WO2020168051A1 - Methods of editing a disease-associated gene using adenosine deaminase base editors, including for the treatment of genetic disease - Google Patents

Methods of editing a disease-associated gene using adenosine deaminase base editors, including for the treatment of genetic disease Download PDF

Info

Publication number
WO2020168051A1
WO2020168051A1 PCT/US2020/018073 US2020018073W WO2020168051A1 WO 2020168051 A1 WO2020168051 A1 WO 2020168051A1 US 2020018073 W US2020018073 W US 2020018073W WO 2020168051 A1 WO2020168051 A1 WO 2020168051A1
Authority
WO
WIPO (PCT)
Prior art keywords
base editor
gene
adenosine
nucleic acid
snp associated
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2020/018073
Other languages
English (en)
French (fr)
Other versions
WO2020168051A9 (en
Inventor
Ian SLAYMAKER
Nicole GAUDELLI
Yi Yu
Bernd ZETSCHE
David A. BORN
Seung-Joo Lee
Michael Packer
Jason Michael GEHRKE
Natalie PETROSSIAN
Angelica Messana
Shaunna BERKOVITCH
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Beam Therapeutics Inc
Original Assignee
Beam Therapeutics Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to US17/430,672 priority Critical patent/US20230140953A1/en
Application filed by Beam Therapeutics Inc filed Critical Beam Therapeutics Inc
Priority to KR1020217029268A priority patent/KR20210127206A/ko
Priority to CA3128876A priority patent/CA3128876A1/en
Priority to CN202080028186.5A priority patent/CN114040970B/zh
Priority to AU2020223306A priority patent/AU2020223306A1/en
Priority to CN202411269394.0A priority patent/CN119280261A/zh
Priority to EP20756724.9A priority patent/EP3924484A4/en
Priority to JP2021546888A priority patent/JP7586601B2/ja
Publication of WO2020168051A1 publication Critical patent/WO2020168051A1/en
Publication of WO2020168051A9 publication Critical patent/WO2020168051A9/en
Anticipated expiration legal-status Critical
Priority to JP2024193416A priority patent/JP2025032080A/ja
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/7105Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/43Enzymes; Proenzymes; Derivatives thereof
    • A61K38/46Hydrolases (3)
    • A61K38/465Hydrolases (3) acting on ester bonds (3.1), e.g. lipases, ribonucleases
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/43Enzymes; Proenzymes; Derivatives thereof
    • A61K38/46Hydrolases (3)
    • A61K38/50Hydrolases (3) acting on carbon-nitrogen bonds, other than peptide bonds (3.5), e.g. asparaginase
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/14Drugs for disorders of the nervous system for treating abnormal movements, e.g. chorea, dyskinesia
    • A61P25/16Anti-Parkinson drugs
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/102Mutagenizing nucleic acids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1137Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/87Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90Stable introduction of foreign DNA into chromosome
    • C12N15/902Stable introduction of foreign DNA into chromosome using homologous recombination
    • C12N15/907Stable introduction of foreign DNA into chromosome using homologous recombination in mammalian cells
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/16Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22Ribonucleases [RNase]; Deoxyribonucleases [DNase]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/24Hydrolases (3) acting on glycosyl compounds (3.2)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/78Hydrolases (3) acting on carbon to nitrogen bonds other than peptide bonds (3.5)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y302/00Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
    • C12Y302/01Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
    • C12Y302/01076L-Iduronidase (3.2.1.76)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y305/00Hydrolases acting on carbon-nitrogen bonds, other than peptide bonds (3.5)
    • C12Y305/04Hydrolases acting on carbon-nitrogen bonds, other than peptide bonds (3.5) in cyclic amidines (3.5.4)
    • C12Y305/04004Adenosine deaminase (3.5.4.4)
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/80Fusion polypeptide containing a DNA binding domain, e.g. Lacl or Tet-repressor
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/20Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPR]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/30Special therapeutic applications
    • C12N2320/34Allele or polymorphism specific uses
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00Nucleic acids vectors
    • C12N2800/10Plasmid DNA
    • C12N2800/106Plasmid DNA for vertebrates
    • C12N2800/107Plasmid DNA for vertebrates for mammalian
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00Nucleic acids vectors
    • C12N2800/80Vectors containing sites for inducing double-stranded breaks, e.g. meganuclease restriction sites

