WO2020135243A1

WO2020135243A1 - Method for creating determinate growth plant type cotton

Info

Publication number: WO2020135243A1
Application number: PCT/CN2019/126867
Authority: WO
Inventors: 陈伟; 张永山; 姚金波; 李燕; 房圣涛
Original assignee: 中国农业科学院棉花研究所
Priority date: 2018-12-29
Filing date: 2019-12-20
Publication date: 2020-07-02
Also published as: CN109486832A; CN109486832B

Abstract

Provided is a method for rapidly creating, by means of a fixed-point gene editing technique, a new cotton material, the stems and fruit spurs of which show determinate growth. According to the method, a plant type regulation and control candidate gene GhLSGZ is knocked out by means of a fixed-point gene editing technique so as to obtain a Ghlsgz mutant with determinate growth habits, wherein the mutant can be used for improving the plant type of the cotton, thereby obtaining a new cotton strain with a superior plant type. Transgenic elements can be removed by means of descendant separation of the obtained Ghlsgz mutant. Also provided is a fixed-point knockout mutant gene of the GhLSGZ gene, a functional target sequence for knocking out the GhLSGZ gene and a complementary primer thereof, a fixed-point knockout vector for knocking out the GhLSGZ gene, a fixed-point knockout method for the GhLSGZ gene of a zero-type fruit spur gene and a method for regulating and controlling the plant type and maturity period of the cotton.

Description

Method for creating limited growth plant type cotton

Technical field

The invention belongs to the field of plant genetic engineering technology and crop genetic breeding technology, and in particular relates to a method for quickly creating new cotton materials with limited growth of main stems and fruit branches through gene fixed-point editing technology.

Background technique

Cotton (Gossypium) is an important economic crop and oil crop in the world. Cotton fiber is an excellent natural spinnable fiber and an important raw material for the textile industry. The advanced cotton-growing countries such as the United States and Australia have achieved full mechanization and strong international competitiveness, leading the direction of cotton development. my country is the world's largest cotton producer, consumer and textile exporter. However, as my country's labor costs continue to rise, the cotton planting benefits gradually decline, and changing the cotton planting method will maximize the cotton planting benefits. Due to the infinite growth characteristics of cotton main stems and branches, the cotton plants are tall and have a long growing period. The maturity of different cotton bolls is inconsistent. The production of cotton has more labor and it is difficult to mechanize the whole process. It changes the characteristics of infinite growth of cotton and shortens the growth of cotton. In the future, it will change the way of cotton planting, promote the whole process of mechanization, and improve the efficiency of cotton planting.

At present, most cotton varieties used in production are of an infinite type. The main stem is continuously differentiated and branched. The branch contains multiple nodes and can grow indefinitely. There is a type of fruit branch mutant with limited growth of fruit branches. It is also commonly called zero-type fruit branches. The zero-type fruit branch mutants usually show that the flower buds are directly differentiated from the main stem and leaf axils in the island cotton, while in the upland cotton, the fruit branch of the zero-type fruit branch material is usually a limited growth, and the top ends with 2 to 3 flowers, with premature , Compact plant type, concentrated flowering characteristics. However, the main stem of the zero-shaped fruit branch still keeps growing indefinitely, and constantly differentiates into limited fruit branches. Therefore, regulating the zero-type fruit branch gene GhLSGZ has important theoretical and practical significance for studying fruit branch development, regulating plant type structure, making cotton plant type more compact, more suitable for high-density planting and suitable for mechanical harvesting.

Gene editing technology is an efficient genetic modification technology developed in recent years, which can knock out endogenous genes of various organisms in a targeted manner. Compared with the early development of the Xin finger nuclease gene editing technology, the transcription activator-like effector nuclease (TALEN) system, clusters of regularly spaced short palindrome repeat sequences The efficiency of the CRISPR/Cas9 and CRISPR/Cpf1 systems in the related systems (Clustered regularly, interspaced, Palindromic repeats/CRISPR, associated, CRISPR/Cas system) is higher, especially the technology of the CRISPR/Cas9 system is more mature. The principle is to complete the recognition of the target site under the guidance of a 20nt long base target sequence (gRNA), and then Cas9 nuclease cleaves the target double strand to form a DNA double-strand break gap (DSB), which activates the two Repair mechanism (ie non-homologous end joining or homologous recombination), resulting in base deletion, insertion and replacement at the break.

