CN113862278A

CN113862278A - Upland cotton GhMS20 gene and application thereof in creating cotton mono-dominant male sterile line

Info

Publication number: CN113862278A
Application number: CN202110975674.3A
Authority: CN
Inventors: 孙杰; 刘峰; 张新宇; 薛飞; 李艳军
Original assignee: Shihezi University
Current assignee: Shihezi University
Priority date: 2021-08-24
Filing date: 2021-08-24
Publication date: 2021-12-31
Anticipated expiration: 2041-08-24
Also published as: CN113862278B

Abstract

The invention discloses a cotton on landGhMS20The application of gene and its editing vector in creating cotton single dominant male sterile line belongs to the field of agricultural biotechnology. The invention discloses a method for cultivating a cotton sterile line, which aims at an MS20 gene of cotton as a target to create a single dominant male sterile line, and comprises the step of reducing the expression or activity of MS20 related to pollen development in cotton plants. The present invention can produce new cotton male sterile line for producing hybrid seed, developing two-line hybrid cotton, recurrent selection and creating gene library in agricultureHas very important application in production.

Description

Upland cottonGhMS20Gene and application thereof in creating cotton mono-dominant male sterile line

Technical Field

The present invention belongs toIn the field of agricultural biotechnology, in particular to a method for expressing in cottonGhMS20Gene and its application in cotton single dominant male sterility. The invention describes a cotton seed extractGhMS20The nucleotide sequence of the gene is utilized to construct a gene editing vector, and cotton is genetically transformed to create a transgenic plant with a single dominant male sterile phenotype.

Background

The male sterility is an important genetic resource for crop hybrid seed production and germplasm innovation, and the positioning, cloning and function analysis of the male sterility gene have important theoretical significance and application value. There are many factors that cause the reduction of plant fertility, such as abnormal tapetum development and degradation, abnormal pollen development, abnormal anther development cracking, and environmental abnormality. Male sterility generally refers to a biological feature of an isogenic plant that maintains fully normal female function, but does not produce normal functional male gametes. The characters are mainly expressed in the fact that anthers have no pollen, male gametes or pollen grains have no activity, the anthers do not crack and the like, but pistils can accept external pollen to fertilize and fruit, so that the characters provide important experimental materials for basic researches on pollen grain development, cytoplasm, nuclear and nucleoplasm interaction inheritance and the like, and the characters also become important tools for developing crop recurrent selection, heterosis, population improvement and germplasm resource innovation. Therefore, the mechanism and application of male sterility in plants have been the focus and hot spot of research in the field of life science.

Cotton is an important fiber crop and has obvious hybrid vigor, and the cotton hybrid seed production approaches include artificial emasculation, chemical emasculation, utilization of the indicated characters, male sterile line and the like. At present, the production of hybrid seeds by cotton breeding is mainly realized by an artificial emasculation method, but the production of hybrid seeds by artificial emasculation has the defects of high cost, low efficiency, long breeding period and the like, so that the research, application and popularization of male sterility in breeding are of great significance. However, F is produced due to lack of suitable male sterile material₁Seed, heterosis has limited application in cotton production. At present, the utilization of male sterility heterosis of cotton is mainly focused on the holes A and Ams5ms6Two cotton recessive cell nucleus male sterile lines are crossed or backcrossedCultivating multiple cave A sterile derived lines, and successively cultivating high heterosis combination types including Chuanzao-I, Chuanzao-IV, Chuanzao-VI and Lu cotton-eight ([ 1 ]]Morphological and anatomical characteristics and physiological and biochemical characteristics research on development of recessive genic male sterile line floral organs of Tang Wen and upland cotton [ D]Yaan, library of Sichuan university of agriculture, 2008; development of male sterility in cotton [ J ] in Shiyali, Zhangrui, ren Yang Zhi, etc]Biotechnological advances, 2013, 05: 328-335). By double recessivems5ms6The hybrid seeds obtained from the sterile line mainly comprise Nannong No. 6, Nannong No. 9, Nannong No. 98-4, Mizhongmiao No. 38 and the like (Shiyali and the like, 2013).