Definitions

  • Targeted editing of nucleic acid sequences is a highly promising approach for the study of gene function and also has the potential to provide new therapies for human genetic diseases.
  • base editors include cytidine base editors (e.g ., BE4) that convert target C'G base pairs to T ⁇ A and adenine base editors (e.g., ABE7.10) that convert A ⁇ T to G » C.
  • cytidine base editors e.g ., BE4
  • adenine base editors e.g., ABE7.10
  • compositions comprising novel adenine base editors (e.g, ABE8) that have increased efficiency and methods of using base editors comprising adenosine deaminase variants for editing a target sequence.
  • a method of treating a neurological disorder in a subject comprising: administering to the subject (i) an adenosine base editor or a nucleic acid sequence encoding the adenosine base editor and (ii) a guide polynucleotide or a nucleic acid sequence encoding the guide polynucleotide, wherein the adenosine base editor comprises a programmable DNA binding domain and an adenosine deaminase domain, wherein the adenosine deaminase domain comprises an amino acid substitution at amino acid position 82 or 166 as numbered in SEQ ID NO: 2 or a corresponding position thereof, and wherein the guide polynucleotide directs the
  • the target gene is an alpha-L-iduronidase (IDUA) gene and the neurological disease is Hurler syndrome.
  • IDUA alpha-L-iduronidase
  • the target gene is a leucine-rich repeat kinase-2 (LRRK2) gene and the neurological disease is
  • the target gene is a methyl CpG binding protein 2 (MECP2) gene and the neurological disease is Rett syndrome.
  • the target gene is an ATP -binding cassette subfamily member 4 (ABCA4) gene and the neurological disease is Stargardt disease.
  • a method of treating Hurler syndrome in a subject comprising administering to the subject (i) an adenosine base editor or a nucleic acid sequence encoding the adenosine base editor and (ii) a guide polynucleotide or a nucleic acid sequence encoding the guide polynucleotide, wherein the adenosine base editor comprises a programmable DNA binding domain and an adenosine deaminase domain, wherein the adenosine deaminase domain comprises an amino acid substitution at amino acid position 82 or 166 as numbered in SEQ ID NO: 2 or a corresponding position thereof, and wherein the guide polynucleotide directs the adenosine base editor to effect an A-to-G nucleobase alteration in an alpha-L-iduronidase (IDUA) gene or a regulatory element thereof in the subject, thereby treating Hurler syndrome in the
  • the administration ameliorates at least one symptom related to Hurler syndrome. In some embodiments, the administration results in faster amelioration of at least one symptom related to Hurler syndrome as compared to treatment with a base editor without the amino acid substitution in the adenosine deaminase.
  • the IDUA gene or regulatory element thereof comprises a SNP associated with Hurler syndrome.
  • the A-to-G nucleobase alteration is at the SNP associated with Hurler syndrome.
  • the SNP associated with Hurler syndrome results in a W402X or a W401X amino acid mutation in an IDUA polypeptide as numbered in SEQ ID NO: 4, or a variant thereof, encoded by the IDUA gene, wherein X is a stop codon.
  • the A-to-G nucleobase alteration changes the SNP associated with Hurler syndrome to a wild type nucleobase.
  • the A-to-G nucleobase alteration changes the SNP associated with Hurler syndrome to a non-wild type nucleobase that results in one or more ameliorated symptoms of Hurler syndrome.
  • the A-to-G alteration at the SNP associated with Hurler Syndrome changes a stop codon to a tryptophan in an IDUA polypeptide encoded by the IDUA gene.
  • the guide polynucleotide comprises a nucleic acid sequence complementary to the IDUA gene or regulatory element thereof comprising the SNP associated with Hurler syndrome.
  • the adenosine base editor is in complex with a single guide RNA (sgRNA) comprising a nucleic acid sequence
  • the sgRNA comprises a nucleic acid sequence selected from the group consisting of: 5'- GACUCUAGGCAGAGGUCUCAA -3', 5'- ACUCUAGGC AGAGGUCUCAA-3 ', 5'- CUCUAGGCCGAAGUGUCGC -3', and 5'- GCUCUAGGCCGAAGUGUCGC-3 '.
  • a method of treating Parkinson’s disease in a subject comprising: administering to the subject (i) an adenosine base editor or a nucleic acid sequence encoding the adenosine base editor and (ii) a guide polynucleotide or a nucleic acid sequence encoding the guide polynucleotide, wherein the adenosine base editor comprises a programmable DNA binding domain and an adenosine deaminase domain, wherein the adenosine deaminase domain comprises an amino acid substitution at amino acid position 82 or 166 as numbered in SEQ ID NO: 2 or a corresponding position thereof, and wherein the guide polynucleotide directs the adenosine base editor to effect an A-to-G nucleobase alteration a leucine-rich repeat kinase-2 (LRRK2) gene or a regulatory element thereof in the subject, thereby treating
  • LRRK2 leucine-rich
  • the administration ameliorates at least one symptom related to Parkinson’s disease. In some embodiments, the administration results in faster amelioration of at least one symptom related to Parkinson’s disease as compared to treatment with a base editor without the amino acid substitution in the adenosine deaminase.
  • the LRRK2 gene or regulatory element thereof comprises a SNP associated with Parkinson’s disease. In some embodiments, the A-to-G nucleobase alteration is at the SNP associated with Parkinson’s disease.
  • the SNP associated with Parkinson Disease results in a A419V, a R1441C, a R1441H, or a G2019S amino acid mutation in a LRRK2 polypeptide as numbered in SEQ ID NO: 3, or a variant thereof, encoded by the LRRK2 gene.
  • the A-to-G nucleobase alteration changes the SNP associated with Parkinson’s disease to a wild type nucleobase. In some embodiments, the A-to-G nucleobase alteration changes the SNP associated with Parkinson’s disease to a non-wild type nucleobase that results in one or more ameliorated symptoms of Parkinson’s disease. In some embodiments, the A-to-G nucleobase alteration changes a Cysteine or Histidine to an Arginine in a LRRK2 polypeptide encoded by the LRRK2 gene. In some embodiments, the A-to-G alteration changes a Serine to a Glycine in a LRRK2 polypeptide encoded by the LRRK2 gene.
  • the A-to-G alteration replaces the Cysteine (C) or Histidine (H) with an Arginine (R) at position 144 or replaces the Serine with a Glycine (G) at position 2019 of a LRRK2 polypeptide as numbered in SEQ ID NO: 3, or a variant thereof, encoded by the LRRK2 gene.
  • a method of treating Parkinson’s disease in a subject comprising: administering to the subject (i) an adenosine base editor or a nucleic acid sequence encoding the adenosine base editor and (ii) a guide polynucleotide or a nucleic acid sequence encoding the guide polynucleotide, wherein the adenosine base editor comprises a programmable DNA binding domain and an adenosine deaminase domain, and wherein the guide polynucleotide directs the adenosine base editor to effect an A-to-G nucleobase alteration at a SNP in a LRRK2 gene associated with Parkinson’s disease, wherein the SNP does not encode a G2019S mutation in a LRRK2 polypeptide as numbered in SEQ ID NO: 3, or a variant thereof.
  • the adenosine deaminase domain comprises an amino acid substitution at amino acid position 82 or 166 as numbered in SEQ ID NO: 2 or a
  • the guide polynucleotide comprises a nucleic acid sequence complementary to the LRRK2 gene or regulatory element thereof comprising the SNP associated with Parkinson’s Disease.
  • the adenosine base editor is in complex with a single guide RNA (sgRNA) comprising a nucleic acid sequence complementary to the LRRK2 gene or regulatory element thereof comprising the SNP associated with Parkinson Disease.
  • the sgRNA comprises a nucleic acid sequence: 5 AAGCGC AAGCCUGGAGGGAA -3'; or 5'- ACUACAGC AUUGCUCAGUAC-3
  • a method of treating Rett syndrome in a subject comprising administering to the subject (i) an adenosine base editor or a nucleic acid sequence encoding the adenosine base editor and (ii) a guide polynucleotide or a nucleic acid sequence encoding the guide polynucleotide, wherein the adenosine base editor comprises a programmable DNA binding domain and an adenosine deaminase domain, wherein the adenosine deaminase domain comprises an amino acid substitution at amino acid position 82 or 166 as numbered in SEQ ID NO: 2 or a corresponding position thereof, and wherein the guide polynucleotide directs the adenosine base editor to effect an A-to-G nucleobase alteration in a methyl CpG binding protein 2 (MECP2) gene or a regulatory element thereof in the subject, thereby treating Rett syndrome in
  • the administration ameliorates at least one symptom related to Rett syndrome. In some embodiments, the administration results in faster amelioration of at least one symptom related to Rett syndrome as compared to treatment with a base editor without the amino acid substitution in the adenosine deaminase.
  • the MECP2 gene or regulatory element thereof comprises a SNP associated with Rett syndrome.
  • the A-to-G nucleobase alteration is at the SNP associated with Rett Syndrome.
  • the SNP associated with Rett syndrome results in a R106W or a T158M amino acid mutation in a MECP2 polypeptide as numbered in SEQ ID NO: 5, or a variant thereof, encoded by the MECP2 gene.
  • the SNP associated with Rett syndrome results in a R255X or a R270X amino acid mutation in a MECP2 polypeptide encoded by the MECP2 gene, wherein X is a stop codon.
  • the A-to-G nucleobase alteration changes the SNP associated with Rett syndrome to a wild type nucleobase. In some embodiments, the A-to-G nucleobase alteration changes the SNP associated with Rett syndrome to a non-wild type nucleobase that results in ameliorated Rett syndrome symptoms. In some embodiments, the A-to-G
  • nucleobase alteration at the SNP associated with Rett Syndrome changes a stop codon to tryptophan in MECP2 polypeptide.
  • the guide polynucleotide comprises a nucleic acid sequence complementary to the MECP2 gene or regulatory element thereof comprising the SNP associated with Rett syndrome.
  • the adenosine base editor is in complex with a single guide RNA (sgRNA) comprising a nucleic acid sequence
  • the guide polynucleotide comprises a nucleic acid sequence selected from the group consisting of: 5'- CUUUUCACUUCCUGCCGGGG-3 ', 5'-AGCUUCCAUGUCCAGCCUUC-3', 5'- ACCAUGAAGUCAAAAUC AUU-3 ', and 5'- GCUUUCAGCCCCGUUUCUUG-3'.
  • a method of treating Stargardt disease in a subject comprising administering to the subject (i) an adenosine base editor or a nucleic acid sequence encoding the adenosine base editor and (ii) a guide polynucleotide or a nucleic acid sequence encoding the guide polynucleotide, wherein the adenosine base editor comprises a programmable DNA binding domain and an adenosine deaminase domain, wherein the adenosine deaminase domain comprises an amino acid substitution at amino acid position 82 or 166 as numbered in SEQ ID NO: 2 or a corresponding position thereof, and wherein the guide polynucleotide directs the adenosine base editor to effect an A-to-G nucleobase alteration in an ATP -binding cassette subfamily member 4 (ABCA4) gene or a regulatory element thereof in the subject, thereby treating Stargardt
  • ABCA4 ATP -bind
  • the administration ameliorates at least one symptom related to Stargardt disease. In some embodiments, the administration results in faster amelioration of at least one symptom related to Stargardt disease as compared to treatment with a base editor without the amino acid substitution in the adenosine deaminase.
  • the ABCA4 gene comprises a SNP associated with Stargardt disease.
  • the A-to-G nucleobase alteration is at the SNP associated with Stargardt disease.
  • the SNP associated with Stargardt disease results in a A1038V or a G1961E amino acid mutation in an ABCA4 polypeptide as numbered in SEQ ID NO: 6, or a variant thereof, encoded by the ABCA4 gene.
  • the SNP associated with Stargardt disease results in a G1961E amino acid mutation in the ABCA4 polypeptide as numbered in SEQ ID NO: 6, or a variant thereof.
  • the A-to-G nucleobase alteration changes the SNP associated with Stargardt disease to a wild type nucleobase. In some embodiments, the A-to-G nucleobase alteration changes the SNP associated with Stargardt disease to a non-wild type nucleobase that results in one or more ameliorated symptoms of Stargardt disease.
  • the guide polynucleotide comprises a nucleic acid sequence complementary to the ABCA4 gene or regulatory element thereof comprising the SNP associated with Stargardt disease.
  • the adenosine base editor is in complex with a single guide RNA (sgRNA) comprising a nucleic acid sequence complementary to the ABCA4 gene or regulatory element thereof comprising the SNP associated with Stargardt Disease.
  • sgRNA single guide RNA
  • the sgRNA comprises the sequence 5'- CUCCAGGGCGAACUUCGAC ACAC AGC-3 '.
  • the treatment described herein results in ameliorated symptoms of the neurological disorder compared to treatment with a base editor comprising an adenosine deaminase domain without the amino acid substitutions.
  • a method of editing a target gene or regulatory element thereof associated with a neurological disorder comprising contacting the target gene or regulatory element thereof with (i) an adenosine base editor and (ii) a guide polynucleotide, wherein the adenosine base editor comprises a programmable DNA binding domain and an adenosine deaminase domain, wherein the adenosine deaminase domain comprises an amino acid substitution at amino acid position 82 or 166 as numbered in SEQ ID NO: 2 or a corresponding position thereof, wherein the guide polynucleotide directs the adenosine base editor to effect an A-to-G nucleobase alteration in a target gene or a regulatory element thereof associated with the neurological disorder.
  • the target gene is a leucine-rich repeat kinase-2 (LRRK2) gene and the neurological disease is Parkinson’s disease.
  • the target gene is an alpha-L- iduronidase (IDUA) gene and the neurological disease is Hurler syndrome.
  • the target gene is a methyl CpG binding protein 2 (MECP2) gene and the neurological disease is Rett syndrome.
  • the target gene is an ATP -binding cassette subfamily member 4 (ABCA4) gene and the neurological disease is Stargardt disease.
  • a method of editing a leucine-rich repeat kinase-2 (LRRK2) gene or a regulatory element thereof comprising contacting the LRRK2 gene or regulatory element thereof with (i) an adenosine base editor or a nucleic acid sequence encoding the adenosine base editor and (ii) a guide polynucleotide or a nucleic acid sequence encoding the guide polynucleotide, wherein the adenosine base editor comprises a programmable DNA binding domain and an adenosine deaminase domain, wherein the adenosine deaminase domain comprises an amino acid substitution at amino acid position 82 or 166 as numbered in SEQ ID NO: 2 or a corresponding position thereof, and wherein the guide polynucleotide directs the adenosine base editor to effect an A-to-G nucleobase alteration in the LRRK2 gene
  • the A-to-G nucleobase alteration is at the SNP associated with Parkinson’s disease.
  • the SNP associated with Parkinson Disease results in a A419V, a R1441C, a R1441H, or a G2019S amino acid mutation in a LRRK2 polypeptide as numbered in SEQ ID NO: 3, or a variant thereof, encoded by the LRRK2 gene.
  • the A-to-G nucleobase alteration changes the SNP associated with Parkinson’s disease to a wild type nucleobase.
  • the A-to-G nucleobase alteration changes the SNP associated with Parkinson’s disease to a non-wild type nucleobase that results in one or more ameliorated symptoms of Parkinson’s disease.
  • the A-to-G nucleobase alteration changes a Cysteine or Histidine to an Arginine in a LRRK2 polypeptide encoded by the LRRK2 gene. In some embodiments, the A-to-G alteration changes a Serine to a Glycine in a LRRK2 polypeptide encoded by the LRRK2 gene.
  • the A-to-G alteration replaces the Cysteine (C) or Histidine (H) with an Arginine (R) at position 144 or replaces the Serine with a Glycine (G) at position 2019 of a LRRK2 polypeptide as numbered in SEQ ID NO: 3, or a variant thereof, encoded by the LRRK2 gene.
  • a method of editing a leucine-rich repeat kinase-2 (LRRK2) gene or a regulatory element thereof comprising contacting the LRRK2 gene or regulatory element thereof with (i) an adenosine base editor or a nucleic acid sequence encoding the adenosine base editor and (ii) a guide polynucleotide or a nucleic acid sequence encoding the guide polynucleotide, wherein the adenosine base editor comprises a programmable DNA binding domain and an adenosine deaminase domain, and wherein the guide polynucleotide directs the adenosine base editor to effect an A-to-G nucleobase alteration at a SNP in a LRRK2 gene, wherein the SNP does not encode a G2019S mutation in a LRRK2 polypeptide as numbered in SEQ ID NO: 3, or a variant thereof.
  • LRRK2 leucine-rich repeat
  • the adenosine deaminase domain comprises an amino acid substitution at amino acid position 82 or 166 as numbered in SEQ ID NO: 2 or a
  • the guide polynucleotide comprises a nucleic acid sequence complementary to the LRRK2 gene or regulatory element thereof comprising the SNP associated with Parkinson’s Disease.
  • the adenosine base editor is in complex with a single guide RNA (sgRNA) comprising a nucleic acid sequence complementary to the LRRK2 gene or regulatory element thereof comprising the SNP associated with Parkinson Disease.
  • sgRNA single guide RNA
  • the sgRNA comprises a nucleic acid sequence: 5'- AAGCGCAAGCCUGGAGGGAA -3'; or 5'-ACUACAGCAUUGCUCAGUAC-3'.
  • a method of editing an alpha-L-iduronidase (IDUA) gene or a regulatory element thereof comprising contacting the IDUA gene or regulatory element thereof with (i) an adenosine base editor or a nucleic acid sequence encoding the adenosine base editor and (ii) a guide polynucleotide or a nucleic acid sequence encoding the guide polynucleotide, wherein the adenosine base editor comprises a
  • adenosine deaminase domain comprises an amino acid substitution at amino acid position 82 or 166 as numbered in SEQ ID NO: 2 or a corresponding position thereof, and wherein the guide polynucleotide directs the adenosine base editor to effect an A-to-G nucleobase alteration in the IDUA gene or a regulatory element thereof.
  • the IDUA gene or regulatory element thereof comprises a SNP associated with Hurler syndrome.
  • the A-to-G nucleobase alteration is at the SNP associated with Hurler syndrome.
  • the SNP associated with Hurler syndrome results in a W402X or a W401X amino acid mutation in an IDUA polypeptide as numbered in SEQ ID NO: 4, or a variant thereof, encoded by the IDUA gene, wherein X is a stop codon.
  • the A-to-G nucleobase alteration changes the SNP associated with Hurler syndrome to a wild type nucleobase. In some embodiments, the A-to-G nucleobase alteration changes the SNP associated with Hurler syndrome to a non-wild type nucleobase that results in one or more ameliorated symptoms of Hurler syndrome. In some embodiments, the A-to-G alteration at the SNP associated with Hurler Syndrome changes a stop codon to a tryptophan in an IDUA polypeptide encoded by the IDUA gene.
  • the guide polynucleotide comprises a nucleic acid sequence complementary to the IDUA gene or regulatory element thereof comprising the SNP associated with Hurler syndrome.
  • the adenosine base editor is in complex with a single guide RNA (sgRNA) comprising a nucleic acid sequence complementary to the IDUA gene or regulatory element thereof comprising the SNP associated with Hurler syndrome.
  • sgRNA single guide RNA
  • the sgRNA comprises a nucleic acid sequence selected from the group consisting of: 5'- GACUCUAGGCAGAGGUCUCAA - 3 ',5'- ACUCUAGGCAGAGGUCUCAA-3 5'- CUCUAGGCCGAAGUGUCGC -3', and 5'- GCUCUAGGCCGAAGUGUCGC-3
  • a method of editing a methyl CpG binding protein 2 (MECP2) gene or regulatory element thereof comprising administering to the subject (i) an adenosine base editor or a nucleic acid sequence encoding the adenosine base editor and (ii) a guide polynucleotide or a nucleic acid sequence encoding the guide polynucleotide, wherein the adenosine base editor comprises a programmable DNA binding domain and an adenosine deaminase domain, wherein the adenosine deaminase domain comprises an amino acid substitution at amino acid position 82 or 166 as numbered in SEQ ID NO: 2 or a corresponding position thereof, and wherein the guide polynucleotide directs the adenosine base editor to effect an A-to-G nucleobase alteration in the MECP2 gene or a regulatory element thereof.
  • MECP2 methyl CpG binding protein 2
  • the MECP2 gene or regulatory element thereof comprises a SNP associated with Rett syndrome.
  • the A-to-G nucleobase alteration is at the SNP associated with Rett Syndrome.
  • the SNP associated with Rett syndrome results in a R106W or a T158M amino acid mutation in a MECP2 polypeptide as numbered in SEQ ID NO: 5, or a variant thereof, encoded by the MECP2 gene.
  • the SNP associated with Rett syndrome results in a R255X or a R270X amino acid mutation in a MECP2 polypeptide encoded by the MECP2 gene, wherein X is a stop codon.
  • the A-to-G nucleobase alteration changes the SNP associated with Rett syndrome to a wild type nucleobase. In some embodiments, the A-to-G nucleobase alteration changes the SNP associated with Rett syndrome to a non-wild type nucleobase that results in one or more ameliorated symptoms of Rett syndrome. In some embodiments, the A- to-G nucleobase alteration at the SNP associated with Rett Syndrome changes a stop codon to tryptophan in MECP2 polypeptide.
  • the guide polynucleotide comprises a nucleic acid sequence complementary to the MECP2 gene or regulatory element thereof comprising the SNP associated with Rett syndrome.
  • the adenosine base editor is in complex with a single guide RNA (sgRNA) comprising a nucleic acid sequence
  • the guide polynucleotide comprises a nucleic acid sequence selected from the group consisting of: 5’- CUUUUCACUUCCUGCCGGGG-3’, 5’-AGCUUCCAUGUCCAGCCUUC-3’, 5’- ACC AUGAAGUC AAAAUC AUU-3’ , and 5’- GCUUUCAGCCCCGUUUCUUG-3’.
  • a method of editing an ATP binding cassette subfamily member 4 (ABCA4) gene or regulatory element thereof comprising contacting the ABCA4 gene or regulatory element thereof with (i) an adenosine base editor or a nucleic acid sequence encoding the adenosine base editor and (ii) a guide polynucleotide or a nucleic acid sequence encoding the guide polynucleotide, wherein the adenosine base editor comprises a programmable DNA binding domain and an adenosine deaminase domain, wherein the adenosine deaminase domain comprises an amino acid substitution at amino acid position 82 or 166 as numbered in SEQ ID NO: 2 or a corresponding position thereof, and wherein the guide polynucleotide directs the adenosine base editor to effect an A-to-G nucleobase alteration in the ABCA4 gene or a regulatory element thereof.
  • ABCA4 ATP binding cassette subfamily member 4
  • the administration ameliorates at least one symptom related to Stargardt disease. In some embodiments, the administration results in faster amelioration of at least one symptom related to Stargardt disease as compared to treatment with a base editor without the amino acid substitution in the adenosine deaminase.
  • the ABCA4 gene comprises a SNP associated with Stargardt disease.
  • the A-to-G nucleobase alteration is at the SNP associated with Stargardt disease.
  • the SNP associated with Stargardt disease results in a A1038V, or a G1961E amino acid mutation in an ABCA4 polypeptide as numbered in SEQ ID NO: 6, or a variant thereof, encoded by the ABCA4 gene.
  • the SNP associated with Stargardt disease results in a G1961E amino acid mutation in the ABCA4 polypeptide as numbered in SEQ ID NO: 6, or a variant thereof.
  • the A-to-G nucleobase alteration changes the SNP associated with Stargardt disease to a wild type nucleobase. In some embodiments, the A-to-G nucleobase alteration changes the SNP associated with Stargardt disease to a non-wild type nucleobase that results in one or more ameliorated symptoms of Stargardt disease.
  • the guide polynucleotide comprises a nucleic acid sequence complementary to the ABCA4 gene or regulatory element thereof comprising the SNP associated with Stargardt Disease.
  • the adenosine base editor is in complex with a single guide RNA (sgRNA) comprising a nucleic acid sequence complementary to the ABCA4 gene or regulatory element thereof comprising the SNP associated with Stargardt Disease.
  • sgRNA single guide RNA
  • the sgRNA comprises the sequence 5'- CUCCAGGGCGAACUUCGAC ACAC AGC-3 '.
  • the contacting is in a cell. In some embodiments, the contacting results in less than 10% indels in a genome in the cell, wherein indel rate is measured by mismatch frequency between sequences flanking the single nucleotide modification and an unmodified sequence. In some embodiments, the contacting results in less than 5% indels in a genome in the cell, wherein indel rate is measured by mismatch frequency between sequences flanking the single nucleotide modification and an unmodified sequence. In some embodiments, the contacting results in less than 1% indels in a genome in the cell, wherein indel rate is measured by mismatch frequency between sequences flanking the single nucleotide modification and an unmodified sequence.
  • the cell is a neuron.
  • the contacting is in a population of cells.
  • the contacting results in the A-to-G nucleobase alteration in at least 40% of the population of cells after the contacting step.
  • the contacting results in the A-to-G nucleobase alteration in at least 50% of the population of cells after the contacting step.
  • the contacting results in the A-to-G nucleobase alteration in at least 70% of the population of cells after the contacting step.
  • at least 90% of the cells are viable after the contacting step.
  • the population of cells was not enriched after the contacting step.
  • the population of cells are neurons.
  • the contacting is in vivo or ex vivo.
  • the polynucleotide programmable DNA binding domain is a Cas9.
  • the Cas9 is a SpCas9, a SaCas9, or a variant thereof.
  • the polynucleotide programmable DNA binding domain comprises a modified SpCas9 having an altered protospacer-adjacent motif (PAM) specificity.
  • PAM protospacer-adjacent motif
  • the Cas9 has specificity for a PAM sequence selected from the group consisting of NGG, NGA, NGCG, NGN, NNGRRT, NNNRRT, NGCG, NGCN, NGTN, and NGC; wherein N is A, G, C, or T; and wherein R is A or G.
  • the polynucleotide programmable DNA binding domain is a nuclease inactive variant.
  • the polynucleotide programmable DNA binding domain is a nickase variant.
  • the nickase variant comprises an amino acid substitution D10A or a corresponding amino acid substitution thereof.
  • the adenosine deaminase domain comprises a TadA domain.
  • the adenosine deaminase comprises a TadA deaminase comprising a V82S alteration and/or a T166R alteration.
  • the adenosine deaminase further comprises one or more of the following alterations: Y147T, Y147R, Q154S, Y123H, Q154R, or a combination thereof.
  • the adenosine deaminase comprises a combination of alterations selected from the group consisting of: Y147R + Q154R +Y123H; Y147R + Q154R + I76Y; Y147R + Q154R + T166R; Y147T + Q154R; Y147T + Q154S; and Y123H + Y147R + Q154R + I76Y.
  • the adenosine base editor domain comprises an adenosine deaminase monomer. In various aspects and embodiments provided herein, the adenosine base editor comprises an adenosine deaminase dimer. In some embodiments, the TadA deaminase is a TadA*8 variant.
  • the TadA*8 variant is selected from the group consisting of: TadA*8.1, TadA*8.2, TadA*8.3, TadA*8.4, TadA*8.5, TadA*8.6, Tad A* 8.7, TadA*8.8, TadA*8.9, TadA*8.10, TadA*8.11, TadA*8.12, and TadA*8.13.
  • the adenosine base editor is an ABE8 base editor selected from the group consisting of: ABE8.1, ABE8.2, ABE8.3, ABE8.4, ABE8.5, ABE8.6, ABE8.7, ABE8.8, ABE8.9, ABE8.10, ABE8.11, ABE8.12, and ABE8.13.
  • provided herein is a cell produced by the method described in various aspects and embodiments disclosed herein. In some aspects, provided herein, is a population of cells produced by the method described in various aspects and embodiments disclosed herein.
  • a base editor system comprising (i) an adenosine base editor or a nucleic acid sequence encoding the adenosine base editor and (ii) a guide polynucleotide or a nucleic acid sequence encoding the guide polynucleotide, wherein the adenosine base editor comprises a programmable DNA binding domain and an adenosine deaminase domain, wherein the adenosine deaminase domain comprises an amino acid substitution at amino acid position 82 or 166 as numbered in SEQ ID NO: 2 or a corresponding position thereof, and wherein the guide polynucleotide directs the adenosine base editor to effect an A-to-G nucleobase alteration in a target gene or a regulatory element thereof associated with the neurological disorder.
  • the target gene is a leucine-rich repeat kinase-2 (LRRK2) gene and the neurological disease is Parkinson’s disease.
  • the target gene is an alpha-L- iduronidase (IDUA) gene and the neurological disease is Hurler syndrome.
  • the target gene is a methyl CpG binding protein 2 (MECP2) gene and the neurological disease is Rett syndrome.
  • the target gene is an ATP -binding cassette subfamily member 4 (ABCA4) gene and the neurological disease is Stargardt disease.
  • a base editor system comprising (i) an adenosine base editor or a nucleic acid sequence encoding the adenosine base editor and (ii) a guide polynucleotide or a nucleic acid sequence encoding the guide polynucleotide, wherein the adenosine base editor comprises a programmable DNA binding domain and an adenosine deaminase domain, wherein the adenosine deaminase domain comprises an amino acid substitution at amino acid position 82 or 166 as numbered in SEQ ID NO: 2 or a
  • guide polynucleotide directs the adenosine base editor to effect an A-to-G nucleobase alteration in a LRRK2 gene a regulatory element thereof.
  • the A-to-G nucleobase alteration is at a SNP associated with Parkinson’s disease in the LRRK2 gene or regulatory element thereof.
  • the SNP associated with Parkinson Disease results in a A419V, a R1441C, a R1441H, or a G2019S amino acid mutation in a LRRK2 polypeptide as numbered in SEQ ID NO: 3, or a variant thereof, encoded by the LRRK2 gene.
  • the A-to-G nucleobase alteration changes the SNP associated with Parkinson’s disease to a wild type nucleobase. In some embodiments, the A-to-G nucleobase alteration changes the SNP associated with Parkinson’s disease to a non-wild type nucleobase that results in ameliorated Parkinson’s symptoms. In some embodiments, the A- to-G nucleobase alteration changes a Cysteine or Histidine to an Arginine in a LRRK2 polypeptide encoded by the LRRK2 gene. In some embodiments, the A-to-G alteration changes a Serine to a Glycine in a LRRK2 polypeptide encoded by the LRRK2 gene.
  • the A-to-G alteration replaces the Cysteine (C) or Histidine (H) with an Arginine (R) at position 144 or replaces the Serine with a Glycine (G) at position 2019 of a LRRK2 polypeptide as numbered in SEQ ID NO: 3, or a variant thereof, encoded by the LRRK2 gene.
  • the adenosine deaminase domain comprises an amino acid substitution at amino acid position 82 or 166 as numbered in SEQ ID NO: 2 or a corresponding position thereof.
