent robe.

Scenedesmus obliquus has a very wide application range. Scenedesmus obliquus is widely distributed in ponds, ditches and rivers in warm areas, plays an important role in aquatic ecosystems, is easy to culture in artificial environments, and is widely used as feed for rotifers, herbivorous fishes, crustaceans and mollusks. Scenedesmus obliquus is used as an indicator organism for water quality evaluation and is an indicator species of a type A middle smear because of strong tolerance to organic pollutants. On one hand, the scenedesmus obliquus provides oxygen for decomposing organic matters by bacteria through photosynthesis, and simultaneously can directly utilize substances such as nitrogen in the water body to grow, so that the content of the organic matters and the nitrogen in the water body is reduced, and the effect of purifying the water quality is achieved. Under the influence of energy crisis, scenedesmus obliquus is rich in linolenic acid and other polyunsaturated fatty acids due to high oil content and good fatty acid composition, and has great attention to the potential in the aspect of producing biological energy. Scenedesmus obliquus not only can be used for producing biodiesel, but also has the potential of producing hydrogen and ethanol.

The C0 can be realized by using Scenedesmus obliquus to produce biological energy products such as grease and the like₂The height of emission reduction, wastewater purification and resource energy production is not only suitable for competing with people for grain and land for water; but also can improve the environment, obtain 'environment value-added energy' and other high value-added products, have great significance to the sustainable development of the society, but the research on the molecular genetics of scenedesmus obliquus is still few at present, and the deep research on the scenedesmus obliquus is needed from the gene level in order to better regulate and control the oil metabolism and biomass accumulation of the scenedesmus obliquus.

The research on genetic transformation of scenedesmus obliquus starts late, and a cell nucleus transformation system is established at present, namely stable expression of green fluorescent protein is realized by using an electric shock transformation method. However, the nuclear expression system has inherent problems, such as complex nuclear genome structure and function, difficulty in realizing directed recombination and site-directed mutagenesis; the expression efficiency of the exogenous gene is low, and the expression is unstable. Scenedesmus obliquus, which is a eukaryote capable of photosynthesis, has chloroplast and mitochondria as two organelles having relatively independent genetic materials. Wherein chloroplast genetic transformation has the following advantages over nuclear transformation: prokaryotic expression system, chloroplast genome site-specific transformation, no gene silencing, high exogenous gene expression efficiency and small variation. Therefore, the development of the Scenedesmus obliquus chloroplast genetic transformation system has important value for basic research and application development of Scenedesmus obliquus. There is currently no research specifically directed to the chloroplast transformation system of Scenedesmus obliquus, which severely hinders the progress of basic research and application development of the alga.

Disclosure of Invention

The invention aims to provide a Scenedesmus obliquus chloroplast homologous recombination empty vector and application thereof.

In order to achieve the purpose, the invention adopts the technical scheme that:

a Scenedesmus obliquus chloroplast homologous recombination empty vector comprises an upstream homologous arm and a downstream homologous arm, and a promoter and a terminator are arranged between the homologous arms, and a base sequence shown in SEQ ID NO.6 of a polycistronic structure formed by at least one exogenous gene is inserted between the promoter and the terminator; wherein, the upstream homology arm contains a base sequence shown by SEQ ID NO. 1, and the downstream homology arm contains a base sequence shown by SEQ ID NO. 2.

A selection marker gene is inserted between the homology arms.

At least one promoter and a terminator are inserted between the upstream homology arm and the downstream homology arm.

The recombinant empty vector sequentially comprises an upstream homology arm, at least one promoter, a selective marker gene, a base sequence shown in SEQ ID NO.6 forming a polycistronic structure with at least one exogenous gene, a terminator and a downstream homology arm.

The promoter is used for regulating and controlling exogenous genes; or the promoter is a promoter for regulating and controlling the exogenous gene and a promoter for regulating and controlling the selective marker gene; wherein the promoter is a base sequence shown by SEQ ID NO. 3 and/or a base sequence shown by SEQ ID NO. 4.

The terminator is a terminator for regulating and controlling an exogenous gene; or, the terminator is a terminator for regulating the exogenous gene and a terminator for regulating the selective marker gene; wherein the terminator is a base sequence represented by the base sequence represented by SEQ ID NO. 5.

The upstream homology arm is a base sequence shown by a sequence shown by SEQ ID NO. 1; or, the 3 'end of the sequence shown in SEQ ID NO. 1 begins, and extends to the 5' end to a continuous fragment of not less than 500 bp;

the downstream homology arm is a base sequence shown by a sequence shown by SEQ ID NO. 2; or, the sequence shown in SEQ ID NO. 2 starts from the 5 'end and extends to the 3' end to a continuous fragment of not less than 500 bp.

The exogenous genes are functional protein genes, structural protein genes, nutritional protein genes and the like; wherein, the functional protein gene can be fatty acid synthetic protein gene, photosynthesis related protein gene, etc., and the structural protein gene can be cell membrane protein gene calmodulin gene, metal ion binding protein gene, etc.

An application of Scenedesmus obliquus chloroplast homologous recombination empty vector in Scenedesmus obliquus chloroplast transformation.

And introducing exogenous genes into the constructed homologous recombination empty vector, then introducing the exogenous genes into scenedesmus obliquus cells, and culturing and screening to obtain transgenic scenedesmus obliquus.

The invention has the advantages that:

the invention successfully constructs a stable chloroplast expression system of Scenedesmus obliquus. The invention can effectively recombine a plurality of exogenous genes into the chloroplast genome of Scenedesmus obliquus, and obtains transgenic algae strains through screening. Compared with the prior art, the invention realizes key breakthrough of scenedesmus obliquus gene engineering technology, and has the following beneficial effects:

1. the invention provides a chloroplast genome homologous recombination site for scenedesmus obliquus chloroplast transformation, which can ensure that the function of any gene of a chloroplast genome is not influenced while the insertion and stable inheritance of a foreign gene are ensured, so that the growth, physiological function and the like of algae cells are not influenced.

