CN117025652A - Method for improving gene knockout efficiency of pseudomonas - Google Patents

Abstract

The invention discloses a method for improving the gene knockout efficiency of pseudomonas, which adopts an SDS gradient to eliminate exogenous plasmids after a target gene is knocked out by adopting a Cas12a knockout system. The method solves the problem of bacterial death caused by exogenous toxic proteins, and improves the conversion rate of the knockout system; the gentamicin resistance gene gmr applicable to all pseudomonas is selected as a screening marker, so that the problem of difficulty in screening mutants of drug-resistant strains such as pseudomonas aeruginosa is solved, and the screening efficiency of knockout strains is effectively improved; meanwhile, a method for eliminating plasmids in a gradient way is provided, the purpose of eliminating exogenous plasmids step by step is achieved by selecting proper SDS concentration, the rapid and continuous knockout of multiple genes can be realized, and the knockout bacteria for eliminating all exogenous plasmids can be obtained, so that different experimental requirements are met.

Description

Method for improving gene knockout efficiency of pseudomonas

Technical Field

The invention belongs to the field of genetic engineering, and particularly relates to a method for improving the gene knockout efficiency of pseudomonas.

Background

Rhamnolipid (Rhamnolipids) is a non-toxic, pollution-free and excellent emulsifying property and antibacterial property biosurfactant produced by pseudomonas fermentation, and has wide application prospect in the fields of cosmetics, biological medicine, environmental repair and the like. However, the lower synthetic yield of rhamnolipids is always an important factor limiting its industrial application.

With the development of metabolic engineering and synthetic biology technologies, the development of more efficient and safe rhamnolipid engineering strains is attracting more and more attention, and various strategies such as metabolic pathway modification, chassis engineering and the like are used for optimizing rhamnolipid production, and the application of the strategies is closely related to the development of gene knockout technology.

At present, the pseudomonas genome knockout technology is still mainly based on a traditional method based on homologous recombination double exchange, for example, the suicide plasmid pEX18Tc adopted by Laura R Hmelo in 2015 and the like is used for realizing the knockout of genes such as pseudomonas aeruginosa fimT and the like, but the method is complex in operation, time-consuming, labor-consuming and low in knockout efficiency. The CRISPR/Cas system is an immune defense system naturally existing in prokaryotes, and the system recognizes and cuts a target sequence through base pairing of RNA and DNA, so that gene knockout is realized. Although a CRISPR/paccrispr double-plasmid knockout system based on a CRISPR/Cas9 system has been developed as early as 2018, ji Quanjiang and the like, the system has complex constituent elements, and the plasmids are huge, so that the conversion efficiency of the knockout system in practical application is low; meanwhile, the Cas9 protein used by the system has toxic effects on partial bacteria, can cause cell morphology change, inhibit bacterial growth and even cause bacterial death, and further cause transformation efficiency reduction and even zero, thereby limiting the wide application of the system. In 2020, li Huanhuan replaces the CRISPR/Cas9 system with the CRISPR/Cas12a system, designs and constructs a pCpf 1-lambda Red/pCrRNA knockout system, and realizes knockout of phzM genes and the like in the pseudomonas aeruginosa PAO1 genome, but the system uses tetracycline resistance genes as screening markers, and for pseudomonas aeruginosa insensitive to tetracycline, screening of mutants can become extremely difficult. In addition, all the knockout systems use sucrose lethal gene sacB as a counter-selection marker when eliminating plasmids, but the effects of the gene on killing different strains are greatly different, and the gene knockout system is not suitable for gene knockout of all pseudomonas, especially pseudomonas aeruginosa.

In summary, there is currently no efficient and rapid gene knockout system suitable for all Pseudomonas species, particularly Pseudomonas aeruginosa.

Disclosure of Invention

In view of the above-described drawbacks of the prior art, an object of the present invention is to provide a method for improving the efficiency of gene knockout of pseudomonas.

The invention provides a method for improving the knockout efficiency of pseudomonas, which is to use a Cas12a knockout system to knockout a target gene and then use SDS gradient to eliminate exogenous plasmids.

Further, the Cas12a knockout system comprises Cas12a expression plasmids and JDP gene expression plasmids.

Further, the cas12a expression plasmid is pUCP18E-P _rpsJ Cas12a. Of course, other plasmids that can express cas12a are also possible.

Further, the pUCP18E-P _rpsJ The cas12a plasmid is a constitutive promoterA promoter and cas12a gene. The promoter may be P _rpsJ ；pUCP18E-P _rpsJ Cas12a is capable of expressing Cas12a protein.

Further, the pUCP18E-P _rpsJ The cas12a plasmid contains an EcoR I cleavage site for insertion of the counter selection marker sacB gene.

Further, the JDP gene comprises a constitutive promoter and a crRNA repeat. The promoter may be P _rpsJ 。

Further, the crRNA repeat sequence downstream comprises two Bsa I cleavage sites for insertion of a crRNA spacer sequence, which together with the crRNA repeat sequence constitutes a DNA fragment encoding the complete crRNA.

Further, the JDP gene expression plasmid is pBBR1MCS5-JDP.

Further, the pBBR1MCS5-JDP plasmid contains Hind III and EcoR I cleavage sites for insertion of repair templates.

Further, either one of the cas12a expression plasmid and the JDP gene expression plasmid carries a gentamicin resistance gene gmr, and the other contains a carbenicillin resistance gene ampR.