The application of CRISPR/Cas9 editing technology in cotton is currently in the exploration stage, involving the optimization of vector types and promoter efficiency (eg Wang et al., 2017, Plant Biotechnology Journal, 16(1):137-150), The results showed that the editing efficiency of CRISPR/Cas9 in cotton was high, and the efficiency range was 66.7-100%. As a gene knockout method, CRISPR/Cas9 editing technology can be used as a gene function verification method and can be used to elucidate the biological function of genes.

Therefore, there is a need in the art for a method of regulating the zero-type fruit branch gene GhLSGZ gene to regulate the plant type structure, so that the obtained new cotton material has a more compact plant type, more suitable for high-density planting and suitable for machine harvesting.

Invention Disclosure

In response to the above-mentioned technical problems in the field, the inventors found that the GhLSGZ genes found in nature so far all have functional loss mutations only in the Dt copy, and the At copy function remains intact. The GhLSGZ gene has a dose effect. If At and Dt are mutated at the same time, the phenotypic variation may be more abundant, which is beneficial to breeding applications. Therefore, in order to overcome the limitations of existing breeding techniques, the present invention provides a method for quickly creating new cotton materials with limited growth of both main stems and fruit branches by knocking out the Dt and At double copies of the GhLSGZ gene.

In the first aspect, the present invention provides a targeted knockout mutant gene of the GhLSGZ gene (hereinafter sometimes simply referred to as the "targeted knockout mutant gene of the present invention"), which is characterized by the knockout of Dt and At of the GhLSGZ gene The nucleotide sequences of the double copy of the subgenomic set, the Dt copy and the At copy of the GhLSGZ gene are shown in SEQ ID No. 1 and 2, respectively.

In a preferred embodiment, the site-directed knock-out mutant gene of the present invention is the GhLSGZ gene site-directed knock-out mutant gene named Ghlsgz-1, and the nucleotide sequences of its Dt copy and At copy are shown in SEQ ID No. 3 and 4, respectively. As shown.

In another preferred embodiment, the site-directed knock-out mutant gene of the present invention is the GhLSGZ gene site-directed knock-out mutant gene named Ghlsgz-2, and the nucleotide sequences of its Dt copy and At copy are as shown in SEQ ID No. 5 And 6 are shown.

In the second aspect, the present invention provides the application of the GhLSGZ gene targeted knockout mutant gene in regulating the plant type and maturity of cotton.

In the present invention, regulating the plant type and maturity of cotton is to regulate the growth habit of the main stem and fruit branches. Differentiate the flower primordium with the third true leaf basal step.

In a third aspect, the present invention provides a nucleotide sequence of a target sequence for knocking out the function of the Ghlsgz gene (hereinafter sometimes simply referred to as "target sequence of the present invention") and its complementary primers.

As shown below, the target sequence is a target sequence based on the CRISPR/Cas9 knockout GhLSGZ gene, and its sequence is SEQ ID No: 7, as shown below, the underline is the target PAM:

CCA ACAAGCAGGTATATAATGGC (SEQ ID No: 7)

The nucleotide sequences of the complementary primers of the above target sequence are SEQ ID No: 8 (forward primer) and SEQ ID No: 9 (reverse primer), as shown below:

Forward primer: 5’-GATTGCCATTATATACCTGCTTGT-3’ (SEQ ID No: 8)

Reverse primer: 3'-ACAAGCAGGTATATAATGGCCAAA-5' (SEQ ID No: 9).

In a fourth aspect, the present invention provides a site-directed knockout vector (hereinafter sometimes simply referred to as "site-directed knockout vector of the present invention"), which includes an sgRNA expression cassette and a gene editing element, the sgRNA expression cassette containing AtU6 Promoter sequence, target primer sequence shown in SEQ ID No. 8-9 and sgRNA terminator sequence.