  • the guide polynucleotide comprises a nucleic acid sequence complementary to the LRRK2 gene or regulatory element thereof comprising the SNP associated with Parkinson’s Disease.
  • the adenosine base editor is in complex with a single guide RNA (sgRNA) comprising a nucleic acid sequence
  • the sgRNA comprises a nucleic acid sequence: 5 '-AAGCGC AAGCCUGGAGGGAA -3'; or 5'- ACUACAGC AUUGCUCAGUAC-3 '.
  • a base editor system comprising (i) an adenosine base editor or a nucleic acid sequence encoding the adenosine base editor and (ii) a guide polynucleotide or a nucleic acid sequence encoding the guide polynucleotide, wherein the adenosine base editor comprises a programmable DNA binding domain and an adenosine deaminase domain, wherein the adenosine deaminase domain comprises an amino acid substitution at amino acid position 82 or 166 as numbered in SEQ ID NO: 2 or a
  • the guide polynucleotide directs the adenosine base editor to effect an A-to-G nucleobase alteration in an alpha-L-iduronidase (IDUA) gene or a regulatory element thereof.
  • IDUA alpha-L-iduronidase
  • the IDUA gene or regulatory element thereof comprises a SNP associated with Hurler syndrome.
  • the A-to-G nucleobase alteration is at the SNP associated with Hurler syndrome.
  • the SNP associated with Hurler syndrome results in a W402X or a W401X amino acid mutation in an IDUA polypeptide as numbered in SEQ ID NO: 4, or a variant thereof, encoded by the IDUA gene, wherein X is a stop codon.
  • the A-to-G nucleobase alteration changes the SNP associated with Hurler syndrome to a wild type nucleobase. In some embodiments, the A-to-G nucleobase alteration changes the SNP associated with Hurler syndrome to a non-wild type nucleobase that results in one or more ameliorated symptoms of Hurler syndrome. In some embodiments, the A-to-G alteration at the SNP associated with Hurler Syndrome changes a stop codon to a tryptophan in an IDUA polypeptide encoded by the IDUA gene.
  • the guide polynucleotide comprises a nucleic acid sequence complementary to the IDUA gene or regulatory element thereof comprising the SNP associated with Hurler syndrome.
  • the adenosine base editor is in complex with a single guide RNA (sgRNA) comprising a nucleic acid sequence
  • the sgRNA comprises a nucleic acid sequence selected from the group consisting of: 5'- GACUCUAGGCAGAGGUCUCAA -3', 5'- ACUCUAGGC AGAGGUCUCAA-3 ', 5'- CUCUAGGCCGAAGUGUCGC -3', and 5'- GCUCUAGGCCGAAGUGUCGC-3 '.
  • a base editor system comprising (i) an adenosine base editor or a nucleic acid sequence encoding the adenosine base editor and (ii) a guide polynucleotide or a nucleic acid sequence encoding the guide polynucleotide, wherein the adenosine base editor comprises a programmable DNA binding domain and an adenosine deaminase domain, wherein the adenosine deaminase domain comprises an amino acid substitution at amino acid position 82 or 166 as numbered in SEQ ID NO: 2 or a
  • the guide polynucleotide directs the adenosine base editor to effect an A-to-G nucleobase alteration in a methyl CpG binding protein 2 (MECP2) gene or regulatory element thereof.
  • MECP2 methyl CpG binding protein 2
  • the MECP2 gene or regulatory element thereof comprises a SNP associated with Rett syndrome.
  • the A-to-G nucleobase alteration is at the SNP associated with Rett Syndrome.
  • the SNP associated with Rett syndrome results in a R106W or a T158M amino acid mutation in a MECP2 polypeptide as numbered in SEQ ID NO: 5, or a variant thereof, encoded by the MECP2 gene.
  • the SNP associated with Rett syndrome results in a R255X or a R270X amino acid mutation in a MECP2 polypeptide encoded by the MECP2 gene, wherein X is a stop codon.
  • the A-to-G nucleobase alteration changes the SNP associated with Rett syndrome to a wild type nucleobase. In some embodiments, the A-to-G nucleobase alteration changes the SNP associated with Rett syndrome to a non-wild type nucleobase that results in one or more ameliorated symptoms of Rett syndrome. In some embodiments, the A- to-G nucleobase alteration at the SNP associated with Rett Syndrome changes a stop codon to tryptophan in MECP2 polypeptide.
  • the guide polynucleotide comprises a nucleic acid sequence complementary to th eMECP2 gene or regulatory element thereof comprising the SNP associated with Rett syndrome.
  • the adenosine base editor is in complex with a single guide RNA (sgRNA) comprising a nucleic acid sequence
  • the guide polynucleotide comprises a nucleic acid sequence selected from the group consisting of: 5'- CUUUUCACUUCCUGCCGGGG-3 ', 5'-AGCUUCCAUGUCCAGCCUUC-3', 5'- ACCAUGAAGUCAAAAUC AUU-3 ', and 5'- GCUUUCAGCCCCGUUUCUUG-3'.
  • a base editor system comprising contacting (i) an adenosine base editor or a nucleic acid sequence encoding the adenosine base editor and (ii) a guide polynucleotide or a nucleic acid sequence encoding the guide polynucleotide, wherein the adenosine base editor comprises a programmable DNA binding domain and an adenosine deaminase domain, wherein the adenosine deaminase domain comprises an amino acid substitution at amino acid position 82 or 166 as numbered in SEQ ID NO: 2 or a
  • ABCA4 ATP binding cassette subfamily member 4
  • the administration ameliorates at least one symptom related to Stargardt disease. In some embodiments, the administration results in faster amelioration of at least one symptom related to Stargardt disease as compared to treatment with a base editor without the amino acid substitution in the adenosine deaminase.
  • the ABCA4 gene comprises a SNP associated with Stargardt disease. In some embodiments, the A-to-G nucleobase alteration is at the SNP associated with Stargardt disease. In some embodiments, the SNP associated with Stargardt disease results in a A1038V, or a G1961E amino acid mutation in an ABCA4 polypeptide as numbered in SEQ ID NO: 6, or a variant thereof, encoded by the ABCA4 gene.
  • the SNP associated with Stargardt disease results in a G1961E amino acid mutation in the ABCA4 polypeptide as numbered in SEQ ID NO: 6, or a variant thereof.
  • the A-to-G nucleobase alteration changes the SNP associated with Stargardt disease to a wild type nucleobase.
  • the A-to-G nucleobase alteration changes the SNP associated with Stargardt disease to a non-wild type nucleobase that results in ameliorated Stargardt Disease symptoms.
  • the guide polynucleotide comprises a nucleic acid sequence complementary to the ABCA4 gene or regulatory element thereof comprising the SNP associated with Stargardt Disease.
  • the adenosine base editor is in complex with a single guide RNA (sgRNA) comprising a nucleic acid sequence complementary to the ABCA4 gene or regulatory element thereof comprising the SNP associated with Stargardt Disease.
  • sgRNA single guide RNA
  • the sgRNA comprises the sequence 5'- CUCCAGGGCGAACUUCGAC ACAC AGC-3 '.
  • the polynucleotide programmable DNA binding domain is a Cas9.
  • the Cas9 is a SpCas9, a SaCas9, or a variant thereof.
  • the polynucleotide programmable DNA binding domain comprises a modified SpCas9 having an altered protospacer-adjacent motif (PAM) specificity.
  • PAM protospacer-adjacent motif
  • the Cas9 has specificity for a PAM sequence selected from the group consisting of NGG, NGA, NGCG, NGN, NNGRRT, NNNRRT, NGCG, NGCN, NGTN, and NGC, wherein N is A, G, C, or T and wherein R is A or G.
  • the polynucleotide programmable DNA binding domain is a nuclease inactive variant.
  • the polynucleotide programmable DNA binding domain is a nickase variant.
  • the nickase variant comprises an amino acid substitution D10A or a corresponding amino acid substitution thereof.
  • the adenosine deaminase domain comprises a TadA domain.
  • the adenosine deaminase comprises a TadA deaminase comprising a V82S alteration and/or a T166R alteration.
  • the adenosine deaminase further comprises one or more of the following alterations: Y147T, Y147R, Q154S, Y123H, Q154R, or a combination thereof.
  • the adenosine deaminase comprises a combination of alterations selected from the group consisting of: Y147R + Q154R +Y123H; Y147R + Q154R + I76Y; Y147R + Q154R +
  • the adenosine base editor domain comprises an adenosine deaminase monomer. In some embodiments, the adenosine base editor comprises an adenosine deaminase dimer.
  • the TadA deaminase is a TadA*8 variant.
  • the TadA*8 variant is selected from the group consisting of: TadA*8.1, TadA*8.2, TadA*8.3, TadA*8.4, TadA*8.5, TadA*8.6, TadA*8.7, TadA* 8.8, TadA* 8.9, TadA* 8.10, TadA* 8.11, TadA* 8.12, and TadA* 8.13.
  • the adenosine base editor is an ABE8 base editor selected from the group consisting of: ABE8.1, ABE8.2, ABE8.3, ABE8.4, ABE8.5, ABE8.6, ABE8.7, ABE8.8, ABE8.9, ABE8.10, ABE8.11, ABE8.12, and ABE8.13.
  • a vector comprising the nucleic acid sequence encoding the adenosine base editor described herein. In some aspects, provided herein, is a vector comprising the nucleic acid sequence encoding the adenosine base editor and the guide polynucleotide described herein. In some embodiments, the vector is a viral vector, a lentiviral vector, or an AAV vector.
  • a cell comprising the base editor system or the vector described herein.
  • the cell is a central nervous system cell.
  • the cell is a neuron.
  • the cell is a photoreceptor.
  • the cell is in vitro , in vivo , or ex vivo.
  • a pharmaceutical composition comprising the base editor, the vector, or the cell described herein and a pharmaceutically acceptable carrier.
  • the pharmaceutical composition described herein further comprises a lipid.
  • the pharmaceutical composition described herein further comprises a virus.
  • kits comprising the base editor or the vector described herein.
  • At least one nucleotide of the guide polynucleotide comprises a non-naturally occurring modification. In various embodiments of the methods described herein, at least one nucleotide of the nucleic acid sequence comprises a non-naturally occurring modification. In various embodiments, at least one nucleotide of the nucleic acid sequence of the base editor system comprises a non- naturally occurring modification. In some embodiments, the non-naturally occurring modification is a chemical modification. In some embodiments, the chemical modification is a 2’-0-methylation. In some embodiments, the nucleic acid sequence comprises a phosphorothi oate .
  • the words“comprising” (and any form of comprising, such as“comprise” and“comprises”),“having” (and any form of having, such as “have” and“has”),“including” (and any form of including, such as“includes” and“include”) or“containing” (and any form of containing, such as“contains” and“contain”) are inclusive or open-ended and do not exclude additional, unrecited elements or method steps. It is contemplated that any embodiment discussed in this specification can be implemented with respect to any method or composition of the present disclosure, and vice versa. Furthermore, compositions of the present disclosure can be used to achieve methods of the present disclosure.
  • “about” or“approximately” means within an acceptable error range for the particular value as determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined, i.e., the limitations of the measurement system.
  • “about” can mean within 1 or more than 1 standard deviation, per the practice in the art.
  • “about” can mean a range of up to 20%, up to 10%, up to 5%, or up to 1% of a given value.
  • the term can mean within an order of magnitude, such as within 5-fold or within 2-fold, of a value.
  • Ranges provided herein are understood to be shorthand for all of the values within the range.
  • a range of 1 to 50 is understood to include any number, combination of numbers, or sub-range from the group consisting 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15,
  • abasic base editor is meant an agent capable of excising a nucleobase and inserting a DNA nucleobase (A, T, C, or G).
  • Abasic base editors comprise a nucleic acid glycosylase polypeptide or fragment thereof.
  • the nucleic acid glycosylase is a mutant human uracil DNA glycosylase comprising an Asp at amino acid 204 ( e.g ., replacing an Asn at amino acid 204) in the following sequence, or corresponding position in a uracil DNA glycosylase, and having cytosine-DNA glycosylase activity, or active fragment thereof.
  • the nucleic acid glycosylase is a mutant human uracil DNA glycosylase comprising an Ala, Gly, Cys, or Ser at amino acid 147 (e.g., replacing a Tyr at amino acid 147) in the following sequence, or corresponding position in a uracil DNA glycosylase, and having thymine-DNA glycosylase activity, or an active fragment thereof.
  • sequence of exemplary human uracil-DNA glycosylase, isoform 1 follows:
  • the abasic editor is any one of the abasic editors described in PCT/JP2015/080958 and US20170321210, which are incorporated herein by reference.
  • the abasic editor comprises a mutation at a position shown in the sequence above in bold with underlining or at a corresponding amino acid in any other abasic editor or uracil deglycosylase known in the art.
  • the abasic editor comprises a mutation at Y147, N204, L272, and/or R276, or corresponding position.
  • the abasic editor comprises a Y147A or Y147G mutation, or corresponding mutation.
  • the abasic editor comprises a N204D mutation, or corresponding mutation. In another embodiment, the abasic editor comprises a L272A mutation, or corresponding mutation. In another embodiment, the abasic editor comprises a R276E or R276C mutation, or corresponding mutation.
  • adenosine deaminase is meant a polypeptide or fragment thereof capable of catalyzing the hydrolytic deamination of adenine or adenosine.
  • the deaminase or deaminase domain is an adenosine deaminase catalyzing the hydrolytic deamination of adenosine to inosine or deoxy adenosine to deoxyinosine.
  • the adenosine deaminase catalyzes the hydrolytic deamination of adenine or adenosine in deoxyribonucleic acid (DNA).
  • adenosine deaminases e.g ., engineered adenosine deaminases, evolved adenosine deaminases
  • the adenosine deaminases may be from any organism, such as a bacterium.
  • the adenosine deaminase is a TadA deaminase. In some embodiments, the TadA deaminase is TadA variant. In some embodiments, the TadA variant is a TadA*8. In some embodiments, the deaminase or deaminase domain is a variant of a naturally occurring deaminase from an organism, such as a human, chimpanzee, gorilla, monkey, cow, dog, rat, or mouse. In some embodiments, the deaminase or deaminase domain does not occur in nature.
  • the deaminase or deaminase domain is at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75% at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% identical to a naturally occurring deaminase.
  • deaminase domains are described in International PCT Application Nos. PCT/2017/045381 (WO 2018/027078) and PCT/US2016/058344 (WO 2017/070632), each of which is incorporated herein by reference for its entirety. Also, see Komor, A.C., etal.
  • a wild type TadA(wt) adenosine deaminase has the following sequence (also termed Tad A reference sequence):
  • the adenosine deaminase comprises an alteration in the following sequence:
  • TadA*7.10 comprises at least one alteration. In some embodiments, TadA*7.10 comprises an alteration at amino acid 82 and/or 166. In particular embodiments, a variant of the above-referenced sequence comprises one or more of the following alterations: Y147T, Y147R, Q154S, Y123H, V82S, T166R, and/or Q154R.
  • the alteration Y123H is also referred to herein as H123H (the alteration H123Y in TadA*7.10 reverted back to Y123H (wt)).
  • a variant of the TadA*7.10 sequence comprises a combination of alterations selected from the group consisting of: Y147T + Q154R; Y147T + Q154S; Y147R + Q154S; V82S + Q154S; V82S + Y147R; V82S + Q154R; V82S + Y123H; I76Y + V82S; V82S + Y123H + Y147T; V82S + Y123H + Y147R; V82S + Y123H + Q154R; Y147R + Q154R +Y123H; Y147R + Q154R + I76Y; Y147R + Q154R + T166R; Y123H + Y147R + Q154R + I76Y; V82S + Y123H + Y147R + Q154R; and I76Y + V82S + Y123H + Y147R + Q154R.
  • the invention provides adenosine deaminase variants that include deletions, e.g ., TadA*8, comprising a deletion of the C terminus beginning at residue 149, 150, 151, 152, 153, 154, 155, 156, or 157.
  • the adenosine deaminase variant is a TadA (e.g, TadA*8) monomer comprising one or more of the following alterations: Y147T, Y147R, Q154S, Y123H, V82S, T166R, and/or Q154R.
  • the adenosine deaminase variant is TadA (e.g, TadA*8) a monomer comprising a combination of alterations selected from the group consisting of: Y147T + Q154R; Y147T + Q154S; Y147R + Q154S; V82S + Q154S; V82S + Y147R; V82S + Q154R; V82S + Y123H; I76Y + V82S; V82S + Y123H + Y147T; V82S + Y123H + Y147R; V82S + Y123H + Q154R; Y147R + Q154R +Y123H; Y147R + Q154R + I76Y; Y147R + Q154R + T166R; Y123H + Y147R + Q154R + I76Y; V82S + Y123H + Y147R + Q154R; and I76Y + V82S + Y123H + Y147
  • the adenosine deaminase variant is a homodimer comprising two adenosine deaminase domains (e.g, TadA*8) each having one or more of the following alterations Y147T, Y147R, Q154S, Y123H, V82S, T166R, and/or Q154R.
  • the adenosine deaminase variant is a homodimer comprising two adenosine deaminase domains (e.g, TadA*8) each having a combination of alterations selected from the group consisting of: Y147T + Q154R; Y147T + Q154S; Y147R + Q154S; V82S + Q154S; V82S + Y147R; V82S + Q154R; V82S + Y123H; I76Y + V82S; V82S + Y123H + Y147T; V82S + Y123H + Y147R; V82S + Y123H + Q154R; Y147R + Q154R +Y123H; Y147R + Q154R + I76Y; Y147R + Q154R + T166R; Y123H + Y147R + Q154R + I76Y; V82S + Y123H + Y147R + Q154R; and
  • the adenosine deaminase variant is a heterodimer comprising a wild-type TadA adenosine deaminase domain and an adenosine deaminase variant domain (e.g., TadA*8) comprising one or more of the following alterations Y147T, Y147R, Q154S, Y123H, V82S, T166R, and/or Q154R.
  • the adenosine deaminase variant is a heterodimer comprising a wild-type TadA adenosine deaminase domain and an adenosine deaminase variant domain (e.g.
  • TadA*8 comprising a combination of alterations selected from the group consisting of: Y147T + Q154R; Y147T + Q154S; Y147R + Q154S; V82S + Q154S; V82S + Y147R; V82S + Q154R; V82S + Y123H; I76Y + V82S; V82S + Y123H + Y147T; V82S + Y123H + Y147R; V82S + Y123H + Q154R; Y147R + Q154R +Y123H; Y147R + Q154R + I76Y; Y147R + Q154R + T166R; Y123H + Y147R + Q154R + I76Y; V82S + Y123H + Y147R + Q154R; and I76Y + V82S + Y123H + Y147R + Q154R.
  • the adenosine deaminase variant is a heterodimer comprising a TadA*7.10 domain and an adenosine deaminase variant domain (e.g ., TadA*8) comprising one or more of the following alterations Y147T, Y147R, Q154S, Y123H, V82S, T166R, and/or Q154R.
  • the adenosine deaminase variant is a heterodimer comprising a TadA*7.10 domain and an adenosine deaminase variant domain (e.g.
  • TadA*8 comprising a combination of the following alterations: Y147T + Q154R; Y147T + Q154S; Y147R + Q154S; V82S + Q154S; V82S + Y147R; V82S + Q154R; V82S + Y123H; I76Y + V82S; V82S + Y123H + Y147T; V82S + Y123H + Y147R; V82S + Y123H + Q154R;
  • the adenosine deaminase is a TadA*8 that comprises or consists essentially of the following sequence or a fragment thereof having adenosine deaminase activity:
  • the TadA*8 is truncated. In some embodiments, the truncated Tad A* 8 is missing 1, 2, 3, 4, 5 ,6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 6, 17, 18, 19, or 20 N-terminal amino acid residues relative to the full length TadA*8. In some embodiments, the truncated Tad A* 8 is missing 1, 2, 3, 4, 5 ,6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 6, 17, 18, 19, or 20 C-terminal amino acid residues relative to the full length TadA*8. In some embodiments the adenosine deaminase variant is a full-length TadA*8.
  • an adenosine deaminase heterodimer comprises a TadA*8 domain and an adenosine deaminase domain selected from one of the following:
  • an adenosine deaminase heterodimer comprises a TadA*8 domain and an adenosine deaminase domain selected from one of the following:
  • TadA7.10 or TadA7.10 variants contemplated as a component of a heterodimer with a Tad A* 8 include:
  • the adenosine deaminase variant comprises an alteration in TadA7.10.
  • TadA7.10 comprises an alteration at amino acid 82 or 166.
  • a variant in the above-referenced sequence comprises one or more of the following alterations: Y147T, Y147R, Q154S, Y123H, V82S, T166R, and Q154R.
  • the adenosine deaminase variant comprises a combination of alterations selected from the group consisting of Y147R + Q154R +Y123H; Y147R + Q154R + I76Y; Y147R + Q154R + T166R; Y147T + Q154R; Y147T + Q154S; and Y123H +
  • the invention provides adenosine deaminase variants that include deletions, e.g., TadA7.10 comprising a deletion of the C terminus beginning at residue 149, 150, 151, 152, 153, 154, 155, 156, or 157.
  • the adenosine deaminase variant is a TadA monomer comprising one or more of the following alterations: Y147T, Y147R, Q154S, Y123H, V82S, T166R, Q154R.
  • the adenosine deaminase variant is a monomer comprising the following alterations: Y147R + Q154R +Y123H; Y147R + Q154R + I76Y; Y147R + Q154R + T166R; Y147T + Q154R; Y147T + Q154S; and Y123H + Y147 R + Q154R + I76Y.
  • the adenosine deaminase variant is a homodimer comprising two adenosine deaminase domains each having one or more of the following alterations Y147T, Y147R, Q154S, Y123H, V82S, T166R, Q154R.
  • the adenosine deaminase variant is a heterodimer comprising a wild-type adenosine deaminase domain or a TadA7.10 domain and an adenosine deaminase variant domain comprising one or more of the following alterations Y147T, Y147R, Q154S, Y123H, V82S, T166R, Q154R.
  • the adenosine deaminase variant is a heterodimer comprising a TadA7.10 domain and an adenosine deaminase variant of TadA7.10 comprising the following alterations: Y147R + Q154R +Y123H; Y147R + Q154R + I76Y; Y147R + Q154R + T166R; Y147T + Q154R; Y147T + Q154S; and Y123H + Y147R + Q154R + I76Y.
  • composition administration is referred to herein as providing one or more compositions described herein to a patient or a subject.
  • composition administration e.g., injection
  • s.c. sub-cutaneous injection
  • i.d. intradermal
  • i.p. intraperitoneal
  • intramuscular injection intramuscular injection.
  • Parenteral administration can be, for example, by bolus injection or by gradual perfusion over time.
  • parenteral administration includes infusing or injecting intravascularly, intravenously, intramuscularly, intraarterially, intrathecally, intratumorally, intradermally, intraperitoneally, transtracheally, subcutaneously, subcuticularly, intraarticularly, subcapsularly, subarachnoidly and intrasternally.
  • administration can be by the oral route.
  • agent is meant any small molecule chemical compound, antibody, nucleic acid molecule, or polypeptide, or fragments thereof.
  • alteration is meant a change (e.g . increase or decrease) in the structure, expression levels or activity of a gene or polypeptide as detected by standard art known methods such as those described herein.
  • an alteration includes a change in a polynucleotide or polypeptide sequence or a change in expression levels, such as a 10% change, a 25% change, a 40% change, a 50% change, or greater.
  • ameliorate is meant decrease, suppress, attenuate, diminish, arrest, or stabilize the development or progression of a disease.
  • analog is meant a molecule that is not identical, but has analogous functional or structural features.
  • a polynucleotide or polypeptide analog retains the biological activity of a corresponding naturally-occurring polynucleotide or polypeptide, while having certain modifications that enhance the analog's function relative to a naturally occurring polynucleotide or polypeptide. Such modifications could increase the analog's affinity for DNA, efficiency, specificity, protease or nuclease resistance, membrane permeability, and/or half-life, without altering, for example, ligand binding.
  • An analog may include an unnatural nucleotide or amino acid.
  • base editor or “nucleobase editor (NBE)” is meant an agent that binds a polynucleotide and has nucleobase modifying activity.
  • the base editor comprises a nucleobase modifying polypeptide (e.g., a deaminase) and a nucleic acid programmable nucleotide binding domain in conjunction with a guide polynucleotide (e.g, guide RNA).
  • the agent is a biomolecular complex comprising a protein domain having base editing activity, i.e., a domain capable of modifying a base (e.g, A, T, C, G, or U) within a nucleic acid molecule (e.g, DNA).
  • a protein domain having base editing activity i.e., a domain capable of modifying a base (e.g, A, T, C, G, or U) within a nucleic acid molecule (e.g, DNA).
  • the polynucleotide programmable DNA binding domain is fused or linked to a deaminase domain.
  • the agent is a fusion protein comprising a domain having base editing activity.
  • the protein domain having base editing activity is linked to the guide RNA (e.g. , via an RNA binding motif on the guide RNA and an RNA binding domain fused to the deaminase).
  • the domain having base editing activity is capable of deaminating a base within a nucleic acid molecule.
  • the base editor is capable of deaminating one or more bases within a DNA molecule.
  • the base editor is capable of deaminating an adenosine (A) within DNA.
  • the base editor is an adenosine base editor (ABE).
  • cytidine deaminase is meant a polypeptide or fragment thereof capable of catalyzing a deamination reaction that converts an amino group to a carbonyl group.
  • the cytidine deaminase has at least about 85% identity to APOBEC or AID.
  • the cytidine deaminase converts cytosine to uracil or 5-methylcytosine to thymine.
  • PmCDAl which is derived from Petromyzon marinus (Petromyzon marinus cytosine deaminase 1,“PmCDAl”), AID (Activation-induced cytidine deaminase; AICDA), which is derived from a mammal (e.g., human, swine, bovine, horse, monkey etc.), and APOBEC are exemplary cytidine deaminases.
  • the base editor is a reprogrammable base editor fused to a deaminase (e.g, an adenosine deaminase or cytidine deaminase).
  • the base editor is a Cas9 fused to a deaminase (e.g, an adenosine deaminase or cytidine deaminase).
  • the base editor is a nuclease-inactive Cas9 (dCas9) fused to a deaminase (e.g, an adenosine deaminase or cytidine deaminase).
  • the Cas9 is a circular permutant Cas9 (e.g, spCas9 or saCas9). Circular permutant Cas9s are known in the art and described, for example, in Oakes etal., Cell 176, 254-267, 2019.
  • the base editor is fused to an inhibitor of base excision repair, for example, a UGI domain, or a dISN domain.
  • the fusion protein comprises a Cas9 nickase fused to a deaminase and an inhibitor of base excision repair, such as a UGI or dISN domain.
  • the base editor is an abasic base editor.
  • the base editor is an adenosine base editor (ABE).
  • ABE adenosine base editor
  • an adenosine deaminase is evolved from TadA.
  • the base editors of the present invention comprise a napDNAbp domain with an internally fused catalytic (e.g., deaminase) domain.
  • the napDNAbp is a Casl2a (Cpfl) with an internally fused deaminase domain.
  • the napDNAbp is a Casl2b (c2cl) with an internally fused deaminase domain.
  • the napDNAbp is a Casl2c (c2c3) with an internally fused deaminase domain.
  • the napDNAbp is a Casl2d (CasX) with an internally fused deaminase domain.
  • the napDNAbp is a Casl2e (CasY) with an internally fused deaminase domain.
  • the napDNAbp is a Casl2g with an internally fused deaminase domain.
  • the napDNAbp is a Casl2h with an internally fused deaminase domain.
  • napDNAbp is a Casl2i with an internally fused deaminase domain.
  • the base editor is a catalytically dead Casl2 (dCasl2) fused to a deaminase domain.
  • the base editor is a Casl2 nickase (nCasl2) fused to a deaminase domain.
  • base editors are generated (e.g ., ABE8) by cloning an adenosine deaminase variant (e.g., TadA*8) into a scaffold that includes a circular permutant Cas9 (e.g, spCAS9 or saCAS9) and a bipartite nuclear localization sequence.
  • Circular permutant Cas9s are known in the art and described, for example, in Oakes et al., Cell 176, 254-267, 2019. Exemplary circular permutants follow where the bold sequence indicates sequence derived from Cas9, the italics sequence denotes a linker sequence, and the underlined sequence denotes a bipartite nuclear localization sequence.
  • the ABE8 is selected from a base editor from Table 6-9, 13, or 14 infra.
  • ABE8 contains an adenosine deaminase variant evolved from TadA.
  • the adenosine deaminase variant of ABE8 is a TadA*8 variant as described in Table 7, 9, 13 or 14 infra.
  • the adenosine deaminase variant is TadA*7.10 variant (e.g. TadA*8) comprising one or more of an alteration selected from the group of Y147T, Y147R, Q154S, Y123H, V82S, T166R, and/or Q154R.
  • ABE8 comprises TadA*7.10 variant (e.g. TadA*8) with a combination of alterations selected from the group consisting of Y147T + Q154R; Y147T + Q154S; Y147R + Q154S; V82S + Q154S; V82S + Y147R; V82S + Q154R; V82S + Y123H; I76Y + V82S; V82S + Y123H + Y147T; V82S + Y123H + Y147R; V82S + Y123H + Y147R; V82S + Y123H +
  • ABE8 is a monomeric construct. In some embodiments, ABE8 is a heterodimeric construct. In some embodiments, the ABE8 base editor comprises the sequence:
  • the polynucleotide programmable DNA binding domain is a CRISPR associated (e.g, Cas or Cpfl) enzyme.
  • the base editor is a catalytically dead Cas9 (dCas9) fused to a deaminase domain.
  • the base editor is a Cas9 nickase (nCas9) fused to a deaminase domain.
  • the base editor is fused to an inhibitor of base excision repair (BER).
  • the inhibitor of base excision repair is a uracil DNA glycosylase inhibitor (UGI).
  • the inhibitor of base excision repair is an inosine base excision repair inhibitor.
  • a cytidine base editor as used in the base editing compositions, systems and methods described herein has the following nucleic acid sequence (8877 base pairs), (Addgene, Watertown, MA.; Komor AC, et al., 2017, Sci Adv., 30;3(8):eaao4774. doi: 10.1126/sciadv.aao4774) as provided below.
  • Polynucleotide sequences having at least 95% or greater identity to the BE4 nucleic acid sequence are also encompassed.
  • the adenine base editor as used in the base editing compositions, systems and methods described herein has the nucleic acid sequence (8877 base pairs), (Addgene, Watertown, MA.; Gaudelli NM, et al, Nature. 2017 Nov 23;551(7681):464- 471. doi: 10.1038/nature24644; Koblan LW, et al, Nat Biotechnol. 2018 Oct;36(9):843-846. doi: 10.1038/nbt.4172.) as provided below. Polynucleotide sequences having at least 95% or greater identity to the ABE nucleic acid sequence are also encompassed.
  • base editing activity is meant acting to chemically alter a base within a polynucleotide.
  • a first base is converted to a second base.
  • the base editing activity is cytidine deaminase activity, e.g ., converting target OG to T ⁇ A.
  • the base editing activity is adenosine or adenine deaminase activity, e.g. , converting A ⁇ T to G * C.
  • the base editing activity is cytidine deaminase activity, e.g. , converting target OG to T ⁇ A and adenosine or adenine deaminase activity, e.g.
  • base editing activity is assessed by efficiency of editing.
  • Base editing efficiency may be measured by any suitable means, for example, by sanger sequencing or next generation sequencing.