2. The invention provides a polycistronic scenedesmus chloroplast endogenous sequence RBS formed by connecting a plurality of exogenous genes in series, which can ensure the coexpression of a plurality of exogenous genes related to functions.

3. The invention provides an efficient Scenedesmus obliquus endogenous regulatory sequence, ensures the efficient transcription of exogenous genes, and is suitable for the transcription of a plurality of genes in polycistrons.

4. The chloroplast genome homologous recombination vector for scenedesmus obliquus chloroplast transformation can introduce exogenous genes into scenedesmus obliquus to express so as to improve the performance of the scenedesmus obliquus, such as protein content, immunity performance, fatty acid content and the like, and carbon fixation performance of the scenedesmus obliquus.

5. The chloroplast genome homologous recombination vector converted from scenedesmus obliquus chloroplast provided by the invention can reconstruct the metabolic pathway of secondary metabolites with high added values in scenedesmus obliquus to obtain a light-driven cell factory, and broaden the application range of scenedesmus obliquus.

Drawings

FIG. 1 is the Scenedesmus obliquus chloroplast homologous recombination empty vector map provided by the embodiment of the invention.

FIG. 2 is a Scenedesmus obliquus chloroplast homologous recombination expression map provided by the embodiment of the invention.

FIG. 3 is an electrophoresis diagram of PCR products provided in the present invention (wherein M is molecular marker DL2000; lane Wild is a Wild strain; lane Mutants is a positive transgenic algal strain).

FIG. 4 shows an electrophoretogram of PCR products provided in the present invention (where M is molecular marker DL5000; lane Wild is a Wild strain; lane Mutant is a positive transgenic algal strain).

FIG. 5 shows southern hybridization of Scenedesmus obliquus provided in the example of the present invention (wherein lane Wild represents a Wild strain and lane Mutant represents a positive transgenic strain).

FIG. 6 shows the western hybridization pattern of transgenic Scenedesmus obliquus provided in the example of the present invention (wherein lane Wild represents a Wild strain; lane Mutant represents a positive transgenic strain).

Detailed Description

The invention is further described below with reference to the figures and examples.

EXAMPLE 1 cloning of endogenous fragment of Scenedesmus obliquus chloroplast

The following primers were designed and synthesized:

SEQ1-for：5’- TGCTCGCAAGAGTGAAACTCAAAG-3’

SEQ1-rev：5’- TTAAAAAAGCTGGACCATACTGGACTTG-3’

SEQ2-for：5’- AGGTAAAAAAGGGAATATAGCTC -3’

SEQ2-rev：5’- TCGCCGGCTCATTCTTCAACAG -3’

SEQ3-for：5’- ATAAAAATTTTAAGTTTCAAATTTTTA-3’

SEQ3-rev：5’- AATATAAAAAAATAAAAATTTAAAATTCTCC -3’

SEQ4-for：5’-ATCAAAAAAAATGTTTTTTTTTGA-3’

SEQ4-rev：5’- ATAAAAAATAAAAAAAGTATT-3’

SEQ5-for：5’-TTTTTTTTTAAAATACTTCCTCTTTAAAG-3’

SEQ5-rev：5’-CAGGTCTCTTCCCAAAATTGCG-3’

wherein the amplification product of primers SEQ1-for and SEQ1-rev is SEQ ID NO 1; the amplification products of primers SEQ2-for and SEQ2-rev are SEQ ID NO 2; the amplification product of primers SEQ3-for and SEQ3-rev is SEQ ID NO 3; the amplification products of primers SEQ4-for and SEQ4-rev are SEQ ID NO 4; the amplification products of primers SEQ5-for and SEQ5-rev are SEQ ID NO 5.

The total DNA of Scenedesmus obliquus genome is taken as a template, PCR amplification is carried out by primers SEQ1-for and SEQ1-rev, and the reaction program is as follows: pre-denaturation at 94 ℃ for 5 min; 35 cycles of 94 ℃ for 1min, 56 ℃ for 30 sec, and 72 ℃ for 70 sec; extension was carried out at 72 ℃ for 5 min. The PCR amplification product is 16SrDNA-trnI sequence of Scenedesmus obliquus chloroplast genome, is 1101bp, and is a fragment SEQ ID NO: 1. After the fragment was subjected to agarose gel electrophoresis, the gel was recovered (Tiangen kit) and purified for use.

The total DNA of Scenedesmus obliquus genome is taken as a template, PCR amplification is carried out by primers SEQ2-for and SEQ2-rev, and the reaction program is as follows: pre-denaturation at 94 ℃ for 5 min; 35 cycles of 94 ℃ for 1min, 50 ℃ for 30 sec, 72 ℃ for 70 sec; extension was carried out at 72 ℃ for 5 min. The PCR amplification product is a Scenedesmus obliquus chloroplast genome trnA-23S rDNA sequence, is 1071 bp, and is a fragment SEQ ID NO of 2. After the fragment was subjected to agarose gel electrophoresis, the PCR product purified (Tiangen kit) was recovered in gel and ligated with pMD-18T vector (Sigma Co.) to obtain recombinant plasmid pMD-SEQ2 containing the fragment SEQ ID NO: 2.

The total DNA of Scenedesmus obliquus genome is taken as a template, PCR amplification is carried out by primers SEQ3-for and SEQ3-rev, and the reaction program is as follows: pre-denaturation at 94 ℃ for 5 min; 35 cycles of 94 ℃ for 1min, 45 ℃ for 30 sec, and 72 ℃ for 40 sec; extension was carried out at 72 ℃ for 5 min. The PCR amplification product is the Scenedesmus obliquus chloroplast genome psbA promoter, which is 634 bp, and is a fragment SEQ ID NO. 3. After the fragment was subjected to agarose gel electrophoresis, the PCR product purified (Tiangen kit) was gel-recovered and ligated with pMD-18T vector (Sigma Co.) to obtain recombinant plasmid pMD-SEQ3 containing the fragment SEQ ID NO: 3.