In the present invention, the gene editing element may use a CRISPR/Cas9 gene editing element commonly used in the art for cotton gene editing. Preferably, the CRISPR/Cas9 gene editing element comprises a plant neomycin phosphotransferase gene (nptII) expression element and a Cas9 gene protein expression element. More preferably, the promoter sequence in the Cas9 gene protein expression element is a 35S promoter sequence.

In a fifth aspect, the present invention provides a recombinant cell containing the site-directed knockout vector of the present invention (hereinafter sometimes simply referred to as "recombinant cell of the present invention"), which is transformed by using the site-directed knockout vector of the present invention To the host cell. In the present invention, the host cell may use a host cell commonly used in the art, including but not limited to Agrobacterium.

In the sixth aspect, the present invention provides the use of the recombinant cell of the present invention in regulating the plant type and maturity of cotton.

In a seventh aspect, the present invention provides a method for targeted knock-out of the zero-type fruit branch gene GhLSGZ gene, the method comprising introducing the targeted knock-out vector of the present invention into a cotton receptor material containing the GhLSGZ gene, so that the cotton is subjected to The GhLSGZ gene in the body material was knocked out to obtain plants with the function of knocking out the GhLSGZ gene.

In an eighth aspect, the present invention provides a method for regulating the plant type and maturity of cotton, the method comprising introducing the site-specific knockout vector of the present invention into a cotton receptor material containing a GhLSGZ gene, so that the cotton receptor The GhLSGZ gene in the material was knocked out, that is, the main stem and fruit branches were obtained with limited growth cotton material.

In a ninth aspect, the present invention provides a method for regulating the plant type and maturity of cotton. The method includes the following steps:

1) Using the method of the eighth aspect above to obtain cotton material with limited growth of the main stem and fruit branches; and

2) Cross the plants with limited growth of the main stem and fruit branches obtained in step 1) with normal growth cotton breeding materials, and isolate the obtained hybrid offspring with early maturity, limited fruit branches, and plant type performance different from the T0 generation The other traits are consistent with normal materials, and they do not carry foreign genetically modified cotton materials.

In a tenth aspect, the present invention provides a method for creating a new cotton material with limited growth of main stems and fruit branches. The method includes the following steps:

S1. According to the sequence of the GhLSGZ gene, a gene site editing system is used to select a target in the GhLSGZ gene to construct a target gene editing transformation vector, wherein the target specifically targets the At and Dt subgenomics of the GhLSGZ gene Double copy; and

S2. Use the target gene editing transformation vector obtained in step S1 to perform site-directed editing on the recipient cotton material to obtain plants with double copies of Dt and At knocked out of the GhLSGZ gene, that is, obtain a new cotton material with limited growth of the main stem and fruit branches .

In a preferred embodiment, the gene site editing system is the TALEN system or the CRISPR/Cas9 system.

In a preferred embodiment, the gene site editing system is a CRISPR/Cas9 system, and the sequence of the target site is shown in SEQ ID NO:7.

In a preferred embodiment, the gene editing transformation vector of interest is the site-directed knockout vector of the present invention.

In a preferred embodiment, the recipient cotton material is a cotton material containing the GhLSGZ gene.

The beneficial effects of the present invention

Compared with the prior art, the present invention has the following beneficial effects:

1. According to the plant type regulation candidate gene GhLSGZ, the present invention uses a gene site editing technique to knock out the GhLSGZ gene to obtain a Ghlsgz mutant. It is found that the growth of the main stem and fruit branches of the mutant shows a limited growth habit, and GhLSGZ is confirmed for the first time. The key factors of cotton plant type regulation can be used as parents for cross breeding.

2. For the first time, the present invention provides a method for quickly creating new cotton materials with both growth of the main stem and fruit branches showing limited growth using gene fixed-point editing technology. The new cotton material can be used to improve the cotton plant type and obtain a new excellent cotton strain with improved plant type.

3. The Ghlsgz mutant obtained by the present invention can be separated by progeny to clear the transgenic elements. Therefore, the present invention provides new molecular breeding techniques for cotton plant type breeding, increasing cotton yield, adapting to the new cotton mechanized planting mode.