  • base editing efficiency is measured by percentage of total sequencing reads with nucleobase conversion effected by the base editor, for example, percentage of total sequencing reads with target A.T base pair converted to a G.C base pair.
  • base editing efficiency is measured by percentage of total cells with nucleobase conversion effected by the abse editor, when base editing is performed in a population of cells.
  • the term“base editor system” refers to a system for editing a nucleobase of a target nucleotide sequence.
  • the base editor system comprises (1) a polynucleotide programmable nucleotide binding domain (e.g ., Cas9); (2) a deaminase domain (e.g., an adenosine deaminase or a cytidine deaminase) for deaminating said nucleobase; and (3) one or more guide polynucleotide (e.g, guide RNA).
  • a polynucleotide programmable nucleotide binding domain e.g ., Cas9
  • a deaminase domain e.g., an adenosine deaminase or a cy
  • the polynucleotide programmable nucleotide binding domain is a
  • the base editor is an adenine or adenosine base editor (ABE). In some embodiments, the base editor system is ABE8.
  • a base editor system may comprise more than one base editing component.
  • a base editor system may include more than one deaminase.
  • a base editor system may include one or more adenosine deaminases.
  • a single guide polynucleotide may be utilized to target different deaminases to a target nucleic acid sequence.
  • a single pair of guide polynucleotides may be utilized to target different deaminases to a target nucleic acid sequence.
  • the deaminase domain and the polynucleotide programmable nucleotide binding component of a base editor system may be associated with each other covalently or non- covalently, or any combination of associations and interactions thereof.
  • a deaminase domain can be targeted to a target nucleotide sequence by a polynucleotide programmable nucleotide binding domain.
  • a polynucleotide programmable nucleotide binding domain can be fused or linked to a deaminase domain.
  • a polynucleotide programmable nucleotide binding domain can target a deaminase domain to a target nucleotide sequence by non-covalently interacting with or associating with the deaminase domain.
  • the deaminase domain can comprise an additional heterologous portion or domain that is capable of interacting with, associating with, or capable of forming a complex with an additional heterologous portion or domain that is part of a polynucleotide programmable nucleotide binding domain.
  • the additional heterologous portion may be capable of binding to, interacting with, associating with, or forming a complex with a polypeptide.
  • the additional heterologous portion may be capable of binding to, interacting with, associating with, or forming a complex with a polynucleotide. In some embodiments, the additional heterologous portion may be capable of binding to a guide polynucleotide. In some embodiments, the additional heterologous portion may be capable of binding to a polypeptide linker. In some embodiments, the additional heterologous portion may be capable of binding to a polynucleotide linker. The additional heterologous portion may be a protein domain.
  • the additional heterologous portion may be a K Homology (KH) domain, a MS2 coat protein domain, a PP7 coat protein domain, a SfMu Com coat protein domain, a steril alpha motif, a telomerase Ku binding motif and Ku protein, a telomerase Sm7 binding motif and Sm7 protein, or an RNA recognition motif.
  • KH K Homology
  • a base editor system may further comprise a guide polynucleotide component. It should be appreciated that components of the base editor system may be associated with each other via covalent bonds, noncovalent interactions, or any combination of associations and interactions thereof.
  • a deaminase domain can be targeted to a target nucleotide sequence by a guide polynucleotide.
  • the deaminase domain can comprise an additional heterologous portion or domain (e.g ., polynucleotide binding domain such as an RNA or DNA binding protein) that is capable of interacting with, associating with, or capable of forming a complex with a portion or segment (e.g., a polynucleotide motif) of a guide polynucleotide.
  • the additional heterologous portion or domain e.g., polynucleotide binding domain such as an RNA or DNA binding protein
  • the additional heterologous portion may be capable of binding to, interacting with, associating with, or forming a complex with a polypeptide. In some embodiments, the additional heterologous portion may be capable of binding to, interacting with, associating with, or forming a complex with a polynucleotide. In some embodiments, the additional heterologous portion may be capable of binding to a guide polynucleotide. In some embodiments, the additional heterologous portion may be capable of binding to a polypeptide linker. In some embodiments, the additional heterologous portion may be capable of binding to a polynucleotide linker. The additional heterologous portion may be a protein domain.
  • the additional heterologous portion may be a K Homology (KH) domain, a MS2 coat protein domain, a PP7 coat protein domain, a SfMu Com coat protein domain, a sterile alpha motif, a telomerase Ku binding motif and Ku protein, a telomerase Sm7 binding motif and Sm7 protein, or an RNA recognition motif.
  • KH K Homology
  • a base editor system can further comprise an inhibitor of base excision repair (BER) component.
  • BER base excision repair
  • components of the base editor system may be associated with each other via covalent bonds, noncovalent interactions, or any combination of associations and interactions thereof.
  • the inhibitor of BER component may comprise a BER inhibitor.
  • the inhibitor of BER can be a uracil DNA glycosylase inhibitor (UGI).
  • the inhibitor of BER can be an inosine BER inhibitor.
  • the inhibitor of BER can be targeted to the target nucleotide sequence by the polynucleotide programmable nucleotide binding domain.
  • a polynucleotide programmable nucleotide binding domain can be fused or linked to an inhibitor of BER. In some embodiments, a polynucleotide programmable nucleotide binding domain can be fused or linked to a deaminase domain and an inhibitor of BER. In some embodiments, a polynucleotide programmable nucleotide binding domain can target an inhibitor of BER to a target nucleotide sequence by non-covalently interacting with or associating with the inhibitor of BER.
  • the inhibitor of BER component can comprise an additional heterologous portion or domain that is capable of interacting with, associating with, or capable of forming a complex with an additional heterologous portion or domain that is part of a polynucleotide programmable nucleotide binding domain.
  • the inhibitor of BER can be targeted to the target nucleotide sequence by the guide polynucleotide.
  • the inhibitor of BER can comprise an additional heterologous portion or domain (e.g ., polynucleotide binding domain such as an RNA or DNA binding protein) that is capable of interacting with, associating with, or capable of forming a complex with a portion or segment (e.g., a polynucleotide motif) of a guide polynucleotide.
  • the additional heterologous portion or domain of the guide polynucleotide can be fused or linked to the inhibitor of BER.
  • the additional heterologous portion may be capable of binding to, interacting with, associating with, or forming a complex with a polynucleotide.
  • the additional heterologous portion may be capable of binding to a guide polynucleotide.
  • the additional heterologous portion may be capable of binding to a polypeptide linker.
  • the additional heterologous portion may be capable of binding to a polynucleotide linker.
  • the additional heterologous portion may be a protein domain.
  • the additional heterologous portion may be a K Homology (KH) domain, a MS2 coat protein domain, a PP7 coat protein domain, a SfMu Com coat protein domain, a sterile alpha motif, a telomerase Ku binding motif and Ku protein, a telomerase Sm7 binding motif and Sm7 protein, or an RNA recognition motif.
  • KH K Homology
  • Cas9 or“Cas9 domain” refers to an RNA guided nuclease comprising a Cas9 protein, or a fragment thereof (e.g, a protein comprising an active, inactive, or partially active DNA cleavage domain of Cas9, and/or the gRNA binding domain of Cas9).
  • a Cas9 nuclease is also referred to sometimes as a Casnl nuclease or a CRISPR (clustered regularly interspaced short palindromic repeat) associated nuclease.
  • CRISPR is an adaptive immune system that provides protection against mobile genetic elements (viruses, transposable elements and conjugative plasmids).
  • CRISPR clusters contain spacers, sequences
  • CRISPR clusters are transcribed and processed into CRISPR RNA (crRNA).
  • crRNA CRISPR RNA
  • type II CRISPR systems correct processing of pre-crRNA requires a trans-encoded small RNA (tracrRNA), endogenous ribonuclease 3 (me) and a Cas9 protein.
  • tracrRNA trans-encoded small RNA
  • me endogenous ribonuclease 3
  • Cas9 protein The tracrRNA serves as a guide for ribonuclease 3-aided processing of pre-crRNA.
  • Cas9/crRNA/tracrRNA endonucleolytically cleaves linear or circular dsDNA target complementary to the spacer.
  • RNA single guide RNAs
  • sgRNA single guide RNAs
  • Cas9 recognizes a short motif in the CRISPR repeat sequences (the PAM or protospacer adjacent motif) to help distinguish self versus non-self.
  • Cas9 nuclease sequences and structures are well known to those of skill in the art (see, e.g. , “Complete genome sequence of an Ml strain of Streptococcus pyogenes.” Ferretti et al. ,
  • Cas9 nucleases and sequences include Cas9 sequences from the organisms and loci disclosed in Chylinski, Rhun, and Charpentier,“The tracrRNA and Cas9 families of type II CRISPR-Cas immunity systems” (2013) RNA Biology 10:5, 726-737; the entire contents of which are incorporated herein by reference.
  • An exemplary Cas9 is Streptococcus pyogenes Cas9 (spCas9), the amino acid sequence of which is provided below:
  • a nuclease-inactivated Cas9 protein may interchangeably be referred to as a“dCas9” protein (for nuclease-“dead” Cas9) or catalytically inactive Cas9.
  • Methods for generating a Cas9 protein (or a fragment thereof) having an inactive DNA cleavage domain are known (See, e.g ., Jinek et al, Science. 337:816-821(2012); Qi et al,“Repurposing CRISPR as an RNA-Guided Platform for Sequence-Specific Control of Gene Expression” (2013) Cell.
  • the DNA cleavage domain of Cas9 is known to include two subdomains, the HNH nuclease subdomain and the RuvCl subdomain.
  • the HNH subdomain cleaves the strand complementary to the gRNA, whereas the RuvCl subdomain cleaves the non-complementary strand. Mutations within these subdomains can silence the nuclease activity of Cas9.
  • the mutations D10A and H840A completely inactivate the nuclease activity of S. pyogenes Cas9 (Jinek et al, Science.
  • a Cas9 nuclease has an inactive (e.g., an inactivated) DNA cleavage domain, that is, the Cas9 is a nickase, referred to as an “nCas9” protein (for“nickase” Cas9).
  • proteins comprising fragments of Cas9 are provided.
  • a protein comprises one of two Cas9 domains: (1) the gRNA binding domain of Cas9; or (2) the DNA cleavage domain of Cas9.
  • proteins comprising Cas9 or fragments thereof are referred to as“Cas9 variants.”
  • a Cas9 variant shares homology to Cas9, or a fragment thereof.
  • a Cas9 variant is at least about 70% identical, at least about 80% identical, at least about 90% identical, at least about 95% identical, at least about 96% identical, at least about 97% identical, at least about 98% identical, at least about 99% identical, at least about 99.5% identical, or at least about 99.9% identical to wild-type Cas9.
  • the Cas9 variant may have 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 21, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46,
  • the Cas9 variant comprises a fragment of Cas9 (e.g, a gRNA binding domain or a DNA-cleavage domain), such that the fragment is at least about 70% identical, at least about 80% identical, at least about 90% identical, at least about 95% identical, at least about 96% identical, at least about 97% identical, at least about 98% identical, at least about 99% identical, at least about 99.5% identical, or at least about 99.9% identical to the corresponding fragment of wild-type Cas9.
  • a fragment of Cas9 e.g, a gRNA binding domain or a DNA-cleavage domain
  • the fragment is at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% identical, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% of the amino acid length of a corresponding wild-type Cas9.
  • the fragment is at least 100 amino acids in length. In some embodiments, the fragment is at least 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1050, 1100, 1150, 1200, 1250, or at least 1300 amino acids in length.
  • wild-type Cas9 corresponds to Cas9 from Streptococcus pyogenes (NCBI Reference Sequence: NC_017053.1, nucleotide and amino acid sequences as follows).
  • wild-type Cas9 corresponds to, or comprises the following nucleotide and/or amino acid sequences:
  • wild-type Cas9 corresponds to Cas9 from Streptococcus pyogenes (NCBI Reference Sequence: NC_002737.2 (nucleotide sequence as follows); and Uniprot Reference Sequence: Q99ZW2 (amino acid sequence as follows).
  • Cas9 refers to Cas9 from: Corynebacterium ulcerans (NCBI Refs: NC_015683.1, NC_017317.1); Corynebacterium diphtheria (NCBI Refs:
  • NCBI Ref NC 017861.1
  • Spiroplasma taiwanense NCBI Ref: NC_021846.1
  • Streptococcus iniae NCBI Ref: NC_021314.1
  • Belliella baltica NCBI Ref: NC_018010.1
  • thermophilus (NCBI Ref: YP_820832.1), Listeria innocua (NCBI Ref: NP_472073.1), Campylobacter jejuni (NCBI Ref: YP_002344900.1) or Neisseria meningitidis (NCBI Ref: YP 002342100.1) or to a Cas9 from any other organism.
  • dCas9 corresponds to, or comprises in part or in whole, a Cas9 amino acid sequence having one or more mutations that inactivate the Cas9 nuclease activity.
  • a dCas9 domain comprises D10A and an H840A mutation as numbered in SEQ ID NO: 1 or corresponding mutations in another Cas9.
  • the dCas9 comprises the amino acid sequence of dCas9 (D10A and H840A):
  • the Cas9 domain comprises a D10A mutation, while the residue at position 840 remains a histidine in the amino acid sequence provided above, or at corresponding positions in any of the amino acid sequences provided herein.
  • dCas9 variants having mutations other than D10A and H840A are provided, which, e.g ., result in nuclease inactivated Cas9 (dCas9).
  • Such mutations include other amino acid substitutions at D10 and H840, or other
  • variants or homologues of dCas9 are provided which are at least about 70% identical, at least about 80% identical, at least about 90% identical, at least about 95% identical, at least about 98% identical, at least about 99% identical, at least about 99.5% identical, or at least about 99.9% identical.
  • variants of dCas9 are provided having amino acid sequences which are shorter, or longer, by about 5 amino acids, by about 10 amino acids, by about 15 amino acids, by about 20 amino acids, by about 25 amino acids, by about 30 amino acids, by about 40 amino acids, by about 50 amino acids, by about 75 amino acids, by about 100 amino acids or more.
  • Cas9 fusion proteins as provided herein comprise the full- length amino acid sequence of a Cas9 protein, e.g, one of the Cas9 sequences provided herein. In other embodiments, however, fusion proteins as provided herein do not comprise a full-length Cas9 sequence, but only one or more fragments thereof. Exemplary amino acid sequences of suitable Cas9 domains and Cas9 fragments are provided herein, and additional suitable sequences of Cas9 domains and fragments will be apparent to those of skill in the art.
  • Cas9 proteins e.g, a nuclease dead Cas9 (dCas9), a Cas9 nickase (nCas9), or a nuclease active Cas9), including variants and homologs thereof, are within the scope of this disclosure.
  • Exemplary Cas9 proteins include, without limitation, those provided below.
  • the Cas9 protein is a nuclease dead Cas9 (dCas9).
  • the Cas9 protein is a Cas9 nickase (nCas9).
  • the Cas9 protein is a nuclease active Cas9.
  • nCas9 nickase nCas9
  • Cas9 refers to a Cas9 from archaea (e.g, nanoarchaea), which constitute a domain and kingdom of single-celled prokaryotic microbes.
  • archaea e.g, nanoarchaea
  • Cas9 refers to a Cas9 from archaea (e.g, nanoarchaea), which constitute a domain and kingdom of single-celled prokaryotic microbes.
  • Cas9 refers to CasX or CasY, which have been described in, for example, Burstein et al ., "New CRISPR-Cas systems from uncultivated microbes.” Cell Res. 2017 Feb 21. doi: 10.1038/cr.2017.21, the entire contents of which is hereby incorporated by reference.
  • genome-resolved metagenomics a number of CRISPR-Cas systems were identified, including the first reported Cas9 in the archaeal domain of life. This divergent Cas9 protein was found in little- studied nanoarchaea as part of an active CRISPR-Cas system.
  • Cas9 refers to CasX, or a variant of CasX. In some embodiments, Cas9 refers to a CasY, or a variant of CasY. It should be appreciated that other RNA-guided DNA binding proteins may be used as a nucleic acid programmable DNA binding protein (napDNAbp), and are within the scope of this disclosure.
  • napDNAbp nucleic acid programmable DNA binding protein
  • napDNAbps useful in the methods of the invention include circular permutants, which are known in the art and described, for example, by Oakes et al. , Cell 176, 254-267, 2019.
  • An exemplary circular permutant follows where the bold sequence indicates sequence derived from Cas9, the italics sequence denotes a linker sequence, and the underlined sequence denotes a bipartite nuclear localization sequence,
  • Non-limiting examples of a polynucleotide programmable nucleotide binding domain which can be incorporated into a base editor include a CRISPR protein-derived domain, a restriction nuclease, a meganuclease, TAL nuclease (TALEN), and a zinc finger nuclease (ZFN).
  • napDNAbp of any of the fusion proteins provided herein may be a CasX or CasY protein.
  • the napDNAbp is a CasX protein.
  • the napDNAbp is a CasY protein.
  • the napDNAbp comprises an amino acid sequence that is at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at ease 99.5% identical to a naturally-occurring CasX or CasY protein.
  • the napDNAbp is a naturally-occurring CasX or CasY protein.
  • the napDNAbp comprises an amino acid sequence that is at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at ease 99.5% identical to any CasX or CasY protein described herein. It should be appreciated that Casl2b/C2cl, CasX and CasY from other bacterial species may also be used in accordance with the present disclosure.
  • Casl2 refers to an RNA guided nuclease comprising a Casl2 protein or a fragment thereof (e.g., a protein comprising an active, inactive, or partially active DNA cleavage domain of Casl2, and/or the gRNA binding domain of Casl2).
  • Casl2 belongs to the class 2, Type V CRISPR/Cas system.
  • a Casl2 nuclease is also referred to sometimes as a CRISPR (clustered regularly interspaced short palindromic repeat) associated nuclease.
  • the sequence of an exemplary Bacillus hisashii Cas 12b (BhCasl2b) Cas 12 domain is provided below:
  • Amino acid sequences having at least 85% or greater identity to the BhCasl2b amino acid sequence are also useful in the methods of the invention.
  • cytidine deaminase is meant a polypeptide or fragment thereof capable of catalyzing a deamination reaction that converts an amino group to a carbonyl group.
  • the cytidine deaminase converts cytosine to uracil or 5-methylcytosine to thymine.
  • PmCDAl which is derived from Petromyzon marinus (Petromyzon marinus cytosine deaminase 1,“PmCDAl”), AID (Activation-induced cytidine deaminase; AICDA), which is derived from a mammal ( e.g ., human, swine, bovine, horse, monkey etc.), and APOBEC are exemplary cytidine deaminases.
  • “conservative amino acid substitution” or“conservative mutation” refers to the replacement of one amino acid by another amino acid with a common property.
  • a functional way to define common properties between individual amino acids is to analyze the normalized frequencies of amino acid changes between corresponding proteins of
  • Non-limiting examples of conservative mutations include amino acid substitutions of amino acids, for example, lysine for arginine and vice versa such that a positive charge can be maintained; glutamic acid for aspartic acid and vice versa such that a negative charge can be maintained; serine for threonine such that a free -OH can be maintained; and glutamine for asparagine such that a free -ML ⁇ can be maintained.
  • coding sequence or“protein coding sequence” as used interchangeably herein refers to a segment of a polynucleotide that codes for a protein. The region or sequence is bounded nearer the 5’ end by a start codon and nearer the 3’ end with a stop codon. Coding sequences can also be referred to as open reading frames.
  • deaminase or“deaminase domain,” as used herein, refers to a protein or enzyme that catalyzes a deamination reaction.
  • the deaminase is an adenosine deaminase, which catalyzes the hydrolytic deamination of adenine to
  • the deaminase is an adenosine deaminase, which catalyzes the hydrolytic deamination of adenosine or adenine (A) to inosine (I).
  • the deaminase or deaminase domain is an adenosine deaminase catalyzing the hydrolytic deamination of adenosine or deoxyadenosine to inosine or deoxyinosine, respectively.
  • the adenosine deaminase catalyzes the hydrolytic deamination of adenosine in deoxyribonucleic acid (DNA).
  • the adenosine deaminases can be from any organism, such as a bacterium.
  • the adenosine deaminase is from a bacterium, such as Escherichia coli , Staphylococcus aureus , Salmonella typhimurium , Shewanella putrefaciens , Haemophilus influenzae , or Caulobacter crescentus.
  • the adenosine deaminase is a TadA deaminase. In some embodiments, the TadA deaminase is TadA variant. In some embodiments, the TadA variant is a TadA*8. In some embodiments, the deaminase or deaminase domain is a variant of a naturally occurring deaminase from an organism, such as a human, chimpanzee, gorilla, monkey, cow, dog, rat, or mouse. In some embodiments, the deaminase or deaminase domain does not occur in nature.
  • the deaminase or deaminase domain is at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75% at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% identical to a naturally occurring deaminase.
  • deaminase domains are described in International PCT Application Nos. PCT/2017/045381 (WO 2018/027078) and PCT/US2016/058344 (WO 2017/070632), each of which is incorporated herein by reference for its entirety.
  • Komor, A.C., et al “Programmable editing of a target base in genomic DNA without double-stranded DNA cleavage” Nature 533, 420-424 (2016); Gaudelli, N.M., et al. ,“Programmable base editing of A ⁇ T to G*C in genomic DNA without DNA cleavage” Nature 551, 464-471 (2017); Komor, A.C., et al.
  • Detect refers to identifying the presence, absence or amount of the analyte to be detected. In one embodiment, a sequence alteration in a polynucleotide or polypeptide is detected. In another embodiment, the presence of indels is detected.
  • detectable label is meant a composition that when linked to a molecule of interest renders the latter detectable, via spectroscopic, photochemical, biochemical, immunochemical, or chemical means.
  • useful labels include radioactive isotopes, magnetic beads, metallic beads, colloidal particles, fluorescent dyes, electron-dense reagents, enzymes (for example, as commonly used in an enzyme linked immunosorbent assay (ELISA)), biotin, digoxigenin, or haptens.
  • disease is meant any condition or disorder that damages or interferes with the normal function of a cell, tissue, or organ.
  • an “effective amount,” as used herein, refers to an amount of a biologically active agent that is sufficient to elicit a desired biological response.
  • the effective amount of an active agent(s) used to practice the present invention for therapeutic treatment of a disease varies depending upon the manner of administration, the age, body weight, and general health of the subject. Ultimately, the attending physician or veterinarian will decide the appropriate amount and dosage regimen. Such amount is referred to as an“effective” amount.
  • an effective amount is the amount of a base editor of the invention (e.g ., a fusion protein comprising a programable DNA binding protein, a nucleobase editor and gRNA) sufficient to introduce an alteration in a gene of interest in a cell (e.g., a cell in vitro or in vivo).
  • a base editor of the invention e.g ., a fusion protein comprising a programable DNA binding protein, a nucleobase editor and gRNA
  • a nucleobase editor comprising a nCas9 domain and a deaminase domain
  • a deaminase domain e.g, adenosine deaminase or cytidine deaminase
  • an effective amount is the amount of a base editor required to achieve a therapeutic effect ( e.g ., to reduce or control a disease or a symptom or condition thereof).
  • Such therapeutic effect need not be sufficient to alter a gene of interest in all cells of a subject, tissue or organ, but only to alter a gene of interest in about 1%, 5%, 10%, 25%, 50%, 75% or more of the cells present in a subject, tissue or organ.
  • an effective amount of a fusion protein provided herein refers to the amount of the fusion protein that is sufficient to induce editing of a target site specifically bound and edited by the nucleobase editors described herein.
  • an agent e.g, a fusion protein, a nuclease, a hybrid protein, a protein dimer, a complex of a protein (or protein dimer) and a polynucleotide, or a polynucleotide
  • an agent e.g, a fusion protein, a nuclease, a hybrid protein, a protein dimer, a complex of a protein (or protein dimer) and a polynucleotide, or a polynucleotide
  • the desired biological response e.g, on the specific allele, genome, or target site to be edited, on the cell or tissue being targeted, and/or on the agent being used.
  • fragment is meant a portion of a polypeptide or nucleic acid molecule. This portion contains, at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% of the entire length of the reference nucleic acid molecule or polypeptide.
  • a fragment may contain 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100, 200, 300, 400, 500, 600, 700, 800, 900, or 1000 nucleotides or amino acids.
  • gRNA guide RNA
  • gRNAs can exist as a complex of two or more RNAs, or as a single RNA molecule.
  • gRNAs that exist as a single RNA molecule may be referred to as single-guide RNAs (sgRNAs), though“gRNA” is used interchangeably to refer to guide RNAs that exist as either single molecules or as a complex of two or more molecules.
  • gRNAs that exist as single RNA species comprise two domains: (1) a domain that shares homology to a target nucleic acid (e.g, and directs binding of a Cas9 complex to the target); and (2) a domain that binds a Cas9 protein.
  • domain (2) corresponds to a sequence known as a tracrRNA, and comprises a stem-loop structure.
  • domain (2) is identical or homologous to a tracrRNA as provided in Jinek et al, Science 337:816- 821(2012), the entire contents of which is incorporated herein by reference.
  • Other examples of gRNAs e.g, those including domain 2 can be found in U.S.
  • a gRNA comprises two or more of domains (1) and (2), and may be referred to as an“extended gRNA.”
  • An extended gRNA will bind two or more Cas9 proteins and bind a target nucleic acid at two or more distinct regions, as described herein.
  • the gRNA comprises a nucleotide sequence that complements a target site, which mediates binding of the nuclease/RNA complex to said target site, providing the sequence specificity of the nuclease:RNA complex.
  • Hybridization means hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleobases.
  • adenine and thymine are complementary nucleobases that pair through the formation of hydrogen bonds.
  • inhibitor of base repair refers to a protein that is capable in inhibiting the activity of a nucleic acid repair enzyme, for example a base excision repair (BER) enzyme.
  • the IBR is an inhibitor of inosine base excision repair.
  • Exemplary inhibitors of base repair include inhibitors of APEl, Endo III, Endo IV, Endo V, Endo VIII, Fpg, hOGGl, hNEILl, T7 Endol, T4PDG, UDG, hSMUGl, and hAAG.
  • the IBR is an inhibitor of Endo V or hAAG.
  • the IBR is a catalytically inactive EndoV or a catalytically inactive hAAG.
  • the base repair inhibitor is an inhibitor of Endo V or hAAG. In some embodiments, the base repair inhibitor is a catalytically inactive EndoV or a catalytically inactive hAAG.
  • the base repair inhibitor is uracil glycosylase inhibitor (UGI).
  • UGI refers to a protein that is capable of inhibiting a uracil-DNA glycosylase base-excision repair enzyme.
  • a UGI domain comprises a wild-type UGI or a fragment of a wild-type UGI.
  • the UGI proteins provided herein include fragments of UGI and proteins homologous to a UGI or a UGI fragment.
  • the base repair inhibitor is an inhibitor of inosine base excision repair.
  • the base repair inhibitor is a“catalytically inactive inosine specific nuclease” or“dead inosine specific nuclease.
  • catalytically inactive inosine glycosylases can bind inosine, but cannot create an abasic site or remove the inosine, thereby sterically blocking the newly formed inosine moiety from DNA damage/repair mechanisms.
  • the catalytically inactive inosine specific nuclease can be capable of binding an inosine in a nucleic acid but does not cleave the nucleic acid.
  • Non-limiting exemplary catalytically inactive inosine specific nucleases include catalytically inactive alkyl adenosine glycosylase (AAG nuclease), for example, from a human, and catalytically inactive endonuclease V (EndoV nuclease), for example, from E. coli.
  • AAG nuclease catalytically inactive alkyl adenosine glycosylase
  • EndoV nuclease catalytically inactive endonuclease V
  • the catalytically inactive AAG nuclease comprises an E125Q mutation or a corresponding mutation in another AAG nuclease.
  • an "intein” is a fragment of a protein that is able to excise itself and join the remaining fragments (the exteins) with a peptide bond in a process known as protein splicing. Inteins are also referred to as “protein introns.” The process of an intein excising itself and joining the remaining portions of the protein is herein termed “protein splicing" or “intein- mediated protein splicing.”
  • an intein of a precursor protein an intein containing protein prior to intein-mediated protein splicing comes from two genes. Such intein is referred to herein as a split intein (e.g ., split intein-N and split intein-C).
  • cyanobacteria DnaE
  • the catalytic subunit a of DNA polymerase III is encoded by two separate genes, dnaE-n and dnaE-c.
  • the intein encoded by the dnaE-n gene may be herein referred as "intein-N.”
  • the intein encoded by the dnaE-c gene may be herein referred as "intein-C.”
  • intein systems may also be used.
  • a synthetic intein based on the dnaE intein, the Cfa-N (e.g., split intein-N) and Cfa-C (e.g, split intein-C) intein pair has been described (e.g, in Stevens et al., J Am Chem Soc. 2016 Feb. 24; 138(7):2162-5, incorporated herein by reference).