Further, the method for eliminating the exogenous plasmid by using the SDS gradient comprises the following steps:

(1) Eliminating JDP gene expression plasmid with SDS in 0.5-2.5% concentration;

(2) SDS with concentration of 5-12.5% is used to eliminate cas12a expression plasmid and JDP gene expression plasmid simultaneously.

The invention provides a method for improving the knockout efficiency of pseudomonas, which comprises the following steps:

(1) Transforming cas12a gene expression plasmid into pseudomonas;

(2) Taking pseudomonas genome DNA as a template, and respectively obtaining an upstream homologous arm and a downstream homologous arm of a target gene through PCR amplification; annealing to obtain crRNA interval sequence; connecting an upstream homology arm, a downstream homology arm and a crRNA spacer sequence of a target gene to a JDP gene expression plasmid to obtain a plasmid for knocking out an A gene and a plasmid for knocking out a B gene;

(3) Electrotransformation of the plasmid for knocking out the A gene into the pseudomonas competent cells with the cas12a gene expression plasmid obtained in the step (1), and screening by PCR to obtain a gene A knocked-out strain;

(4) Inoculating the gene A knocked-out strain into a culture medium containing SDS with concentration of 0.5-2.5% to culture to a stationary growth period, and screening the knocked-out strain with the JDP gene expression plasmid eliminated by using an antibiotic flat plate;

(5) Transforming the B plasmid into competent cells of the gene A knockout strain obtained in the step (4), and obtaining a gene A and gene B double knockout strain through PCR screening;

(6) The gene B knockout strain is inoculated into a culture medium containing SDS with the concentration of 5-12.5% for culturing to a stationary growth phase, and the double knockout strain for eliminating double plasmids is screened by an antibiotic flat plate.

Preferably, the concentration of SDS in step (4) is 1%. Here, the concentration refers to the mass percentage of SDS in the medium.

Preferably, the concentration of SDS in step (6) is 10%. Here, the concentration refers to the mass percentage of SDS in the medium.

Further, the culture medium is LB culture medium. The corresponding culture medium is selected by eliminating the resistance gene (e.g., gmr or ampR) contained in the plasmid in step (4) and step (6) as needed.

Further, the pBBR1MCS5-JDP plasmid also contains gmr gene. Thus, the antibiotic plate selected was an LB plate containing gentamicin.

Compared with the prior art, the invention has the beneficial effects that:

1. adopts a Cas12a system with lower toxicity, avoids the problem of low conversion efficiency caused by the lethal effect of toxic exogenous proteins, has the advantages of high conversion rate and high gene knockout efficiency,

2. the gentamicin resistance gene gmr is selected as a screening marker, and the screening marker is suitable for screening all pseudomonas, particularly for pseudomonas insensitive to tetracycline, and the application range of the knockout system is enlarged.

3. The selective elimination of plasmids is realized by further adopting an SDS gradient resistance eliminating mode, so that the continuous knockout of genes is realized, the experimental period is effectively shortened, and a powerful genetic operation tool is provided for pseudomonas.

Drawings

FIG. 1pUCP18E-P _rpsJ -cas12a plasmid map.

FIG. 2 recombinant strain P.aeromonas ATCC 27853/pUCP18E-P _rpsJ Cas12a growth curve assay results.

FIG. 3pBBR1MCS5-JDP plasmid map.

FIG. 4pBBR1MCS5-JDP-Tc plasmid electrotransformation results.

FIG. 5 shows the results of SDS-elimination of plasmids at different concentrations (A, B, C is 1% SDS-elimination of plasmids, D, E, F is 5% SDS-elimination of plasmids, G, H, I is 10% SDS-elimination of plasmids; A, D, G is an anti-LB plate; B, E, H is a plate containing 200 mg.L) ^-1 LB plate containing 50 mg.L of carbenicillin as C, F, I ^-1 LB plate for gentamicin).

FIG. 6ATCC 27853/pUCP18E-P _rpsJ Verification of the sucrose lethal effect of cas12a-sacB (TY is a carbenicillin plate without sucrose, 20STY is a carbenicillin plate with 20% sucrose, 30STY is a carbenicillin plate with 30% sucrose).

FIG. 7pBBR1MCS5-C ₁ Results of the electric transformation of JD20 plasmid.

FIG. 8 colony PCR verification of phaC1 gene knockout results.

Detailed Description

Other advantages and effects of the present invention will become apparent to those skilled in the art from the following disclosure, which describes the embodiments of the present invention with reference to specific examples. The invention may be practiced or carried out in other embodiments that depart from the specific details, and the details of the present description may be modified or varied from the spirit and scope of the present invention. It should be understood that the process equipment or devices not specifically identified in the examples below are all conventional in the art. Furthermore, it is to be understood that the reference to one or more method steps in this disclosure does not exclude the presence of other method steps before or after the combination step or the insertion of other method steps between these explicitly mentioned steps, unless otherwise indicated; it should also be understood that the combined connection between one or more devices/means mentioned in the present invention does not exclude that other devices/means may also be present before and after the combined device/means or that other devices/means may also be interposed between these two explicitly mentioned devices/means, unless otherwise indicated. Moreover, unless otherwise indicated, the numbering of the method steps is merely a convenient tool for identifying the method steps and is not intended to limit the order of arrangement of the method steps or to limit the scope of the invention in which the invention may be practiced, as such changes or modifications in their relative relationships may be regarded as within the scope of the invention without substantial modification to the technical matter.

Plasmid source:

plasmid 6His-MBP-TEV-FNCPf1 was purchased from Ningbo biosciences, inc., pUCP18E-P _rpsJ For this laboratory construction, pAC-crRNA-Km was purchased from Hangzhou Baozi Biotechnology Co. pBBR1MCS5, pEX18Tc was purchased from Wohan vast, biotechnology Inc.