4. For the first time, the present invention provides a method for quickly creating limited growth habit cotton by using gene fixed-point editing technology. The limited growth habit cotton can be used for genetic improvement of cotton plant type. Moreover, the Ghlsgz mutant obtained by the present invention can be isolated by progeny to exclude transgenic elements. Therefore, the present invention provides a new molecular breeding technique for improving the plant type of cotton and improving the adaptability of mechanized cotton planting.

5. The present invention provides for the first time a new method for simultaneous knockout of double copies of the subgroup of the GhLSGZ gene, and obtains a plant type variation type that does not exist in nature. Naturally, there is no material that can be screened to obtain natural Ath and Dt copies of the GhLSGZ gene with simultaneous loss of function mutations. The phenotypic variation is limited, which limits the breeding applications of the GhLSGZ gene. Different types of mutation combinations can be generated in the separated population of offspring of the obtained mutant material, and the phenotypic variation is abundant.

6. The present invention provides a more efficient editing event than other existing editing events of the GhLSGZ gene, which is represented by the selection position (closer to the gene 5', the knockout is more thorough), the vector construction is simpler (single target) and Sequence characteristics (GC content 40%; high sequence specificity, not easy to off target, etc.) show more efficient target sites; in addition, the target design also excludes the possibility of off-target editing of GhLSGZ homologous genes. In addition, the promoter of the cas9 expression element is the 35S promoter instead of the rice Ubi promoter used in the original editing event, which is more efficient.

BRIEF DESCRIPTION

Figure 1 illustrates the gene structure of the GhLSGZ gene and the construction of a targeted knockout vector. Fig. 1A shows the gene structure of GhLSGZ. The small black box indicates the exon, the arrow indicates the editing site of the CRISPR/Cas9 system, and the sequence within the dotted frame indicates the target sequence and the PAM sequence (underlined bases). Figure 1B is a sequence comparison of GhLSGZ and its two homologous genes. The underline is the PAM sequence, and the italic base is the target sequence. The target specifically targets the GhLSGZ gene, and the off-target rate is greatly reduced. FIG. 1C is a CRISPR/Cas9 system used in the present invention. The U6 plasmid carries an sgRNA expression cassette, which is driven by Arabidopsis AtU6.

Figure 2 is the identification of the mutant Ghlsgz obtained by knocking out the upland cotton line YZ-1 containing the GhLSGZ gene; Figure 2A is the identification of the kanamycin resistance gene NPT of the transgenic T0 plant of Ghlsgz, * indicates which is used Transgenic identification bands of 2 independent Ghlsgz mutants were analyzed by sequencing analysis of target mutations. M represents Marker, B represents blank control, N represents negative control, P represents positive control. Figure 2B is the result of Ghlsgz's target location sequencing. Italic bases are target positions and underlined PAM sequences. WT is wild type. "-" indicates base deletion. Dt represents the editing result of the GhLSGZ gene, and At represents the homologous gene of the At subgroup of the GhLSGZ gene. Figure 2C is the phenotype of two Ghlsgz mutants. The arrow points to the flower at the tip of the main stem. The Ghlsgz mutant flowers early.

Figure 3 is the identification and phenotype of the transgenic T1 generation of Ghlsgz functional knockout mutants without transgenic individuals. Figure 3A is the identification of PCR-amplified kanamycin gene NPT screening of non-transgenic individuals (indicated by *). M represents Marker, B represents blank control, N represents negative control, P represents positive control. Figure 3B is the identification of the corresponding phenotype of a single plant. The arrow points to the flower at the tip of the main stem.

Fig. 4 shows that the hybrid mutant Ghlsgz-1 and the upland cotton standard line TM-1 showed the intermediate type limited growth single plant. The arrow points to the flower at the tip of the main stem.

The best way to implement the invention

The content of the present invention will be further described below with reference to the accompanying drawings and specific embodiments, but it should not be construed as limiting the present invention. Without departing from the spirit and essence of the present invention, modifications or replacements to the methods, steps, and conditions of the present invention all belong to the scope of the present invention. Unless otherwise specified, the experimental methods used in the examples are conventional methods and techniques well known to those skilled in the art, and the reagents or materials used are all obtained through commercial sources.

