WO2020130548A1 - 인간 쥐피에이티씨에치4 단백질 유래 세포막 투과 도메인 - Google Patents

인간 쥐피에이티씨에치4 단백질 유래 세포막 투과 도메인 Download PDF

Info

Publication number
WO2020130548A1
WO2020130548A1 PCT/KR2019/017830 KR2019017830W WO2020130548A1 WO 2020130548 A1 WO2020130548 A1 WO 2020130548A1 KR 2019017830 W KR2019017830 W KR 2019017830W WO 2020130548 A1 WO2020130548 A1 WO 2020130548A1
Authority
WO
WIPO (PCT)
Prior art keywords
protein
cargo
cell membrane
peptide
cell
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/KR2019/017830
Other languages
English (en)
French (fr)
Inventor
김성준
김균도
황인수
구근본
김천생
김범태
안대균
김해수
권영찬
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Korea Research Institute of Chemical Technology KRICT
Original Assignee
Korea Research Institute of Chemical Technology KRICT
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from KR1020190165874A external-priority patent/KR20200076604A/ko
Application filed by Korea Research Institute of Chemical Technology KRICT filed Critical Korea Research Institute of Chemical Technology KRICT
Publication of WO2020130548A1 publication Critical patent/WO2020130548A1/ko
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Images

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/04Peptides having up to 20 amino acids in a fully defined sequence; Derivatives thereof
    • A61K38/08Peptides having 5 to 11 amino acids
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/12Viral antigens
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/385Haptens or antigens, bound to carriers
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals

Definitions

  • the present invention relates to a cell membrane permeation domain derived from human GPATCH4 protein and an intracellular delivery system comprising the same.
  • Biopharmaceuticals include therapeutic proteins, antibodies, vaccines for prevention or treatment, gene therapy, and cell therapy.
  • recombinant protein drugs are drugs that are produced in large quantities using gene recombination technology for therapeutic proteins that are difficult to produce through a living body. Growth hormone, erythropoietin, interferon, colony stimulating factor (CSF), and blood coagulation factor (Recombinant human insulin) for the treatment of diabetes in the early 1980s were first approved by the U.S. FDA.
  • the cell-penetrating peptide was first discovered to have the properties of the HIV virus' TAT protein and the polypeptides present in the TAT protein (GRKKRRQRRRPPG, RKKRRQRRR, YGRKKRRQRRR) to pass through the cell membrane.
  • Derived MPG GLFLGFLGAAGSTMGAWSQPKKKRKV
  • bovine prion protein-derived BPrPr MVKSKIGSWILVLFVAMWSDVGLCKKRP
  • human Hph-1 protein-derived Hph-1 YARVRRRGPRR
  • human NLBP protein-derived NP2 NLBP protein-derived NP2
  • TAT-JBD20 cell-penetrating peptides are developed for the treatment of cerebral vascular disease (Cerebral ischemia) and degenerative brain disease (Alzheimer's disease) using TAT-JBD20, the treatment of amyotrophic lateral sclerosis using TAT-BH4, MPG-8/siRNA and TAT -Preclinical experiments such as cancer treatments using DRBD/siRNA are in progress.
  • TAT- ⁇ PKC inhibitor a treatment for hearing loss and inflammation using TAT-JBD20
  • a treatment for brain tumor using p28 are in clinical trials.
  • the existing cell permeation peptides are mainly invented from non-human proteins such as viruses and Drosophila or have low permeation efficiency
  • cell permeation peptides having high permeation efficiency among human derived peptides human GPATCH4 (G-Patch Domain Containing 4)
  • the protein-derived cell-penetrating peptide was invented, and the peptides present in the human-derived protein were confirmed for similarity to existing cell-penetrating peptides, thereby completing the present invention.
  • 6.dNP2 is a blood-brain barrier-permeable peptide enabling ctCTLA-4 protein delivery to ameliorate experimental autoimmune encephalomyelitis. Nat Commun. 8244 (2015), pp. 1-13 was used.
  • An object of the present invention is to provide a novel cell membrane permeation domain that exhibits high cell permeation efficiency and can minimize side effects.
  • Another object of the present invention is to provide an intracellular delivery system including a cell membrane permeation domain to which a cargo of an intracellular transport target is bound to the end of a peptide.
  • Another object of the present invention is to provide a method for transporting a cargo into a cell, the method comprising contacting a cell membrane permeation domain to which a cell of the intracellular transport target is bound to the cell at the end of the peptide.
  • the present invention is to provide a cell membrane permeation domain comprising the polypeptide of any one of SEQ ID NOs: 1 to 7 derived from human GPATCH4 (G-Patch Domain Containing 4) protein.
  • cell penetrating peptide refers to a peptide having the ability to carry a cargo (Cargo) of a transport target into a cell in vitro or in-compensation, the term “cell membrane permeation domain ”.
  • the term'peptide' or'peptide' means a polymer in the form of a chain formed by combining 4 to 1000 amino acid residues by a peptide or peptide bond, and mixed with'polypeptide' or'polypeptide' It is possible.
  • the present invention unlike the cell permeation peptide derived from a virus or other species, in order to minimize the side effects generated when the cargo material is delivered through the cell permeation peptide into the human body, it is human-derived, and is very high in the cell compared to the existing cell permeation peptide.
  • the present invention provides a recombinant cargo cell membrane permeability improved, comprising a cell fused to the N- or C-terminal of the cell membrane permeation domain and the cell membrane permeation domain.
  • the cargo may be a recombinant cargo that is a protein, nucleic acid, lipid, or compound.
  • the cargo may be an adjuvant or antigen.
  • the cargo is a hormone, an immunoglobulin, an antibody, a structural protein, a signaling peptide, a storage peptide, a membrane peptide, a transmembrane peptide, an inner peptide, an outer peptide, a secretory peptide, a viral peptide, a native peptide , Glycated protein, fragmented protein, disulfide peptide, recombinant protein, chemically modified protein, and any one selected from the prion group.
  • the term'recombination cargo means a complex formed by recombination of cell membrane permeation domains and one or more cargoes by genetic fusion or chemical bonding.
  • the term'contact' means that the cargo is in contact with eukaryotic or prokaryotic cells, and the cargo is transferred into the eukaryotic or prokaryotic cells.
  • the cargo may be any one of a recombinant cargo selected from the group consisting of nucleic acids, coding nucleic acid sequences, mRNA, antisense RNA molecules, carbohydrates, lipids, and glycolipids.
  • the cargo may be a recombinant cargo that is a contrast agent, drug, or chemical.
  • the term'contrast material' refers to all materials used for the imaging of biological structures or fluids in medical imaging.
