LU101834A1

LU101834A1 - A chloroplast homologous recombinant empty vector of Dunaliella salina and its application

Info

Publication number: LU101834A1
Application number: LU101834A
Authority: LU
Inventors: Yulin Cui; Bin Lin; Song Qin; Jinling Chu; Xudong Jiao
Original assignee: Yantai Inst Coastal Zone Res Cas
Priority date: 2019-02-20
Filing date: 2019-06-19
Publication date: 2020-08-20
Also published as: LU101834B1; CN109536525A; WO2020168659A1; CN109536525B

Abstract

The invention relates to genetic engineering technology, in particular to a homologous recombination empty vector of D. salina chloroplast and its application. The vector includes a promoter and a terminator. The recombinant empty vector contains an upstream homology arm of the base sequence shown in SEQ ID NO: 1 and a downstream homology arm of the base sequence shown in SEQ ID NO: 2. The nucleotide sequence shown in SEQ ID NO: which forms a polycistronic structure with at least one exogenous gene is interposed. By adopting the Dunaliella salina chloroplast stable expression system of the present invention, multiple foreign genes can be stably expressed in the chloroplast.

Description

A chloroplast homologous recombinant empty vector of Dunaliella salina and its u101834 application Technology The invention relates to genetic engineering technology, in particular to a chloroplast homologous recombinant empty vector of Dunaliella salina and its application.

Background In eukaryotic microalgae for photosynthesis, DNA exists in the nucleus, chloroplast and mitochondria, which constitutes an independent and interconnected genetic system. Since the birth of genetic engineering technology, exogenous gene transformation technology targeting the nucleus has been widely used. However, with the development of research, it has been found that nuclear genome genetic engineering has difficulties to overcome: 1) The efficiency of foreign gene insertion into nuclear genome is low, and random insertion leads to great variability between different clones, so extensive screening is needed; 2) The structure and function of nuclear genome is complex, and the insertion of foreign gene sometimes causes variation of other characters; 3) The expression efficiency of foreign gene is low, and the expression is unstable; 4) The safety and stability are not high, and the foreign gene is easy to spread. These problems seriously restrict the application of foreign gene transformation technology.

In 1988, Boynton and colleagues used Chlamydomonas for the first time to achieve chloroplast transformation through the biolistic method, which makes people realize that chloroplasts can be used as new transformation expression receptors in genetic engineering. Chloroplast transformation utilizes the mechanism of DNA homologous recombination, adding the homologous sequence of the chloroplastgenome of the recipient cell to the two flanks of the foreign gene, inserting the foreign 101834 DNA between the functional genes of the chloroplast, thereby more precisely controlling the insertion of the foreign gene. In higher plants (such as tobacco), chloroplast transformation has been widely used. Compared with the nuclear transformation system, the chloroplast transformation system has many advantages: 1) targeted integration of foreign genes; 2) no gene silencing; 3) higher expression efficiency of foreign genes; and 4) less variation.

Dunaliella salina is a halophilic green microalga that belongs to Chlorophyta, Chlorophyceae, and Halophila in taxonomy. It can reduce the concentration of sodium chloride by regulating the metabolism of glycerol in the cell. Under appropriate stress conditions, D. salina strain can accumulate B-carotene content, making the B-carotene content account for more than 10% of the total dry organic matter weight; as well, it also contains a lot of minerals such as protein, polysaccharide, Ca, P, Zn, etc., showing that the algae strain has certain application value. At present, the genome of the D. salina chloroplast genome has been sequenced, which provides a sufficient basis for the genetic modification of the D. salina chloroplast. But up to now, the research of D. salina chloroplast transformation has just started, lacking efficient and stable chloroplast insertion sites and endogenous high-efficiency regulatory sequences, which restricts the basic research and application development of the algae.

Summary of the invention The purpose of the present invention is to provide a chloroplast homologous recombination empty vector of D. salina and its application.

The technical solutions adopted by the present invention were: An empty vector for chloroplast homologous recombination of D. salina includes promoters and terminators. The recombinant empty vector contains an upstream homology arm of the base sequence shown in SEQ ID NO: 1 and a downstream homology arm of the base sequence shown in SEQ ID NO: 2. The base sequenceshown in SEQ ID NO: 5 that forms a polycistronic structure with at least one foreign u101834 gene is inserted between the homology arms.

A selectable marker gene was inserted between the homology arms.

At least one promoter and one terminator were inserted between the upstream homology arm and the downstream homology arm; wherein, the terminator is a prokaryotic terminator of chloroplast.