The total DNA of Scenedesmus obliquus genome is taken as a template, PCR amplification is carried out by primers SEQ4-for and SEQ4-rev, and the reaction program is as follows: pre-denaturation at 94 ℃ for 5 min; 35 cycles of 94 ℃ for 1min, 45 ℃ for 20 sec, and 72 ℃ for 40 sec; extension was carried out at 72 ℃ for 5 min. The PCR amplification product is the atpA promoter of the Scenedesmus obliquus chloroplast genome, and is 501 bp, namely the fragment SEQ ID NO: 4. After the fragment was subjected to agarose gel electrophoresis, the gel was recovered (Tiangen kit) and purified for use.

The total DNA of Scenedesmus obliquus genome is taken as a template, PCR amplification is carried out by primers SEQ5-for and SEQ5-rev, and the reaction program is as follows: pre-denaturation at 94 ℃ for 5 min; 35 cycles of 94 ℃ for 1min, 45 ℃ for 30 sec, and 72 ℃ for 30 sec; extension was carried out at 72 ℃ for 5 min. The PCR amplification product is a Scenedesmus obliquus chloroplast genome rbcL terminator, is 340 bp, and is a fragment SEQ ID NO. 5. After the fragment was subjected to agarose gel electrophoresis, the PCR product purified (Tiangen kit) was recovered in gel and ligated with pMD-18T vector (Sigma Co.) to obtain recombinant plasmid pMD-SEQ5 containing the fragment SEQ ID NO: 5.

Example 2: construction of Scenedesmus obliquus chloroplast transformation empty vector

bar-for: 5’-ATGAGCCCAGAACGACGCC-3’

bar-rev: 5’-TCATCAAATCTCGGTGACGGG-3’

Carrying out PCR amplification by using a vector pSVB as a template and primers bar-for and bar-rev, wherein the reaction program comprises the following steps: pre-denaturation at 94 ℃ for 5 min; 35 cycles of 94 ℃ for 1min, 54 ℃ for 30 sec, 72 ℃ for 40 sec; extension was carried out at 72 ℃ for 5 min. The PCR amplification product is about 555 bp, namely herbicide resistance gene bar. After the fragment was subjected to agarose gel electrophoresis, the gel was recovered (Tiangen kit) and purified for use.

Based on the product, pMD18T is used as a starting vector to construct a Scenedesmus obliquus chloroplast homologous recombination empty vector by a homologous recombination method. Wherein pMD-SEQ2, pMD-SEQ3 and pMD-SEQ5 need to be utilized firstlyAdding a joint and a restriction enzyme site at the 5 'end or the 3' end of the sequence by PCR, wherein the joint and the restriction enzyme site are respectively shown in SEQ ID NO 1, SEQ ID NO 4,barNo linker or cleavage site is added.

The following primers were designed and synthesized:

L1-for：5’-AGTATGGTCCAGCTTTTTTAAATAAAAATTTTAAGTTTCAAATT-3’

L1-rev：5’-GGCGTCGTTCTGGGCTCATAATATAAAAAAATAAAAATTTAAA-3’

L2-for：

5’-CCCGTCACCGAGATTTGATGATTTTTTTTTAAAATACTTCCTCTTTAA-3’

L2-rev：5’-TCAAAAAAAAACATTTTTTTTGATCAGGTCTCTTCCCAAAATTGCG-3’

L3-for：5’-CGAGCTCAGGTAAAAAAGGGAATATAGCTC -3’

L3-rev：5’-GGAATCCTCGCCGGCTCATTCTTCAACAG-3’

taking pMD-SEQ3 as a template, carrying out PCR amplification by primers L1-for and L1-rev, wherein the reaction program is as follows: pre-denaturation at 94 ℃ for 5 min; 35 cycles of 94 ℃ for 1min, 56 ℃ for 30 sec, and 72 ℃ for 50 sec; extension was carried out at 72 ℃ for 5 min. The PCR amplification product is about 670 bp, namely SEQ ID NO 3 with joints at two ends. After the fragment was electrophoresed on agarose gel, the purified PCR product (Tiangen kit) was gel recovered and named SEQ ID NO 3-1 for future use.

Taking pMD-SEQ5 as a template, carrying out PCR amplification by primers L2-for and L2-rev, wherein the reaction program is as follows: pre-denaturation at 94 ℃ for 5 min; 35 cycles of 94 ℃ for 1min, 45 ℃ for 30 sec, and 72 ℃ for 40 sec; extension was carried out at 72 ℃ for 5 min. The PCR amplification product is about 380 bp, namely SEQ ID NO 6 with joints at two ends. After the fragment was electrophoresed on agarose gel, the purified PCR product (Tiangen kit) was gel recovered and named SEQ ID NO: 5-1 for future use.

PCR amplification is carried out by taking pMD-SEQ2 as a template and primers L3-for and L3-rev, and the reaction program is as follows: pre-denaturation at 94 ℃ for 5 min; 35 cycles of 94 ℃ for 1min, 55 ℃ for 30 sec, and 72 ℃ for 1 min; extension was carried out at 72 ℃ for 5 min. The PCR amplification product is about 1080 bp, namely the PCR amplification product is the PCR amplification product containing 5' endSacI cleavage site, 3' end containingEcoThe RI cleavage site SEQ ID NO 2. After the fragments were subjected to agarose gel electrophoresis,the gel recovered (Tiangen kit) purified PCR product, designated SEQ ID NO: 2-1, was used.