  • Non-limiting examples of intein pairs that may be used in accordance with the present disclosure include: Cfa DnaE intein, Ssp GyrB intein, Ssp DnaX intein, Ter DnaE3 intein, Ter ThyX intein, Rma DnaB intein and Cne Prp8 intein (e.g., as described in U.S. Patent No. 8,394,604, incorporated herein by reference.
  • nucleotide and amino acid sequences of inteins are provided.
  • Intein-N and intein-C may be fused to the N-terminal portion of the split Cas9 and the C-terminal portion of the split Cas9, respectively, for the joining of the N-terminal portion of the split Cas9 and the C-terminal portion of the split Cas9.
  • Intein-N and intein-C may be fused to the N-terminal portion of the split Cas9 and the C-terminal portion of the split Cas9, respectively, for the joining of the N-terminal portion of the split Cas9 and the C-terminal portion of the split Cas9.
  • an intein-N is fused to the C-terminus of the N-terminal portion of the split Cas9, /. e. , to form a structure of N— [N-terminal portion of the split Cas9]-[intein-N]— C.
  • an intein-C is fused to the N-terminus of the C-terminal portion of the split Cas9, i.e ., to form a structure of N-[intein-C]— [C-terminal portion of the split Cas9]-C.
  • intein-mediated protein splicing for joining the proteins the inteins are fused to (e.g ., split Cas9) is known in the art, e.g ., as described in Shah et al., Chem Sci.
  • isolated refers to material that is free to varying degrees from components which normally accompany it as found in its native state.
  • Isolate denotes a degree of separation from original source or surroundings.
  • Purify denotes a degree of separation that is higher than isolation.
  • a “purified” or “biologically pure” protein is sufficiently free of other materials such that any impurities do not materially affect the biological properties of the protein or cause other adverse consequences. That is, a nucleic acid or peptide of this invention is purified if it is substantially free of cellular material, viral material, or culture medium when produced by recombinant DNA techniques, or chemical precursors or other chemicals when chemically synthesized.
  • Purity and homogeneity are typically determined using analytical chemistry techniques, for example, polyacrylamide gel electrophoresis or high-performance liquid chromatography.
  • the term "purified" can denote that a nucleic acid or protein gives rise to essentially one band in an electrophoretic gel.
  • modifications for example, phosphorylation or glycosylation, different modifications may give rise to different isolated proteins, which can be separately purified.
  • isolated polynucleotide is meant a nucleic acid (e.g ., a DNA) that is free of the genes which, in the naturally-occurring genome of the organism from which the nucleic acid molecule of the invention is derived, flank the gene.
  • the term therefore includes, for example, a recombinant DNA that is incorporated into a vector; into an autonomously replicating plasmid or virus; or into the genomic DNA of a prokaryote or eukaryote; or that exists as a separate molecule (for example, a cDNA or a genomic or cDNA fragment produced by PCR or restriction endonuclease digestion) independent of other sequences.
  • the term includes an RNA molecule that is transcribed from a DNA molecule, as well as a recombinant DNA that is part of a hybrid gene encoding additional polypeptide sequence.
  • an “isolated polypeptide” is meant a polypeptide of the invention that has been separated from components that naturally accompany it.
  • the polypeptide is isolated when it is at least 60%, by weight, free from the proteins and naturally-occurring organic molecules with which it is naturally associated.
  • the preparation is at least 75%, more preferably at least 90%, and most preferably at least 99%, by weight, a polypeptide of the invention.
  • An isolated polypeptide of the invention may be obtained, for example, by extraction from a natural source, by expression of a recombinant nucleic acid encoding such a polypeptide; or by chemically synthesizing the protein.
  • linker can refer to a covalent linker (e.g ., covalent bond), a non-covalent linker, a chemical group, or a molecule linking two molecules or moieties, e.g., two components of a protein complex or a ribonucleocomplex, or two domains of a fusion protein, such as, for example, a polynucleotide programmable DNA binding domain (e.g, dCas9) and a deaminase domain (e.g, an adenosine deaminase, a cytidine deaminase, or an adenosine deaminase and a cytidine deaminase) or a napDNAbp domain (e.g., Casl2b) and
  • linkers flank a deaminase domain that is inserted within a Cas protein or fragment thereof.
  • a linker can join different components of, or different portions of components of, a base editor system.
  • a linker can join a guide polynucleotide binding domain of a polynucleotide programmable nucleotide binding domain and a catalytic domain of a deaminase.
  • a linker can join a CRISPR polypeptide and a deaminase.
  • a linker can join a Cas9 and a deaminase.
  • a linker can join a dCas9 and a deaminase.
  • a linker can join a nCas9 and a deaminase.
  • a linker can join a Casl2a/Cpfl, Casl2b/C2cl, Casl2c/C2c3, Casl2d/CasY, Casl2e/CasX, Casl2g, Casl2h, or Casl2i and a deaminase.
  • a linker can join a guide polynucleotide and a deaminase.
  • a linker can join a deaminating component and a polynucleotide programmable nucleotide binding component of a base editor system.
  • a linker can join an RNA-binding portion of a deaminating component and a napDNAbp component of a base editor system. In some embodiments, a linker can join an RNA-binding portion of a deaminating component and a polynucleotide programmable nucleotide binding component of a base editor system. In some embodiments, a linker can join an RNA-binding portion of a deaminating component and an RNA-binding portion of a polynucleotide programmable nucleotide binding component of a base editor system.
  • a linker can be positioned between, or flanked by, two groups, molecules, or other moieties and connected to each one via a covalent bond or non- covalent interaction, thus connecting the two.
  • the linker can be an organic molecule, group, polymer, or chemical moiety.
  • the linker can be a polynucleotide.
  • the linker can be a DNA linker.
  • the linker can be an RNA linker.
  • a linker can comprise an aptamer capable of binding to a ligand.
  • the ligand may be carbohydrate, a peptide, a protein, or a nucleic acid.
  • the linker may comprise an aptamer may be derived from a riboswitch.
  • the riboswitch from which the aptamer is derived may be selected from a theophylline riboswitch, a thiamine pyrophosphate (TPP) riboswitch, an adenosine cobalamin (AdoCbl) riboswitch, an S-adenosyl methionine (SAM) riboswitch, an SAH riboswitch, a flavin mononucleotide (FMN) riboswitch, a tetrahydrofolate riboswitch, a lysine riboswitch, a glycine riboswitch, a purine riboswitch, a GlmS riboswitch, or a pre-queosinel (PreQl) riboswitch.
  • a linker may comprise an aptamer bound to a polypeptide or a protein domain, such as a polypeptide ligand.
  • the polypeptide ligand may be a K Homology (KH) domain, a MS2 coat protein domain, a PP7 coat protein domain, a SfMu Com coat protein domain, a sterile alpha motif, a telomerase Ku binding motif and Ku protein, a telomerase Sm7 binding motif and Sm7 protein, or an RNA recognition motif.
  • the polypeptide ligand may be a portion of a base editor system component.
  • a nucleobase editing component may comprise a deaminase domain and an RNA recognition motif.
  • the linker can be an amino acid or a plurality of amino acids e.g ., a peptide or protein). In some embodiments, the linker can be about 5-100 amino acids in length, for example, about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 20-30, 30- 40, 40-50, 50-60, 60-70, 70-80, 80-90, or 90-100 amino acids in length. In some
  • the linker can be about 100-150, 150-200, 200-250, 250-300, 300-350, 350- 400, 400-450, or 450-500 amino acids in length. Longer or shorter linkers can be also contemplated.
  • a linker joins a gRNA binding domain of an RNA- programmable nuclease, including a Cas9 nuclease domain, and the catalytic domain of a nucleic-acid editing protein (e.g., cytidine or adenosine deaminase).
  • a linker joins a dCas9 and a nucleic-acid editing protein.
  • the linker is positioned between, or flanked by, two groups, molecules, or other moieties and connected to each one via a covalent bond, thus connecting the two.
  • the linker is an amino acid or a plurality of amino acids (e.g, a peptide or protein).
  • the linker is an organic molecule, group, polymer, or chemical moiety.
  • the linker is 5-200 amino acids in length, for example, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 35, 45, 50, 55, 60, 60, 65, 70, 70, 75, 80, 85, 90, 90, 95, 100, 101, 102,
  • the domains of the nucleobase editor are fused via a linker that comprises the amino acid sequence of SGGSSGSETPGTSESATPESSGGS, SGGS SGGS SGSETPGTSESATPES SGGS SGGS, or
  • domains of the nucleobase editor are fused via a linker comprising the amino acid sequence SGSETPGTSESATPES, which may also be referred to as the XTEN linker.
  • a linker comprises the amino acid sequence SGGS.
  • a linker comprises (SGGS)n, (GGGS)n, (GGGGS) n, (G)n, (EAAAK)n, (GGS)n,
  • n is independently an integer between 1 and 30, and wherein X is any amino acid.
  • n is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15.
  • the linker is 24 amino acids in length. In some embodiments, the linker comprises the amino acid sequence SGGS SGGS SGSETPGTSESATPES . In some embodiments, the linker is 40 amino acids in length. In some embodiments, the linker comprises the amino acid sequence
  • the linker is 64 amino acids in length. In some embodiments, the linker comprises the amino acid sequence
  • the linker is 92 amino acids in length. In some embodiments, the linker comprises the amino acid sequence
  • marker is meant any protein or polynucleotide having an alteration in expression level or activity that is associated with a disease or disorder.
  • mutation refers to a substitution of a residue within a sequence, e.g ., a nucleic acid or amino acid sequence, with another residue, or a deletion or insertion of one or more residues within a sequence. Mutations are typically described herein by identifying the original residue followed by the position of the residue within the sequence and by the identity of the newly substituted residue. Various methods for making the amino acid substitutions (mutations) provided herein are well known in the art, and are provided by, for example, Green and Sambrook, Molecular Cloning: A Laboratory Manual (4th ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (2012)).
  • an intended mutation such as a point mutation
  • a nucleic acid e.g ., a nucleic acid within a genome of a subject
  • an intended mutation is a mutation that is generated by a specific base editor (e.g., cytidine base editor or adenosine base editor) bound to a guide polynucleotide (e.g, gRNA), specifically designed to generate the intended mutation.
  • a specific base editor e.g., cytidine base editor or adenosine base editor
  • a guide polynucleotide e.g, gRNA
  • mutations made or identified in a sequence are numbered in relation to a reference (or wild-type) sequence, i.e., a sequence that does not contain the mutations.
  • a reference sequence i.e., a sequence that does not contain the mutations.
  • the skilled practitioner in the art would readily understand how to determine the position of mutations in amino acid and nucleic acid sequences relative to a reference sequence.
  • non-conservative mutations involve amino acid substitutions between different groups, for example, lysine for tryptophan, or phenylalanine for serine, etc. In this case, it is preferable for the non-conservative amino acid substitution to not interfere with, or inhibit the biological activity of, the functional variant.
  • the non-conservative amino acid substitution can enhance the biological activity of the functional variant, such that the biological activity of the functional variant is increased as compared to the wild-type protein.
  • nuclear localization sequence refers to an amino acid sequence that promotes import of a protein into the cell nucleus.
  • nuclear localization sequences are known in the art and described, for example, in Plank et ah, International PCT application, PCT/EP2000/011690, filed November 23, 2000, published as WO/2001/038547 on May 31, 2001, the contents of which are incorporated herein by reference for their disclosure of exemplary nuclear localization sequences.
  • the NLS is an optimized NLS described, for example, by Koblan et al, Nature Biotech. 2018 doi: 10.1038/nbt.4172.
  • an NLS comprises the amino acid sequence KRTADGS E FE S PKKKRKV, KRPAATKKAGQAKKKK,
  • KKTELQTTNAENKTKKL KRGINDRNFWRGENGRKTR, RKSGKIAAIWKRPRK, PKKKRKV, or MD S L LMNRRK FL Y Q FKNVRWAKGRRE T YL C .
  • nucleic acid and“nucleic acid molecule,” as used herein, refer to a compound comprising a nucleobase and an acidic moiety, e.g, a nucleoside, a nucleotide, or a polymer of nucleotides.
  • polymeric nucleic acids e.g, nucleic acid molecules comprising three or more nucleotides are linear molecules, in which adjacent nucleotides are linked to each other via a phosphodiester linkage.
  • “nucleic acid” refers to individual nucleic acid residues (e.g, nucleotides and/or nucleosides).
  • “nucleic acid” refers to an oligonucleotide chain comprising three or more individual nucleotide residues.
  • polynucleotide can be used interchangeably to refer to a polymer of nucleotides (e.g ., a string of at least three nucleotides).
  • “nucleic acid” encompasses RNA as well as single and/or double-stranded DNA. Nucleic acids may be naturally occurring, for example, in the context of a genome, a transcript, an mRNA, tRNA, rRNA, siRNA, snRNA, a plasmid, cosmid, chromosome, chromatid, or other naturally occurring nucleic acid molecule.
  • a nucleic acid molecule may be a non-naturally occurring molecule, e.g., a recombinant DNA or RNA, an artificial chromosome, an engineered genome, or fragment thereof, or a synthetic DNA, RNA, DNA/RNA hybrid, or including non-naturally occurring nucleotides or nucleosides.
  • the terms“nucleic acid,” “DNA,”“RNA,” and/or similar terms include nucleic acid analogs, e.g, analogs having other than a phosphodiester backbone. Nucleic acids can be purified from natural sources, produced using recombinant expression systems and optionally purified, chemically synthesized, etc.
  • nucleic acids can comprise nucleoside analogs such as analogs having chemically modified bases or sugars, and backbone modifications.
  • a nucleic acid sequence is presented in the 5' to 3' direction unless otherwise indicated.
  • a nucleic acid is or comprises natural nucleosides (e.g, adenosine, thymidine, guanosine, cytidine, uridine, deoxyadenosine, deoxythymidine, deoxyguanosine, and deoxycytidine); nucleoside analogs (e.g, 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolo-pyrimidine, 3-methyl adenosine, 5-methylcytidine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine, C5-propynyl-cytidine, C5-methylcytidine, 2-aminoadenosine, 7- deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-
  • nucleic acid programmable DNA binding protein or “napDNAbp” may be used interchangeably with“polynucleotide programmable nucleotide binding domain” to refer to a protein that associates with a nucleic acid (e.g, DNA or RNA), such as a guide nucleic acid or guide polynucleotide (e.g, gRNA), that guides the napDNAbp to a specific nucleic acid sequence.
  • the polynucleotide programmable nucleotide binding domain is a polynucleotide programmable DNA binding domain.
  • the polynucleotide programmable nucleotide binding domain is a polynucleotide programmable RNA binding domain.
  • the polynucleotide programmable nucleotide binding domain is a polynucleotide programmable RNA binding domain.
  • polynucleotide programmable nucleotide binding domain is a Cas9 protein.
  • a Cas9 protein can associate with a guide RNA that guides the Cas9 protein to a specific DNA sequence that is complementary to the guide RNA.
  • the napDNAbp is a Cas9 domain, for example a nuclease active Cas9, a Cas9 nickase (nCas9), or a nuclease inactive Cas9 (dCas9).
  • Non-limiting examples of nucleic acid programmable DNA binding proteins include, Cas9 (e.g ., dCas9 and nCas9), Casl2a/Cpfl, Casl2b/C2cl, Casl2c/C2c3,
  • Cas enzymes include Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cas5d, Cas5t, Cas5h, Cas5a, Cas6, Cas7, Cas8, Cas8a, Cas8b, Cas8c, Cas9 (also known as Csnl or Csxl2), CaslO, CaslOd, Casl2a/Cpfl, Casl2b/C2cl, Casl2c/C2c3, Casl2d/CasY, Casl2e/CasX, Casl2g, Casl2h, Casl2i, Csyl , Csy2, Csy3, Csy4, Csel, Cse2, Cse3, Cse4, Cse5
  • nucleobase refers to a nitrogen-containing biological compound that forms a nucleoside, which in turn is a component of a nucleotide.
  • RNA ribonucleic acid
  • DNA deoxyribonucleic acid
  • nucleobases - adenine (A), cytosine (C), guanine (G), thymine (T), and uracil (U) - are called primary or canonical.
  • Adenine and guanine are derived from purine, and cytosine, uracil, and thymine are derived from pyrimidine.
  • DNA and RNA can also contain other (non-primary) bases that are modified.
  • Non-limiting exemplary modified nucleobases can include hypoxanthine, xanthine, 7-methylguanine, 5,6- dihydrouracil, 5-methylcytosine (m5C), and 5-hydromethylcytosine.
  • Hypoxanthine and xanthine can be created through mutagen presence, both of them through deamination (replacement of the amine group with a carbonyl group).
  • Hypoxanthine can be modified from adenine.
  • Xanthine can be modified from guanine.
  • Uracil can result from deamination of cytosine.
  • A“nucleoside” consists of a nucleobase and a five carbon sugar (either ribose or deoxyribose). Examples of a nucleoside include adenosine, guanosine, uridine, cytidine, 5- methyluridine (m5U), deoxyadenosine, deoxyguanosine, thymidine, deoxyuridine, and deoxycytidine.
  • nucleoside with a modified nucleobase examples include inosine (I), xanthosine (X), 7-methylguanosine (m7G), dihydrouridine (D), 5-methylcytidine (m5C), and pseudouridine (Y).
  • A“nucleotide” consists of a nucleobase, a five carbon sugar (either ribose or deoxyribose), and at least one phosphate group.
  • nucleic acid programmable DNA binding protein refers to a protein that associates with a nucleic acid (e.g., DNA or RNA), such as a guide nucleic acid, that guides the napDNAbp to a specific nucleic acid sequence.
  • a Casl2 protein can associate with a guide RNA that guides the Casl2 protein to a specific DNA sequence that is complementary to the guide RNA.
  • the napDNAbp is a Casl2 domain, for example a nuclease active Casl2 domain.
  • napDNAbps examples include, Casl2a/Cpfl, Casl2b/C2cl, Casl2c/C2c3, Casl2d/CasY, Casl2e/CasX, Casl2g, Casl2h, and Casl2i.
  • Other napDNAbps are also within the scope of this disclosure, although they may not be specifically listed in this disclosure. See, e.g., Makarova et al.
  • nucleobase editing domain or“nucleobase editing protein,” as used herein, refers to a protein or enzyme that can catalyze a nucleobase modification in RNA or DNA, such as cytosine (or cytidine) to uracil (or uridine) or thymine (or thymidine), and adenine (or adenosine) to hypoxanthine (or inosine) deaminations, as well as non-templated nucleotide additions and insertions.
  • cytosine or cytidine
  • uracil or uridine
  • thymine or thymidine
  • adenine or adenosine
  • hypoxanthine or inosine
  • the nucleobase editing domain is a deaminase domain (e.g., an adenine deaminase or an adenosine deaminase; or a cytidine deaminase or a cytosine deaminase). In some embodiments, the nucleobase editing domain is more than one deaminase domain (e.g, an adenine deaminase or an adenosine deaminase and a cytidine or a cytosine deaminase). In some embodiments, the nucleobase editing domain can be a naturally occurring nucleobase editing domain.
  • the nucleobase editing domain can be an engineered or evolved nucleobase editing domain from the naturally occurring nucleobase editing domain.
  • the nucleobase editing domain can be from any organism, such as a bacterium, human, chimpanzee, gorilla, monkey, cow, dog, rat, or mouse.
  • nucleobase editing proteins are described in International PCT Application Nos. PCT/2017/045381 (WO 2018/027078) and PCT/US2016/058344 (WO 2017/070632), each of which is incorporated herein by reference for its entirety.
  • “obtaining” as in“obtaining an agent” includes synthesizing, purchasing, or otherwise acquiring the agent.
  • A“patient” or“subject” as used herein refers to a mammalian subject or individual diagnosed with, at risk of having or developing, or suspected of having or developing a disease or a disorder.
  • the term“patient” refers to a mammalian subject with a higher than average likelihood of developing a disease or a disorder.
  • Exemplary patients can be humans, non-human primates, cats, dogs, pigs, cattle, cats, horses, camels, llamas, goats, sheep, rodents ( e.g ., mice, rabbits, rats, or guinea pigs) and other mammalians that can benefit from the therapies disclosed herein.
  • Exemplary human patients can be male and/or female.
  • Patient in need thereof or“subject in need thereof’ is referred to herein as a patient diagnosed with, at risk or having, predetermined to have, or suspected of having a disease or disorder.
  • pathogenic mutation refers to a genetic alteration or mutation that increases an individual’s susceptibility or predisposition to a certain disease or disorder.
  • the pathogenic mutation comprises at least one wild-type amino acid substituted by at least one pathogenic amino acid in a protein encoded by a gene.
  • pharmaceutically-acceptable carrier means a pharmaceutically-acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, manufacturing aid (e.g., lubricant, talc magnesium, calcium or zinc stearate, or steric acid), or solvent encapsulating material, involved in carrying or transporting the compound from one site (e.g ., the delivery site) of the body, to another site (e.g, organ, tissue or portion of the body).
  • manufacturing aid e.g., lubricant, talc magnesium, calcium or zinc stearate, or steric acid
  • solvent encapsulating material involved in carrying or transporting the compound from one site (e.g ., the delivery site) of the body, to another site (e.g, organ, tissue or portion of the body).
  • a pharmaceutically acceptable carrier is“acceptable” in the sense of being
  • excipient “carrier,”“pharmaceutically acceptable carrier,”“vehicle,” or the like are used interchangeably herein.
  • composition can refer to a composition formulated for pharmaceutical use.
  • protein refers to a polymer of amino acid residues linked together by peptide (amide) bonds.
  • the terms refer to a protein, peptide, or polypeptide of any size, structure, or function. Typically, a protein, peptide, or polypeptide will be at least three amino acids long.
  • a protein, peptide, or polypeptide can refer to an individual protein or a collection of proteins.
  • One or more of the amino acids in a protein, peptide, or polypeptide can be modified, for example, by the addition of a chemical entity such as a carbohydrate group, a hydroxyl group, a phosphate group, a farnesyl group, an isofamesyl group, a fatty acid group, a linker for conjugation, functionalization, or other modifications, etc.
  • a protein, peptide, or polypeptide can also be a single molecule or can be a multi-molecular complex.
  • a protein, peptide, or polypeptide can be just a fragment of a naturally occurring protein or peptide.
  • a protein, peptide, or polypeptide can be naturally occurring, recombinant, or synthetic, or any combination thereof.
  • the term“fusion protein” as used herein refers to a hybrid polypeptide which comprises protein domains from at least two different proteins.
  • One protein can be located at the amino-terminal (N-terminal) portion of the fusion protein or at the carboxy -terminal (C-terminal) protein thus forming an amino-terminal fusion protein or a carboxy-terminal fusion protein, respectively.
  • a protein can comprise different domains, for example, a nucleic acid binding domain (e.g, the gRNA binding domain of Cas9 that directs the binding of the protein to a target site) and a nucleic acid cleavage domain, or a catalytic domain of a nucleic acid editing protein.
  • a protein comprises a proteinaceous part, e.g, an amino acid sequence constituting a nucleic acid binding domain, and an organic compound, e.g, a compound that can act as a nucleic acid cleavage agent.
  • a protein is in a complex with, or is in association with, a nucleic acid, e.g, RNA or DNA.
  • Any of the proteins provided herein can be produced by any method known in the art.
  • the proteins provided herein can be produced via recombinant protein expression and purification, which is especially suited for fusion proteins comprising a peptide linker. Methods for recombinant protein expression and purification are well known, and include those described by Green and Sambrook, Molecular Cloning: A
  • Polypeptides and proteins disclosed herein can comprise synthetic amino acids in place of one or more naturally-occurring amino acids.
  • synthetic amino acids include, for example, aminocyclohexane carboxylic acid, norleucine, a-amino n-decanoic acid, homoserine, S-acetylaminomethyl-cysteine, trans-3- and trans-4-hydroxyproline, 4- aminophenylalanine, 4-nitrophenylalanine, 4-chlorophenylalanine, 4-carboxyphenylalanine, b-phenyl serine b-hydroxyphenylalanine, phenylglycine, a-naphthylalanine,
  • the polypeptides and proteins can be associated with post-translational modifications of one or more amino acids of the polypeptide constructs.
  • post- translational modifications include phosphorylation, acylation including acetylation and formylation, glycosylation (including N-linked and O-linked), amidation, hydroxylation, alkylation including methylation and ethylation, ubiquitylation, addition of pyrrolidone carboxylic acid, formation of disulfide bridges, sulfation, myristoylation, palmitoylation, isoprenylation, farnesylation, geranylation, glypiation, lipoylation and iodination.
  • polynucleotide programmable nucleotide binding domain or“nucleic acid programmable DNA binding protein (napDNAbp)” refers to a protein that associates with a nucleic acid (e.g ., DNA or RNA), such as a guide polynucleotide (e.g, guide RNA), that guides the polynucleotide programmable nucleotide binding domain to a specific nucleic acid sequence.
  • a guide polynucleotide e.g, guide RNA
  • the polynucleotide programmable nucleotide binding domain is a polynucleotide programmable DNA binding domain.
  • the polynucleotide programmable nucleotide binding domain is a polynucleotide programmable RNA binding domain. In some embodiments, the polynucleotide programmable nucleotide binding domain is a Casl2 protein.
  • the term "recombinant" as used herein in the context of proteins or nucleic acids refers to proteins or nucleic acids that do not occur in nature, but are the product of human engineering.
  • a recombinant protein or nucleic acid molecule comprises an amino acid or nucleotide sequence that comprises at least one, at least two, at least three, at least four, at least five, at least six, or at least seven mutations as compared to any naturally occurring sequence.
  • reference is meant a standard or control condition.
  • the reference is a wild-type or healthy cell.
  • a reference is an untreated cell that is not subjected to a test condition, or is subjected to placebo or normal saline, medium, buffer, and/or a control vector that does not harbor a polynucleotide of interest.
  • A“reference sequence” is a defined sequence used as a basis for sequence
  • a reference sequence may be a subset of or the entirety of a specified sequence; for example, a segment of a full-length cDNA or gene sequence, or the complete cDNA or gene sequence.
  • the length of the reference polypeptide sequence will generally be at least about 16 amino acids, at least about 20 amino acids, at least about 25 amino acids, about 35 amino acids, about 50 amino acids, or about 100 amino acids.
  • the length of the reference nucleic acid sequence will generally be at least about 50 nucleotides, at least about 60 nucleotides, at least about 75 nucleotides, about 100 nucleotides or about 300 nucleotides or any integer thereabout or therebetween.
  • a reference sequence is a wild-type sequence of a protein of interest.
  • a reference sequence is a polynucleotide sequence encoding a wild-type protein.
  • RNA-programmable nuclease and "RNA-guided nuclease” are used with ( e.g ., binds or associates with) one or more RNA(s) that is not a target for cleavage.
  • an RNA-programmable nuclease when in a complex with an RNA, may be referred to as a nuclease:RNA complex.
  • the bound RNA(s) is referred to as a guide RNA (gRNA).
  • gRNAs can exist as a complex of two or more RNAs, or as a single RNA molecule.
  • gRNAs that exist as a single RNA molecule may be referred to as single guide RNAs (sgRNAs), though "gRNA” is used interchangeably to refer to guide RNAs that exist as either single molecules or as a complex of two or more molecules.
  • gRNAs that exist as single RNA species comprise two domains: (1) a domain that shares homology to a target nucleic acid (e.g., and directs binding of a Cas9 complex to the target); and (2) a domain that binds a Cas9 protein.
  • domain (2) corresponds to a sequence known as a tracrRNA, and comprises a stem-loop structure.
  • domain (2) is identical or homologous to a tracrRNA as provided in Jinek et ah, Science 337:816-821(2012), the entire contents of which is incorporated herein by reference.
  • gRNAs e.g, those including domain 2
  • a gRNA comprises two or more of domains (1) and (2), and may be referred to as an "extended gRNA.”
  • an extended gRNA will, e.g. , bind two or more Cas9 proteins and bind a target nucleic acid at two or more distinct regions, as described herein.
  • the gRNA comprises a nucleotide sequence that complements a target site, which mediates binding of the nuclease/RNA complex to said target site, providing the sequence specificity of the nuclease:RNA complex.
  • the RNA-programmable nuclease is the (CRISPR-associated system) Cas9 endonuclease, for example, Cas9 (Casnl) from Streptococcus pyogenes (see, e.g., "Complete genome sequence of an Ml strain of Streptococcus pyogenes.” Ferretti J.J., et al. , Proc. Natl. Acad. Sci. U.S. A. 98:4658-4663(2001); "CRISPR RNA maturation by trans- encoded small RNA and host factor RNase III.” Deltcheva E., et al. , Nature 471 :602- 607(2011).
  • Cas9 Cas9
  • RNA-programmable nucleases e.g, Cas9
  • Cas9 RNA:DNA hybridization to target DNA cleavage sites
  • these proteins are able to be targeted, in principle, to any sequence specified by the guide RNA.
  • Methods of using RNA-programmable nucleases, such as Cas9, for site-specific cleavage (e.g, to modify a genome) are known in the art (see e.g, Cong, L. et al., Multiplex genome engineering using CRISPR/Cas systems. Science 339, 819-823 (2013); Mali, P. et al. , RNA-guided human genome engineering via Cas9. Science 339, 823- 826 (2013); Hwang, W.Y.
  • SNP single nucleotide polymorphism
  • SNPs can fall within coding regions of genes, non-coding regions of genes, or in the intergenic regions (regions between genes). In some embodiments, SNPs within a coding sequence do not necessarily change the amino acid sequence of the protein that is produced, due to degeneracy of the genetic code.