PCR amplification：

The PCR system is as follows: 1. Mu.L of template DNA (100 ng. Mu.L) ^-1 ) 2. Mu.L of upstream primer (10. Mu.M), 2. Mu.L of downstream primer (10. Mu.M), 25. Mu.L of 2 XPhantaMaster Mix (Nanjinozan Biotech Co., ltd.), 1. Mu.L of LDMSO, and finally an appropriate amount of ddH were added ₂ O was added to a total volume of 50. Mu.L.

After the PCR system is prepared, PCR reaction is carried out, and the cycle is as follows: (1) 94 ℃ for 10min; (2) 30cycles at 95℃for 30s;55 ℃ for 30s;72 ℃,1kb min ^-1 ；(3)72℃,10min；(4)16℃,+∞。

Plasmid restriction linearization：

The enzyme digestion system is as follows: 5. Mu.L 10X QuickCut Green Buffer, 1. Mu.L restriction enzyme 1, 1. Mu.L restriction enzyme 2, 1. Mu.g plasmid DNA, and finally adding an appropriate amount of ddH ₂ O was added to a total volume of 50. Mu.L.

After the reaction system was prepared, it was reacted in a water bath at 37℃for 3 hours.

Pseudomonas electrotransformation competent preparation：

Streak the glycerinum preserved in the refrigerator at-80 ℃ on LB plate containing corresponding antibiotics, culture at 37 ℃ for 16-24 h, then pick single colony to inoculate in LB culture medium, culture at 37 ℃ and 220rpm overnight. Inoculating 1mL of the bacterial liquid into 40mL of LB culture medium, culturing at 37 ℃ and 200rpm for about 4 hours until OD ₆₀₀ When the bacterial liquid grows to 0.8-1.0, the bacterial liquid is placed on ice. After 30min in ice bath, the culture medium supernatant was discarded after centrifugation at 7000rpm at 4℃for 10min to collect the bacteria. Washing the thalli three times with 20, 10 and 5mL precooled 0.3M sucrose respectively; then 500. Mu.L of pre-chilled 0.3M sucrose was added to resuspend the cells and competent cells were aliquoted into pre-chilled 1.5mL EP tubes at a volume of 100. Mu.L per tube and stored at-80℃for either ready-to-use or direct electrotransformation.

Electric conversion:

taking a tube of the Pseudomonas electrotransformation competence prepared above, placing on ice for melting, adding 5-10 mu L of plasmid into the competence, carrying out ice bath for 30min, transferring into a precooled electrorotating cup for electric shock under the conditions of 2.5kV and 3.0ms, immediately adding 800 mu L of LB,37 ℃ and 220rpm, and culturing for 1.5-2 h. After completion of the culture, the culture was centrifuged at 5000rpm for 5min, a part of the medium was aspirated, the cells were resuspended in the remaining 100. Mu.L of the medium, plated on corresponding resistance screening plates, and cultured overnight at 37 ℃.

Colony PCR：

The PCR system is as follows: 1 single colony or 0.5. Mu.L of bacterial liquid, 0.5. Mu.L of upstream primer (10. Mu.M), 0.5. Mu.L of downstream primer (10. Mu.M), 5. Mu.L of 2 XTaq Mix (Nanjinouzan Biotech Co., ltd.) and finally a proper amount of ddH were added ₂ O was added to a total volume of 10. Mu.L.

After the PCR system is prepared, PCR reaction is carried out, and the cycle is as follows: (1) 95 ℃ for 10min; (2) 25cycles at 95℃for 30s;55 ℃ for 30s;72 ℃,1kb min ^-1 ；(3)72℃,10min；(4)16℃,+∞。

Growth curve determination：

Thawing the strain preserved at-80 ℃ at room temperature, streaking a small amount of bacterial liquid on an LB solid medium by using an inoculating loop, and culturing for 16h at the constant temperature of 37 ℃. Picking upInoculating single colony into LB liquid culture medium, shake culturing at 37deg.C and 220rpm for 16 hr, transferring to 100mL LB culture medium according to 1% inoculum size, sampling at regular time during culturing, and monitoring OD ₆₀₀ And drawing a growth curve.

Example one knockout plasmid pUCP18E-P _rpsJ Construction of Cas12a and validation of Cas12a protein toxicity

It was found that even in the absence of sgrnas, the expressed Cas9 protein had strong toxicity to some bacteria, resulting in a significant decrease in its conversion efficiency, when the expression of the exogenous toxic protein was precisely regulated by commonly used induction expression systems or gene knockout was performed using other Cas proteins such as Cas12a protein instead of Cas9 (Nat commun.2017may4). In order to solve the problem of low conversion rate of the Cas9 knockout system in pseudomonas, the invention selects Cas12a protein to replace Cas9 protein and constructs plasmid pUCP18E-P _rpsJ Cas12a, the plasmid composition is shown in FIG. 1. Plasmid pUCP18E-P _rpsJ The specific construction method of cas12a is as follows:

the primers cas12a-F (the nucleotide sequence of which is shown as SEQ ID NO. 1) and cas12a-R (the nucleotide sequence of which is shown as SEQ ID NO. 2) are adopted to amplify cas12a gene by taking plasmid 6His-MBP-TEV-FNcpf1 as a template, wherein the size of the cas12a gene is 3900bp. pUCP18E-P was subjected to the restriction enzymes Sal I and Xho I _rpsJ The plasmid was subjected to double enzyme tangential. And then, respectively recovering the PCR product and the double enzyme digestion product by using a gel recovery and purification kit (Shanghai JieRui bioengineering Co., ltd.). The specific steps were carried out according to the kit use instruction manual.