The research of the cotton male sterile mutant mainly focuses on the aspects of genetic analysis, cytology, physiology and biochemistry and the like. For example, 1355A is a nuclear sterile mutant caused by a single recessive mutation, whose pollen wall of the anther at the single nuclear stage is thickened without spikes (Wu Y L, Min L, Wu Z, et al, Defective polar wall controls to a large stability in the large stability line 1355A of cotton. Sci Rep, 2015, 5: 9608.). With the development of genome sequence and functional tools for analyzing genes, Transcriptomic studies have also been used to study the mechanism of occurrence of sterile mutants, such as transcriptome analysis of anthers of hole A sterile mutants, and it was found that differential genes are mainly involved in hormone signaling, carbon and energy metabolism and pollen wall development (Wei M, Song M Z, Fan S L, Yu S X. transcriptional analysis of differential expressed genes along with gene expression in genetic master and wild type gene expression, Genomics, 2013, 14(1): 97 BMC.). Comparison analysis of anther transcriptome of upland cotton photosensitive nuclear sterile mutant CCRI9106 and wild type control under the long-day sunlight of Anyang revealed the potential male sterility mechanism of CCRI9106 (Zhang M, Liu J, Ma Q, et al. Deficiencines in the formation and regulation of anti-cancer and tryptone con-tribute to male sterility in cotton PGMS line. BMC Genomics, 2020, 21(1): 825). Although research on cytoplasmic and nuclear male sterility in cotton has been partially advanced, it is not widely used, and research on dominant nuclear sterility, particularly monogenic dominant nuclear male sterility, is relatively rare. New MS germplasm, and in particular stable GMS germplasm, is urgently needed to guide breeding efforts.

Disclosure of Invention

The invention aims to provide the cottonGhMS20Its coding sequence, and the carrier and host containing said nucleic acid sequence.

The present invention provides a gene related to anther development, namedGhMS20The encoded protein was named GhMS 20. The nucleotide sequence of the gene is given in SEQ ID NO. 1. The amino acid sequence coded by the gene is shown in SEQ ID NO. 2.

The invention also provides a recombinant expression vector containing the GhMS20 gene, and preferably, the vector is a plasmid.

The invention also provides a recombinant host cell, preferably an escherichia coli cell, an agrobacterium cell or a plant cell, containing the gene or the recombinant expression vector.

The invention also aims to provide application of the gene for coding cotton GhMS20 protein in creating a cotton male sterile line.

The invention further provides a method for cultivating a cotton sterile line based on GhMS20 gene related to cotton anther development, which is characterized by comprising the following steps: reducing the expression or activity of anther development-associated GhMS20 gene in the cotton plant. The nucleotide sequence of the GhMS20 gene is shown in SEQ ID No. 1. The method for reducing the anther development related GhMS20 gene activity in cotton plants comprises the following steps: reducing the expression level of the GhMS20 gene and/or reducing the activity of the encoded protein; the expression of the GhMS20 gene in the cotton plant during the development of anther is reduced, so that the following conditions are met: in the meiotic stage of cotton anther development, the ratio of E1/E0 is less than or equal to 30 percent; wherein E1 is the expression level of the GhMS20 gene related to anther development in the GhMS20 gene editing plant; e0 is the expression level of the GhMS gene which is normal for wild plants of the same type.

Preferably, the cotton sterile line cultivated is a single dominant gene male sterile line.

More preferably, by gene homologous recombination or gene recombinationThe expression or activity of the GhMS20 gene was reduced by the editing method. For example, knock out cotton in transgenic cotton plantsGhMS20The gene editing vector pCas9-GhMS20The vector is based on pRGEB32 plasmid vectorMS20Gene sequence is inserted into the gene sequence to construct; the design of gene target site is shown in figure 1; FIG. 2 is a schematic representation of the pRGEB32 plasmid vector.

The plant gene editing vector is pCas9-GhMS20A plasmid; the plasmid vector comprises a plant selection marker gene NPT-II; p is a radical ofCas9-GhMS20The plasmid vector is schematically shown in FIG. 3.