  • SNPs in the coding region are of two types: synonymous and nonsynonymous SNPs. Synonymous SNPs do not affect the protein sequence, while nonsynonymous SNPs change the amino acid sequence of protein. The nonsynonymous SNPs are of two types: missense and nonsense. SNPs that are not in protein-coding regions can still affect gene splicing, transcription factor binding, messenger RNA degradation, or the sequence of noncoding RNA.
  • SNP expression SNP
  • SNV single nucleotide variant
  • a somatic single nucleotide variation can also be called a single-nucleotide alteration.
  • nucleic acid molecule e.g., a nucleic acid programmable DNA binding domain and guide nucleic acid
  • compound e.g., a nucleic acid programmable DNA binding domain and guide nucleic acid
  • molecule that recognizes and binds a polypeptide and/or nucleic acid molecule of the invention, but which does not substantially recognize and bind other molecules in a sample, for example, a biological sample.
  • Nucleic acid molecules useful in the methods of the invention include any nucleic acid molecule that encodes a polypeptide of the invention or a fragment thereof. Such nucleic acid molecules need not be 100% identical with an endogenous nucleic acid sequence, but will typically exhibit substantial identity. Polynucleotides having“substantial identity” to an endogenous sequence are typically capable of hybridizing with at least one strand of a double-stranded nucleic acid molecule. Nucleic acid molecules useful in the methods of the invention include any nucleic acid molecule that encodes a polypeptide of the invention or a fragment thereof. Such nucleic acid molecules need not be 100% identical with an endogenous nucleic acid sequence, but will typically exhibit substantial identity. Polynucleotides having“substantial identity” to an endogenous sequence are typically capable of hybridizing with at least one strand of a double-stranded nucleic acid molecule.
  • hybridize pair to form a double-stranded molecule between complementary polynucleotide sequences (e.g ., a gene described herein), or portions thereof, under various conditions of stringency.
  • complementary polynucleotide sequences e.g ., a gene described herein
  • stringency See, e.g., Wahl, G. M. and S. L. Berger (1987) Methods Enzymol. 152:399; Kimmel, A. R. (1987) Methods Enzymol. 152:507).
  • stringent salt concentration will ordinarily be less than about 750 mM NaCl and 75 mM trisodium citrate, preferably less than about 500 mM NaCl and 50 mM trisodium citrate, and more preferably less than about 250 mM NaCl and 25 mM trisodium citrate.
  • Low stringency hybridization can be obtained in the absence of organic solvent, e.g, formamide, while high stringency hybridization can be obtained in the presence of at least about 35% formamide, and more preferably at least about 50% formamide.
  • Stringent temperature conditions will ordinarily include temperatures of at least about 30° C, more preferably of at least about 37° C, and most preferably of at least about 42° C.
  • Varying additional parameters, such as hybridization time, the concentration of detergent, e.g, sodium dodecyl sulfate (SDS), and the inclusion or exclusion of carrier DNA, are well known to those skilled in the art.
  • concentration of detergent e.g, sodium dodecyl sulfate (SDS)
  • SDS sodium dodecyl sulfate
  • Various levels of stringency are accomplished by combining these various conditions as needed.
  • hybridization will occur at 30° C in 750 mM NaCl, 75 mM trisodium citrate, and 1% SDS.
  • hybridization will occur at 37° C in 500 mM NaCl, 50 mM trisodium citrate, 1% SDS, 35% formamide, and 100 pg/ml denatured salmon sperm DNA (ssDNA).
  • hybridization will occur at 42° C in 250 mM NaCl, 25 mM trisodium citrate, 1% SDS, 50% formamide, and 200 pg/ml ssDNA. Useful variations on these conditions will be readily apparent to those skilled in the art.
  • wash stringency conditions can be defined by salt concentration and by temperature. As above, wash stringency can be increased by decreasing salt concentration or by increasing temperature.
  • stringent salt concentration for the wash steps will preferably be less than about 30 mM NaCl and 3 mM trisodium citrate, and most preferably less than about 15 mM NaCl and 1.5 mM trisodium citrate.
  • Stringent temperature conditions for the wash steps will ordinarily include a temperature of at least about 25° C, more preferably of at least about 42° C, and even more preferably of at least about 68° C.
  • wash steps will occur at 25° C in 30 mM NaCl, 3 mM trisodium citrate, and 0.1% SDS. In a more preferred embodiment, wash steps will occur at 42 C in 15 mM NaCl, 1.5 mM trisodium citrate, and 0.1% SDS. In a more preferred embodiment, wash steps will occur at 68° C in 15 mM NaCl, 1.5 mM trisodium citrate, and 0.1% SDS. Additional variations on these conditions will be readily apparent to those skilled in the art.
  • Hybridization techniques are well known to those skilled in the art and are described, for example, in Benton and Davis (Science 196: 180, 1977); Grunstein and Hogness (Proc. Natl. Acad. Sci., USA 72:3961, 1975); Ausubel et al. (Current Protocols in Molecular Biology, Wiley Interscience, New York, 2001); Berger and Kimmel (Guide to Molecular Cloning Techniques, 1987, Academic Press, New York); and Sambrook et al. , Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, New York.
  • a “split Cas9 protein” or “split Cas9” refers to a Cas9 protein that is provided as an N- terminal fragment and a C-terminal fragment encoded by two separate nucleotide sequences.
  • the polypeptides corresponding to the N-terminal portion and the C-terminal portion of the Cas9 protein may be spliced to form a“reconstituted” Cas9 protein.
  • the Cas9 protein is divided into two fragments within a disordered region of the protein, e.g ., as described in Nishimasu et al., Cell, Volume 156, Issue 5, pp. 935-949, 2014, or as described in Jiang et al. (2016) Science 351 : 867-871.
  • PDB file: 5F9R each of which is incorporated herein by reference.
  • the protein is divided into two fragments at any C, T, A, or S within a region of SpCas9 between about amino acids A292-G364, F445-K483, or E565-T637, or at corresponding positions in any other Cas9,
  • Cas9 variant e.g, nCas9, dCas9, or other napDNAbp.
  • protein is divided into two fragments at SpCas9 T310, T313, A456, S469, or C574.
  • the process of dividing the protein into two fragments is referred to as “splitting” the protein.
  • the N-terminal portion of the Cas9 protein comprises amino acids 1-573 or 1-637 S. pyogenes Cas9 wild-type (SpCas9) (NCBI Reference Sequence:
  • NC 002737.2, Uniprot Reference Sequence: Q99ZW2 and the C-terminal portion of the Cas9 protein comprises a portion of amino acids 574-1368 or 638-1368 of SpCas9 wild-type.
  • the C-terminal portion of the split Cas9 can be joined with the N-terminal portion of the split Cas9 to form a complete Cas9 protein.
  • the C-terminal portion of the Cas9 protein starts from where the N-terminal portion of the Cas9 protein ends.
  • the C-terminal portion of the split Cas9 comprises a portion of amino acids (551-651)-1368 of spCas9. "(551-651)-1368" means starting at an amino acid between amino acids 551-651 (inclusive) and ending at amino acid 1368.
  • the C- terminal portion of the split Cas9 may comprise a portion of any one of amino acid 551-1368, 552-1368, 553-1368, 554-1368, 555-1368, 556-1368, 557-1368, 558-1368, 559-1368, 560- 1368, 561-1368, 562-1368, 563-1368, 564-1368, 565-1368, 566-1368, 567-1368, 568-1368, 569-1368, 570-1368, 571-1368, 572-1368, 573-1368, 574-1368, 575-1368, 576-1368, 577- 1368, 578-1368, 579-1368, 580-1368, 581-1368, 582-1368, 583-1368, 584-1368, 585-1368, 586-1368, 587-1368, 588-1368, 589-1368, 590-1368, 591-1368, 592-1368, 593-1368, 594- 1368, 595-1368, 596-13
  • subject is meant a mammal, including, but not limited to, a human or non human mammal, such as a bovine, equine, canine, ovine, or feline.
  • Subjects include livestock, domesticated animals raised to produce labor and to provide commodities, such as food, including without limitation, cattle, goats, chickens, horses, pigs, rabbits, and sheep.
  • substantially identical is meant a polypeptide or nucleic acid molecule exhibiting at least 50% identity to a reference amino acid sequence (for example, any one of the amino acid sequences described herein) or nucleic acid sequence (for example, any one of the nucleic acid sequences described herein). In one embodiment, such a sequence is at least 60%, 80% or 85%, 90%, 95% or even 99% identical at the amino acid level or nucleic acid to the sequence used for comparison.
  • Sequence identity is typically measured using sequence analysis software (for example, Sequence Analysis Software Package of the Genetics Computer Group, University of Wisconsin Biotechnology Center, 1710 University Avenue, Madison, Wis. 53705,
  • BLAST, BESTFIT, GAP, or PILEUP/PRETTYBOX programs Such software matches identical or similar sequences by assigning degrees of homology to various substitutions, deletions, and/or other modifications.
  • Conservative substitutions typically include substitutions within the following groups: glycine, alanine; valine, isoleucine, leucine;
  • a BLAST program may be used, with a probability score between e 3 and e 100 indicating a closely related sequence.
  • COBALT is used, for example, with the following parameters:
  • EMBOSS Needle is used, for example, with the following parameters:
  • target site refers to a sequence within a nucleic acid molecule that is modified by a nucleobase editor.
  • the target site is deaminated by a deaminase or a fusion protein comprising a deaminase (e.g ., cytidine or adenine deaminase).
  • the terms“treat,” treating,”“treatment,” and the like refer to reducing or ameliorating a disorder and/or symptoms associated therewith or obtaining a desired pharmacologic and/or physiologic effect. It will be appreciated that, although not precluded, treating a disorder or condition does not require that the disorder, condition or symptoms associated therewith be completely eliminated. In some embodiments, the effect is therapeutic, i.e., without limitation, the effect partially or completely reduces, diminishes, abrogates, abates, alleviates, decreases the intensity of, or cures a disease and/or adverse symptom attributable to the disease.
  • the effect is preventative, i.e., the effect protects or prevents an occurrence or reoccurrence of a disease or condition.
  • the presently disclosed methods comprise administering a therapeutically effective amount of a compositions as described herein.
  • uracil glycosylase inhibitor or“UGI” is meant an agent that inhibits the uracil- excision repair system.
  • the agent is a protein or fragment thereof that binds a host uracil-DNA glycosylase and prevents removal of uracil residues from DNA.
  • a UGI is a protein, a fragment thereof, or a domain that is capable of inhibiting a uracil-DNA glycosylase base-excision repair enzyme.
  • a UGI domain comprises a wild-type UGI or a modified version thereof.
  • a UGI domain comprises a fragment of the exemplary amino acid sequence set forth below.
  • a UGI fragment comprises an amino acid sequence that comprises at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the exemplary UGI sequence provided below.
  • a UGI comprises an amino acid sequence that is homologous to the exemplary UGI amino acid sequence or fragment thereof, as set forth below.
  • the UGI is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identical to a wild- type UGI or a UGI sequence, or portion thereof, as set forth below.
  • An exemplary UGI comprises an amino acid sequence as follows:
  • vector refers to a means of introducing a nucleic acid sequence into a cell, resulting in a transformed cell.
  • Vectors include plasmids, transposons, phages, viruses, liposomes, and episome.
  • “Expression vectors” are nucleic acid sequences comprising the nucleotide sequence to be expressed in the recipient cell. Expression vectors may include additional nucleic acid sequences to promote and/or facilitate the expression of the of the introduced sequence such as start, stop, enhancer, promoter, and secretion sequences.
  • compositions or methods provided herein can be combined with one or more of any of the other compositions and methods provided herein.
  • DNA editing has emerged as a viable means to modify disease states by correcting pathogenic mutations at the genetic level.
  • all DNA editing platforms have functioned by inducing a DNA double strand break (DSB) at a specified genomic site and relying on endogenous DNA repair pathways to determine the product outcome in a semi stochastic manner, resulting in complex populations of genetic products.
  • DSB DNA double strand break
  • endogenous DNA repair pathways to determine the product outcome in a semi stochastic manner, resulting in complex populations of genetic products.
  • HDR homology directed repair
  • a number of challenges have prevented high efficiency repair using HDR in therapeutically-relevant cell types. In practice, this pathway is inefficient relative to the competing, error-prone non-homologous end joining pathway.
  • HDR is tightly restricted to the G1 and S phases of the cell cycle, preventing precise repair of DSBs in post mitotic cells.
  • it has proven difficult or impossible to alter genomic sequences in a user-defined, programmable manner with high efficiencies in these populations.
  • compositions or methods provided herein can be combined with one or more of any of the other compositions and methods provided herein.
  • DNA editing has emerged as a viable means to modify disease states by correcting pathogenic mutations at the genetic level.
  • all DNA editing platforms have functioned by inducing a DNA double strand break (DSB) at a specified genomic site and relying on endogenous DNA repair pathways to determine the product outcome in a semi stochastic manner, resulting in complex populations of genetic products.
  • DSB DNA double strand break
  • endogenous DNA repair pathways to determine the product outcome in a semi stochastic manner, resulting in complex populations of genetic products.
  • HDR homology directed repair
  • a number of challenges have prevented high efficiency repair using HDR in therapeutically-relevant cell types. In practice, this pathway is inefficient relative to the competing, error-prone non-homologous end joining pathway.
  • HDR is tightly restricted to the G1 and S phases of the cell cycle, preventing precise repair of DSBs in post mitotic cells.
  • it has proven difficult or impossible to alter genomic sequences in a user-defined, programmable manner with high efficiencies in these populations.
  • FIGs. 1A - 1C depict plasmids.
  • FIG. 1A is an expression vector encoding a
  • FIG. IB is a plasmid comprising nucleic acid molecules encoding proteins that confer chloramphenicol resistance (CamR) and spectinomycin resistance (SpectR). The plasmid also comprises a kanamycin resistance gene disabled by two point mutations.
  • FIG. 1C is a plasmid comprising nucleic acid molecules encoding proteins that confer chloramphenicol resistance (CamR) and spectinomycin resistance (SpectR). The plasmid also comprises a kanamycin resistance gene disabled by three point mutations.
  • FIG. 2 is an image of bacterial colonies transduced with the expression vectors depicted in FIG. 1, which included a defective kanamycin resistance gene.
  • the vectors contained ABE7.10 variants that were generated using error prone PCR. Bacterial cells expressing these“evolved” ABE7.10 variants were selected for kanamycin resistance using increasing concentrations of kanamycin. Bacteria expressing ABE7.10 variants having adenosine deaminase activity were capable of correcting the mutations introduced into the kanamycin resistance gene, thereby restoring kanamycin resistance. The kanamycin resistant cells were selected for further analysis. FIGs.
  • FIG. 3A and 3B illustrate editing of a regulatory region of the hemoglobin subunit gamma (HGB1) locus, which is a therapeutically relevant site for upregulation of fetal hemoglobin.
  • FIG. 3A is a drawing of a portion of the regulatory region for the HGB1 gene.
  • FIG. 3B quantifies the efficiency and specificity of adenosine deaminase variants. Editing is assayed at the hemoglobin subunit gamma 1 (HGB1) locus in HEK293T cells, which is therapeutically relevant site for upregulation of fetal hemoglobin.
  • the top panel depicts nucleotide residues in the target region of the regulatory sequence of the HGB1 gene.
  • A5, A8, A9, and A11 denote the edited adenosine residues in HGB1.
  • FIG. 4 illustrates the relative effectiveness of adenosine base editors comprising a dCas9 that recognizes a noncanonical PAM sequence.
  • the top panel depicts the coding sequence of the hemoglobin subunit.
  • the bottom panel is a graph demonstrating the efficiency of adenosine deaminase variant base editors with guide RNAs of varying lengths.
  • FIG. 5 is a graph illustrating the efficiency and specificity of ABE8 base editors. The percent editing at intended target nucleotides and unintended target nucleotides (bystanders) is quantified.
  • FIG. 6 is a graph illustrating the efficiency and specificity of ABE8 base editors. The percent editing at intended target nucleotides and unintended target nucleotides (bystanders) is quantified.
  • FIGs. 7A - 7D depict eighth generation adenine base editors mediate superior A ⁇ T to G * C conversion in human cells.
  • FIG. 7A illustrates an overview of adenine base editing: i) ABE8 creates an R-loop at a sgRNA-targeted site in the genome; ii) TadA* deaminase chemically converts adenine to inosine via hydrolytic deamination on the ss-DNA portion of the R-loop; iii) D10A nickase of Cas9 nicks the strand opposite of the inosine containing strand; iv) the inosine containing strand can be used as a template during DNA replication; v) inosine preferentially base pairs with cytosine in the context of DNA polymerases; and vi) following replication, inosine may be replaced by guanosine.
  • FIG. 7B illustrates the architecture of ABE8.x-m and ABE8.x-d.
  • FIG. 7C illustrates three perspectives of the E. coli TadA deaminase (PDB 1Z3 A) aligned with the S. aureus TadA (not shown) complexed with tRNAArg2 (PDB 2B3 J). Mutations identified in eighth round of evolution are highlighted.
  • FIG. 7D are graphs depicting A ⁇ T to G * C base editing efficiencies of core ABE8 constructs relative to ABE7.10 constructs in Hek293T cells across eight genomic sites. Values and error bars reflect the mean and s.d. of three independent biological replicates performed on different days.
  • FIGS 8A-8C depict Cas9 PAM-variant ABE8s and catalytically dead Cas9 ABE8 variants mediate higher A ⁇ T to G * C conversion than corresponding ABE7.10 variants in human cells. Values and error bars reflect the mean and s.d. of three independent biological replicates performed on different days.
  • FIG. 8A is a graph depicting A ⁇ T to G * C conversion in Hek293T cells with NG-Cas9 ABE8s (-NG PAM).
  • FIG. 8B is a graph depiecting A ⁇ T to G*C conversion in Hek293T cells with Sa-Cas9 ABE8s (-NNGRRT PAM).
  • FIG. 8A is a graph depicting A ⁇ T to G * C conversion in Hek293T cells with NG-Cas9 ABE8s (-NG PAM).
  • FIG. 8B is a graph depiecting A ⁇ T to G*C conversion in Hek293T cells with Sa-C
  • 8C is a graph depiecting A ⁇ T to G * C conversion in Hek293T cells with catalytically inactivated, dCas9-ABE8s (D10A, H840A in S. pyogenes Cas9).
  • FIGs 9A and 9B are graphs that depict on-target DNA editing frequencies.
  • FIGs 9B and 9C are graphs that depict sgRNA-guided DNA-off- target editing frequencies.
  • FIG 9E is a graph depicting RNA off-target editing frequencies.
  • FIGs. 10A-10B depict the median A ⁇ T to G * C conversion and corresponding INDEL formation of TadA, C-terminal alpha-helix truncation ABE constructs in HEK293T cells.
  • FIG 10A is a heat map depicting A ⁇ T to G * C median editing conversion across 8 genomic sites.
  • FIG 11 are heat maps depicting the median A ⁇ T to G * C conversion of 40 ABE8 constructs in HEK293T cells across 8 genomic sites. Median values were determined from two or greater biological replicates.
  • FIG. 12 is a heat map depicting median INDEL % of 40 ABE8 constructs in HEK293T cells across 8 genomic sites. Median values were determined from two or greater biological replicates.
  • FIG. 13 is a graph depicting fold change in editing, ABE8:ABE7. Representation of average ABE8:ABE7 A ⁇ T to G * C editing in Hek293T cells across all A positions within the target of eight different genomic sites. Positions 2-12 denote location of a target adenine within the 20-nt protospacer with position 20 directly 5’ of the -NGG PAM.
  • FIG. 14 depicts a dendrogram of ABE8s. Core ABE8 constructs selected for further studies highlighted in in black.
  • FIG. 15 are heat maps depicting median A ⁇ T to G * C conversion of core eight ABE8 constructs in HEK293T cells across 8 genomic sites. Median values were determined from three or greater biological replicates.
  • FIG. 16 is a heat map depicting median INDEL frequency of core 8 ABE8s tested at 8 genomic sites in HEK293T cells.
  • FIG. 21 are heat maps depicting median A ⁇ T to G * C conversion of core dC9-ABE8- m constructs at eight genomic sites in HEK293T cells.
  • Dead Cas9 (dC9) is defined as D10A and H840A mutations within S. pyogenes Cas9. Median value generated from n>3 biological replicate.
  • FIG. 22 are heat maps depicting median A ⁇ T to G * C conversion of core dC9-ABE8-d constructs at eight genomic sites in HEK293T cells.
  • Dead Cas9 (dC9) is defined as D10A and H840A mutations within S. pyogenes Cas9. Median value generated from n>3 biological replicate.
  • FIGs. 23A and 23B depict Median INDEL frequency of core dC9-ABE8s tested at 8 genomic sites in HEK293T cells. Median value generated from n>3 biological replicate.
  • FIG. 23A is a heat map depicting indel frequency shown for dC9-ABE8-m variants relative to ABE7.10.
  • FIG. 23B is a heat map depicting indel frequency shown for dC9-ABE8-d variants relative to ABE7.10.
  • FIG. 24 is a graph depicting OG to T ⁇ A editing with Hek293T cells treated with ABE8s and ABE7.10. Editing frequencies for each site averaged across all C positions within the target. Cytosines within the protospacer are indicted with shading.
  • FIGs. 25A and 25B are graph depicting on-target DNA editing frequencies for core ABE8 constructs as compared to ABE7.
  • FIGs. 25C and 25D are graphs depicting on-target DNA editing frequencies for ABE8 with mutations that improve RNA off-target editing.
  • FIGs. 25E and 25F are graphs depicting sgRNA-guided DNA-off-target editing frequencies for core ABE 8 constructs as compared to ABE7.
  • FIGs. 25G and 25H are graphs depicting sgRNA-guided DNA-off-target editing frequencies for ABE 8 constructs with mutations that improve RNA off-target editing.
  • FIGs. 27A and 27B depict A ⁇ T to G » C conversion and phenotypic outcomes in primary cells.
  • FIG. 27A is a graph depicting A ⁇ T to G C conversion at -198 HBG1/2 site in CD34+ cells treated with ABE from two separate donors. NGS analysis conducted at 48 and 144h post treatment. -198 HBG1/2 target sequence shown with A7 highlighted. Percent A ⁇ T to G * C plotted for A7.
  • FIG. 27B is a graph depicting percentage of g-globin formed as a fraction of alpha-globin. Values shown from two different donors, post ABE treatment and erythroid differentiation.
  • FIGs. 28A and 28B depict A ⁇ T to G * C conversion of CD34+ cells treated with ABE8 at the -198 promoter site upstream of HBG1/2.
  • FIG. 28A is a heat map depicting A to G editing frequency of ABE8s in CD34+ cells from two donors, where Donor 2 is heterozygous for sickle cell disease, at 48 and 144h post editor treatment.
  • FIG. 28B is a graphical representation of distribution of total sequencing reads which contain either A7 only edits or combined (A7 + A8) edits.
  • FIG. 29 is a heat map depicting INDEL frequency of CD34+ cells treated with ABE8 at the -198 site of the gamma-globin promoter. Frequencies shown from two donors at 48h and 144h time points.
  • FIG. 30 depicts an UHPLC UV-Vis trace (220 nm) and integration of globin chain levels of untreated differentiated CD34+ cells (donor 1).
  • FIG. 31 depicts an UHPLC UV-Vis trace (220 nm) and integration of globin chain levels of differentiated CD34+ cells treated with ABE7.10-m (donorl)
  • FIG. 32 depicts an UHPLC UV-Vis trace (220 nm) and integration of globin chain levels of differentiated CD34+ cells treated with ABE7.10-d (donorl).
  • FIG. 33 depicts an UHPLC UV-Vis trace (220 nm) and integration of globin chain levels of differentiated CD34+ cells treated with ABE8.8-m (donorl)
  • FIG. 34 depicts an UHPLC UV-Vis trace (220 nm) and integration of globin chain levels of differentiated CD34+ cells treated with ABE8.8-d (donorl).
  • FIG. 35 depicts an UHPLC UV-Vis trace (220 nm) and integration of globin chain levels of differentiated CD34+ cells treated with ABE8.13-m (donorl).
  • FIG. 36 depicts an UHPLC UV-Vis trace (220 nm) and integration of globin chain levels of differentiated CD34+ cells treated with ABE8.13-d (donorl).
  • FIG. 37 depicts an UHPLC UV-Vis trace (220 nm) and integration of globin chain levels of differentiated CD34+ cells treated with ABE8.17-m (donorl).
  • FIG. 38 depicts an UHPLC UV-Vis trace (220 nm) and integration of globin chain levels of differentiated CD34+ cells treated with ABE8.17-d (donorl).
  • FIG. 39 depicts an UHPLC UV-Vis trace (220 nm) and integration of globin chain levels of differentiated CD34+ cells treated with ABE8.20-m (donorl).
  • FIG. 40 depicts an UHPLC UV-Vis trace (220 nm) and integration of globin chain levels of differentiated CD34+ cells treated with ABE8.20-d (donor 1).
  • FIG. 41 depicts an UHPLC UV-Vis trace (220 nm) and integration of globin chain levels of differentiated CD34+ cells untreated (donor 2). Note: donor 2 is heterozygous for sickle cell disease.
  • FIG. 42 depicts an UHPLC UV-Vis trace (220 nm) and integration of globin chain levels of differentiated CD34+ cells treated with ABE7.10-m (donor 2). Note: donor 2 is heterozygous for sickle cell disease.
  • FIG. 43 depicts an UHPLC UV-Vis trace (220 nm) and integration of globin chain levels of differentiated CD34+ cells treated with ABE7.10-d (donor 2). Note: donor 2 is heterozygous for sickle cell disease.
  • FIG. 44 depicts an UHPLC UV-Vis trace (220 nm) and integration of globin chain levels of differentiated CD34+ cells treated with ABE8.8-m (donor 2). Note: donor 2 is heterozygous for sickle cell disease.
  • FIG. 45 depicts an UHPLC UV-Vis trace (220 nm) and integration of globin chain levels of differentiated CD34+ cells treated with ABE8.8-d (donor 2). Note: donor 2 is heterozygous for sickle cell disease.
  • FIG. 46 depicts an UHPLC UV-Vis trace (220 nm) and integration of globin chain levels of differentiated CD34+ cells treated with ABE8.13-m (donor 2). Note: donor 2 is heterozygous for sickle cell disease.
  • FIG. 47 depicts an UHPLC UV-Vis trace (220 nm) and integration of globin chain levels of differentiated CD34+ cells treated with ABE8.13-d (donor 2). Note: donor 2 is heterozygous for sickle cell disease.
  • FIG. 48 depicts an UHPLC UV-Vis trace (220 nm) and integration of globin chain levels of differentiated CD34+ cells treated with ABE8.17-m (donor 2). Note: donor 2 is heterozygous for sickle cell disease.
  • FIG. 49 depicts an UHPLC UV-Vis trace (220 nm) and integration of globin chain levels of differentiated CD34+ cells treated with ABE8.17-d (donor 2). Note: donor 2 is heterozygous for sickle cell disease.
  • FIG. 50 depicts an UHPLC UV-Vis trace (220 nm) and integration of globin chain levels of differentiated CD34+ cells treated with ABE8.20-m (donor 2). Note: donor 2 is heterozygous for sickle cell disease.
  • FIG. 51A-51E depict editing with ABE8.8 at two independent sites reached over 90% editing on day 11 post erythroid differentiation before enucleation and about 60% of gamma globin over alpha globin or total beta family globin on day 18 post erythroid differentiation.
  • FIG. 51A is a graph depicting an average of ABE8.8 editing in 2 healthy donors in 2 independent experiments. Editing efficiency was measured with primers that distinguish HBGl and HBG2.
  • FIG. 51B is a graph depicting an average of 1 healthy donor in 2 independent experiments. Editing efficiency was measured with primers that recognize both HBGl and HBG2.
  • FIG. 51C is a graph depicting editing of ABE8.8 in a donor with heterozygous E6V mutation.
  • FIGs. 51D and 51E are graphs depicting gamma globin increase in the ABE8.8 edited cells.
  • FIGs. 52A and 52B depict percent editing using ABE variants to correct sickle cell mutations.
  • FIG. 52A is a graph depicting a screen of different editor variants with about 70% editing in SCD patient fibroblasts.
  • FIG. 52B is a graph depicting CD34 cells from healthy donors edited with a lead ABE variant, targeting a synonymous mutation A13 in an adjacent proline that resides within the editing window and serves as a proxy for editing the SCD mutation.
  • ABE8 variants showed an average editing frequency around 40% at the proxy A13.
  • FIG. 53A is a graph depicting A-to-I editing frequencies in targeted RNA amplicons for core ABE 8 constructs as compared to ABE7 and Cas9(D10A) nickase control.
  • FIG. 53B is a graph depicting A-to-I editing frequencies in targeted RNA amplicons for ABE8 with mutations that have been reported to improve RNA off-target editing.
  • FIG. 54 is a schematic diagram illustrating the loss of dopamine that results from the loss of dopaminergic neurons in Parkinson Disease.
  • FIG. 55 is a schematic diagram showing a guide RNA and target sequences for the correction of R1441C and R1441H mutations in LRRK2 associated with Parkinson’s Disease.
  • FIG. 56 is a schematic diagram showing target sequences for correction of the Y1699C, G2019S, and 12020 mutations in LRRK2 associated with Parkinson’s Disease.
  • FIG. 57A-57C provides a graph, a schematic diagram, and a table.
  • FIG. 57A quantifies the percent conversion of A to G at nucleic acid position 7 of the LRRK2 target sequence.
  • the editors used are designated PV1-PV14, a description of this which is provided below.
  • pCMV designates the CMV promoter
  • bpNLS designates a bipartite Nuclear Localization Signal
  • monoABE8.1 designates a monomeric form of the ABE8.1 base editor.
  • FIG. 57B depicts target sequences and guide RNA for correction of the R1441C mutation in LRRK2 associated with Parkinson’s Disease.
  • FIG. 57C shows the percent conversion of A to G at nucleic acid position 7 of the LRRK2 target sequence.
  • Editors PV1-14 were used to edit LRRK2 R1441C.
  • Editors (15-28) were used to edit G2109.
  • PV1 also termed PV15.
  • PV2 also termed PV16.
  • PV3 also termed PV17.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Microbiology (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Neurosurgery (AREA)
  • Neurology (AREA)
  • Epidemiology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Immunology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Psychology (AREA)
  • Diabetes (AREA)
  • Obesity (AREA)
  • Virology (AREA)
  • Cell Biology (AREA)
  • Mycology (AREA)
  • Hematology (AREA)
PCT/US2020/018073 2019-02-13 2020-02-13 Methods of editing a disease-associated gene using adenosine deaminase base editors, including for the treatment of genetic disease Ceased WO2020168051A1 (en)