SEQ ID NO.1：GAGTCTGAGGTCAAAGTCGACATGAGCATCTACCAGGAGTTCGTC

SEQ ID NO.2：AACAGGAGTCCAAGACTCGAGTTAGTTATTTCTATTCTGGACAAACTCG

The cas12a gene fragment obtained above and pUCP18E-P were subjected to the following procedures _rpsJ The plasmid enzyme-digested products were ligated using a one-step cloning kit (Nanjinouzan Biotechnology Co., ltd.) according to the kit operating manual. After ligation was completed 10. Mu.L of ligation product was converted to Escherichia coli BL (DE 3). Colonies were obtained from the transformants after overnight culturePCR was performed to verify that the primers were cas12a-F (SEQ ID NO. 1) and cas12a-R (SEQ ID NO. 2). The positive transformants which were correctly confirmed by PCR were transferred and stored, and plasmids were extracted with a plasmid DNA miniprep kit (Shanghai Jieli Biotechnology Co., ltd.) for subsequent experiments, and specific steps of plasmid extraction were performed according to the kit use instruction manual. At the same time, the plasmid was sent to general biosystems (Anhui) Co., ltd for sequencing and confirmation, and the finally obtained plasmid was named pUCP18E-P _rpsJ -cas12a plasmid. Meanwhile, we constructed a plasmid pUCP18E-P capable of constitutively expressing Cas9 protein according to the same method _rpsJ -cas9。

In order to compare the conversion efficiency of Cas12a protein and Cas9 protein, the invention respectively electrotransduces the two plasmids into pseudomonas, and the result shows that under the same plasmid quantity and the same electrotransduce condition, the electrotransduce pUCP18E-P is realized _rpsJ The cas12a plasmid gave significantly more transformants than the electrotransport pUCP18E-P _rpsJ The cas9 plasmid, while we calculated their transformation efficiencies, the results are shown in Table 1, from which pUCP18E-P can be seen _rpsJ The electrotransformation efficiency of the cas12a plasmid was 83 CFU. Mu.g ^-1 While pUCP18E-P _rpsJ The cas9 plasmid was only 5 CFU. Mu.g ^-1 The Cas12a protein is shown to be capable of effectively improving the conversion rate of the knockout system, and the problem of low conversion efficiency caused by toxicity of the Cas9 protein can be relieved to a certain extent.

TABLE 1 plasmid pUCP18E-P _rpsJ Cas12a and pUCP18E-P _rpsJ Comparison of the electrical conversion efficiencies of cas9

Further, we examined whether constitutive expression of Cas12a protein would inhibit P.aeroginosa ATCC 27853/pUCP18E-P _rpsJ The growth of cas12a was verified, and the results of the growth curve are shown in FIG. 2, which shows that recombinant bacterium P.aeroginosa ATCC 27853/pUCP18E-P _rpsJ Both Cas12a and wild bacteria entered the stationary phase of growth at about 7h, indicating that the growth rate of recombinant bacteria was substantially identical to that of wild bacteria, indicating Cas12a expression in pseudomonasThe protein does not have a significant inhibitory effect on the growth of pseudomonas.

As described in the literature, another approach to solve the problem of low conversion rate caused by Cas9 protein toxicity is to replace inducible promoters, but in the present invention we found that expression of Cas12a protein using constitutive promoters did not inhibit bacterial growth, thus proving that a protocol for expressing Cas12a protein using a native constitutive promoter is feasible, and that this protocol can couple bacterial growth and protein expression, thereby shortening the time for protein expression and simplifying the subsequent gene knockout step.

EXAMPLE two construction of pBBR1MCS5-JDP knockout plasmid and comparison of gentamicin and tetracycline screening efficiencies

In order to solve the problem of difficult screening of mutants of drug-resistant strains such as pseudomonas aeruginosa, the invention selects gentamicin resistance gene gmr as a screening marker to construct plasmid pBBR1MCS5-JDP, and the plasmid composition is shown in figure 3. The specific construction method of the plasmid pBBR1MCS5-JDP is as follows:

the plasmid pAC-crRNA-Km is used as a template, and the crRNA repetitive sequence is prepared by adopting primers crRNA-repeat-F (the nucleotide sequence of which is shown as SEQ ID NO. 3) and crRNA-repeat-R (the nucleotide sequence of which is shown as SEQ ID NO. 4), wherein the size of the repetitive sequence is 862bp. With the plasmid pUCP18E-P _rpsJ As a template, primer P is adopted _rpsJ F (the nucleotide sequence of which is shown as SEQ ID NO. 5) and P _rpsJ R (the nucleotide sequence of which is shown as SEQ ID NO. 6) calls P _rpsJ A promoter sequence, the size of which is 501bp. The pBBR1MCS5 plasmid was double-enzyme tangential using BamH I and EcoR I. And then, respectively recovering the PCR product and the double enzyme digestion product by using a gel recovery and purification kit (Shanghai JieRui bioengineering Co., ltd.). The specific steps were carried out according to the kit use instruction manual.