The application of the gene editing recombinant vector, the expression cassette, the transgenic cell line or the recombinant bacterium in improving the fertility of cotton is also within the protection scope of the invention. In the application, the change of the cotton property is specifically as follows: 1) leading to single dominant male sterility of cotton; 2) other agronomic traits of cotton are not affected.

The invention also provides application of the cotton sterile line obtained by the method in cotton breeding, which is characterized by comprising the following steps: restoring fertility to the sterile line of claim by means of crossing and backcrossing. The method comprises the following specific steps: maintaining the sterile line; transforming the plant from sterile to fertile; maintaining the plant fertile and breeding.

Sea island cotton introduced earlier by the present inventorsG. barbadense) 1 male sterile mutant strain is found in the germplasm resources, is finally cloned to GhMS20 gene through deep research, and is further verified to be capable of creating a cotton male sterile line through gene knockout and the like. Therefore, the invention can generate a new cotton male sterile line for producing hybrid seeds, developing novel two-line hybrid cotton, recurrent selection and creating a gene bank, and has very important application in agricultural production.

Drawings

FIG. 1 GhMS20 gene target site design. Where black boxes represent exons, grey boxes represent upstream and downstream non-coding regions, and lines represent introns.

FIG. 2 schematic representation of the pRGEB32 plasmid vector.

FIG. 3 Cas9-Gh MS20 plasmid vector schematic.

FIG. 4 Agrobacterium-mediated transformation of the hypocotyl. Wherein, A, selecting and culturing hypocotyls; B. differentiation culture of embryonic callus; C. rooting culture of embryoid; D. hardening seedlings; E. and (5) regenerating plants.

FIG. 5 PCR identification of transgenic plants. Wherein, M: DNA marker, 1-2: Gene editing plant 3: a positive control; 4: and (5) negative control.

FIG. 6 detection of expression level of gene editing plant GhMS 20. Wherein, the expression level of the MS20 gene of the gene editing plant is obviously reduced: WT: a control plant; p-MS 20: and (5) gene editing plants.

FIG. 7 phenotype analysis of GhMS20 gene edited plants. Wherein, A, B, C: anthers and stigma (wild type, GhMS20, GhMS 20); d, E, F: single anther and pollen grain (wild type, GhmS20, GhmS 20)

FIG. 8 GhMS20 Gene editing plant pollen grain phenotype analysis (I2-KI staining method for pollen grain activity). A, dyeing pollen grains I2-KI of wild fertile plants; the B and C genes compile plants GhFAR2A-1, GhFAR2A-2 pollen grain I2-KI for dyeing.

FIG. 9 restoration of fertility in plants with gene editing after pollen pollination of wild type plants. A, gene editing of plant flowers after pollen pollination of wild plants; B. hybridizing and belling; C. the cotton bolls are mature and boll-opening.

Detailed Description

Example 1GhMS20Cloning of the genes:

sea island cotton introduced earlier by the present inventorsG. barbadense) 1 male sterile mutant strain is found in the germplasm resources, normal boll formation can be realized by pollinating with the fertile plant pollen, and sterile plants and fertile plants are separated by about 1:1 in the progeny. For convenient research and utilization, the sea island cotton and upland cotton are respectively backcrossed with sterile plant, and the sterile gene is transferred into the sea island cotton and upland cotton varieties on production. Then, the sea island cotton Xinhai No. 53 and the upland cotton SD98-6 are hybridized and backcrossed with corresponding upland cotton and island cotton sterile plants to respectively breed two sterile lines of Xinhai No. 53A and SD 98-6A. Respectively taking Xinhai No. 53 and SD98-6 as flowersThe powder donor is backcrossed for 5 times, and the male sterility character is transferred into the New sea No. 53 and SD98-6 background. At each generation BC₁F₁In the method, the sterile segregation ratio and the fertile segregation ratio of the progeny are both observed to be about 1:1, and the selfing progeny of all the fertile seeds are fertile. These results indicate that the male sterility trait is controlled by a single dominant nuclear gene, which can only be maintained in heterozygosity.