Priority Applications (9)

Application Number Priority Date Filing Date Title
JP2021546888A JP7586601B2 (ja) 2019-02-13 2020-02-13 遺伝的疾患の治療用を含めアデノシンデアミナーゼ塩基エディターを用いて疾患関連遺伝子を編集する方法
KR1020217029268A KR20210127206A (ko) 2019-02-13 2020-02-13 유전성 질환의 치료를 위한 것을 포함하는, 아데노신 데아미나제 염기 편집기를 사용하여 질환-관련 유전자를 편집하는 방법
CA3128876A CA3128876A1 (en) 2019-02-13 2020-02-13 Methods of editing a disease-associated gene using adenosine deaminase base editors, including for the treatment of genetic disease
CN202080028186.5A CN114040970B (zh) 2019-02-13 2020-02-13 使用腺苷脱氨酶碱基编辑器编辑疾病相关基因的方法,包括遗传性疾病的治疗
AU2020223306A AU2020223306A1 (en) 2019-02-13 2020-02-13 Methods of editing a disease-associated gene using adenosine deaminase base editors, including for the treatment of genetic disease
US17/430,672 US20230140953A1 (en) 2019-02-13 2020-02-13 Methods of editing a disease-associated gene using adenosine deaminase base editors, including for the treatment of genetic disease
EP20756724.9A EP3924484A4 (en) 2019-02-13 2020-02-13 METHODS OF EDITING A DISEASE-ASSOCIATED GENE USING ADENOSINE DEAMINASE BASE EDITORS, INCLUDING FOR THE TREATMENT OF A GENETIC DISEASE
CN202411269394.0A CN119280261A (zh) 2019-02-13 2020-02-13 使用腺苷脱氨酶碱基编辑器编辑疾病相关基因的方法,包括遗传性疾病的治疗
JP2024193416A JP2025032080A (ja) 2019-02-13 2024-11-05 遺伝的疾患の治療用を含めアデノシンデアミナーゼ塩基エディターを用いて疾患関連遺伝子を編集する方法