The recombinant empty vector sequentially contains an upstream homology arm, at least one promoter, a selection marker gene, a base sequence shown in SEQ ID NO: 5 that forms a polycistronic structure with at least one foreign gene, a terminator, and a downstream homology arm.

The promoter is a promoter that regulates foreign genes; Or, the promoter is a promoter that regulates a foreign gene and a promoter that regulates a selectable marker gene; wherein, the promoter is the base sequence shown in SEQ ID NO: 3 and/or the base shown in SEQ ID NO: 4 sequence. The nucleotide sequence shown in SEQ ID NO: 3 and/or the nucleotide sequence shown in SEQ ID NO: 4 can regulate the foreign gene or the selectable marker gene, respectively.

The upstream homology arm is the base sequence shown in the sequence shown in SEQ ID NO: 1; or, the sequence shown in SEQ ID NO: 1 starts at the 3 'end and extends to a 5' end to a continuous fragment of not less than 500 bp; The downstream homology arm is the base sequence shown in the sequence shown in SEQ ID NO: 2; or, the sequence shown in SEQ ID NO: 2 starts at the 5 'end and extends to the 3' end to a continuous fragment of not less than 500 bp; The promoter is the base sequence shown in the sequence of the sequence shown in SEQ ID NO: 3; or, the sequence shown in SEQ ID NO: 3 starts at the 5 'end and extends toward the 3' end to a continuous fragment of not less than 800 bp; The promoter is the base sequence shown in the sequence of the sequence shown in SEQ ID NO: 4; or, the sequence shown in SEQ ID NO: 4 starts at the 5 'end and extends toward the 3' end to a continuous fragment of not less than 510 bp; The linking sequence is the base sequence shown in the sequence of the sequenceshown in SEQ ID NO: 5; or, the sequence shown in SEQ ID NO: 5 starts at the 5 'end 101834 and extends to the 3' end to a continuous fragment of not less than 15 bp; The selectable marker gene is the bar gene of glufosinate resistance gene.

The application of an empty vector of D. salina chloroplast homologous recombination, the application of the vector in chloroplast transformation of D. salina .

The foreign gene is introduced into the constructed homologous recombination empty vector and then into D. salina cells, and the transgenic D. salina is obtained through culture selection The foreign genes are functional protein genes, structural protein genes and nutritional protein genes, etc.; among them, functional protein genes such as fatty acid synthesis protein genes, photosynthesis related protein genes, etc., structural protein genes such as cell membrane protein genes calmodulin genes, metal ion binding protein genes, etc.

The advantages of the present invention: The invention successfully constructed a chloroplast stable expression system of D. salina. The invention can effectively recombine multiple foreign genes into the chloroplast genome of D. salina and obtain transgenic algae strains through screening. Compared with the prior art, the present invention achieves a key breakthrough of D.

salina genetic engineering technology and has the following beneficial effects:

1. The present invention provides a chloroplast genome homologous recombination site for D. salina chloroplast transformation.

2. The present invention provides an endogenous sequence of D. salina chloroplasts in which multiple exogenous genes are connected in series.

3. The present invention provides an efficient endogenous regulatory sequence of D. salina.

Figure legends

Fig. 1. Map of pMD-BKT-CRTR plasmid provided by an example of the 101834 invention.

Fig. 2. Electrophoresis diagram of PCR products provided by an embodiment of the present invention (where M is a molecular marker DL2000; lane wt is a wild strain; 5 lane bar is a positive transgenic algae strain).

Fig. 3. Electrophoresis diagram of PCR products provided by an embodiment of the present invention (where M is a molecular marker DL5000; lane wt is a wild strain; lane tf is a positive transgenic algal strain).

Fig. 4. Southern hybridization diagram of transgenic D. salina provided by the embodiment of the present invention (where the lane wt is a wild strain; the lane tf is a positive transgenic algae strain), 1) the result of the hybridization of the genome by Xhol and EcoRI double enzyme digestion; 2) the hybridization result of double digestion of BamHI and HindIII.

Fig. 5. Western hybridization diagram of transgenic D. salina provided by the embodiment of the present invention (where lane wt is a wild strain; lane tf is a positive transgenic algae strain).

Implementation method The present invention will be further described below with reference to the drawings and embodiments.