To further confirm this hypothesis, the inventors will be sterile (SD 98-6A or New sea 53A) and fertile (BC)₅F₁) The segregating population is crossed with recurrent parent (SD 98-6 or Xinhai No. 53) and simultaneously is crossed with another upland cotton variety Xinluzao No. 33, several segregating populations are generated, and according to the existence of identification fertility of pollen at the flowering stage, SD98-6A and SD98-6 are backcrossed to obtain BC₆F₁The population sterile strain 1015 strain and the fertile strain 1004 strain meet the segregation ratio of 1:1 (chi 2 = 0.06)< χ2 0.05 = 3.84，P = 0.86 >0.05). Similarly, from New sea 53A × New sea No. 53 BC₆F₁Population, SD98-6A X two F New Luzao # 33 and New sea 53A X two F New Luzao # 33₁The segregation ratio of fertile plants to sterile plants in the population is close to 1: 1. In addition, fertile progeny (BC)₅F₁) Hybridization F of SD98-6 with parent SD98-6₁The generations are all completely fertile, which indicates that the fertile progeny isolate is homozygous in fertility character and is consistent with the parent type. The results show that the introduced SD98-6A or Xinhai 53A male sterile line is controlled by single nuclear gene dominant mutation, and the male sterile line is named asMS20(ii) a The function of the gene is closely related to the metabolism of anther synthesized fatty acid derivatives.

Performing extreme character mixed pool re-sequencing (BSA-seq) on fertile plants and sterile plants to locateMS20A gene. The male sterility is an important genetic resource for crop hybrid seed production and germplasm innovation, and the positioning, cloning and function analysis of the single dominant male sterility gene have important theoretical significance and application value. The gene editing and the like are carried out on the target gene, which is beneficial to creating a male sterile material for recurrent selective breeding of cotton and accelerating the breeding process of the cotton. The following describes a specific cloning process of the GhMS20 gene.

(1) And extracting the RNA of the anther of the cotton in the meiotic stage by using a plant RNA extraction kit instruction. RNA concentration and purity were determined using an ND1000 nucleic acid protein analyzer, and RNA integrity was determined by agarose gel electrophoresis.

(2) Synthesizing a first strand of cDNA;

(3) design of upstream primer (5' -CGC)GGATCC ATGGGGGCCTTGTTCCTC-3 '), a downstream primer (5' -C)GAGCTCCTAGCTAATAGGTGAAGAG CACA-3'), and adding the upstream and downstream primers respectivelyBamHI andSac i cleavage site (underlined).

(4) And (3) performing RT-PCR amplification by using the first strand of the cDNA synthesized in the step (2) as a template and the primer in the step (3). The RT-PCR reaction program is as follows: denaturation at 94 deg.C for 5 min; 35 cycles (94 ℃ for 1min, 56 ℃ for 1min, 72 ℃ for 1 min); 10min at 72 ℃. Reaction (25 μ L): 10 is richExPCR Buffer 2.5. mu.L, 2.5mM dNTP mix 2.0. mu.L, 10. mu.M forward primer F11. mu.L, 10. mu.M reverse primer R11. mu.L, cDNA template, 2. mu.L, 5U/. mu.LEx Taq 0.5 μL，ddH₂O 16 μL。

(5) The PCR product was separated by electrophoresis on a 1.0% agarose gel, and the desired fragment was recovered and purified by using a gel recovery kit.