  • the contrast material may include, but is not limited to, radiopaque contrast material, paramagnetic contrast material, superparamagnetic contrast material, CT contrast material, or other contrast material.
  • it may include radiopaque metals and salts thereof (e.g., silver, platinum, platinum, etc.) and other radiopaque chemicals (e.g., calcium salts, barium salts such as barium sulfate, tantalum and tantalum oxide). have.
  • Paramagnetic contrast materials include gadolinium proliferatives, MR imaging, and other gadolinium, manganese, iron, dysprosium, copper europium, erbium, chromium, Nickel and cobalt complex hydroxybenzylethylene diamine diacetic acid (HBED).
  • the superparamagnetic contrast material may include magnetite, superparamagnetic iron oxide, ultrafine, superparamagnetic iron oxide, and monocrystalline iron oxide.
  • Other suitable contrast materials may include iodized and non-iodinated, ionic and nonionic CR compositions, and contrast materials such as spin-labels, or other diagnostic actives. When expressed in a cell, it may include a marker gene encoding an easily detectable protein.
  • Various labels such as radionuclides, fluorescent substances, enzyme cofactors, and enzyme inhibitors can be used.
  • the cargo according to the present invention is a protein or a peptide
  • the transport peptide and the transport peptide form a fusion protein form a fusion protein form You can combine objects.
  • a specific example of binding by a fusion protein is as follows: When preparing a primer for producing a fusion protein, a nucleotide encoding a transport peptide is attached to a nucleotide expressing a moving target, and then the obtained nucleotide is vectored as a restriction enzyme. (Example: PET vector), and BL-21 (DE3) is introduced into cells and expressed.
  • the carrier peptide is a dye or fluorescent substance, specifically fluorescein ithiosia Nate (FITC, fluorescein isothiocyanate), luciferase (Luc), green fluorescent protein (GFP), enhanced green fluorescent protein (EGFP), Tag GFP, Superfolder GFP, PA GFP , AcGFP, PS-GFP2, Yellow fluorescent protein (YFP), enhanced yellow fluorescent protein (EYFP), SYFP, TagYFP, PhiYFP, Azurite, mKalamal, Cyan fluorescent protein, CFP), enhanced Cyan fluorescent protein (ECFP), TagCFP, PS-CFP2, Red fluorescent protein (RFP), Tag RFP, Tag RFP657, mRFP1, PaTagRFP, Turbo RFP, RFP693, tdRFP , Blue fluorescent protein (B
  • CAT chloramphenicol acetyltransferase
  • the present invention provides a gene construct comprising a polynucleotide encoding the cell membrane permeation domain.
  • the present invention provides an expression vector for expressing a recombinant cargo protein having improved cell membrane permeability, including a gene construct.
  • the present invention also includes the step of administering to a subject a pharmaceutical composition comprising a conjugate with a bioactive peptide bound to the cell membrane permeation domain and a pharmaceutically acceptable carrier, cervical cancer, prostate cancer, ovarian cancer, and uterus. It is to provide a method of preventing or treating diseases such as endometrial cancer, uterine cancer, bladder cancer, esophageal cancer, head and neck cancer Wilms' tumor, soft tissue sarcoma, stomach cancer, pancreatic cancer, breast cancer, and bronchial cancer.
  • diseases such as endometrial cancer, uterine cancer, bladder cancer, esophageal cancer, head and neck cancer Wilms' tumor, soft tissue sarcoma, stomach cancer, pancreatic cancer, breast cancer, and bronchial cancer.
  • the pharmaceutical composition according to the present invention can be used in the form of an oral dosage form such as powder, granule, tablet, capsule, suspension, emulsion, syrup aerosol, external preparation, suppository, and sterile injectable solution, respectively, according to a conventional method. have.
  • Carriers, excipients and diluents that may be included in the composition include lactose, textrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl Cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil.
  • Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc. These solid preparations contain at least one excipient such as starch, calcium carbonate, sucrose or lactose, gelatin, etc. in the extract. Is prepared. Also, lubricants such as magnesium stearate and talc are used in addition to simple excipients. Liquid preparations for oral use include suspensions, intravenous solutions, emulsions, syrups, etc.
  • Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, and suppositories.
  • non-aqueous solvent suspension propyl glycol, polyethylene glycol, vegetable oil such as olive oil, and injectable ester such as ethyl oleate may be used.
  • injectable ester such as ethyl oleate
  • Witepsol Macrogol, Tween 61, cacao butter, laurin butter, and glycerogelatin may be used.
  • the preferred dosage of the composition of the present invention depends on the patient's condition and body weight, the degree of disease, the drug form, the route and duration of administration, but can be appropriately selected by those skilled in the art. However, for the desired effect, the composition of the present invention is administered at 0.0001 to 500 mg/kg per day, preferably 0.001 to 250 mg/kg per day. The administration may be administered once a day, or may be divided into several times. The above dosage does not limit the scope of the present invention in any way.
  • the cell permeation peptide of the present invention exhibits significantly improved permeation efficiency or cell permeability compared to conventional peptides, thereby allowing the carried cargo or biologically active molecule to be introduced into the cell, effectively maintaining activity, and significantly reducing cost. .
  • FIG. 1 shows a schematic diagram of a gene composite for making an expression gene composite of the GPATCH4P1-EGFP recombinant fusion protein.
  • Figure 2 shows the results obtained by observing a gene composite expressing a protein fused with a human permeable peptide GPATCH4P1 derived from human GPATCH4 protein and Enhanced Green Fluorescent Protein (EGFP) fluorescence protein through agarose gel electrophoresis.
  • EGFP Green Fluorescent Protein
  • Figure 3 shows that by inserting the GPATCH4P1-EGFP gene composite into the protein expression vector pET28a+ and processing the restriction enzyme to the combined gene composite to confirm the results.
  • FIG. 4 shows that the GPATCH4P1-EGFP-pET28a+ vector was transformed into BL21(DE3) recipient cells to induce protein production, followed by sonication and observed through polyacrylamide gel electrophoresis.
  • FIG. 5 shows the observation of polyacrylamide gel electrophoresis by purifying the GPATCH4P1-EGFP recombinant fusion protein produced using BL21(DE3) recipient cells.
  • Figure 6 shows the results of comparing the permeation efficiency in cells with a flow cytometer after treating the recombinant protein fused with EGFP and the GPATCH4P1-EGFP recombinant protein in a human T immune cell line (Jurkat).
  • FIG. 9 shows that the distribution pattern of the GPATCH4P1-EGFP recombinant protein observed into the cell was observed using a confocal microscope after treating the GPATCH4P1-EGFP recombinant protein on the cervical cancer cell line (HeLa).