SEQ ID NO.3：GGAGTCTGAGGTCAAAGTCTAAGAACTTTAAATAATTTCTACTGTTGTAG

SEQ ID NO.4：GATAAGCTTGATATCGAATTCTAGACAGAGACCTTTCACACTCCAGT

SEQ ID NO.5：CGCTCTAGAACTAGTGGATCCGCACCAAGCGTGAAGACGTAG

SEQ ID NO.6：AGACTTTGACCTCAGACTCCAATTTACCA

Repeating the crRNA sequence and P obtained above _rpsJ The promoter sequence and pBBR1MCS5 plasmid restriction enzyme were ligated using a multi-fragment one-step cloning kit (Nanjinouzan Biotechnology Co., ltd.) according to the kit protocol. After ligation was completed, 10. Mu.L of ligation product was transformed into E.coli BL21 (DE 3). Colony PCR verification is carried out on the obtained transformant after overnight culture, and the primer is P _rpsJ -F (SEQ ID NO. 5) and crRNA-repeat-R (SEQ ID NO. 4). The positive transformants which were correctly confirmed by PCR were transferred and stored, and plasmids were extracted with a plasmid DNA miniprep kit (Shanghai Jieli Biotechnology Co., ltd.) for subsequent experiments, and specific steps of plasmid extraction were performed according to the kit use instruction manual. The plasmid was also sent to general biosystems (Anhui) Inc. for sequencing confirmation. The resulting plasmid was designated as pBBR1MCS5-JDP plasmid. The plasmid was electrotransformed into P.aeromonas ATCC 27853/pUCP18E-P _rpsJ As shown in FIG. 4, the result of the electrotransformation in cas12a shows that 295 transformants were obtained after the electrotransformation, and the electrotransformation efficiency was 983.3 CFU.mu.g ^-1 。

Meanwhile, the gentamicin resistance gene gmr of the plasmid pBBR1MCS5-JDP is replaced by the tetracycline resistance gene tcr, so that the plasmid pBBR1MCS5-JDP-Tc is constructed and used for comparing the screening efficiency of gentamicin and tetracycline on knocked-out bacteria.

Electric transformation of plasmid pBBR1MCS5-JDP-Tc P.aeromonas ATCC 27853/pUCP18E-P _rpsJ The results of cas12a are shown in FIG. 5. As can be seen from the graph, when the tetracycline concentration is 100 mg.L ^-1 When the method is used, the phenomenon of pasting plates occurs, and single bacterial colonies cannot be screened; when the concentration of the tetracycline is 200 mg.L ^-1 When a transformant is not obtained, the screening efficiency is remarkably reduced when the tetracycline resistance gene is used as a screening marker compared with the electrotransformation result of the plasmid pBBR1MCS5-JDP, so that the tetracycline is not suitable as a resistance screening marker of P.aeromonas ATCC 27853, and the screening efficiency of the knocked-out strain can be effectively improved by using the gentamicin resistance gene gmr as a screening marker.

Example three plasmid gradient elimination

Plasmid elimination is another difficult problem in the process of pseudomonas gene knockout, and currently sucrose lethal gene sacB is commonly used for plasmid elimination, but the effect difference of the method in different strains is large, and in order to solve the problem, sodium Dodecyl Sulfate (SDS) is selected for gradient elimination of the plasmid.

SDS is an ionic surfactant, and under proper concentration, it can dissolve membrane protein and destroy cell membrane, and SDS can change the binding site of plasmid on cell membrane, so that it can not be accurately duplicated, and finally the plasmid can not be correctly distributed into subcellular, so that the goal of eliminating plasmid can be reached. After gene knockout, gradient elimination of plasmids can be realized by controlling the concentration of SDS, and the metabolic burden of a host is reduced. We can either selectively eliminate the plasmid pBBR1MCS5-JDP (used for constructing the multigene knockout bacterium) or simultaneously eliminate the plasmid pUCP18E-P _rpsJ Cas12a and pBBR1MCS5-JDP (for elimination of all foreign plasmids in the host). In this experiment, SDS at 1%, 5% and 10% concentration was used as an example for plasmid elimination experiments. The specific operation is as follows:

electric transformation of plasmid pBBR1MCS5-JDP to P.aeromonas ATCC 27853/pUCP18E-P _rpsJ In cas12a, single colonies were then picked up and inoculated into 20mL of antibiotic-free LB medium, cultured at 37℃and 220rpm for about 16 hours, and after that, 50. Mu.L of the bacterial liquid was aspirated and inoculated into 20mL of LB medium containing 1%, 5% and 10% SDS, respectively, cultured at 37℃and 220rpm for at least 24 hours, and cultured until the growth period became stationary. Then diluting the bacterial liquid obtained by the above method with sterile water 10 ⁶ ～10 ⁹ 100. Mu.L of the mixture was plated on an antibiotic-free LB plate and incubated overnight at 37 ℃. Picking single colony from the plate and respectively dibbling on the non-antibody 200 mg.L ^-1 Carbenicillin and 50 mg.L ^-1 Gentamicin LB plate, 37 degrees overnight culture. Bacteria that eliminate the pBBR1MCS5-JDP plasmid cannot be found at 50 mg.L ^-1 Gentamicin LB plate grows on the plate, eliminating pUCP18E-P _rpsJ Colony of cas12a plasmid cannot be found at 200 mg.L ^-1 Carbenicillin grows on LB plates, and bacteria which cannot grow on both antibiotic plates are eliminated double plasmids.