Example 1 Construction of GhLSGZ functional knockout vector

The gene-specific target sequence (SEQ ID NO: 7) was designed for the coding sequence of the fruit branch limited growth control gene GhLSGZ (copy of Dt and At, SEQ ID NO: 1-2) (Figure 1A). Synthesize the corresponding primers (forward primer and reverse primer SEQ ID NO: 8-9), through 95 ° C, 2min, slowly cooled to room temperature to form an oligonucleotide double-strand with attg and aaac sticky ends, and the The B6I endonuclease digested U6 vector was ligated to connect the target primer sequence to the sgRNA expression cassette driven by the AtU6 promoter, which was verified by sequencing. The constructed sgRNA expression cassette fragment was transferred to the linearized CRISPR/Cas9 gene editing binary vector 35S: Cas9 vector (purchased from Biomax Biotechnology Co., Ltd.) by XBa I and Bbs1 double digestion clone (Figure 1C), T4 ligase ligates to produce KO-GhLSGZ.

Example 2 Identification of GhLSGZ gene knockout line Ghlsgz

The binary transformation vector KO-GhLSGZ of Example 1 was transduced into Agrobacterium strain LBA4404 by electrotransduction, and T0 transformants were obtained by Agrobacterium-mediated transformation of upland cotton YZ-1. The specific process is: after cutting the hypocotyl of the 6-day-old recipient sterile seedling into 5-6mm fragments, the Agrobacterium tumefaciens LBA4404 with the target gene is impregnated into the sterile germ hypocotyl of cotton, and inoculated on the callus induction culture On the basis. Subculture every 30 days. After growing on callus induction medium for three months, inoculate the tissue in embryogenic callus induction medium. After differentiation to produce embryogenic callus, the embryogenic The wound tissue was inoculated on the embryogenic callus proliferation medium, subcultured once every 15 days, and then the embryogenic callus was inoculated into the embryoid body induction medium, and the normal mature embryos (about 1 cm) were inoculated Seedlings are made on rooting medium. All cultures were carried out at 28°C with alternating light and dark for 14h/10h. The primers NPT_F/NPT_R (Table 1) were used for PCR identification to obtain transgenic positive knockout mutants (Figure 2A). Further, a fragment containing two target sites of two independently transformed plants was amplified by PCR, and the mutation effect of the GhLSGZ gene was sequenced and analyzed to obtain mutants Ghlsgz-1 and Ghlsgz-2 (Figure 2B). They generate frame shifts and premature termination codes due to base deletion, that is, the truncated gene Ghlsgz with loss of function, as shown in SEQ ID NO: 3-4 and SEQ ID NO: 5-6.

Table 1 NPT detection primer sequences of kanamycin resistance gene

Example 3 Identification and Performance Observation of Transgenic Individuals in T1 Plants with GhLSGZ Functional Knockout Mutants

Transgenic T1 plants of the above-mentioned GhLSGZ functional knockout mutants were subjected to PCR detection of transgenes (NPT genes), and individuals without transgenes were isolated (FIG. 3A ). Then the growth of these individuals was observed, and it was found that the main stems and fruit branches of these mutants became limited growth (Figure 3B).

Example 4 Performance of Ghlsgz mutant improved cotton plant type

F1 was obtained by crossing the transgenic Ghlsgz mutant with the normal indefinite upland cotton standard line TM-1, which showed normal indefinite growth. Observation of F2 strains produced by F1 inbreds revealed that the separation ratio between individuals with infinite growth and those with limited growth met the expected ratio of separation between two pairs of sites. Due to the dose effect of the GhLSGZ gene, some intermediate-type phenotypes were also observed (Figure 4). Choosing TM-1 as the reincarnation parent can transform TM-1 into a material with limited growth habits.

The present invention includes the following embodiments:

1. The targeted knockout mutant gene Ghlsgz-1 of the GhLSGZ gene, wherein the nucleotide sequences of the Dt copy and At copy of the targeted knockout mutant gene Ghlsgz-1 are shown in SEQ ID Nos. 3 and 4, respectively.

2. The targeted knockout mutant gene Ghlsgz-2 of the GhLSGZ gene, wherein the nucleotide sequences of the Dt copy and At copy of the targeted knockout mutant gene Ghlsgz-2 are shown in SEQ ID No. 5 and 6, respectively.