  • Figure 10 shows the results of confirming the efficiency of introduction into cells by flow cytometry (FACS) after processing the intracellular delivery efficiency of the GPATCH4P1 mutant-EGFP fusion protein of the present invention to a human T immune cell line (Jurkat).
  • FACS flow cytometry
  • the present invention provides a cell membrane permeation domain or cell permeation peptide comprising a polypeptide of any one of SEQ ID NOs: 1 to 7 derived from human GPATCH4 (G-Patch Domain Containing 4) protein.
  • the gene sequence information expressing GPATCH4P1 in the base sequence of the human-derived GPATCH4 protein is aaaaaaaagaaaaagaaaaggaggcagaaa (SEQ ID NO: 8) and was converted to aaaaaaaagaagaagaaacggagacaaaaa (SEQ ID NO: 9) through codon optimization during gene synthesis.
  • the base sequence expressing the EGFP fluorescent protein linked after the base sequence expressing the GPATCH4P1 peptide is represented by SEQ ID NO: 10, and the base sequence of the linker portion between the GPATCH4P1 peptide and the EGFP protein is ggaggtgggggctcg (SEQ ID NO: 11).
  • the cell permeation peptides or cell membrane permeation domains represented by SEQ ID NOs: 2 to 7 of the present invention are mutated cell permeation peptides of the GPATCH4P1 cell permeation peptide, and GPATCH4P1 mutant which replaces glutamine, the ninth amino acid of GPATCH4P1, with another amino acid. And GPATCH4P1 mutant mutated cell membrane domain or cell permeation peptide with N-terminal and C-terminal amino acids removed one by one.
  • the cell membrane permeation domain or cell permeation peptide derived from the human GPATCH4P1 protein of the present invention is shown in Table 1 below.
  • GPATCH4P1 cell-penetrating peptide derived from human GPATCH4 protein and an EGFP fluorescent protein are fused
  • the present invention provides a gene construct comprising a polynucleotide encoding a cell membrane permeation domain (GPATCH4P1 cell permeation peptide, GPATCH4P1), and for expressing a recombinant cargo protein having improved cell membrane permeability comprising the gene construct
  • An expression vector is provided.
  • the vector is characterized in that it further comprises a gene encoding a cargo protein, so that a recombinant cargo protein in which the cargo of the cell membrane permeation domain and the protein is fused can be expressed.
  • the present invention comprises the steps of preparing a recombinant cargo fused to the N- terminal or C- terminal of the cell membrane permeation domain; And contacting the prepared recombinant cargo with cells.
  • the GPATCH4P1 base sequence was converted to a base sequence expressing the same peptide through codon optimization during artificial gene synthesis, and was synthesized by attaching a gene expressing the EGFP fluorescent protein to the base sequence of the GPATCH4P1 peptide to verify cell permeability (FIG. 2). .
  • linker sequencing was added between the cell-penetrating peptide and the EGFP protein to increase flexibility.
  • the artificial synthetic gene was introduced into the pET28a+ plasmid vector treated with NheI restriction enzyme and XhoI restriction enzyme through T4 ligase after treatment with NheI restriction enzyme and XhoI restriction enzyme.
  • the pET-28a plasmid vector used herein allows protein purification through Ni-NTA Resin by expressing 6 histidines (6 x His) at the N-terminus in front of the GPATCH4P1-EGFP fusion protein.
  • the pET28a+ plasmid vector into which the GPATCH4P1-EGFP fusion protein artificial gene has been introduced is transformed into Top10 recipient cells and cultured in LB agar plates containing kanamycin to incubate grown colonies in LB medium for about 16 hours.
  • a recombinant cargo in which cargo was fused to the cell membrane permeation domain (GPATCH4P1) was prepared.
  • the method of delivering cargo to cells of the present invention comprises the steps of: 1) preparing the recombinant cargo; And 2) contacting the recombinant cargo prepared in the step with cells. Preparation 2) The contact between the cargo and the cell can be performed in vitro or in vivo. When the contact is performed in vitro, the contact is made by culturing the cell by treating the medium containing the recombinant cargo to cells in vitro.
  • the recombinant cargo is intramuscular, intra-peritoneal, intravenous, oral, or subcutaneous (nasal).
  • Subsutaneous, subcutaneous (intradermal), mucosal (muscosal), or inhaled (inhale) through the path is injected into the body (injection), and in vivo, the cell is in contact with the recombinant cargo.
  • the plasmid vector prepared in Example 1 above was transformed into BL21(DE3) recipient cells and then cultured in LB medium containing Kanamycin for about 16 hours. Here, 100 times more LB medium was added, incubated until the OD value reached 0.4-0.6, and then IPTG (Isopropyl ⁇ -D-1-thiogalactopyranoside) was added to a final concentration of 1 mM, followed by 5 hours at 37°C. Or incubate at 20 °C for 16 hours.
  • IPTG Isopropyl ⁇ -D-1-thiogalactopyranoside
  • the GPATCH4P1-EGFP fusion protein increased the water-soluble and expression efficiency of the protein under the condition of incubating at 20° C. for 16 hours after adding IPTG. Therefore, in order to purify the high-purity GPATCH4P1-EGFP fusion protein, BL21(DE3) transformed cells transformed under the same conditions were cultured, and then the culture solution was centrifuged to obtain a cell pellet and lysis buffer (50 mM NaH2PO4, 300 mM NaCl, 10 mM Imidazole ).
  • the supernatant was recovered through centrifugation, filtered through a 45 ⁇ m filter, and the supernatant was passed through a Ni-NTA agarose column to bind the recombinant protein.
  • washing buffer 50 mM NaH2PO4, 300 mM NaCl, 20 mM Imidazole
  • the recombinant protein was eluted using elution buffer (50 mM NaH2PO4, 300 mM NaCl, 500 mM Imidazole). After replacing the solution containing the GPATCH41-EGFP fusion protein with PBS using the PD-10 desalting column, it was confirmed by polyacrylamide gel electrophoresis and Coomassie blue staining (FIG. 5).
  • the plasmid vector expressing the protein in which the EGFP fluorescent protein is fused with the cell permeation peptides TAT, Hph-1 and NP2, respectively expresses the GPATCH4P1-EGFP fusion protein It was prepared in the same manner as the plasmid vector. Expression and purification of the conventional CPP-EGFP fusion protein was also performed in the same manner as GPATCH4P1-EGFP fusion protein.
  • Jurkat cells were dispensed into 24 well plates at 1.5 X 10 6 /well, and then suspended in 2 ml of RPMI 1640 medium containing 10% Fetal Bovine Serum and 1% penicillin/streptomycin to finalize the CPP-EGFP fusion protein. After treatment with 5 ⁇ M, the cells were cultured in a 5% CO 2 incubator maintained at 37° C. for 2 hours. Thereafter, the medium containing the cells was transferred to a 5 ml tube, followed by centrifugation to remove the supernatant and washing with PBS solution was repeated 3 times.