Example 1: Cloning of the homologous recombination fragment of D. salina chloroplast Two primer pairs were designed and synthesized: P1: 5”-TTACCAGGGTTTGACATGTCTAGAA-3” P2: 5’-TGGGCTATAGAAGATTTGAAC-3” P3: 5’-GGGAATGTAGCTCAGTTGGTAGAGC-3’ P4: 5’-TTCAGCTGTTTCGTTTTTAGAAAACT-3’ The amplification products of primers Pl and P2 are SEQ ID NO: 1, namelyfragment 16S-TrnA; the amplification products of primers P3 and P4 are SEQ ID NO: (101836 2, namely fragment TrnI-23S (Fig. 1). Using genomic DNA of D. salina as template, PCR amplification was performed with primers PI and P2. The reaction procedure was: 94 °C, 10min pre-denaturation; 94 °C Imin, 60 °C 90s, 72 °C 90s, a total of 30 cycles; 72 °C Smin extension. The PCR amplification product is about 901bp, which is the fragment 16S-trnl. After the fragment is electrophoresed on agarose gel, the PCR product purified by gel recovery kit (Tiangen company) is connected to pMD-18T vector (Sigma company) To obtain the recombinant plasmid pMD16I containing the fragment 16S-trnl.

Using the genomic DNA of D. salina as template, PCR amplification was carried out with primers P3 and P4. The reaction procedure was: 94 °C 10min pre-denaturation; 94 °C 1min, 60 °C 90s, 72 °C 90s, 30 cycles in total; 72 °C 5min extend. The PCR amplification product is about 731bp, which is the fragment trnA-23S. After the fragment was electrophoresed on agarose gel, the PCR product purified by gel recovery kit (Tiangen company) was connected to pMD-18T vector (Sigma company) to obtain the recombinant plasmid pMD23A containing the fragment tmA-23S.

Example 2: Amplification and cloning of two chloroplast promoter fragments of D. salina Two primer pairs were designed and synthesized: PS: 5’-ATCCGCGTAGAGTAATAGG-3” P6: 5’-GAGCACCATTTTTACTTCTGGTGTA-3’ P7: 5’-GGATCCGCCGATCCGTGGTTTAGAGTT-3° P8: 5’”-ACGTGCCCAAAGGCTAGTATTT-3° The amplification product of primers P5 and P6 was SEQ ID NO: 3, that is, fragment S'atpA, which is a promoter with chloroplast initiation function derived from the chloroplast of D. salina; the amplification product of primers P7 and P8 was SEQ ID NO: 4, the fragment S'psbA, is a promoter with chloroplast promoter function derived from D. salina chloroplast (Fig. 2).

; Using the genomic DNA of D. salina as template, PCR amplification was Hoes performed with primers P5 and P6. The reaction procedure was: 94 °C 10min pre-denaturation; 94 °C 1min, 60 °C 90s, 72 °C 90s, a total of 30 cycles; 72 °C 5min extend. The PCR amplification product was about 943bp, which is the fragment S'atpA. After the fragment was electrophoresed on agarose gel, the PCR product purified by gel recovery kit (Tiangen company) was connected to pMD-18T vector (Sigma) to obtain the recombinant plasmid pMDatpA containing fragment 5'atpA.

Using the genomic DNA of D. salina as template, PCR amplification was performed with primers P7 and P8. The reaction procedure was: 94 °C 10min pre-denaturation; 94 °C Imin, 60 °C 90s, 72 °C 90s, 30 cycles in total; 72 °C Smin extend. The PCR amplification product was about 511bp, which is the fragment 5'psbA. After the fragment was electrophoresed on agarose gel, the PCR product purified by gel recovery kit (Tiangen company) was connected to the pMD-18T vector (Sigma company) to obtain the recombinant plasmid pMDpsbA containing fragment 5'psbA.

Example 3: Construction of an empty vector of chloroplast homologous recombination for D. salina Based on the above cloning vectors pMD161, pMD23A, pMDatpA, pMDpsbA, the homologous recombination vector of D. salina chloroplast was constructed by homologous recombination method.

Six primer pairs were designed and synthesized: P9: tagcctttgggcacgt ATGAGCCCAGAACGACGCC P10: ctgagctacaticcc TCATCAAATCTCGGTGACGGG P15: tgctcctegagCTGCTTGTGAAGTTTGGAAAGAAA P16: tectectegagCTGCTTGTGAAGTTTGGAAAGAAA P17: catgattac gaattcggatccTTACCAGGGTTTGACATGTCTAGAA P18: gcggatTGGGCTATAGAAGATTTGAAC P19: gatgaGGGAATGTAGCTCAGTTGGTAGAGC P20: acgacggccagtgecaagett TTCAGCTGTTTCGTTTTTAGAAAACT

P21: tatageccaATCCGCGTAGAGTAATAGG 101834 P22: aagcagctcgagGAGCACCATTTTTACTTCTGGTGTA P23: tatgaccatgattacgaattcGGATCCGCCGATCCGTGGTTTAGAGTT P24: tcatACGTGCCCAAAGGCTAGTATTT The amplification product of primers P9 and P10 was the fragment bar, which is the glufosinate resistance gene; the amplification product of primers P15 and P16 was the fragment rbcL, which is a terminator with chloroplast termination function derived from the chloroplast of D. salina; the amplification product of primers P17 and P18 was upstream of fragment 16S-TrnA; The amplification product of primers P19 and P20 was downstream of fragment Trnl-23S; the amplification product of primers P21 and P22 was fragment 5'atpA; the amplification product of primers P23 and P24 was the fragment 5'psbA.