The same concentration (20-100 ng/mL) of SEQ ID NO:1, SEQ ID NO: 3-1,barThe gene fragment, SEQ ID NO 5-1 and SEQ ID NO 4 are mixed as a template, sequentially connected by a fusion PCR kit and inserted into a pMD18T vector by a TA cloning method, and the named pMD 18T-1.

2-1 and pMD18T-1 of SEQ ID NOSacI andEcoafter the two RI enzymes are cut by enzyme, the two RI enzymes are connected by utilizing T4 ligase to form the Scenedesmus obliquus chloroplast homologous recombination empty vector which is named as pSo/ch/bar. The structure of the carrier is shown in figure 1.

1 exogenous gene or more than two exogenous genes can be inserted into a pSo/ch/bar vector in an enzyme digestion connection mode after being connected by SEQ ID NO. 7, thereby constructing a Scenedesmus obliquus chloroplast expression vector, and the exogenous genes can be expressed in chloroplasts after being introduced into Scenedesmus obliquus. The foreign gene may be a functional protein gene such as a protein gene catalyzing various enzymatic reactions, a photosynthesis-related protein gene, a structural protein gene such as a cell membrane protein gene, a metal ion-binding protein gene, etc., and a nutritional type protein gene such as a neuropeptide, an antimicrobial peptide gene, etc.

Two antibiotic peptide genes (GenBank No.6K50_ A; GenBank No. AKA 60777.2) having antibiotic activity were inserted into the vector and then introduced into Scenedesmus obliquus, and the performance of the vector was examined by examining the expression of these two foreign genes.

EXAMPLE 3 use of the vector obtained according to the above example in Scenedesmus obliquus chloroplast transformation

1. Construction of expression vectors

The following primers were designed and synthesized:

F1-for: 5’-CCTCTAGAATGCATCATCACCATCACCATGGTTTCGGTTGCAACGGTCCCTGG-3’

F1-rev: 5’-TTAGTAGCACTTGCAGACGAA TAAATTTTGAAATGGTGATGGTGATGGTGCAT-3’

F2-for: 5’-ATGCACCATCACCATCACCATTTCTTCTTCCACATCATCAAGGG-3’

F2-rev: 5’-GGGATCCTTACTTCCAGACGAGACCGTGGAT-3’

wherein, F1-for carriesXbaI restriction enzyme site and 6 × His label, F1-rev underlined sequence fragment is SEQID NO 6, italic part is the joint; the underlined sequence in F2-for is the 6 XHis tag, and F2-rev carriesBamHI enzyme cutting site.

The artificially synthesized antibacterial peptide gene 1 is used as a template, PCR amplification is carried out by primers F1-for and F1-rev, and the reaction program comprises pre-denaturation at 94 ℃ for 5min, 35 cycles of pre-denaturation at 94 ℃ for 1min, 30 sec at 55 ℃ and 20 sec at 72 ℃ and extension at 72 ℃ for 5 min. The PCR amplification product is about 220 bp, namely the PCR amplification product is the PCR amplification product containing 5' endXbaI, antibacterial peptide sequence of enzyme cutting site. After the fragment was subjected to agarose gel electrophoresis, the purified PCR product was recovered by gel (Tiangen kit) and named F1.

The artificially synthesized antibacterial peptide gene 2 is used as a template, PCR amplification is carried out by primers F2-for and F2-rev, and the reaction program comprises pre-denaturation at 94 ℃ for 5min, 35 cycles of pre-denaturation at 94 ℃ for 1min, 30 sec at 52 ℃ and 20 sec at 72 ℃ and extension at 72 ℃ for 5 min. The PCR amplification product is about 240 bp, namely 3' endBamThe antibacterial peptide sequence of HI enzyme cutting site. After the fragment was subjected to agarose gel electrophoresis, the purified PCR product was recovered by gel (Tiangen kit) and named F2.

The same concentrations (20-100 ng/mL) of F1 and F2 were mixed, ligated using a fusion PCR kit, and passed throughXbaI andBamand HI enzyme cutting connection mode, connecting the fusion fragment to an empty vector pTl/ch/bar. The obtained vector has accurate sequence through sequencing verification and is named as pSo/ch/bar-anti2, and the vector structure is shown in figure 2.

2. Transformation of Scenedesmus obliquus

Collecting algae liquid cultured to the terminal stage of exponential growth, centrifuging at 6000rpm, collecting cells, washing Lacquer algae for 3 times with precooled penetrant, resuspending algae cells in 30mL precooled penetrant (0.2 mol/L mannitol), and standing on ice for 1 h; centrifuged at 6000rpm for 10 min, the cells were collected, and the cell count was adjusted to 10 with the permeation buffer⁸Per mL; the mixture was heated at 42 ℃ for 10 min, ice-washed for 5min, 50 ug/mL plasmid DNA and 12.52 mg/mL salmon sperm DNA (final concentration of salmon sperm DNA 25ug/mL) were added along the tube wall, blown gently and spread evenly, and left on ice for 10 min.

And transferring the treated cell mixed solution into a dry precooling electric shock cup, and setting the electric shock condition as 2kv and the pulse time as 3 ms. The transformed algae cells are washed twice with fresh culture solution, and the algae solution is transferred to a test tube with 10 mL of fresh liquid culture medium and cultured in the dark at 22-25 ℃ for 18-24 h.

3. Screening and identification of transformed scenedesmus obliquus

Centrifuging and concentrating the recovered and cultured algae solution, and spreading onto a container containing 10 ug ml^-1And (4) dispersing and growing the resistant algae cells on the glufosinate solid culture plate to obtain the resistant single algae colonies. After about 20 days of culture, single colonies grew on the plates. Picking single algae colony out, and streaking to contain 5ug ml^-1The resistant algal colonies were further purified and resistance enhanced on solid culture plates of sardine bony. After 20 days, picking single algae to fall into the culture solution for continuous culture for about 20 days, centrifuging for 5min at 6000g, collecting algae, wherein the wet weight of each algae is more than or equal to 100mg, and then placing in liquid nitrogen for freezing for later use.