  • the Jurkat cells were suspended in 650 ⁇ l of PBS, and then the fluorescence of CPP-EGFP introduced into the cells was measured through a flow cytometer to confirm the efficiency of introduction into the cells (FIG. 6 ). Through this, it was confirmed that the GPATCH4P1 showed higher efficiency than the existing cell permeation peptides.
  • EGFP, TAT-EGFP, and GPATCH4P1-EGFP fusion proteins were treated with Jurkat cells at a final concentration of 5 ⁇ M, respectively, and cultured for 0.5, 1, 2, 4, and 6 hours, respectively. It was confirmed (Fig. 8). Through this, it was confirmed that the GPATCH4P1-EGFP fusion protein was introduced into cells in a time-dependent manner, and it was confirmed that it showed a higher delivery efficiency at all times compared to the TAT-EGFP fusion protein.
  • HeLa cells are dispensed into a 24 well cell culture slide with 2 X 10 4 /well, and then contain 10% Fetal Bovine Serum and 1% penicillin/streptomycin
  • the cells were suspended in 500 ⁇ l of DMEM medium and cultured for 18 hours in a 5% CO 2 incubator maintained at 37°C.
  • EGFP and GPATCH4P1-EGFP fusion proteins were treated with cells at a final concentration of 10 ⁇ M, and then cultured for 1 hour. After this, the culture solution was removed, washed three times with PBS solution, and then treated with 4% PFA solution at room temperature for 30 minutes to fix it.
  • the GPATCH4P1 mutant which replaced glutamine, the ninth amino acid of GPATCH4P1 with another amino acid, and the GPATCH4P1 mutant, each of which was removed by one of the N-terminal and C-terminal amino acids, were designed. Thereafter, a plasmid vector expressing the GPATCH4P1 mutant-EGFP fusion protein was produced and then purified by expressing the protein.
  • Jurkat cells were dispensed into 24 well plates at 1.5 X 10 6 /well, and then suspended in 2 ml of RPMI 1640 medium containing 10% Fetal Bovine Serum and 1% penicillin/streptomycin to finalize the concentration of the CPP-EGFP fusion protein. After treatment with 5 ⁇ M, the cells were cultured in a 5% CO 2 incubator maintained at 37° C. for 2 hours. Thereafter, the medium containing the cells was transferred to a 5 ml tube, followed by centrifugation to remove the supernatant and washing three times with PBS solution.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Public Health (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Immunology (AREA)
  • Epidemiology (AREA)
  • Mycology (AREA)
  • Microbiology (AREA)
  • Virology (AREA)
  • Communicable Diseases (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Oncology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Organic Chemistry (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

본 발명은 인간 GPATCH4 단백질 유래의 세포막 투과 도메인 관한 것으로, 더욱 구체적으로는 상기 인간 GPATCH4 단백질 유래의 세포막 투과 도메인(GPATCH4P1 세포막 투과 도메인) 또는 세포 투과 펩타이드 및 이를 포함하는 세포내 전달 시스템에 관한 것이다. 본 발명의 인간 GPATCH4 단백질 유래의 세포막 투과 도메인 및 이를 이용하여 화합물, 생체분자 및 다양한 고분자 물질 등의 카고(Cargo) 물질을 세포 내로 전달 할 수 있다. 본 발명의 GPATCH4P1 세포막 투과 도메인은 종래의 세포 투과 펩타이드와 비교하여 더 높은 세포 투과 효율을 나타내며 인간 단백질 유래여서, 외래단백질 유래의 펩타이드가 일으키는 부작용 및 면역 반응을 피할 수 있으므로 인체에 적용되는 화합물, 생체분자 및 다양한 고분자 물질을 효과적으로 세포 내로 전달하는 방법으로 유용하게 사용될 수 있다.

Description

인간 쥐피에이티씨에치4 단백질 유래 세포막 투과 도메인
본 발명은 인간 GPATCH4 단백질 유래의 세포막 투과 도메인 및 이를 포함하는 세포내 전달 시스템에 관한 것이다.
질병을 치료하거나 증상을 완화하는 데 쓰이는 의약품은 크게 저분자 화합물 의약품과 고분자 바이오 의약품으로 구분되며 바이오 의약품에는 치료용 단백질, 항체, 예방 또는 치료를 위한 백신, 유전자 치료제 그리고 세포 치료제 등이 포함된다. 특히 재조합 단백질 의약품은 생체를 통한 생산이 힘든 치료용 단백질을 유전자 재조합 기술을 이용하여 대량 생산한 의약품이다. 1980년대 초에 당뇨병 치료를 위한 재조합 인간 인슐린(Recombinant human insulin)이 최초로 미국 FDA의 승인을 받은 후에 성장호르몬(Growth hormone), 에리스로포이에틴, 인터페론(Interferon), 콜로니자극인자(CSF), 혈액응고인자(Blood factors)등의 다양한 재조합 단백질 의약품이 출시되었다. 그러나 세포막을 통과하여 세포 내부에 들어가 활성을 나타내기가 비교적 용이한 저분자 화합물 의약품에 비하여 재조합 단백질이나 핵산 등을 포함한 대부분의 고분자 물질은 세포 내로의 전달이 매우 어려워 의약품으로의 효능이 나타나기에 큰 어려움이 있다. 따라서 고분자 물질의 세포 내 전달을 위해 전기 천공법(Electroporation), 미세주입법(Microinjection), 양이온성 지질 소포체 (Cationic lipid vesicle), 바이러스 벡터(Viral vector), 바이러스 유사 입자 (Virus-like particles), 유전자 조작 박테리아(Genetically-modified bacteria) 등을 이용한 방법들이 사용되거나 연구되어 왔다. 하지만 위와 같은 방법들은 생체에 직접 이용이 어렵거나 생체에서 분리한 세포에 전달 후 다시 생체로 주입해야 하는 어려움이 따르며 그에 따른 시간과 비용 증가가 크다는 어려움이 있다. 또한 생체 내에서 세포사멸 또는 면역반응 등을 유도하는 부작용을 일으키기도 하여 적용에 큰 한계를 가지고 있다.
위와 같은 문제점들을 극복할 수 있는 새로운 약물 전달 기술(Drug delivery system) 및 고분자 바이오 의약품 개발을 위한 연구들이 활발히 진행되고 있으며 그 중 대표적인 방법이 바로 단백질 전달 도메인(Protein Transduction Domain, PTD) 또는 세포 투과 펩타이드(Cell Penetrating Peptides, CPP)로 알려진 전달체이다.