Using plasmid PSVB (Cui Yulin, Jiang Peng, Wang Jinfeng, Li Fuchao, Chen Yingjie, Zheng Guoting, Qin Song. 2012. Chinese Journal of Oceanology and Limnology, 30 (3): 471-475.) as template, via primers P9 and P10 PCR amplification was performed with P10. The reaction procedure was: 94 °C 10min pre-denaturation; 94 °C 1min, 60 °C 90s, 72 °C 90s, a total of 30 cycles; 72 °C 5min extension. The PCR amplification product was about 570 bp. After the fragment was electrophoresed on agarose gel, the purified PCR product is obtained by gel recovery kit (Tiangen company), which is the fragment bar.

Using the genomic DNA of D. salina as template, PCR amplification was carried out with primers P15 and P16. The reaction procedure was: 94 °C 10min pre-denaturation; 94 °C 1min, 60 °C 90s, 72 °C 90s, a total of 30 cycles; 72 °C Smin extend. The PCR amplification product was about 272 bp. After the fragment was electrophoresed on agarose gel, the purified PCR product was obtained by gel recovery kit (Tiangen company), which is the fragment rbcL.

Using the plasmid pMD16I as template, PCR amplification was performed with primers P17 and P18. The reaction procedure was: 94 °C 10min pre-denaturation; 94 °C 1min, 60 °C 90s, 72 °C 90s, 30 cycles in total; 72 °C 5min extension. The PCRamplification product was about 901 bp. After the fragment was electrophoresed on u101834 agarose gel, the purified PCR product was obtained by gel recovery kit (Tiangen company), which is the fragment 16S-TrnA.

Using the plasmid pMD23A as template, PCR amplification was performed with primers P19 and P20. The reaction procedure was: 94 °C 10min pre-denaturation; 94 °C 1min, 60 °C 90s, 72 °C 90s, a total of 30 cycles; 72 °C Smin extension. The PCR amplification product was about 731 bp. After the fragment was electrophoresed on agarose gel, the purified PCR product is obtained by gel recovery kit (Tiangen company), which is the fragment Trnl-23S. Using the plasmid pMDatpA as template, PCR amplification was performed with primers P21 and P22. The reaction procedure was: 94 °C 10min pre-denaturation; 94 °C 1min, 60 °C 90s, 72 °C 90s, a total of 30 cycles; 72 °C 5min extension. The PCR amplification product was about 943 bp. After the fragment was electrophoresed on agarose gel, the purified PCR product was obtained by gel recovery kit (Tiangen company), which is the fragment S'atpA.

Using the plasmid pMDpsbA as template, PCR amplification was performed with primers P23 and P24. The reaction program was: 94 °C 10min pre-denaturation; 94 °C 1min, 60 °C 90s, 72 °C 90s, 30 cycles in total; 72 °C 5min extension. The PCR amplification product was about 511 bp. After the fragment was electrophoresed on agarose gel, the purified PCR product was obtained by gel recovery kit (Tiangen company), which is the fragment S'psbA.

The pMD-18T vector was digested with EcoRI and Hindlll, and ligated with the obtained S'psdA, bar, 16S-TrnA to obtain a recombinant plasmid pPBI containing promoter, glufosinate resistance gene, and homology arm genes. The above-obtained recombinant plasmid pPBI was digested with BamHI, and then digested and ligated with the obtained tmA-23S, S'atpA, rbcL to obtain a recombinant plasmid pSARPBI containing promoters, homology arms, and glufosinate resistance gene.

Insert the base sequence shown in SEQ ID NO: 5 capable of forming a polycistronic structure with at least one foreign gene on this vector pSARPBI to

| 10 obtain a recombinant empty vector; One or more exogenous genes can be expressed u101834 after introduction into D. salina chloroplast. Among them, the base sequence shown in SEQ ID NO: 5 was inserted into the vector through the introduced foreign gene; for | example, adding sequence 5 between two foreign genes to form a polycistronic structure can realize co-expression of the multiple foreign genes.

In addition, the selective resistance gene in the recombinant empty vector may be inserted in the manner described in the above embodiment, or may be inserted when inserting the foreign gene.