Applications Claiming Priority (18)

Application Number Priority Date Filing Date Title
US201962805271P 2019-02-13 2019-02-13
US62/805,271 2019-02-13
US201962850919P 2019-05-21 2019-05-21
US62/850,919 2019-05-21
US201962852224P 2019-05-23 2019-05-23
US201962852228P 2019-05-23 2019-05-23
US62/852,228 2019-05-23
US62/852,224 2019-05-23
US201962873138P 2019-07-11 2019-07-11
US62/873,138 2019-07-11
US201962888867P 2019-08-19 2019-08-19
US62/888,867 2019-08-19
US201962931722P 2019-11-06 2019-11-06
US62/931,722 2019-11-06
US201962941569P 2019-11-27 2019-11-27
US62/941,569 2019-11-27
US202062966526P 2020-01-27 2020-01-27
US62/966,526 2020-01-27

Publications (2)

Publication Number Publication Date
WO2020168051A1 true WO2020168051A1 (en) 2020-08-20
WO2020168051A9 WO2020168051A9 (en) 2020-10-22

Family

ID=72045106

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2020/018073 Ceased WO2020168051A1 (en) 2019-02-13 2020-02-13 Methods of editing a disease-associated gene using adenosine deaminase base editors, including for the treatment of genetic disease

Country Status (8)

Country Link
US (1) US20230140953A1 (https=)
EP (1) EP3924484A4 (https=)
JP (2) JP7586601B2 (https=)
KR (1) KR20210127206A (https=)
CN (2) CN119280261A (https=)
AU (1) AU2020223306A1 (https=)
CA (1) CA3128876A1 (https=)
WO (1) WO2020168051A1 (https=)

Cited By (24)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2021136408A1 (zh) * 2019-12-30 2021-07-08 博雅辑因(北京)生物科技有限公司 一种基于leaper技术治疗mps ih的方法和组合物
US11142760B2 (en) 2019-02-13 2021-10-12 Beam Therapeutics Inc. Compositions and methods for treating hemoglobinopathies
US11168324B2 (en) 2018-03-14 2021-11-09 Arbor Biotechnologies, Inc. Crispr DNA targeting enzymes and systems
WO2022027035A1 (en) * 2020-07-27 2022-02-03 The Children's Hospital Of Philadelphia In utero and postnatal gene editing and therapy for treatment of monogenic diseases, including mucopolysaccharidosis type 1h and other disorders
CN114686456A (zh) * 2022-05-10 2022-07-01 中山大学 基于双分子脱氨酶互补的碱基编辑系统及其应用
WO2022241270A3 (en) * 2021-05-14 2022-12-22 Beam Therapeutics Inc. Compositions and methods for treating transthyretin amyloidosis
US11661596B2 (en) 2019-07-12 2023-05-30 Peking University Targeted RNA editing by leveraging endogenous ADAR using engineered RNAs
WO2023102449A3 (en) * 2021-12-01 2023-07-13 Shape Therapeutics Inc. Engineered guide rnas and polynucleotides for rna editing targeting lrrk2
US11702658B2 (en) 2019-04-15 2023-07-18 Edigene Therapeutics (Beijing) Inc. Methods and compositions for editing RNAs
WO2023169454A1 (zh) * 2022-03-08 2023-09-14 中国科学院遗传与发育生物学研究所 腺嘌呤脱氨酶及其在碱基编辑中的用途
JP2023546681A (ja) * 2020-10-21 2023-11-07 ザ ボード オブ トラスティーズ オブ ザ レランド スタンフォード ジュニア ユニバーシティー Adarを動員するガイドrnaのスクリーニングプラットフォーム
WO2024052681A1 (en) * 2022-09-08 2024-03-14 The University Court Of The University Of Edinburgh Rett syndrome therapy
JP2024514649A (ja) * 2021-04-16 2024-04-02 ビーム セラピューティクス インク. 肝細胞の遺伝子修飾
JP2024519922A (ja) * 2021-05-21 2024-05-21 ビーム セラピューティクス インク. トランスサイレチン遺伝子の塩基編集
US12133884B2 (en) 2018-05-11 2024-11-05 Beam Therapeutics Inc. Methods of substituting pathogenic amino acids using programmable base editor systems
WO2024233941A1 (en) * 2023-05-11 2024-11-14 Massachusetts Eye And Ear Infirmary Base editing approaches to treat abca4-associated stargardt disease
WO2025180419A1 (zh) * 2024-02-26 2025-09-04 尧唐(上海)生物科技有限公司 一种脱氨酶变体、包含其的碱基编辑器及其应用
US12454694B2 (en) 2018-09-07 2025-10-28 Beam Therapeutics Inc. Compositions and methods for improving base editing
US12522812B2 (en) 2018-05-16 2026-01-13 Arbor Biotechnologies, Inc. CRISPR-associated systems and components
US12529041B2 (en) 2018-09-07 2026-01-20 Beam Therapeutics Inc. Compositions and methods for delivering a nucleobase editing system
US12576151B2 (en) 2020-09-25 2026-03-17 Beam Therapeutics Inc. Fratricide resistant modified immune cells and methods of using the same
US12594301B2 (en) 2019-09-27 2026-04-07 Beam Therapeutics Inc. Compositions and methods for treatment of liquid cancers
US12600971B2 (en) 2019-02-13 2026-04-14 Beam Therapeutics Inc. Modified immune cells having adenosine deaminase base editors for modifying a nucleobase in a target sequence
US12612618B2 (en) 2020-01-31 2026-04-28 Beam Therapeutics Inc. Nucleobase editors having reduced non-target deamination and assays for characterizing nucleobase editors

Families Citing this family (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA3170326A1 (en) * 2020-02-13 2021-08-19 Beam Therapeutics Inc. Compositions and methods for engraftment of base edited cells
EP4426821A1 (en) * 2021-11-02 2024-09-11 University of Massachusetts Nme2cas9 inlaid domain fusion proteins
WO2024230760A1 (zh) * 2023-05-09 2024-11-14 北京齐禾生科生物科技有限公司 一种可作用于dna的腺苷脱氨酶及其应用
WO2024238623A1 (en) * 2023-05-15 2024-11-21 University Of Georgia Research Foundation, Inc. Doubly constrained peptides as allosteric inhibitors of leucine rich repeat kinase 2
CN117965505A (zh) * 2023-06-28 2024-05-03 微光基因(苏州)有限公司 工程化的腺苷脱氨酶及碱基编辑器
WO2025184515A1 (en) * 2024-02-29 2025-09-04 Vesigen, Inc. Arrdc1-mediated microvesicle-based delivery of therapeutic agents to cells and tissues of the eye

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20130109048A1 (en) * 2010-07-09 2013-05-02 Ecole Polytechnique Federale De Lausanne (Epfl) Method for in-vitro monitoring of neuronal disorders and use thereof
WO2018027078A1 (en) * 2016-08-03 2018-02-08 President And Fellows Of Harard College Adenosine nucleobase editors and uses thereof
US20180216095A1 (en) * 2014-10-14 2018-08-02 Halozyme, Inc. Compositions of adenosine deaminase-2 (ada2), variants thereof and methods of using same
WO2018213708A1 (en) * 2017-05-18 2018-11-22 The Broad Institute, Inc. Systems, methods, and compositions for targeted nucleic acid editing
WO2019005884A1 (en) * 2017-06-26 2019-01-03 The Broad Institute, Inc. CRISPR / CAS-ADENINE DEAMINASE COMPOSITIONS, SYSTEMS AND METHODS FOR TARGETED NUCLEIC ACID EDITION

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3526320A1 (en) * 2016-10-14 2019-08-21 President and Fellows of Harvard College Aav delivery of nucleobase editors
CN109306361B (zh) * 2018-02-11 2022-06-28 华东师范大学 一种新的a/t到g/c碱基定点转换的基因编辑系统
CN109295186B (zh) * 2018-09-30 2023-10-03 中山大学 一种基于全基因组测序检测腺嘌呤单碱基编辑系统脱靶效应的方法及其在基因编辑中的应用

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20130109048A1 (en) * 2010-07-09 2013-05-02 Ecole Polytechnique Federale De Lausanne (Epfl) Method for in-vitro monitoring of neuronal disorders and use thereof
US20180216095A1 (en) * 2014-10-14 2018-08-02 Halozyme, Inc. Compositions of adenosine deaminase-2 (ada2), variants thereof and methods of using same
WO2018027078A1 (en) * 2016-08-03 2018-02-08 President And Fellows Of Harard College Adenosine nucleobase editors and uses thereof
WO2018213708A1 (en) * 2017-05-18 2018-11-22 The Broad Institute, Inc. Systems, methods, and compositions for targeted nucleic acid editing
WO2019005884A1 (en) * 2017-06-26 2019-01-03 The Broad Institute, Inc. CRISPR / CAS-ADENINE DEAMINASE COMPOSITIONS, SYSTEMS AND METHODS FOR TARGETED NUCLEIC ACID EDITION

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See also references of EP3924484A4 *

Cited By (31)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11912992B2 (en) 2018-03-14 2024-02-27 Arbor Biotechnologies, Inc. CRISPR DNA targeting enzymes and systems
US11168324B2 (en) 2018-03-14 2021-11-09 Arbor Biotechnologies, Inc. Crispr DNA targeting enzymes and systems
US12133884B2 (en) 2018-05-11 2024-11-05 Beam Therapeutics Inc. Methods of substituting pathogenic amino acids using programmable base editor systems
US12522812B2 (en) 2018-05-16 2026-01-13 Arbor Biotechnologies, Inc. CRISPR-associated systems and components
US12529041B2 (en) 2018-09-07 2026-01-20 Beam Therapeutics Inc. Compositions and methods for delivering a nucleobase editing system
US12454694B2 (en) 2018-09-07 2025-10-28 Beam Therapeutics Inc. Compositions and methods for improving base editing
EP3924481A4 (en) * 2019-02-13 2023-01-25 Beam Therapeutics Inc. Compositions and methods for treating hemoglobinopathies
US11344609B2 (en) 2019-02-13 2022-05-31 Beam Therapeutics Inc. Compositions and methods for treating hemoglobinopathies
US11752202B2 (en) 2019-02-13 2023-09-12 Beam Therapeutics Inc. Compositions and methods for treating hemoglobinopathies
US12600971B2 (en) 2019-02-13 2026-04-14 Beam Therapeutics Inc. Modified immune cells having adenosine deaminase base editors for modifying a nucleobase in a target sequence
US11142760B2 (en) 2019-02-13 2021-10-12 Beam Therapeutics Inc. Compositions and methods for treating hemoglobinopathies
US12016908B2 (en) 2019-02-13 2024-06-25 Beam Therapeutics Inc. Compositions and methods for treating hemoglobinopathies
US11702658B2 (en) 2019-04-15 2023-07-18 Edigene Therapeutics (Beijing) Inc. Methods and compositions for editing RNAs
US11661596B2 (en) 2019-07-12 2023-05-30 Peking University Targeted RNA editing by leveraging endogenous ADAR using engineered RNAs
US12594301B2 (en) 2019-09-27 2026-04-07 Beam Therapeutics Inc. Compositions and methods for treatment of liquid cancers
WO2021136408A1 (zh) * 2019-12-30 2021-07-08 博雅辑因(北京)生物科技有限公司 一种基于leaper技术治疗mps ih的方法和组合物
US12612618B2 (en) 2020-01-31 2026-04-28 Beam Therapeutics Inc. Nucleobase editors having reduced non-target deamination and assays for characterizing nucleobase editors
WO2022027035A1 (en) * 2020-07-27 2022-02-03 The Children's Hospital Of Philadelphia In utero and postnatal gene editing and therapy for treatment of monogenic diseases, including mucopolysaccharidosis type 1h and other disorders
US12576151B2 (en) 2020-09-25 2026-03-17 Beam Therapeutics Inc. Fratricide resistant modified immune cells and methods of using the same
JP2023546681A (ja) * 2020-10-21 2023-11-07 ザ ボード オブ トラスティーズ オブ ザ レランド スタンフォード ジュニア ユニバーシティー Adarを動員するガイドrnaのスクリーニングプラットフォーム
EP4232584A4 (en) * 2020-10-21 2025-07-16 Univ Leland Stanford Junior SCREENING PLATFORM FOR RECRUITING GUIDE RNAS
JP2024514649A (ja) * 2021-04-16 2024-04-02 ビーム セラピューティクス インク. 肝細胞の遺伝子修飾
WO2022241270A3 (en) * 2021-05-14 2022-12-22 Beam Therapeutics Inc. Compositions and methods for treating transthyretin amyloidosis
JP2024519922A (ja) * 2021-05-21 2024-05-21 ビーム セラピューティクス インク. トランスサイレチン遺伝子の塩基編集
WO2023102449A3 (en) * 2021-12-01 2023-07-13 Shape Therapeutics Inc. Engineered guide rnas and polynucleotides for rna editing targeting lrrk2
WO2023169454A1 (zh) * 2022-03-08 2023-09-14 中国科学院遗传与发育生物学研究所 腺嘌呤脱氨酶及其在碱基编辑中的用途
US12331291B2 (en) 2022-05-10 2025-06-17 Sun Yat-Sen University Split complementary base editing systems based on bimolecular deaminases and uses thereof
CN114686456A (zh) * 2022-05-10 2022-07-01 中山大学 基于双分子脱氨酶互补的碱基编辑系统及其应用
WO2024052681A1 (en) * 2022-09-08 2024-03-14 The University Court Of The University Of Edinburgh Rett syndrome therapy
WO2024233941A1 (en) * 2023-05-11 2024-11-14 Massachusetts Eye And Ear Infirmary Base editing approaches to treat abca4-associated stargardt disease
WO2025180419A1 (zh) * 2024-02-26 2025-09-04 尧唐(上海)生物科技有限公司 一种脱氨酶变体、包含其的碱基编辑器及其应用

Also Published As

Publication number Publication date
JP2022520080A (ja) 2022-03-28
KR20210127206A (ko) 2021-10-21
JP7586601B2 (ja) 2024-11-19
CN114040970B (zh) 2024-09-27
JP2025032080A (ja) 2025-03-11
US20230140953A1 (en) 2023-05-11
AU2020223306A1 (en) 2021-08-05
EP3924484A4 (en) 2024-07-17
WO2020168051A9 (en) 2020-10-22
CA3128876A1 (en) 2020-08-20
CN114040970A (zh) 2022-02-11
EP3924484A1 (en) 2021-12-22
CN119280261A (zh) 2025-01-10

Similar Documents

Publication Publication Date Title
US20240132867A1 (en) Adenosine deaminase base editors and methods of using same to modify a nucleobase in a target sequence
JP7586601B2 (ja) 遺伝的疾患の治療用を含めアデノシンデアミナーゼ塩基エディターを用いて疾患関連遺伝子を編集する方法
AU2019316094B2 (en) Multi-effector nucleobase editors and methods of using same to modify a nucleic acid target sequence
US20220098593A1 (en) Splice acceptor site disruption of a disease-associated gene using adenosine deaminase base editors, including for the treatment of genetic disease
JP7779988B2 (ja) 低減されたオフターゲット脱アミノ化を有する核酸塩基エディターおよび核酸塩基標的配列を改変するためのその使用方法
AU2020336969B2 (en) Compositions and methods for non-toxic conditioning
AU2019266326B2 (en) Methods of editing single nucleotide polymorphism using programmable base editor systems
AU2019265018B2 (en) Methods of suppressing pathogenic mutations using programmable base editor systems
US20220313799A1 (en) Compositions and methods for editing a mutation to permit transcription or expression
US20230070861A1 (en) Compositions and methods for treating hepatitis b

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20756724

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 3128876

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2020223306

Country of ref document: AU

Date of ref document: 20200213

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2021546888

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 20217029268

Country of ref document: KR

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2020756724

Country of ref document: EP

Effective date: 20210913