(6) Connecting the target fragment recovered and purified in the step (5) with a pMD20-T plasmid, wherein the reaction system is as follows: 2 XBuffer 5.0. mu.l, pMD18-T Easy Vector 0.5. mu.l, PCR product 3.5. mu.l, T₄1.0 μ l of DNA ligase, mixing the above components, and ligating at 16 ℃ overnight to obtain pMD20-MS20A plasmid. The ligation product was transformed into E.coli Top10 competent cells by the following steps: thawing a tube of competent cells stored at-70 deg.C on ice box, adding 10 μ l of ligation product, shaking gently, mixing, and ice-cooling for 30 min; quickly placing in ice bath for 2min after heat shock is carried out for 90s at 42 ℃, adding 400 mu l of liquid LB, and carrying out shake culture at 37 ℃ and 150rpm for 45 min; mu.l of the culture medium was spread evenly on a plate coated with ampicillin (100mg/L), and incubated at 37 ℃ for 12 hours. Selecting the single clone growing on the plate, culturing in LB liquid culture medium containing ampicillin (100mg/L) at 37 deg.C and 220rpm for 16h, performing PCR identification with primer F1/R1 to obtain positive clone, sequencing with full-automatic sequencer to obtainGhMS20The nucleotide sequence of (a).

Example 2GhMS20Construction of Gene editing vector

According to the cotton of landGhMS20The DNA sequence of the gene was designed as the target site, both target sites were located in the first exon, and the size of the editing interval was 278 bp (FIG. 1). Using pRGEB32 vector as template and primers respectivelyGhMS201-as, pRGEB32-7S andGhMS202-s，GhMS202-as is amplified to obtain 2 small fragments. The two fragments were fused using overlap extension PCR and the PCR product was recovered. By usingBsaI, carrying out enzyme digestion on vector plasmids, and using T to recycle the recovered linearized vector and fused target fragments₄DNA ligase ligation to obtain recombinant plasmid pCas9-GhMS20。

Recombinant plasmid pCas9-GhMS20Transforming into escherichia coli competent cells, picking monoclonal shake bacteria to extract plasmids, sending the monoclone with correct plasmid PCR verification and enzyme digestion verification to Huada gene for sequencing. Extracting plasmids from the single-clone shake bacteria with correct sequencing, and performing electric shock transformation on the plasmids into agrobacterium tumefaciens LBA 4404.

EXAMPLE 3 Agrobacterium mediated genetic transformation of Cotton

Containing recombinant plasmid pCas9-GhMS20The infected hypocotyl is transformed into upland cotton Y-1, the infected hypocotyl is placed in a co-culture medium at 20 ℃ for 2 days, transferred into a selective medium, subcultured once for 30 days until embryogenic callus grows out, and transferred into a differentiation medium. Subculturing once every fifteen days, transferring into a rooting culture medium after embryoid appears until a regenerated seedling grows up, washing the root culture medium, hardening off in water for 5-7 days, and transferring into nutrient soil for culturing. The resistant plants obtained were planted in pots and cultured in a phytotron at a constant temperature of 22 ℃ for 16h/8h of light cycle (FIG. 4).

Extraction of pCas9-GhMS20Transforming the obtained cotton seedling leaf genome DNA with recombinant plasmid, and using pCas9-GhMS20The recombinant plasmid is used as a positive control, the DNA of the untransformed cotton strain is used as a negative control, and the DNA sequence is determined by a specific primer: cas 9F: GCTTG TGCGTTTCGATTTGA, performing PCR amplification verification on Cas9R: CCGCTCGTGCTTCTTATCCT, and verifying whether Cas9 exists in plants or not by taking untransformed cotton leaf DNA as negative control; further obtaining transgenic plants(FIG. 5).

Example 4 identification of Gene-edited plants and analysis of expression level

A plant RNA rapid extraction kit (Beijing Etdelle Biotechnology Co., Ltd.) is used for extracting total RNA of transgenic plant leaves, Easy Script One-Step GDNA Removal and cDNA Synthesis SuperMix kit is used for reversely transcribing the total RNA into cDNA, and the specific operation steps are shown in the kit specification. In the obtained edited plants using real-time fluorescent quantitative PCRGhMS20The amount of gene expression was measured according to 2^-ΔΔCtCalculating the relative expression quantity of the gene, and the result shows that the edited plant is compared with the wild plantGhMS20The expression level of the gene was significantly reduced (fig. 6).