Example 4 The application of the vector obtained in the chloroplast transformation of D. salina according to the above examples; the two key genes for the synthesis of astaxanthin in Haematococcus pluvialis are used as foreign genes, and they are inserted into this vector into D. salina.

Expression of key genes for astaxanthin synthesis in the chloroplast of D. salina.

1. Construction of vector Two primer pairs were designed and synthesized: P11: gtaaaaatggtgctcctcgagATGCATCATCACCATCACCACGTCGCATCGGC

ACTAA P12: tgatggtgatgatgcalTAAATTTCCCTCCCITCATGCCAAGGCAGGCAC the italics in the frame are the sequence shown in SEQ ID No: 5) P13: atgcatcatcaccatcaccatCTGTCGAAGCTGCAGTCAATCA P14: aaacttcacaagcagctegagCTACCGCTTGGACCAGTCCA The amplification product of primers P11 and P12 was the fragment bkt, which is the exogenous gene B-carotene ketolase; the amplification product of primers P13 and P14 was the fragment crtr-b, which is the exogenous gene -carotene hydroxylase.

Using the H. pluvialis genome as template, PCR amplification was performed with primers P11 and P12. The reaction procedure was: 94 °C 10min pre-denaturation; 94 °C 1min, 60 °C 90s, 72 °C 90s, 30 cycles in total; 72 °C 5min extend. The PCR amplification product was about 978bp. After the fragment was electrophoresed onagarose gel, the purified PCR product was obtained by gel recovery kit (Tiangen (1101884 company), which is the fragment bkt. Using H. pluvialis genome as template, PCR amplification was carried out with primers P13 and P14. The reaction procedure was: 94 °C 10min pre-denaturation; 94 °C 1min, 60 °C 90s, 72 °C 90s, 30 cycles in total; 72 °C 5min extend. The PCR amplification product was about 900 bp. After the fragment was electrophoresed on agarose gel, the purified PCR product was obtained by gel recovery kit (Tiangen company), which is the fragment crtr-b. After the chloroplast homologous recombination empty vector pSARPBI was digested with Xhol, and ligated with the obtained bkt and crtr-b, the D. salina chloroplast expression vector pMD-BKT-CRTR was obtained (Fig. 1).

2. Transformation of D. salina Before transformation, the D. salina at a concentration of approximately 5.0 x 10° cell mL" in the logarithmic growth phase was centrifuged at 6000 g for 5 min, the supernatant was discarded, and the concentration was adjusted to 1 x 10° cell mL" with the salt algae culture solution. Then take 0.2 mL of algae fluid and apply it to the center of the solid culture plate, forming a circle with a diameter of about 3 cm. The coated flat plate is placed in the ultra-clean workbench for use. Preparation of microparticle: Add 50 pL gold powder suspension (about 3mg gold powder) while vortexing and add 5 pL plasmid pMD-BKT-CRTR (plasmid concentration>= 1ug pL), 50 pL 2.5M CaCI2, 20 pL 0.1M Spermidine. Then continue to vortex for 3 min. Centrifuge for 5-6s and discard the supernatant. Then wash with 250 pL absolute ethanol twice, and finally resuspend with 60 pL absolute ethanol. Such a tube of particle-coated particles can be used for 5-6 bombardments. Under aseptic conditions (in a clean bench), bombard with a high-pressure helium-type gene gun. After the bombardment, the algae cells were cultured on a solid culture plate in the dark for 8 hours, and then transferred to the saline algae culture medium to continue culturing for 40 hours to restore the cell growth state.

3. Screening and identification of D. salina u101834 The D. salina cells after the recovery culture were transferred to the selective culture medium to kill the untransformed algal cells. The selective culture medium was the salt algae culture medium containing 15pg mL” glufosinate. After 15 days, the culture solution was centrifuged at 6000 g for 5 min, and the supernatant was discarded. The collected algae body was spread on the solid culture plate containing 15ug m L glufosinate, so that the resistant algae cells could grow dispersedly to obtain resistant single algae colonies. After about 20 days of cultivation, single algae | colonies grew on the plate. Then, single algae were picked out and streaked onto a solid culture plate containing 5 pg m L of chlorpyrifos to further purify the resistant algae and enhance resistance. After 20 days, single algae were picked and dropped into the culture liquid to continue culturing for about 20 days. Centrifuge at 6000g for 5 minutes to collect algae bodies (weight > = 100mg), and then placed in liquid nitrogen for freezing.