And extracting the total genome DNA of the transgenic scenedesmus obliquus for molecular identification. The integration of the plasmid was first identified by PCR. The upstream primer used in PCR was bar for, the downstream primer was bar rev, the product was the bar gene, and the reaction procedure was as described above. This fragment was amplified in a part of the resistant scenedesmus obliquus genome, and was not found in untransformed scenedesmus obliquus, see FIG. 3.

Then primers are respectively designed and synthesized on the upstream of the 15 'end of the SEQ ID NO and the downstream of the 23' end of the SEQ ID NO, and the sequences of the primers are as follows:

con-F for: 5’-CGATGGATACTAAGTGCTGTC-3’

con-F rev: 5’-CGCTTTCGCTTGGGCTCCGGA-3’

the pair of primers con-F for and con-F rev is amplified to a fragment comprising a homology arm in the total DNA of the wild Scenedesmus obliquus genome, and the length of the fragment is about 2300 bp; in the transgenic scenedesmus obliquus genome total DNA for realizing homogenization, fragments of a homology arm and all gene expression frames are amplified, and the length is about 4300bp.

PCR amplification is carried out by taking the whole genome DNA of the positive transgenic algae as a template and using primers con-F for and con-F rev. The PCR reaction program comprises 94 ℃ for 1min, 59 ℃ for 30 sec, 72 ℃ for 50 sec, 30 cycles and 72 ℃ for 5min extension. The PCR product has two bands, one is 2300 bp and the other is 4300bp (see figure 4) after electrophoretic separation, which indicates that the exogenous gene is inserted into the Scenedesmus obliquus chloroplast genome but the integration is not realized.

The transgenic scenedesmus obliquus sample with positive PCR result is subjected to Southern hybridization identification. Preparing digoxin labeled probe by taking bar, antibacterial peptide 1 and antibacterial peptide 2 gene PCR products as templates, wherein the total DNA of the genome of each sample is not less than 4 ug. The results of hybridization and the like using the Roche digoxigenin-labeled Southern hybridization kit are shown in FIG. 5. This indicates that in the positive mutant, the foreign fragment has been stably inserted into the chloroplast genome.

The Southern hybridization of the transgenic scenedesmus obliquus sample with positive result is continued to be subjected to western hybridization identification. Western blotting the expressed protein was identified by using mouse anti-His IgG and goat anti-mouse IgG conjugated to Horse Radish Peroxidase (HRP). The hybridization results showed that there appeared an approximately 28 kDa band and a 16 kDa band after hybridization, which were consistent with the size of the foreign gene protein, but not in the genome of the untransformed algal strain (see FIG. 6), indicating that the foreign protein had been expressed in the positive algal strain.

The above examples show that the vector of the present invention is used to successfully test the co-expression of two antibacterial peptide genes in Scenedesmus obliquus chloroplasts, and the ability of the vector of the present invention to regulate the expression of exogenous genes in Scenedesmus obliquus chloroplasts is demonstrated, and the expression of various protein genes can be realized, including functional protein genes such as protein genes catalyzing various enzymatic reactions, photosynthesis-related protein genes, structural proteins such as cell membrane protein genes, metal ion binding protein genes, etc., and nutritional proteins such as neuropeptides, antibacterial peptide genes, etc.

Sequence listing

SEQ ID NO:1

5‘-TGCTCGCAAGAGTGAAACTCAAAGGAATTGACGGGGACCCGCACAAGCGGTGGATTATGCGGTTTAATTCGATGATACACGAAGAACCTTACCAGGGATTGACATGCCAGGAACTTTCTAGAGATAGATTGGTGCCTTTTTTAGGAACCTGGACACAGGTGGTGCATGGCTGTCGTCAGCTCGTGCCGTGAGGTGTAGAGTTAAGTCTTCTAACGAGCGCAACCCTTGTCTTTAGTTAAAACCATTTGGAACTCTAAAGAGACTGCCGGTGTAAACCGGAGGAAGGAGAGGATGACGTCAAGTCAGCATGCCCCTTACATCCTGGGCTACACGCGTAATACAATGGCTAAGACAATAGGCAGCGAACCCGCGAGGGGAAGCGAATCTAGCAAACTTAGCCTCAGTTCAGATTGTAGGCTGCAACTCGCCTGCATGAAGCCGGAATCGCTAGTAATCGCCGGTCAGCTATACGGCGGTGAATACGTTCTCGGGTCTTGTACACACCGCCCGTCACATGCTGGAAGCCGATCTGTCCCGAAGACAGGACGTTAACCTAGCCCCTCTGGGGATTGGAGGCTAATGTCAACGGTTGGGTTGGTGACTAATATGAAGTCGTAACAAGGTATCCGTACTGGAAGGTGTGGATGGAGAAATCTTTTTATTCATTTTTCTTTTTTTGCTTTTTTATCTTTTTTTTTTTTAAAGATAAAAAAAAGCAAAAAAAGTGGTTTATATAAATAAACCTAATTTTTATTTTTTCAATTTTATTTGTATGAATTGTTTTTTGAAACAGTCCATACAAATAAAATTGAAATTTAAAATTTTCTCTTCTCCTTTTTTTTTCAAAAAAAGTAGAAAAGAGAATCTTGGAATGTTTTGTTGATTTTTCATTTTTTTTTTCATATATTTTTTTTACTTTTTCTTTTTGAAAAAAAAATTTGAAACAAAAAGTTGAAAATAGAAAAAAAAACATTTATCTTTTTTTAAACTTTTTTTTTAAAGAAAACAATATGGACGGACCATTAGCTCAGTTGGTTAGAGCGCTCGCTTGATAAGCGAGAGGTTCACTGGTTCAAGTCCAGTATGGTCCAGCTTTTTTAA-3’