Plasmid elimination results are shown in the figure6, it is shown that 31 single colonies among 48 single colonies selected when the concentration of SDS is 1% can realize the single elimination of pBBR1MCS5-JDP plasmid, the elimination rate reaches 64.6%, the SDS with the concentration can selectively eliminate the pBBR1MCS5-JDP plasmid, and the obtained knocked-out bacteria can directly perform the next round of gene knockout according to the method described in the fourth example. Of the 48 single colonies picked, 28 were successful in eliminating pBBR1MCS5-JDP and pUCP18E-P at the same time when the SDS concentration was increased to 5% _rpsJ Two plasmids of cas12a, with a double plasmid elimination rate of 58.3%, significantly higher than 1% SDS. Continuing to increase the SDS concentration to 10%, it was found that 40 single colonies among the 48 single colonies picked successfully eliminated both pBBR1MCS5-JDP and pUCP18E-P _rpsJ The elimination rate of the cas12a plasmid and the double plasmid is as high as 83.3 percent.

The invention also adopts SDS with other concentrations to carry out plasmid elimination experiments, the results are shown in table 2, and the results show that when the concentration of SDS is 0.5-2.5%, the invention mainly eliminates pBBR1MCS5-JDP plasmid, wherein 1% of SDS has the best effect of eliminating the selectivity of single plasmid; when the concentration of SDS is 5-12.5%, most single colonies are double-plasmid eliminating bacteria, wherein the double-plasmid eliminating rate of 10% SDS is highest; whereas when the SDS concentration is higher than 12.5%, the strain growth is inhibited, and single colonies cannot be obtained on the LB plate without antibody, so that SDS at too high a concentration is not suitable for plasmid elimination.

TABLE 2 efficiency of eliminating plasmids by SDS at different concentrations

At the same time, it was attempted to use sucrose lethal gene sacB for plasmid elimination, and insert sacB as a plasmid pUCP18E-P _rpsJ EcoR I cleavage site of cas12a, construction of plasmid pUCP18E-P _rpsJ Cas12a-sacB. The principle of eliminating plasmid by the method is that sacB gene codes sucrose fructosan enzyme which can catalyze the hydrolysis of sucrose into glucose and fructose and polymerize fructose into high molecular weight fructosan, but the accumulation of the high molecular weight fructosan has toxic effect on cells, so that the strain carrying sacB gene cannot be on the culture medium containing sucroseOnly strains that eliminate the plasmid carrying the sacB gene survive growth.

However, pUCP18E-P will _rpsJ After electrotransfer of the cas12a-sacB plasmid into p.aeromonas atcc 27853, the resulting strain can be grown on plates containing both sucrose and carbenicillin, the results are shown in figure 7. The result shows that pUCP18E-P is carried _rpsJ The P.aeromonas ATCC 27853 of the cas12a-sacB plasmid can still grow on sucrose-containing plates, and the sacB gene fails to exert a lethal effect, so that there is a difference in the lethal effect of the sacB gene among different strains, and the gene is not suitable as a counter-selectable marker for the elimination plasmid of P.aeromonas ATCC 27853.

In summary, the invention provides a method for eliminating pseudomonas plasmid with universality, which adopts SDS with concentration of 0.5-2.5% to selectively eliminate single plasmid, and the obtained strain can be used for continuously constructing multigene knockout bacteria; SDS with concentration of 5% -12.5% can be used for eliminating all exogenous plasmids in the host, reducing the metabolic burden of the host, and meeting different experimental requirements.

Example four use of pUCP18E-P _rpsJ High-efficiency gene knockout of pseudomonas aeruginosa strain by cas12a/pBBR1MCS5-JDP double-plasmid system

Use of pUCP18E-P _rpsJ The cas12a/pBBR1MCS5-JDP double plasmid system can realize the efficient knockout of different genes in all strains of Pseudomonas, and in the experiment, the phaC1 gene is selected as an example, and the gene knockout experiment is carried out on P.aeromonas ATCC 27853. The specific knockout process is as follows:

genomic DNA from P.aeromonas ATCC 27853 was extracted using a genomic extraction kit (Shanghai Jieji Biotechnology Co., ltd.) and the specific procedures were performed according to the kit use instruction manual.

The P.aeromonas ATCC 27853 genome DNA is used as a template, primers phaC1up500-F (the nucleotide sequence of which is shown as SEQ ID NO. 7) and phaC1up500-R (the nucleotide sequence of which is shown as SEQ ID NO. 8), phaC1down500-F (the nucleotide sequence of which is shown as SEQ ID NO. 9) and phaC1down500-R (the nucleotide sequence of which is shown as SEQ ID NO. 10) are used for respectively preparing homologous arm sequences phaC1-up arm and phaC1-down arm of the target gene to be knocked out, and the sizes of the two homologous arm sequences are 536bp and 514bp respectively. The pBBR1MCS5-JDP plasmid was double-enzyme tangential using HindIII and EcoRI. And then, respectively recovering the PCR product and the double enzyme digestion product by using a gel recovery and purification kit (Shanghai JieRui bioengineering Co., ltd.). The specific steps were carried out according to the kit use instruction manual.

SEQ ID NO.7：GTCGACGGTATCGATAAGCTTCTACCTGTACGAGCTGGCGAC

SEQ ID NO.8：TTTCGGCAACGCTCCATTGTT

SEQ ID NO.9：ACAATGGAGCGTTGCCGAAAGCGACCAGCCTGAAGAA

SEQ ID NO.10：AAAGGTCTCTGTCTAGAATTCTTCTTGCAGCGTTCCGGA

The multi-piece one-step cloning kit (Nanjinouzan Biotech Co., ltd.) used for the digestion of the phaC1-up arm fragment, phaC1-down arm fragment and pBBR1MCS5-JDP plasmid was used for ligation, and the specific steps were performed according to the kit use instruction manual. After ligation was completed, 10. Mu.L of ligation product was transformed into E.coli BL21 (DE 3). Colony PCR verification was performed on the obtained transformants after overnight culture, and the primers were phaC1up500-F and phaC1down500-R. Transferring and preserving positive transformant with correct PCR, extracting plasmid for subsequent experiment with small amount of plasmid DNA extracting kit (Shanghai JieRui bioengineering Co., ltd.) and the specific steps of plasmid extraction are carried out according to the operation manual of the kit, and simultaneously the plasmid is sent to general biological (Anhui) Co., ltd for sequencing and confirmation, and finally the obtained plasmid is named pBBR1MCS5-C ₁ JDP plasmid.