세포 투과 펩타이드는 HIV 바이러스의 TAT 단백질 및 TAT 단백질 내 존재하는 폴리펩타이드들(GRKKRRQRRRPPG, RKKRRQRRR, YGRKKRRQRRR)이 세포막을 통과하는 성질을 가진 것으로 최초로 밝혀진 후 초파리 유래의 Penetratin (RQIKIWFQNRRMKWKK), HIV-glycoprotein-41 유래의 MPG (GALFLGFLGAAGSTMGAWSQPKKKRKV), 소의 프리온단백질 유래의 BPrPr(MVKSKIGSWILVLFVAMWSDVGLCKKRP), 인간 Hph-1 단백질 유래의 Hph-1 (YARVRRRGPRR), 인간 NLBP 단백질 유래의 NP2(KIKKVKKKGRK)등의 새로운 세포 투과 펩타이드들이 개발되었다. 이 후 위와 같은 세포 투과 펩타이드를 이용한 연구들이 활발히 진행되고 있으며 이를 통해 DNA, siRNA, PNA(Peptide nucleic acid), 단백질, liposome nanoparticle과 같은 카고 물질들을 효과적으로 세포 내로 전달할 수 있다는 것이 밝혀졌다.
선행 연구들을 통해 세포 투과 펩타이드가 직접 투과(Direct penetration)를 통해 에너지 비의존적이며 낮은 온도에서도 고분자 물질을 세포 내로 전달 가능하다는 것이 밝혀졌으며 엔도사이토시스(Endocytosis) 통한 투과 또한 가능하다는 것이 밝혀졌다.
현재 세포 투과 펩타이드는 TAT-JBD20를 이용한 뇌혈관질환(Cerebral ischemia) 및 퇴행성 뇌질환(Alzheimer's disease) 치료제 개발, TAT-BH4를 이용한 루게릭병 (amyotrophic lateral sclerosis) 치료제 개발, MPG-8/siRNA 및 TAT-DRBD/siRNA 를 이용한 암치료제 등의 전임상 실험이 진행되고 있다. 또한 TAT-δPKC inhibitor 를 이용한 심근경색(Myocardial infarction) 치료제 개발, TAT-JBD20를 이용한 청력 손실 및 염증 치료제 개발, p28을 이용한 뇌종양 치료제 등이 임상 실험 중에 있다.
위와 같이 세포 투과 펩타이드에 관한 연구 및 이를 이용한 여러 신약 후보 물질의 개발이 활발히 진행되고 있으나 극복해야 할 문제점들이 존재하며 이를 위해 세포 투과 효율을 개선하고 세포 투과 펩타이드 및 이와 결합된 카고 물질에 의한 생체 내 부작용과 의도치 않은 면역반응을 최소화 할 수 있는 새로운 세포 투과 펩타이드의 개발이 필요하다.
이에 기존 세포 투과 펩타이드가 바이러스와 초파리 등의 비인간 유래의 단백질에서 주로 발명되었거나 투과 효율이 낮은 단점을 극복하기 위하여, 인간 유래의 펩타이드 중 높은 투과 효율을 가지는 세포 투과 펩타이드, 인간 GPATCH4(G-Patch Domain Containing 4) 단백질 유래 세포 투과 펩타이드를 발명하게 되었고, 인간 유래 단백질 내 존재하는 펩타이드를 대상으로 기존 세포 투과 펩타이드들과 유사성을 확인하였으며, 이를 통해 본 발명을 완성하였다.
선행문헌으로 비특허문헌
1. Mutational analysis of a human immunodeficiency virus type 1 Tat protein transduction domain which is required for delivery of an exogenous protein into mammalian cells. J. Gen. Virol., 83 (2002), pp. 1173-1181
2. The third helix of the Antennapedia homeodomain translocates through biological membranes. J. Biol. Chem., 269 (1994), pp. 10444-10450
3. A new peptide vector for efficient delivery of oligonucleotides into mammalian cells. Nucleic Acids Res. 14 (1997) pp. 2730-2736.
4. N-terminal peptides from unprocessed prion proteins enter cells by macropinocytosis. Biochem. Biophys. Res. Commun., 348 (2006), pp. 379-385
5. Intranasal delivery of the cytoplasmic domain of CTLA-4 using a novel protein transduction domain prevents allergic inflammation. Nat Med, 12 (2006), pp. 574-579
6. dNP2 is a blood-brain barrier-permeable peptide enabling ctCTLA-4 protein delivery to ameliorate experimental autoimmune encephalomyelitis. Nat Commun. 8244 (2015), pp. 1-13 을 이용하였다.
본 발명의 목적은 높은 세포 투과 효율을 나타내며 부작용을 최소화 할 수 있는 신규한 세포막 투과 도메인을 제공하는 데 있다.
본 발명의 다른 목적은 펩타이드의 말단에 세포내 운반 대상의 카고(cargo)가 결합되어 있는 세포막 투과 도메인을 포함하는 세포내 전달 시스템을 제공하는데 있다.
본 발명의 또 다른 목적은 펩타이드의 말단에 세포내 운반 대상의 카고(cargo)가 결합되어 있는 세포막 투과 도메인을 세포에 접촉시키는 단계를 포함하는 카고를 세포 내로 운반하는 방법을 제공하는 데 있다.
본 발명은 상기 목적을 달성하기 위하여, 인간 GPATCH4(G-Patch Domain Containing 4) 단백질 유래 서열번호 1 내지 7 중 어느 하나의 폴리펩티드를 포함하는 세포막 투과 도메인을 제공하는 데 있다.
본 발명에서 용어 “세포 투과 펩타이드(Cell penetrating peptide, CPP)”는 인 비트로 또는 인 비보상에서 운반 대상의 카고(Cargo)를 세포 내로 운반할 수 있는 능력을 가진 펩타이드를 의미하여, 용어 “세포막 투과 도메인”과 혼용된다.
또한 본 발명에서 용어 ‘펩티드’또는 ‘펩타이드’는 펩티드 또는 펩타이드 결합에 의해 4개 내지 1000개의 아미노산 잔기들이 서로 결합되어 형성된 사슬 형태의 고분자를 의미하며, ‘폴리펩티드’ 또는 ‘폴리펩타이드’와 상호 혼용 가능한 의미이다.
본 발명에서는 인체 내로 세포 투과 펩타이드를 통해 카고 물질 전달 시 생겨나는 부작용을 최소화 하기 위해 기존의 바이러스 또는 다른 종에서 유래된 세포 투과 펩타이드와 달리 인간 유래여서, 기존 세포 투과 펩타이드와 비교하여 세포내로 매우 높은 전달 효율을 가지며 인체에 처리시 부작용을 최소화 할 수 있는 신규 인간 유래 세포막 투과 도메인 또는 세포 투과 펩타이드를 제공한다.