Extract the total genomic DNA of transgenic D. salina for molecular identification. First use PCR to identify the integration of the plasmid. The upstream primer used in PCR is bar for, the downstream primer is bar rev, and the product is the bar gene. 94 °C 1min, 60 °C 90s, 72 °C 90s, a total of 30 cycles; 72 °C 5min extension. The PCR product is about 570bp (Fig. 2). This fragment was amplified in a part of the resistant D. salina genome and was not found in the untransformed D. salina.

Then design and synthesize primers near the 3 'end of SEQ ID NO: 1 and near the 5' end of SEQ ID NO: 2 respectively. The primer sequences are as follows: con-16s for: TTACCAGGGTTTGACATGTCTAGAA; con-23s rev: TTCAGCTGTTTCGTTTTTAGAAAACT, The primers con-16s for and con-23s rev were amplified in the wild-type D. salina genome DNA to include 16S-23S fragments, about 1630bp in length; The fragment amplified to 16S-TrmA-atpA-bkt-crtr-b-rbcL-psbA-bar-Trl-23S is about 5800bp in length.

Using the genomic DNA of positive transgenic algae as template, PCRamplification was performed with primers con-16s for and con-23s-rev. The PCR u101834 reaction program is: 94 °C 1min, 60 °C 90s, 72 °C 90s, a total of 30 cycles; 72 °C Smin extension. The PCR product has two bands separated by electrophoresis, one is about 1630 bp, and the other is 5800 bp (Fig. 3). The longer band indicates that the bar gene and the two foreign genes have been inserted into the D. salina chloroplast genome by homologous recombination, and the insertion site is the space between the fragments SEQ ID NO: 1 and SEQ ID NO: 2 position.

Transgenic D. salina with positive PCR results was identified by Southern hybridization. Genomic DNA (4 pg) was first subjected to random double digestion, a total of two groups: Xhol and EcoRI double digestion, 37°C 2h; BamHI and HindIII double digestion, 37°C 2h. The Southern hybridization probe is derived from a segment within the genes of the digoxin-labeled plasmid pMD-BKT-CRTR bar, bkt, and crtr-b. The results of hybridization showed that a part of the genome of the glufosinate-resistant algae strain showed a band of 1300 bp and a band of 1000 bp after bar hybridization, and a band of 1800 bp and a band of 4000 bp appeared after bkt hybridization, crtr-b After the hybridization, a band of 1800 bp and a band of 4000 bp appeared, which was the same size as the band after plasmid digestion, but there was no such band in the genome of the untransformed algae strain (Fig. 4), indicating that the plasmid pMD-BKT-CRTR has been integrated into the chloroplast genome in some positive algal strains.

The transgenic D. salina samples with positive PCR results should continue to be identified by Western hybridization. Western blotting uses mouse anti-His IgG and goat anti-mouse IgG to bind horseradish peroxidase (HRP) to identify expressed proteins. The results of the hybridization showed that after the hybridization, a band 0f 39.85 kDa and a band of 32.85 kDa appeared, which was consistent with the size of the foreign gene protein, but this band was not found in the genome of the untransformed algal strain (Fig. 5). This indicates that in some positive algal strains, foreign proteins have been expressed.

The above examples show that the two key genes for astaxanthin synthesis are

. . lu101834 successfully expressed in the chloroplast of D. salina using the vector of the present invention, demonstrating the ability of the vector of the invention to regulate the expression of foreign genes in the chloroplast of D. salina, which can achieve the expression of various protein genes.

At well, the above characteristics can also be achieved by replacing the foreign gene by the following functional protein gene, structural protein gene and nutritional protein gene. The functional protein gene such as fatty acid synthesis protein gene, photosynthesis related protein gene, etc, structural protein gene (such as cell membrane protein gene and calmodulin gene), metal ion binding protein gene, etc., nutrient protein gene (such as neuropeptide gene). List of Sequences SEQ ID NO:1