A DNA fragment 23 bases downstream of a certain TTN (N is an arbitrary base) was selected on the target gene phaC1 (TTN is not included). To enable the DNA fragment to be inserted into the above-constructed pBBR1MCS5-C ₁ In the JDP plasmid, tag a is added to the 5' end of the single-stranded DNA sequence. Meanwhile, the reverse complementary sequence of the DNA sequence is synthesized, and AGAC is added at the 5' -end of the reverse complementary sequence. The primer sequences were as follows:

phaC1-crRNA20-F:tagaCGCGGCTTGCTTGGGAAGCTCGT(SEQ ID NO.11)

phaC1-crRNA20-R:agacACGAGCTTCCCAAGCAAGCCGCG(SEQ ID NO.12)

the primers are synthesized by the Shanghai Biotechnology (Shanghai) limited company by adopting a conventional method, and then the 5' end of the primers is subjected to phosphorylation modification, wherein the specific reaction system is as follows: 5. Mu.L of 10×T4DNAligenase Buffer (takara), 10. Mu.L of upstream primer, 10. Mu.L of downstream primer, 1. Mu.LT 4 polynucleotide kinase (NEB), 24. Mu.L of ddH ₂ O. After the reaction was completed, 2.5. Mu.L of 1M NaCl was added to the reaction product and the mixture was annealed at 37℃for 5 minutes, and the mixture was cooled to room temperature to obtain a DNA double strand, followed by ddH ₂ O dilutes the resulting double stranded DNA product 20-fold.

The double-stranded DNA obtained above was reacted with pBBR1MCS5-C using Golden Gate assembly ₁ JDP plasmid ligation. Golden Gate assembly the reaction system is as follows: 1. Mu.L of 10 XT 4 DNA ligase Buffer (takara), 1. Mu.L of the above-mentioned phosphorylated double-stranded DNA diluted 20-fold, 1. Mu.L of pBBR1MCS5-C ₁ JDP plasmid (20 nM), 0.5 mu L T DNA library (takara), 0.5 mu LBsaI-HF (NEB), and finally adding an appropriate amount of ddH ₂ O was added to a total volume of 10. Mu.L. After the reaction system is prepared, the reaction is carried out in a PCR instrument, and the cycle is as follows: (1) 25cycles at 37℃for 2min;16 ℃ for 5min; (2) 50 ℃ for 5min;80 ℃ for 15min; (3) 16 ℃, ++ infinity a. The invention relates to a method for producing a fibre-reinforced plastic composite.

After the reaction was completed, 10. Mu.L of ligation product was transformed to E.coli BL21 (DE 3), and colony PCR verification was performed on the obtained transformants after overnight culture, with the primers phaC1-crRNA20-F and M13-R. The positive transformants which were correctly confirmed by PCR were transferred and stored, and plasmids were extracted with a plasmid DNA miniprep kit (Shanghai Jieli Biotechnology Co., ltd.) for subsequent experiments, and specific steps of plasmid extraction were performed according to the kit use instruction manual. The plasmid was also sent to general biosystems (Anhui) Inc. for sequencing confirmation. The resulting plasmid was designated pBBR1MCS5-C ₁ JD-crRNA20 plasmid. SEQ ID NO.13: CAGGAAACAGCTATGAC

Preparation of P.aerocinosa ATCC 27853/pUCP18E-P _rpsJ CAS12a electrotransformation competence and transformation of pBBR1MCS5-C ₁ The JD-crRNA20 plasmid was electroporated into the competence and plated on a plasmid containing 200 mg.L ^-1 Carbenicillin and 50 mg.L ^-1 GentamicinOn LB plates of (C), the culture was inverted at 37℃for 24 hours, and only bacteria successfully transformed into plasmids were able to grow on the medium.

And then, carrying out colony PCR verification on the obtained transformant by adopting primers phaC1-up900-F (the nucleotide sequence of which is shown as SEQ ID NO. 14) and phaC1-down500-R, and carrying out gel electrophoresis detection on the obtained PCR product by adopting 1% agarose gel. The length of the PCR product of the strain which is successfully knocked out is shorter than that of the PCR product of the normal strain, so that whether the gene knocked out is successful or not can be judged through the size of the DNA fragment on agarose gel, and meanwhile, the PCR product is sent to general biology (Anhui) stock company for sequencing and confirmation.