3. Use of the site-directed knockout mutant gene Ghlsgz-1 according to embodiment 1 and the site-directed knockout mutant gene Ghlsgz-2 according to embodiment 2 in regulating cotton plant type and maturity.

4. The application according to embodiment 3, wherein the regulation of the cotton plant type is to regulate the growth habit of the main stem and fruit branches, and it is preferable to regulate the limited growth of both the main stem and fruit branches.

5. The nucleotide sequence of the target for knocking out the function of the Ghlsgz gene and its complementary primer, wherein the nucleotide sequence of the target is shown in SEQ ID No. 7, and the nucleotide sequence of the complementary primer As shown in SEQ ID No. 8-9.

6. A targeted knockout vector, characterized in that the targeted knockout vector includes an sgRNA expression cassette and a CRISPR/Cas9 gene editing element, and the sgRNA expression cassette includes the AtU6 promoter sequence, as shown in SEQ ID No. 8-9 The target sequence and sgRNA terminator sequence shown; preferably, the CRISPR/Cas9 gene editing element comprises a plant neomycin phosphotransferase gene expression element and a Cas9 gene protein expression element, more preferably, the Cas9 gene protein expression element The promoter sequence is the 35S promoter sequence.

7. A recombinant cell containing the site-directed knockout vector according to embodiment 6.

8. Use of the recombinant cell according to embodiment 7 in regulating cotton plant type and maturity.

9. The use according to embodiment 8, wherein the regulation of cotton plant type and maturity is to regulate the growth habit of the main stem and fruit branches, preferably the main stem and fruit branches are both limited in growth.

10. A method for targeted knock-out of the zero-type fruit branch gene GhLSGZ gene, wherein the method includes introducing the targeted knock-out vector according to embodiment 6 into a cotton receptor material containing a GhLSGZ gene to make the cotton receptor material The GhLSGZ gene in was knocked out to obtain plants with the function of knocking out the GhLSGZ gene.

11. A method for regulating cotton plant type and maturity period, wherein the method comprises introducing the site-directed knockout vector according to embodiment 6 into a cotton receptor material containing a GhLSGZ gene, so that the cotton receptor material The GhLSGZ gene was knocked out, that is, cotton material with limited growth of main stem and fruit branch was obtained.

12. A method for regulating cotton plant type and maturity, wherein the method includes the following steps:

1) Using the method according to embodiment 11 to obtain cotton material with limited growth of both main stems and fruit branches; and

13. A method for creating a new cotton material in which both the main stem and fruit branches exhibit limited growth, the method comprising the following steps:

14. The method according to embodiment 13, wherein the gene site editing system is the TALEN system or the CRISPR/Cas9 system.

15. The method according to embodiment 14, wherein the gene site editing system is a CRISPR/Cas9 system, and the sequence of the target is shown in SEQ ID NO: 7.

16. The method according to embodiment 13, wherein the recipient cotton material is a cotton material containing the GhLSGZ gene.

Although specific embodiments of the present invention have been illustrated and described, it will be obvious to those skilled in the art that various other changes and modifications can be made without departing from the spirit and scope of the invention. Therefore, all such changes and modifications falling within the scope of the present invention are included in the appended claims.

Industrial applications

The present invention aims at the plant type regulation candidate gene GhLSGZ, knocks out the GhLSGZ gene using gene site editing technology to obtain a Ghlsgz mutant, and finds that the growth of the main stem and fruit branches of the mutant shows a limited growth habit, and GhLSGZ is the first to prove that cotton plant type regulation The key factor can be used as a parent for cross breeding. The Ghlsgz mutant obtained by the present invention can be separated by offspring, and the transgenic elements can be removed, which can be used for cotton plant type breeding, improve cotton yield, adapt to the new cotton mechanized planting mode, and provide new molecular breeding technical means. In addition, the present invention provides for the first time a new method for simultaneous knockout of double copies of the subgroup of GhLSGZ genes, and obtains a plant type variation type that does not exist in nature. Different types of mutation combinations can be generated in the separated population of offspring of the mutant material obtained by the present invention, and the phenotypic variation is abundant.