TTACCAGGGTTTGACATGTCTAGAATTTTTCAGAAATGGAAAAGTGCTTCC TTTTTATGAAAGGAAGAACTAGAACACAGGTGGTGCATGGCTGTCGTCAG CTCGTGCGTTGACGTGTATGGTTAAGTCCTGCAACGAGCGCAACCCTCGTC TTTAGTTACTTTCCAAGTTCTCTAAAGAGACTGCGCGCGCAAGCGCTGAGG AAGGTGAGGATGACGTCAAGTCAGCATGCCCCTTACACCCTGGGCGACAC GCGTAATACAATGGTTGGGACAATCAGAAGCTACCCCGTAAGGGCACGCC AATCTGCTAAACTCAACCCTAGTTCGGATTGTAGGCTGCAACTCGCCTACA TGAAGCCGGAATCTATAGTAATCGCCAGTCAGCTATATGGCGGTGAATAC GTTCCTGGTCTCTGTACACACCGCCCGTCACATCAAGAAAGGTGGTAGTG GATTAAGCTACTAGTAACCTCTCTGAGGAAGACGGTATCCACTCCAAGAC TACTGATCATGATGAAGTCGTAACAAGGTAGGGGTACTGGAAGGTGTCCC TGGATCACCTCCTTCTTTTTAGGAATTTTCTATCTGACCCTCCTACCAGGAG ACTAGGACCTTTGGTCCTAGCCTCACGGTAAACCCAAAGGGTTTAGGCTT ACCTTCTCGTGAGGGGAGCTGACGCGTTAGATGGAAAAATAAAAGTTTTT CCATCTATAAAGCGTAATGAGATAGAATCAATAAAATTATTTAAAAGGTG ACCTTAACCGAACGTAAATTTACGTTCGGTTAAGGTCACCCTTATATATTC TTATCCAAAAGAATTTTAATGGGCTATTAGCTCAGTTGGTTAGAGCGCACC

CCTGATAAGGGTGAGGTCAGAAGTTCAAATCTTCTATAGCCCA SEQ ID NO:2

GGGAATGTAGCTCAGTTGGTAGAGCATCGCATTTGCATTGCGAGGGTCGC GGGTTCGAAACCTGTCATTTCCACAATTATGAATTGAAAGTTAAAAAAAG GAGATAAATTTTATCTCCTTTTTTAGCGATTTTAAAAAGAAAAAAAAATAA ATAAAAGAAACAAGAAACAAAAATTATAGGTCAAATGAACTTAGGCTTA

CGGTGGAGACCTAGGCACCCAGAGACGAAGAAGGGCGCAGATACCGGCG 40 AAACGCTCCGGGGAGTTGGCAACAAACTTTGATCCGGAGATCCCCGAATA

GGGCAACCTGTACAACTTCCAACAGAATTCATAAGTTGGAAAGAGGCAAC CCAGTGAATTGAAACATCTTAGTAGCTGGAGGAAAAGAAAGCAAACGCG

ATTCCCGTAGTAGCGGCGAGCGAACCGGGAACAGCCTAAACCCATTTCCA lu101834

TTAGGGAATGGGGGTAGTGGGAAGACATTATAATTATAAAAAAAATAGA AAATAAGAGAAATTATCGAATAAAATTCTTTTACGAGGCGCCCGCAGACA TCGTCGAGGACGACGAGTCTAGGTCGCCTCGTAGAGCTCGCCTCGCAGAG GCGACCTACAGAATTTTATTCGAGAATTCTCGAAGATTTTCAATATCCATA GGATATTGAAAACTTCGATAATTTATAATCTTTGTTTATAGATTTATTCTCT

TTTAGAGTTTTCTAAAAACGAAACAGCTGAA SEQ ID NO:3

ATCCGCGTAGAGTAATAGGAGAATGTTTTTTGGTATCCAATTATAAATTGA TTTTTTATATTTTTTATAATATAGTTATATTTATAGGCAATAACTAAAAAAC CAAATAAAATTTTCTTAAATAAAAATTTTCTCCTTAATTGAAATGAAAAGT TCGTATATAAGGGAATGAATAATAACTTTTGTTAAAGTTATTAACAAAAT AACAAATAGGTGCGTCCGTTAAAAAAAAAAAAAATTTAGCGGAAAAAAA CAAAGCGGAAAAAACAAAGCGGAAAAAACAAAGCGGAAAAAAAAAAGT TTTTTTCCTTAGAAACAACTTTAGTTAATATCGAAGTTTTCAATATCCTTTA GGATATTGAAAATCTTATAGATTTCTATAAGAAAATTCTAATAGAGAAGA AAATTTACGAAGTAAATTTTCTATTTTCTTCGATAAATTCTGAAAGAGAAG AAAATTTACTTTGTAAATGTTCTATTTTCTTCCGAAAATTTTTTTCGCGGAA AAAACAAAAGAAAAATTTITTTTACGAAAAAAATTTTCCCGGACAAAACT TTGTTTTGTCCTAAGGAAAAAACAACAAAGAAAATTCTGAAAGAATTTTC TTTGTTGTTITGTCCGGCATAAAAAAATTTTCTITGTGGTTTTGTCCTAGGA AAACCCGTCCCCAAGGCGGGTCCGTTCGTCCGGCGTGAGGAGGGGGGCAC CTTTGGTTTTTTCCGCTGATGGTTTGTGTACGAGGTCAGCTTCCATGGGCG GGGCGGCTGTTTGCGATGCTCTTACGGGCTTAACACATGTATCTTGTATAG ACCTATTTGTTTGTATCATTTATCTTAAAAGAACAAAAAAAAAATTTTTAT GGCAATGCGCACACCAGAAGAATTAAGTAATCTAATTAAAGATTTAATTG