(a) Sequence characteristics: 16S rDNA-trnI

● length: 1101bp

● type: base sequence

● chain type: single strand

● topology: linearity

(b) Molecular type: DNA

(c) Suppose that: whether or not

(d) Antisense: whether or not

(e) The initial sources were: scenedesmus obliquus chloroplast genome

SEQ ID NO:2

5‘-AGGTAAAAAAGGGAATATAGCTCAGTTGGTAGAGCATTGCCTTTGCAAGGCAAGGGCCAAGGGTTCGAATCCCTTTATTTCCACCCTTTCATTTAAAAACGAATGAAAGTGATCAAAAAAGTTTTTTTTGATTTTGCTTTTACGCTTTTTTTCAAAGAAAAAAAGCAGGAAAGCAAAAAAGTGAAAAAAAACAAAAAAGTTTTTTTATATGTATAAAAAAACTATCAATGTTTGTCAAAAAAAATATTTTTTCTGTTGAATTGATTTTGGTTTTTTATTTTTGTTTATTTTAAAAAAACTTGTTTTAATTGAAATTTTTTCTTTTAAACTTTTTTTTGAAAAAAAGCAAAAGAAAAGTAAAAGCCAAGGATGCAATTTTGCATTTTTTAGGTCAAAGAAACGAAGGCTTACGGTGGAGACCTAGGCACTCAGAGACGATGAAGGGCGCAGATACCGGCGATACGCTTCGGGGAGCTGGTAACAAGCATCGATCCGAAGATCCCCGAATAGGGCAACCTCTTAAAGAACTCCTTTTTGAATTCATAGAAAAGGAAGAGGCAACCCGGTGAACTGAAACATCTCAGTAGCCGGAGGAAAAGAAAGCAAAAGCGATTCCCGGAGTAGCGGCGAGCGAAATGGGAACAGCCTAAACCACTTTCCTTTTGGAAGTGGGGTTGTGGGAATCCAAATAAAAATCAAATGAAAATCAAATGAAAATCAAATGAAAATCAAATGAAAATCAAATGAAAATCAAATGAAAATCAAATGAAAATCAAAAAAGATGAGACGAAGCAGCTGAATCCTGCACCATAGATGGTGAAAGTCCAGTAGTCAAAAACTTTCAAACCTTGGAAAATCCCGAGTAGCATGGGACACGTGGAATCCCGTGTGAATCAGCGAGGACCACCTCGTAAGGCTAAATACTCCTGAGTGACCGATAGTGAAGAAGTACAGCGATGGAAAGGTGAAATAGAACCCCCTGTCGGGGAGTGAAAGAGAACATGAAACCGTAAGCTGACAAGCAGTGGGAGGATAATCTGACCGCGTGCCTGTTGAAGAATGAGCCGGCGA-3’

(a) Sequence characteristics: trnA-23S rDNA

● length: 1071 bp

● type: base sequence

● chain type: single strand

● topology: linearity

(b) Molecular type: DNA

(c) Suppose that: whether or not

(d) Antisense: whether or not

(e) The initial sources were: scenedesmus obliquus chloroplast genome

SEQ ID NO:3

5‘-ATAAAAATTTTAAGTTTCAAATTTTTAGTTTGAAAATACAAATAAATATTTAGTTTCAAAATAAAATTAAAGATTTAATCTGAAAAACACAAACTTTTCATTTTAAATTTTTATACAATTCAAAATTCTATTTAGTTTATTCAATTTTATAAAGTTTTCAAACTTAAAAAAAAATTCAAACAAAAACAATGAAGTTTATAATTTCAAGTGTTAAAGATTTGAAATTTTAAAGATTAATAATTAGAGTTTAAAAAAATATTAATTATTAAATTTATGATTTGAAAACTTAAGTTTAATAAAAACTGAAGTATAAATTCAAATATATAAATAAAAATTTTAAATAATTAAATTTTTAATTCAAATAAAAATATTGAAACCAAATATTAAAAAATAAATTTTTTGGTGATTTATTTATGAATTTTTGATTTTTTTATGTATTCTTTAATAATGTATTTTTGTTTTTATTGAAAAATTTAAAAAAAATTGTGATAAAAAAACATCGAATAATATTTTTTAGACTAAAAATTGACATTTTTGAAATTTATGTTATATTTTTAATTAACAAGAGTTCAATTGAATTCATGAAAAATCTTTTAAAGATTCGGAGAATTTTAAATTTTTATTTTTTTATATT-3’

(a) Sequence characteristics: psbA promoter

● length: 634 bp

● type: base sequence

● chain type: single strand

● topology: linearity

(b) Molecular type: DNA

(c) Suppose that: whether or not

(d) Antisense: whether or not

(e) The initial sources were: scenedesmus obliquus chloroplast genome

SEQ ID NO:4

5‘-ATCAAAAAAAATGTTTTTTTTTGATTTTGTTTTTACAACGCAAAAAAAAAGCAGAATGGACCAAATTTTTCAATTTGAAAAAATCAAAAATTTAAACTGTTTTTAATGAAAATAAAGTATTTTTTTTCCTTCTAAAAAAATTTTTTTTAATGTTCAAAATATAAAACTTTTAGAATTTTTTTTTAAGTTTGAATCTTTTTTGAAAAGATTTTATATTTTGAAACAAGCACTCCAAAAAGTATTTTTTAAAAAATTGAATTTTTCTAAAGAACAATATTTGAAAAAATTATACTTTTTAATTTTCATTTTTTCTAAAAAATAAAATTTCATAAGTATAAATTTCAAATTTTTTTTTTTTTGCTCTTACTTTTTTTGCTTTGCTGCTTTTTATCATTTTTTGCAAAGCAAAAAATGAAGAAGAAAAAAAGCGTAAAAGTGATAAAAAGCAAAAAAGCAAAAGAAGAAAAAAACTTTTAAAAAAATACTTTTTTTATTTTTTAT-3’