본 발명은 상기 세포막 투과 도메인 및 상기 세포막 투과 도메인의 N 말단 또는 C 말단에 융합된 카고를 포함하는 세포막 투과율이 향상된 재조합 카고를 제공한다.
상기 카고는 단백질, 핵산, 지질 또는 화합물인 재조합 카고 일 수 있다. 또한 상기 카고는 아주반트 또는 항원일 수 있다.
일 구현예에 따르면 상기 카고는 호르몬, 면역글로불린, 항체, 구조 단백질, 신호전달 펩타이드, 저장 펩타이드, 막 펩타이드, 막관통 펩타이드, 내부 펩타이드, 외부 펩타이드, 분비성 펩타이드, 바이러스 펩타이드, 천연(native) 펩타이드, 당화 단백질, 단편화된 단백질, 디설파이트(Disulfide peptide), 재조합 단백질, 화학적으로 변형된 단백질 및 프리온 군으로부터 선택되는 어느 하나인 재조합 카고 일 수 있다.
또한 본 발명에서 용어 ‘재조합 카고’란 세포막 투과 도메인 및 한 개이상의 카고가 유전적 융합이나 화학결합에 의해 재조합되어 형성된 복합체를 의미한다.
또한 본 발명에서 용어 ‘접촉’이란 카고가 진핵 또는 원핵세포와 접하는 것을 의미하며, 이러한 접촉에 의하여 상기 카고가 상기 진핵 또는 원핵 세포의 내로 전달된다.
또한 본 발명에서 단백질, 펩티드 등을 세포 내로 도입시키는 것에 대하여 운반, 침투, 수송, 전달 또는 통과 한다는 표현들과 상호 혼용 한다.
또한 일 구현예에 따르면 상기 카고는 핵산, 코딩 핵산 서열, mRNA, 안티센스 RNA 분자, 탄수화물, 지질 및 당지질로 이루어진 군으로부터 선택되는 어느 하나인 재조합 카고 일 수 있다.
또한 일 구현예에 따르면, 상기 카고는 조영물질, 약물 또는 화학물질인 재조합 카고 일 수 있다.
본 발명에서 용어‘조영물질’은 의학적 영상 촬영(Imaging)에서 생체 구조 또는 유체의 조영을 위해 사용되는 모든 물질을 의미한다. 상기 조영물질은 방사선 비투과성 조영물질, 상자성 조영물질, 초상자성 조영물질, CT 조영물질 또는 기타 조영 물질을 포함할 수 있으나, 이에 한정되는 것은 아니다. 예를 들면 방사선비투과 금속 및 그의 염(예를 들면, 은, 금 백금 등) 및 기타 방사선비투과 화학물(예를 들면, 칼슘염, 황산바륨과 같은 바륨염, 탄탈룸 및 산화 탄탈룸)을 포함 할 수 있다. 상자성 조영물질(MR 영상용)은 가돌리늄 디엔틸렌 트리아민펜타아세트산 및 그의 유도체 및 기타 가돌리늄, 망간, 철, 디스프로시움(dysprosium), 구리 유로피움(europium), 에르비움(erbium), 크롬, 니켈 및 코발트 복합체 히드록시벤질에틸렌 디아민 디아세트산(HBED)을 포함할 수 있다. 초상자성 조영물질(MR 영상용)은 자철석(magentite), 초상자성 산화철, 초소, 초상자성 산화철 및 단결정성 산화철을 포함할 수 있다. 다른 적합한 조영물질은 요오드화 및 비요오드화, 이온성 및 비이온성 CR 조성물질, 및 스핀-표지(spin-label)와 같은 조영물질, 또는 기타 진단 활성제를 포함 할 수 있다. 세포에서 발현되는 경우, 용이하게 검출가능한 단백질을 코딩하는 마커 유전자를 포함할 수 있다. 방사선핵종, 형광물질, 효소보조인자, 효소 저해제 등과 같은 다양한 표지들이 이용될 수 있다.
일 예로서, 본 발명에 따른 카고가 단백질 또는 펩티드인 경우, 이동 대상을 발현하는 DNA에 운반 펩티드를 발현하는 DNA를 결합시킨 후 이를 발현시킴으로써, 이동 대상과 펩티드의 융합 단백질 형태로 운반 펩티드와 이동 대상을 결합 시킬 수 있다. 융합 단백질에 의한 결합의 구체적인 예는 다음과 같다: 융합 단백질을 생산하기 위한 프라이머(primer) 제작시 이동 대상을 발현하는 뉴클레오티드 앞에 운반 펩티드를 코딩하는 뉴클레오티드를 붙인 다음, 수득한 뉴클레오티드를 제한 효소로 벡터(예: PET 벡터)에 삽입하고, BL-21(DE3)을 세포에 도입(transformation)하여 발현시킨다. 이때, IPTG(Isopropyl β-D-1-thiogalactopyranosid)와 같은 발현 유도제를 처리하여, 융합 단백질을 정제한 후 PBS를 처리하면, 상기 운반 펩티드는 염색 물질 또는 형광 물질, 구체적으로 플루오레세인 이오티오시아네이트(FITC, fluorescein isothiocyanate), 루시퍼라아제(Luciferase, Luc), 녹색형광단백질 (Green fluorescent protein, GFP), 증강된 녹색형광단백질(enhanced green fluorescent protein, EGFP), Tag GFP, Superfolder GFP, PA GFP, AcGFP, PS-GFP2, 노랑형광단백질(Yellow fluorescent protein, YFP), 증강된 노랑형광단백질 (enhanced Yellow fluorescent protein, EYFP), SYFP, TagYFP, PhiYFP, Azurite, mKalamal, 청색형광단백질(Cyan fluorescent protein, CFP), 증강된 청색형광단백질(enhanced Cyan fluorescent protein, ECFP), TagCFP, PS-CFP2, 빨강형광단백질(Red fluorescent protein, RFP), Tag RFP, Tag RFP657, mRFP1, PaTagRFP, Turbo RFP, RFP693, tdRFP, 파랑형광단백질(Blue fluorescent protein, BFP), mTag BFP, 노랑녹색형광단백질(Yellow-green fluorescent protein, mNeongreen), 밝은 형광단백질(Bright monomeric fluorescent protein, Scarlet-i), 엠플럼(mplum), 엠체리(monomeric cherry fluorescent protein, mcherry), PAmcherry, 엠스트로베리(monomeric strawberry fluorescent proteins, mStrawberry), 엠오렌지 (monomeric orange fluorescent protein, mOrange), PSmOrange, 엠라지베리 (mRasberry), 엠케이트(mKate), mKate2, 엠티에프피(monomeric teal fluorescent protein, mTFP), 엠넵튠(mNeptune), 엠루비(mRubby), mRubby2, 엠바나나(mBanana), 디에스레드(DSRed), 엠시트린(mCitrine), 에메랄드(Emerald), 티-사파이어(T-Sapphire), 엠에플(mApple), 엠그레이프(mgrape), 비너스(Venus), 토페즈(Topaz), 제이-레드(J-Red), 티디토마토(tdTomato), mTurquoise, mTurquosie2, mKO, mKO2, mUKG. IFP1.4, mEos2, mEos4, mHoneydew, Dronpa, katushka, Ypet, CyPet, Clover, kaede , KikGR, mTangerine, Zsgreen, ZsYellow, 세루리안(Cerulean), 베타-갈락토시다아제, 베타-람타메이즈, 베타-글루쿠로니데이즈, 알카라인 포스파타아제, 클로람페니콜 아세틸트랜스퍼라아제(Chloramphenicol acetyltransferase, CAT) 또는 퍼록시다아제(Peroxidase)와 결합할 수 있다.