SEQ ID NO.14：CCATGGTCTAGAATGCTCGAGCCGCTACATCCTTTGACCACCGCC

The result of PCR verification is shown in FIG. 8, and the result shows that the gene knockout bacteria only amplify to obtain 1400bp bands, and the gene bands of 3080bp are not contained, which indicates that the strains are all successful in knocking out the phaC1 gene. The strain which is successfully knocked out is preserved and named as P.aeroginosa ATCC 27853 delta phaC1/pUCP18E-P _rpsJ -cas12a/pBBR1MCS5-C ₁ JD20, followed by elimination of the plasmid in the strain by the procedure of example three, succeeded in eliminating the plasmid and obtaining the gene knockout strain P.aeromonas ATCC 27853. DELTA. PhaC1 and the single plasmid elimination strain P.aeromonas ATCC 27853. DELTA. PhaC1/pUCP18E-P _rpsJ Cas12a. The above described single plasmid-eliminating strain constructs phaC2 gene knockout plasmid pBBR1MCS5-C according to the method described in this example ₂ Continuous knockout of phaC2 gene is carried out after JD14, and finally, the gene knockout strain P.aeromonas ATCC 27853 delta phaC1 delta phaC2 is obtained.

The invention also performs knockout experiments on other genes of P.aeromonasATCC 27853, and simultaneously performs gene knockout experiments on P.putidaKT2440, and partial results are shown in Table 3, and the results show that the knockout efficiency of the editing system reaches 100% and exceeds the editing efficiency of the reported pseudomonas gene editing system.

TABLE 3pUCP18E-P _rpsJ Knockout efficiency of cas12a/pBBR1MCS5-JDP double plasmid system on different genes

In summary, the invention provides a method for improving the gene knockout efficiency of pseudomonas, which is to eliminate exogenous plasmids by adopting SDS gradient after target genes are knocked out by adopting a Cas12a knockout system. The method adopts the Cas12a protein with lower toxicity to replace the Cas9 protein, solves the problem of bacterial death caused by introducing exogenous toxic protein, and has the advantages of high conversion rate and high gene knockout efficiency; the gentamicin resistance gene gmr is selected as a screening marker, and the screening marker is suitable for screening all pseudomonas, particularly for pseudomonas insensitive to tetracycline, so that the application range of the knockout system is enlarged; meanwhile, a method for eliminating plasmids in a gradient way is provided, the purpose of eliminating exogenous plasmids step by step is achieved by selecting proper SDS concentration, the rapid and continuous knockout of multiple genes can be realized, and the knockout bacteria for eliminating all exogenous plasmids can be obtained, so that different experimental requirements are met.

With the above-described preferred embodiments according to the present invention as an illustration, the above-described descriptions can be used by persons skilled in the relevant art to make various changes and modifications without departing from the scope of the technical idea of the present invention. The technical scope of the present invention is not limited to the description, but must be determined according to the scope of claims.

Claims (9)

1. A method for improving the knockout efficiency of pseudomonas, which is to eliminate exogenous plasmid by SDS gradient after target gene is knocked out by adopting Cas12a knockout system.

2. The method of increasing the efficiency of pseudomonas knockout of claim 1, wherein the Cas12a knockout system comprises a Cas12a expression plasmid and a JDP gene expression plasmid.

3. The method for improving the knockout efficiency of pseudomonas according to claim 2, wherein either one of the cas12a expression plasmid and the JDP gene expression plasmid carries a gentamicin resistance gene gmr and the other plasmid contains a carbenicillin resistance gene ampR.

4. The method of increasing the efficiency of pseudomonas knockout according to claim 2, wherein said cas12a expression plasmid is pUCP18E-P _rpsJ -cas12a。

5. The method of claim 2, wherein the JDP gene comprises a constitutive promoter and a crRNA repeat sequence comprising two Bsa I cleavage sites downstream for insertion of a crRNA spacer sequence, and wherein the crRNA repeat sequence constitutes a DNA fragment encoding the complete crRNA.

6. The method for improving the knockout efficiency of pseudomonas according to claim 2, wherein the JDP gene expression plasmid is pBBR1MCS5-JDP.

7. The method for improving the knockout efficiency of pseudomonas according to claim 1, wherein the method for eliminating the exogenous plasmid by SDS gradient comprises:

(1) Eliminating JDP gene expression plasmid with SDS in 0.5-2.5% concentration;

(2) SDS with concentration of 5-12.5% is used to eliminate cas12a expression plasmid and JDP gene expression plasmid simultaneously.

8. The method for improving the efficiency of Pseudomonas knockout according to any one of claims 1 to 7, wherein the method comprises the steps of,

(1) Transforming cas12a gene expression plasmid into pseudomonas;

(2) Taking pseudomonas genome DNA as a template, and respectively obtaining an upstream homologous arm and a downstream homologous arm of a target gene through PCR amplification; annealing to obtain crRNA interval sequence; connecting an upstream homology arm, a downstream homology arm and a crRNA spacer sequence of a target gene to a JDP gene expression plasmid to obtain a plasmid for knocking out an A gene and a plasmid for knocking out a B gene;

(3) Electrotransformation of the plasmid for knocking out the A gene into the pseudomonas competent cells with the cas12a gene expression plasmid obtained in the step (1), and screening by PCR to obtain a gene A knocked-out strain;

(4) Inoculating the gene A knocked-out strain into a culture medium containing SDS with concentration of 0.5-2.5% to culture to a stationary growth period, and screening the knocked-out strain with the JDP gene expression plasmid eliminated by using an antibiotic flat plate;

(5) Transforming the B plasmid into competent cells of the gene A knockout strain obtained in the step (4), and obtaining a gene A and gene B double knockout strain through PCR screening;

(6) The gene B knockout strain is inoculated into a culture medium containing SDS with the concentration of 5-12.5% for culturing to a stationary growth phase, and the double knockout strain for eliminating double plasmids is screened by an antibiotic flat plate.

9. The knockout system of claim 8, wherein said SDS is at a concentration of 1% in step (4); the SDS concentration in step (6) was 10%.