AAGAATATACACCAGAAGTAAAAATGGTGCTC SEQID NO:4

GCCGATCCGTGGTTTAGAGTTTCCCATAAGACAAATCTGTACCTACATACG AATTAGAATATTTAAATTTTTATGACTTATATTGCCAACAATGATGTTCAT AAAATTATATAGTACAGACTAAATAAAATTTTTTCTTTTTTAGCGGAAAAA ACAACAAATAAATTTTTTTTTCCGGACAAAACGTTGTTTTGTCCTAAGAAA AAAACCGAAGGTGCTCCCCCCACGCGACGGACGTAGTCCTAGCCCTTAGG GGTTTCCGCTAAAGTTGTTTTGTCCGTTACACAATTTTAAAATTATTTAAA AGTTGTTGTTTATAAAAAAGATGCTCTTGCTTTTGAAAAATTATCTGGTAT TATAATAATACCAGGTTTTAATGAAAAAGCTTGAATAATATAAAAAATAA

AAAAGTTAAAAAACTTTTTTTCGGAGAAAATCAAAAATTAATAAAAAATT 40 ACAAATT

ATGACAGCAATTTTAGAACGTCGTGAAAATACTAGCCTTTGGGCACGT SEQ ID NO:5

AGGGAGGGAAATTTA

Claims

Claims lu101834

1. An empty vector for chloroplast homologous recombination of D. salina, including promoters and terminators, characterized in that the recombinant empty vector contains the upstream homology arm of the base sequence shown in SEQ ID | NO: 1 and SEQ ID NO: 2 in the downstream homology arm of the shown base sequence, the base sequence shown in SEQ ID NO: 5 which forms a polycistronic structure with at least one foreign gene is inserted between the homology arms.

2. The empty vector of D. salina chloroplast homologous recombination according to claim 1, characterized in that a selection marker gene is inserted between the homology arms.

3. The chloroplast homologous recombination empty vector of D. salina according to claim 1 or 2, characterized in that at least one promoter and one terminator are inserted between the upstream homology arm and the downstream homology arm; wherein, the terminator It is a terminator of chloroplast pronuclear nature.

4. The chloroplast homologous recombination empty vector of D. salina according to claim 3, characterized in that: the recombinant empty vector comprises upstream homology arms, at least one promoter, a selection marker gene, and at least one foreign gene, the base sequence shown in SEQ ID NO: 5 constituting the polycistronic structure, terminator, and downstream homology arm.

5. The empty vector for chloroplast homologous recombination of D. salina according to claim 4, characterized in that the promoter is a promoter that regulates foreign genes; Or, the promoter is a promoter that regulates a foreign gene and a promoter that regulates a selectable marker gene; wherein, the promoter is the base sequence shown in SEQ ID NO: 3 and/or the base shown in SEQ ID NO: 4 sequence.

6. The empty vector for chloroplast homologous recombination of D. salina according to claim 1, characterized in that: The upstream homology arm is the basesequence shown in the sequence shown in SEQ ID NO: 1; or, the sequence shown in (101836 SEQ ID NO: 1 starts at the 3 'end and extends to a 5' end to a continuous fragment of not less than 500 bp; The downstream homology arm is the base sequence shown in the sequence shown in SEQ ID NO: 2; or, the sequence shown in SEQ ID NO: 2 starts at the 5 ‘end and extends to the 3' end to a continuous fragment of not less than 500 bp; The promoter is the base sequence shown in the sequence of the sequence shown in SEQ ID NO: 3; or, the sequence shown in SEQ ID NO: 3 starts at the 5 'end and extends toward the 3' end to a continuous fragment of not less than 800 bp; The promoter is the base sequence shown in the sequence of the sequence shown in SEQ ID NO: 4; or, the sequence shown in SEQ ID NO: 4 starts at the 5 'end and extends toward the 3' end to a continuous fragment of not less than 510 bp; The linking sequence is the base sequence shown in the sequence of the sequence shown in SEQ ID NO: 5; or, the sequence shown in SEQ ID NO: 5 starts at the 5 'end and extends to the 3’ end to a continuous fragment of not less than 15 bp.

7. An application of chloroplast homologous recombination empty vector of D. salina in the chloroplast transformation of D. salina according to claim 1.

8. The application according to claim 7, characterized in that the foreign gene is introduced into the constructed homologous recombination empty vector and then into — D. salina cells, and the transgenic D. salina is obtained through culture selection.