Example 5 editing plant target site sequencing and mutation type analysis

Primers are designed at 100-200 bp upstream and downstream of the target site respectively, and the editing type is detected. Sequencing results show that two editing types exist in the edited plants. The first editing type resulted in the deletion of a 319 bp fragment, the deleted sequence comprising the sequence between the two target sites, and 34 bp upstream of the first target site and 7 bp downstream of the second target site. The second type of editing is located at the first target site, resulting in the deletion of a 24 bp fragment comprising the first 6 bp of the first target sequence and a non-coding region 1 bp upstream of the start codon.

Example 6 editing phenotypic analysis of plants

The edited plants showed male sterility compared to wild type plants: abundant pollen grains are attached to the anther surface of the wild type plant, the anther of the gene editing plant is abnormally atrophied, and pollen grains are not on the anther surface (figure 7). Subjecting pollen grains to I₂KI staining, pollen grains of wild type plants are round, large and full, and are uniformly colored, and after anther knocking-off of sterile plants, pollen grains are not found (FIG. 8). The edited plants crossed with wild type plants and hybrid species could be obtained, indicating that the pistil of the edited plants was functioning normally (FIG. 9).

<110> river university

<120> upland cotton GhMS20 gene and application thereof in creating cotton mono-dominant male sterile line

<160>5

<210>1

<211>2698

<212> Cotton

<220>

<223> cotton FAR2A Gene

<400>1

atgggggccttgttcctcaattgtttctctgtaccaccaactgctttcaataaaggtgggtcggggaggaagaagcgcagcaactgtagcagtttcgtacattgccaagggagtggtgggaaagcaatcaaaactgctggggtttattctgttgtgaaggaaaggtccaaaatggttaatggtggtgatcgtagtgcggcgcttatggatgctggaagcctaattgtgtcgccaaatcaagctgatattgcagttaaagatttggtgccttatggaggatcaactactagcttagtggagttgcaagatggtattggcattgtcaagttccttagagggaaggagtttttcattactggttctacaggatttcttgccaaaggtacgtacctgtttttcttccccgaccgggccgggccaaacatagacttagataagaaaaataacatgttttcaatgtttgttttcttatattaattatacgcagttcttattgagaagattttacgaactgtgcctgatgttgggaagatatttgtgttggtgaaggctaaaagcaaagaagcagcaatggaaagattgaaaactgaagtatgttatgtagagttctgtcttgcttgcgttatataacatgtttgaaccaatattctttttcctgctattgaatcaaactttagtctttggttttggttttggtttttttggttttgttttagataataaatgcagagcttttcaactgtctacaacaaacatatgggaatagttaccaaagtttcatgttgagcaaacttgtccctgtggtaggaaatgtttgtgaatctgatcttggattggatgatgaattagctaacttgatttcaaaagaagtcgacattattgtgaattctgcagctaatacaacttttgatgaaaggttaattacttttattattaaatttaaaataagattgtgtaacctttaagattataaaatttaattgaaaacaatttgcagatatgatgtggccatggatataaatacaaaaggagcatcccatctcatgggttttgccaagaagtgcaaaaaacttaaactctttttacaagtgtcaacaggcaagcaattaaacccaacatttctacacatatataatttgaaggatatgtagattttagctgataagcagaatattacatgtgcagcatacgtgaatggccaaagacaaggaagagttatggaaaagccatttgacataggagattgtattgcaagggaaaatttaattgctgaaaccacgccaagatctatacccgagttagatatcgaagaagagtttggattggctcgcgataccaaggaaggttgtcatgaacgtgaactggctcagaaaatgaaagaattgggtctacaaaggtgagtattctcattctcttctttccatagtggttttctttaagcttgtgaatgtgcacaatatatcatgaacatttggaatcatactcgtaacttagaaagtttaatattgcaaatcattacttgtctgctcctctgtgattggtactacttttctgtttcttttatgcattgacgtgatgatttaacacctgatcagggctagaaaatatggatggcaagacacctatgtgttcaccaaggctatgggagagatgatgatcaataatatgagaggagaaataccggtagtgataatacgaccaagtgtcatcgagagcacctgcaaagaaccatttcctggatggatggaaggaaataggtatctcttgctttaagttcatatatataatgcaatcgtttctagcaaaaaatttgagcgttgcggttttgtttctgtcttaggatgatggacccaatagtattatgctatgggaaagggcagctaacaggtttcttggttgatcccaatggagttcttgatgttgtaagctattgttgtctgatttattcataaattctgatacattgtttttgatgaactaacaatagcgaaatctcggagtacaggttccagcagatatggttgtgaatgcaaccttggcagccattgcaagacatggaatgaccccaaaatcagatattaacatctaccacatcgcatcatcagttgtgaatccactggttttccaggatttagccagaatgctccatgagcactacaattcaaggccttttctcgactcgaagggtaccccaatccacgttccgtcaatgaagctgttcagttccatggaggatttctcagctcacctctggagagatgctatgcaccaaactggattgccagcattggcatcttggagcggaaaactgtcgcagaagctcgaagcggtgtgcagaaagtctgtggagcaagcaaagtacttggctaacatatacgagccatacacattctatggaggaaggtaagtcaatttttacattaaatctcagtttcagccatggatttctcatttgcatataatcttcaaatcttggtcaactgacagagaaaaaaaaacattaaatcaaacaaatgttaggtttgacaacagcaacaccaagagactactggagaccatgtctgaagaagagaaggtaagctttggatttgatgtggaaaccatagattggaaagattatataaaaaatgtgcatattcctgggttaaggaggcatgtaatgaagggcagagggatgtgctcttcacctattagctag 2698