(a) Sequence characteristics: atpA promoter

● length: 501 bp

● type: base sequence

● chain type: single strand

● topology: linearity

(b) Molecular type: DNA

(c) Suppose that: whether or not

(d) Antisense: whether or not

(e) The initial sources were: scenedesmus obliquus chloroplast genome

SEQ ID NO:5

5‘-TTTTTTTTTAAAATACTTCCTCTTTAAAGGGGAAGTATTTTTTTCTTGATTTTAGAACTCTAAAAACATAAATTGTTTATTTTTGTTTTTCATTTTCATTTATTTATTGATAAAAACAAAAGAAGCAGCAAAACAAAAAAACAAAAAAAACTAAAAAAATTTGTTTTGTTCATTTCAATAGAATAAAAAAAACAAAATTTTTCAAAAAAATTTATAAAATTATTGTAAGTTTTCAATACAAAAAATTTTTTAAAAATATTTTTTAATATGTTTTTTTTTTTTAAATTGAAAAAAAAATTCAAAACAAAGAATTTTAAAAAATAGAAGAGTTTTTAATTAA-3’

(a) Sequence characteristics: rbcL terminator

● length: 340 bp

● type: base sequence

● chain type: single strand

● topology: linearity

(b) Molecular type: DNA

(c) Suppose that: whether or not

(d) Antisense: whether or not

(e) The initial sources were: scenedesmus obliquus chloroplast genome

SEQ ID NO:6

5’-AAAATTTA-3’

(a) Sequence characteristics: rbs, ribosome binding site

● length: 8 bp

● type: base sequence

● chain type: single strand

● topology: linearity

(b) Molecular type: DNA

(c) Suppose that: whether or not

(d) Antisense: whether or not

(e) The initial sources were: scenedesmus obliquus chloroplast genome.

Sequence listing

<110> institute of tobacco pipe coastal zone of Chinese academy of sciences

<120> Scenedesmus obliquus chloroplast homologous recombination empty vector and application thereof