Claims

The nucleotide sequence of the Dt copy and At copy of the targeted knockout mutant gene Ghlsgz-1 of the GhLSGZ gene is shown in SEQ ID No. 3 and 4, respectively.
The nucleotide sequence of the Dt copy and At copy of the targeted knockout mutant gene Ghlsgz-2 of the GhLSGZ gene is shown in SEQ ID No. 5 and 6, respectively.
Use of the site-directed knockout mutant gene Ghlsgz-1 according to claim 1 and the site-directed knockout mutant gene Ghlsgz-2 according to claim 2 in regulating cotton plant type and maturity.
The use according to claim 3, wherein the regulation of the cotton plant type is to regulate the growth habit of the main stem and fruit branches.
The use according to claim 4, wherein the regulation is limited growth for both main stems and fruit branches.
The nucleotide sequence of the target for knocking out the function of the Ghlsgz gene and its complementary primer, wherein the nucleotide sequence of the target is shown in SEQ ID No. 7, and the nucleotide sequence of the complementary primer is as SEQ ID No. 8-9 shows.
A targeted knockout vector, characterized in that the targeted knockout vector includes an sgRNA expression cassette and a CRISPR/Cas9 gene editing element. The sgRNA expression cassette includes an AtU6 promoter sequence, as shown in SEQ ID No. 8-9 Target sequence and sgRNA terminator sequence.
The targeted knockout vector according to claim 7, wherein the CRISPR/Cas9 gene editing element comprises a plant neomycin phosphotransferase gene expression element and a Cas9 gene protein expression element.
The site-directed knockout vector according to claim 8, wherein the promoter sequence in the Cas9 gene protein expression element is a 35S promoter sequence.
A recombinant cell containing the site-directed knockout vector according to any one of claims 7-9.
The use of the recombinant cell according to claim 10 in regulating cotton plant type and maturity.
The use according to claim 11, wherein the regulation of cotton plant type and maturity is to regulate the growth habit of main stems and fruit branches.
The use according to claim 12, wherein the regulation is limited growth for both main stems and fruit branches.
A method for targeted knockout of the zero-type fruit branch gene GhLSGZ gene, wherein the method includes introducing the targeted knockout vector according to any one of claims 7-9 into a cotton receptor material containing a GhLSGZ gene, so that The GhLSGZ gene in the cotton receptor material was knocked out to obtain plants with the function of knocking out the GhLSGZ gene.
A method for regulating the plant type and maturity of cotton, wherein the method comprises introducing the site-specific knockout vector according to any one of claims 7-9 into a cotton receptor material containing a GhLSGZ gene, so that the cotton is subjected to The GhLSGZ gene in the body material was knocked out, that is, the cotton material with limited growth of the main stem and fruit branches was obtained.
A method for regulating cotton plant type and maturity, wherein the method includes the following steps:

1) Using the method according to claim 15 to obtain cotton material with limited growth of both main stems and fruit branches; and

2) Cross the plants with limited growth of the main stem and fruit branches obtained in step 1) with normal growth cotton breeding materials, and isolate the obtained hybrid offspring with early maturity, limited fruit branches, and plant type performance different from the T0 generation The other traits are consistent with normal materials, and they do not carry foreign genetically modified cotton materials.
A method for creating a new cotton material with both main stems and fruit branches showing limited growth, the method includes the following steps:

S1. According to the sequence of the GhLSGZ gene, a gene site editing system is used to select a target in the GhLSGZ gene to construct a target gene editing transformation vector, wherein the target specifically targets the At and Dt subgenomics of the GhLSGZ gene Double copy; and

S2. Use the target gene editing transformation vector obtained in step S1 to perform site-directed editing on the recipient cotton material to obtain plants with double copies of Dt and At knocked out of the GhLSGZ gene, that is, obtain a new cotton material with limited growth of the main stem and fruit branches .
The method according to claim 17, wherein the gene site editing system is the TALEN system or the CRISPR/Cas9 system.
The method according to claim 18, wherein the gene site editing system is a CRISPR/Cas9 system, and the sequence of the target is shown in SEQ ID NO:7.
The method according to claim 17, wherein the recipient cotton material is a cotton material containing the GhLSGZ gene.