본 발명의 다른 양태에 따르면, 본 발명은 상기 세포막 투과 도메인을 코딩하는 폴리뉴클레오티드를 포함하는 유전자 컨스트럭트(Gene construct)를 제공한다.
또한 본 발명은 유전자 컨스트럭트를 포함하는, 세포막 투과율이 향상된 재조합 카고 단백질 발현용 발현 벡터를 제공한다.
본 발명은 또한, 상기 세포막 투과 도메인에 생리활성 펩타이드가 결합되어 있는 결합체 및 약학적으로 허용가능한 담체를 포함하는 약학 조성물을 개체에 투여하는 단계를 포함하는, 자궁경부암, 전립선암, 난소암, 자궁내막암, 자궁암, 방광암, 식도암, 두경부암 윌름즈종양, 연부조직육종, 위암, 췌장암, 유방암, 기관지암 등의 질환 예방 또는 치료 방법을 제공하는 데 있다.
본 발명에 따른 약학 조성물은 각각 통상의 방법에 따라 산제, 과립제, 정제, 캡슐제, 현탁액, 에멀젼, 시럽 에어로졸 등의 경구형 제형, 외용제, 좌제 및 멸균 주사용액의 형태로 제형화하여, 사용될 수 있다. 조성물에 포함될 수 있는 담체, 부형체 및 희석제로는 락토즈, 텍스트로즈, 수크로즈, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말티톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로즈, 미정질 셀룰로스, 폴리비닐 피롤리돈, 물, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 탈크, 마그네슘 스테아레이트 및 광물유를 들 수 있다.
제제화할 경우에는 보통 사용하는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제된다. 경구투여를 위한 고형제제에는 정제, 환제, 산제, 과립제, 캡슐제 등이 포함되며, 이러한 고형제제는 상기 추출물에 적어도 하나 이상의 부형제 예를 들면 전분, 칼슘카보네이트, 수크로스 또는 락토오스, 젤라틴 등을 섞어 조제된다. 또한 단순한 부형제 이외에 마그네슘 스테아레이트, 탈크 같은 윤활제들도 사용된다. 경구를 위한 액상 제제로는 현탁제, 내용액제, 유제, 시럽제 등이 해당되는데 흔히 사용되는 단순희석제인 물, 리퀴드 파라핀 이외에 여러가지 부형제, 예를 틀면 습윤제, 감미제, 방향제, 보존제 등이 포함될 수 있다. 비경구 투여를 위한 제제에는 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조 제제, 좌제가 포함된다. 비수성용제 현탁제로는 프로필레글리콜, 폴리에틸렌글리콜, 올리브 오일과 같은 식물성 기름, 에틸올에이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다. 좌제의 기제로는 위텝솔, 마크로골, 트윈61, 카카오지, 라우린지, 글리세로제라틴 등이 사용될 수 있다.
본 발명의 조성물의 바람직한 투여량은 환자의 상태 및 체중, 질병의 정도, 약물형태, 투여경로 및 기간에 따라 다르지만, 당업자에 의해 적절하게 선택될 수 있다. 그러나 바람직한 효과를 위해서 본 발명의 조성물은 1일 0.0001 내지 500mg/kg으로, 바람직하게는 0.001 내지 250mg/kg으로 투여하는 것이 좋다. 투여는 하루에 한번 투여할 수도 있고, 수회 나누어 투여 할 수도 있다. 상기 투여량은 어떠한 면으로든 본 발명의 범위를 한정하는 것은 아니다.
본 발명의 다른 양태에 따르면, 상기 세포막 투과 도메인의 N-말단 또는 C-말단에 카고가 융합된 재조합 카고를 제조하는 단계; 및 상기 제조된 재조합 카고를 분리된 세포와 접촉시키는 단계를 포함하는 세포 내로의 카고 전달 방법을 제공한다.
또한 본 발명의 다른 양태에 따르면, 상기 세포막 투과 도메인의 N-말단 또는 C-말단에 카고가 융합된 재조합 카고를 제조하는 단계; 및 상기 제조된 재조합 카고를 인간을 제외한 동물에게 투여하는 단계;를 포함하는 동물 내로의 카고 전달 방법을 제공한다.
세포막 투과 도메인과 세포막의 접촉에서 특별하게 요구되는 조건, 예컨대, 제한적인 시간, 온도 및 농도 등의 조건은 없으며, 당업계에서 세포막 투과에 적용되는 일반적인 조건으로 실시 될 수 있다.
본 발명의 세포 투과 펩타이드는 기존 펩타이드와 비교하여 크게 향상된 투과 효율 또는 세포 투과능을 나타냄으로 운반된 카고 또는 생물학적 활성 분자를 세포 내로 도입시키고, 효과적으로 활성을 유지하도록 하고, 비용 또한 크게 절감시킬 수 있다.
또한, 세포 투과 펩타이드 또는 세포막 투과 도메인을 통해 전달되는 카고 물질의 효과를 증대시킬 수 있다.
또한, 인간 단백질 유래의 세포 투과 펩타이드이기 때문에 비인간 단백질 유래의 펩타이드들이 유발 하는 부작용을 최소화 할 수 있다.
다만, 본 발명의 효과는 상기에서 언급한 효과로 제한되지 아니하며, 언급되지 않는 또 다른 효과들은 하기의 기재로부터 당업자에게 명확히 이해될 수 있을 것이다.
도 1은 GPATCH4P1-EGFP 재조합 융합 단백질의 발현하는 유전자 합성물을 만들기 위한 유전자 합성물의 모식도를 나타낸 것이다.