<210>2

<211>27

<212> Artificial sequence

<220>

<400>2

cgcggatccatgggggccttgttcctc 27

<210>3

<211>30

<212> Artificial sequence

<220>

<400>3

cgagctcctagctaataggtgaagagcaca 30

<210>4

<211>20

<212> Artificial sequence

<220>

<400>4

gcttgtgcgtttcgatttga 20

<210>5

<211>20

<212> Artificial sequence

<220>

<400>5

ccgctcgtgcttcttatcct 20

Claims

1. Related to anther developmentGhMS20The nucleotide sequence of the gene is shown in SEQ ID No. 1.

2. Comprising the compound of claim 1GhMS20A vector for the recombinant expression of a gene, preferably a plasmid.

3. A recombinant host cell, preferably an E.coli cell, an Agrobacterium cell or a plant cell, comprising the gene according to claim 1 or the recombinant expression vector according to claim 2.

4. The method of claim 1GhMS20The application of the gene in breeding cotton sterile line.

5. Development correlation based on cotton antherGhMS20The method for gene culture of the cotton sterile line is characterized by comprising the following steps: reducing anther development-related in said cotton plantGhMS20Expression or activity of the gene.

6. The method of claim 1, wherein the method comprisesGhMS20The nucleotide sequence of the gene is shown in SEQ ID No. 1.

7. The method of claim 1, wherein the method is performed by gene homologous recombination or gene editingGhMS20Reduction of expression or activity of the gene.

8. The method of claim 5, wherein said reducing anther development-associated in a cotton plantGhMS20Methods of gene activity include: make itGhMS20The expression level of the gene is reduced, and/or the activity of the protein coded by the gene is reduced; by "reducing" is meant flowering in said cotton plantDuring the development process of the medicineGhMS20The reduction in the expression level of the gene satisfies the following condition: in the meiotic stage of cotton anther development, the ratio of E1/E0 is less than or equal to 30 percent; wherein E1 isGhMS20Anther development related in gene-edited plantsGhMS20The level of expression of the gene; e0 is normal for wild type plants of the same typeGhMSThe level of expression of the gene.

9. The method of any one of claims 5 to 8, wherein the cotton sterile line cultivated is a single dominant gene male sterile line.

10. Use of a cotton sterile line obtained by the method of any one of claims 5 to 9 for cotton breeding comprising: restoring fertility of the sterile line of claim by means of crossing and backcrossing; preferably, the method comprises the following steps: maintaining the sterile line; transforming the plant from sterile to fertile; maintaining the plant fertile and breeding.