<160>6

<170>SIPOSequenceListing 1.0

<210>1

<211>1101

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>1

tgctcgcaag agtgaaactc aaaggaattg acggggaccc gcacaagcgg tggattatgc 60

ggtttaattc gatgatacac gaagaacctt accagggatt gacatgccag gaactttcta 120

gagatagatt ggtgcctttt ttaggaacct ggacacaggt ggtgcatggc tgtcgtcagc 180

tcgtgccgtg aggtgtagag ttaagtcttc taacgagcgc aacccttgtc tttagttaaa 240

accatttgga actctaaaga gactgccggt gtaaaccgga ggaaggagag gatgacgtca 300

agtcagcatg ccccttacat cctgggctac acgcgtaata caatggctaa gacaataggc 360

agcgaacccg cgaggggaag cgaatctagc aaacttagcc tcagttcaga ttgtaggctg 420

caactcgcct gcatgaagcc ggaatcgcta gtaatcgccg gtcagctata cggcggtgaa 480

tacgttctcg ggtcttgtac acaccgcccg tcacatgctg gaagccgatc tgtcccgaag 540

acaggacgtt aacctagccc ctctggggat tggaggctaa tgtcaacggt tgggttggtg 600

actaatatga agtcgtaaca aggtatccgt actggaaggt gtggatggag aaatcttttt 660

attcattttt ctttttttgc ttttttatct tttttttttt taaagataaa aaaaagcaaa 720

aaaagtggtt tatataaata aacctaattt ttattttttc aattttattt gtatgaattg 780

ttttttgaaa cagtccatac aaataaaatt gaaatttaaa attttctctt ctcctttttt 840

tttcaaaaaa agtagaaaag agaatcttgg aatgttttgt tgatttttca tttttttttt 900

catatatttt ttttactttt tctttttgaa aaaaaaattt gaaacaaaaa gttgaaaata 960

gaaaaaaaaa catttatctt tttttaaact ttttttttaa agaaaacaat atggacggac1020

cattagctca gttggttaga gcgctcgctt gataagcgag aggttcactg gttcaagtcc1080

agtatggtcc agctttttta a 1101

<210>2

<211>1071

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>2

aggtaaaaaa gggaatatag ctcagttggt agagcattgc ctttgcaagg caagggccaa 60

gggttcgaat ccctttattt ccaccctttc atttaaaaac gaatgaaagt gatcaaaaaa 120

gttttttttg attttgcttt tacgcttttt ttcaaagaaa aaaagcagga aagcaaaaaa 180

gtgaaaaaaa acaaaaaagt ttttttatat gtataaaaaa actatcaatg tttgtcaaaa 240

aaaatatttt ttctgttgaa ttgattttgg ttttttattt ttgtttattt taaaaaaact 300

tgttttaatt gaaatttttt cttttaaact tttttttgaa aaaaagcaaa agaaaagtaa 360

aagccaagga tgcaattttg cattttttag gtcaaagaaa cgaaggctta cggtggagac 420

ctaggcactc agagacgatg aagggcgcag ataccggcga tacgcttcgg ggagctggta 480

acaagcatcg atccgaagat ccccgaatag ggcaacctct taaagaactc ctttttgaat 540

tcatagaaaa ggaagaggca acccggtgaa ctgaaacatc tcagtagccg gaggaaaaga 600

aagcaaaagc gattcccgga gtagcggcga gcgaaatggg aacagcctaa accactttcc 660

ttttggaagt ggggttgtgg gaatccaaat aaaaatcaaa tgaaaatcaa atgaaaatca 720

aatgaaaatc aaatgaaaat caaatgaaaa tcaaatgaaa atcaaatgaa aatcaaaaaa 780

gatgagacga agcagctgaa tcctgcacca tagatggtga aagtccagta gtcaaaaact 840

ttcaaacctt ggaaaatccc gagtagcatg ggacacgtgg aatcccgtgt gaatcagcga 900

ggaccacctc gtaaggctaa atactcctga gtgaccgata gtgaagaagt acagcgatgg 960

aaaggtgaaa tagaaccccc tgtcggggag tgaaagagaa catgaaaccg taagctgaca1020

agcagtggga ggataatctg accgcgtgcc tgttgaagaa tgagccggcg a 1071

<210>3

<211>634

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

ataaaaattt taagtttcaa atttttagtt tgaaaataca aataaatatt tagtttcaaa 60

ataaaattaa agatttaatc tgaaaaacac aaacttttca ttttaaattt ttatacaatt 120

caaaattcta tttagtttat tcaattttat aaagttttca aacttaaaaa aaaattcaaa 180

caaaaacaat gaagtttata atttcaagtg ttaaagattt gaaattttaa agattaataa 240

ttagagttta aaaaaatatt aattattaaa tttatgattt gaaaacttaa gtttaataaa 300

aactgaagta taaattcaaa tatataaata aaaattttaa ataattaaat ttttaattca 360

aataaaaata ttgaaaccaa atattaaaaa ataaattttt tggtgattta tttatgaatt 420

tttgattttt ttatgtattc tttaataatg tatttttgtt tttattgaaa aatttaaaaa 480

aaattgtgat aaaaaaacat cgaataatat tttttagact aaaaattgac atttttgaaa 540

tttatgttat atttttaatt aacaagagtt caattgaatt catgaaaaat cttttaaaga 600

ttcggagaat tttaaatttt tattttttta tatt 634

<210>4

<211>501

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

atcaaaaaaa atgttttttt ttgattttgt ttttacaacg caaaaaaaaa gcagaatgga 60

ccaaattttt caatttgaaa aaatcaaaaa tttaaactgt ttttaatgaa aataaagtat 120

tttttttcct tctaaaaaaa ttttttttaa tgttcaaaat ataaaacttt tagaattttt 180

ttttaagttt gaatcttttt tgaaaagatt ttatattttg aaacaagcac tccaaaaagt 240

attttttaaa aaattgaatt tttctaaaga acaatatttg aaaaaattat actttttaat 300

tttcattttt tctaaaaaat aaaatttcat aagtataaat ttcaaatttt tttttttttg 360

ctcttacttt ttttgctttg ctgcttttta tcattttttg caaagcaaaa aatgaagaag 420

aaaaaaagcg taaaagtgat aaaaagcaaa aaagcaaaag aagaaaaaaa cttttaaaaa 480

aatacttttt ttatttttta t 501

<210>5

<211>340

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>5

ttttttttta aaatacttcc tctttaaagg ggaagtattt ttttcttgat tttagaactc 60

taaaaacata aattgtttat ttttgttttt cattttcatt tatttattga taaaaacaaa 120

agaagcagca aaacaaaaaa acaaaaaaaa ctaaaaaaat ttgttttgtt catttcaata 180

gaataaaaaa aacaaaattt ttcaaaaaaa tttataaaat tattgtaagt tttcaataca 240

aaaaattttt taaaaatatt ttttaatatg tttttttttt ttaaattgaa aaaaaaattc 300

aaaacaaaga attttaaaaa atagaagagt ttttaattaa 340

<210>6

<211>8

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>6

aaaattta 8

Claims

1. A Scenedesmus obliquus chloroplast homologous recombination empty vector is characterized in that: comprises an upstream homologous arm and a downstream homologous arm, a promoter and a terminator are arranged between the homologous arms, and a base sequence shown as SEQ ID NO.6 of a polycistronic structure formed by at least one exogenous gene is inserted between the promoter and the terminator; wherein, the upstream homology arm is a base sequence shown in SEQ ID NO. 1, and the downstream homology arm is a base sequence shown in SEQ ID NO. 2;

a selection marker gene is inserted between the homology arms.

2. The Scenedesmus obliquus chloroplast homologous recombinant empty vector of claim 1, wherein: at least one promoter and a terminator are inserted between the upstream homology arm and the downstream homology arm.

3. The Scenedesmus obliquus chloroplast homologous recombinant empty vector according to claim 1 or 2, characterized in that: the recombinant empty vector sequentially comprises an upstream homology arm, at least one promoter, a selective marker gene, a base sequence shown in SEQ ID NO.6 forming a polycistronic structure with at least one exogenous gene, a terminator and a downstream homology arm.

4. The Scenedesmus obliquus chloroplast homologous recombinant empty vector of claim 3, wherein: the promoter is used for regulating and controlling exogenous genes; or the promoter is a promoter for regulating and controlling the exogenous gene and a promoter for regulating and controlling the selective marker gene; wherein the promoter is a base sequence shown by SEQ ID NO. 3 and/or a base sequence shown by SEQ ID NO. 4.

5. The Scenedesmus obliquus chloroplast homologous recombinant empty vector of claim 3, wherein: the terminator is a terminator for regulating and controlling an exogenous gene; or, the terminator is a terminator for regulating the exogenous gene and a terminator for regulating the selective marker gene; wherein the terminator is a base sequence represented by the base sequence represented by SEQ ID NO. 5.

6. The use of the Scenedesmus obliquus chloroplast homologous recombination empty vector of claim 1 in Scenedesmus obliquus chloroplast transformation.

7. Use according to claim 6, characterized in that: and introducing exogenous genes into the homologous recombinant empty vector, then introducing the exogenous genes into scenedesmus obliquus cells, and culturing and screening to obtain transgenic scenedesmus obliquus.