도 2는 인간 GPATCH4 단백질 유래의 세포 투과 펩타이드 GPATCH4P1와 Enhanced Green Fluorescent Protein(EGFP) 형광단백질이 융합된 단백질을 발현하는 유전자 합성물을 아가로스 겔 전기영동법을 통해 관찰한 결과를 나타낸 것이다.
도 3은 단백질 발현 벡터 pET28a+에 GPATCH4P1-EGFP 유전자 합성물을 삽입하여 결합된 유전자 합성물에 제한 효소를 처리하여 그 결과를 확인 것을 나타낸 것이다.
도 4는 GPATCH4P1-EGFP-pET28a+벡터를 BL21(DE3) 수용세포에 형질전환 후 단백질 생산을 유도하고 초음파 분해한 뒤에 폴리아크릴아마이드 겔 전기 영동법을 통해 관찰한 것을 나타낸 것이다.
도 5는 BL21(DE3) 수용세포를 이용해 생산한 GPATCH4P1-EGFP 재조합 융합 단백질을 정제하여 폴리아크릴아마이드 겔 전기 영동법을 통해 관찰한 것을 나타낸 것이다.
도 6은 기존의 세포 투과 펩타이드가 EGFP와 융합한 재조합 단백질과 GPATCH4P1-EGFP 재조합 단백질을 인간 T 면역 세포주(Jurkat)에 처리한 후 유세포분석기로 세포 내 투과 효율을 비교한 결과를 나타낸 것이다.
도 7은 세포 투과 펩타이드가 융합한 재조합 단백질들을 농도별로 처리한 후 유세포분석기로 세포 내 투과 효율을 비교한 결과를 나타낸다.
도 8은 세포 투과 펩타이드가 융합한 재조합 단백질들을 시간별로 처리한 후 유세포분석기로 세포 내 투과 효율을 비교한 결과를 나타낸 것이다.
도 9는 GPATCH4P1-EGFP 재조합 단백질을 자궁경부암 세포주(HeLa)에 처리한 후 공초점 현미경(Confocal Microscope)를 이용해 세포 내로 투과된 GPATCH4P1-EGFP 재조합 단백질의 분포 양상을 관찰한 것을 나타낸 것이다.
도 10은 본 발명의 GPATCH4P1 변이(mutant)-EGFP 융합 단백질의 세포 내 전달 효율을 인간 T 면역 세포주(Jurkat)에 처리한 후 유세포분석기(FACS) 로 세포 내 도입 효율을 확인한 결과를 나타낸 것이다.
본 명세서에서 달리 정의되어 있지 않는 한, 사용된 모든 기술 및 과학 용어는 당업계에 통상의 기술자가 통상적으로 이해하는 바와 같은 의미를 가진다. 본 명세서에 포함되는 용어를 포함하는 다양한 과학적 사건이 잘 알려져 있고, 당업계에서 이용 가능하다.
본 발명은 인간 GPATCH4(G-Patch Domain Containing 4) 단백질 유래 서열번호 1 내지 7 중 어느 하나의 폴리펩티드를 포함하는 세포막 투과 도메인 또는 세포투과 펩타이드를 제공한다.
종래의 기존 세포 투과 펩타이드는 바이러스와 초파리 등의 비인간 유래의 단백질에서 주로 발명되었거나 투과 효율이 낮은 단점을 가지고 있다. 이를 극복하기 위하여, 본 발명자들은 인간 유래의 펩타이드 중 세포 투과성을 가질 것으로 예상되는 인간 GPATCH4(G-Patch Domain Containing 4) 단백질에서 203번째에서 212번째 아미노산서열로 이루어진 GPATCH4P1 펩타이드 KKKKKKRRQK(서열번호 1)를 발견하였다.
인간유래 GPATCH4 단백질의 염기 서열 내 GPATCH4P1를 발현하는 유전자 서열 정보는 aaaaaaaagaaaaagaaaaggaggcagaaa(서열번호 8)이며 유전자 합성시에는 코돈 최적화를 통해 aaaaaaaagaagaagaaacggagacaaaaa(서열번호 9)로 전환하여 사용되었다. 세포 투과성을 검증하기 위하여 GPATCH4P1 펩타이드를 발현하는 염기 서열 뒤에 연결된 EGFP 형광단백질을 발현하는 염기 서열은 서열번호 10로 표시되며 GPATCH4P1 펩타이드와 EGFP 단백질 사이에 linker 부분의 염기서열은 ggaggtgggggctcg(서열번호 11)이다.
본 발명의 서열번호 2 내지 7로 표시되는 세포 투과 펩타이드 또는 세포막 투과 도메인은 상기 GPATCH4P1 세포 투과 펩타이드의 변이(mutant)된 세포 투과 펩타이드로, GPATCH4P1의 9번째 아미노산인 글루타민을 다른 아미노산으로 치환한 GPATCH4P1 mutant 및 N-말단과 C-말단의 아미노산을 각각 하나씩 제거한 GPATCH4P1 mutant 변이된 세포막 도메인 또는 세포 투과 펩타이드이다.
본 발명의 인간 GPATCH4P1 단백질 유래 세포막 투과 도메인 또는 세포 투과 펩타이드는 하기 표1과 같다.
인간 GPATCH4P1 단백질 유래 세포막 투과 도메인 또는 세포 투과 펩타이드
서열번호 서열명칭 서열(Sequence)
서열번호 1 GPATCH4P1 KKKKKKRRQK
서열번호 2 GPATCH4P1-M1 KKKKKKRRYK
서열번호 3 GPATCH4P1-M2 KKKKKKRREK
서열번호 4 GPATCH4P1-M3 KKKKKKRRKK
서열번호 5 GPATCH4P1-M4 KKKKKKRRGK
서열번호 6 GPATCH4P1-M5 KKKKKKRRQ
서열번호 7 GPATCH4P1-M6 KKKKKRRQK
본 발명의 이점 및 특징, 그리고 그것들을 달성하는 방법은 상세하게 후술되어있는 실시예들을 참조하면 명확해질 것이다. 이하에서는 본 발명을 실시예에 의하여 더욱 상세히 설명한다. 단, 하기 실시예는 본 발명을 예시하는 것일 뿐 본 발명의 내용을 하기 실시예에 한정하는 것은 아니다.
<실시예 1> 인간 GPATCH4 단백질 유래의 세포 투과 펩타이드(GPATCH4P1)와 EGFP 형광단백질이 융합된 단백질을 발현하는 플라스미드 벡터의 제작
본 발명은 세포막 투과 도메인(GPATCH4P1 세포 투과 펩타이드, GPATCH4P1)을 코딩하는 폴리뉴클레오티드를 포함하는 유전자 컨스트럭트(Gene construct)를 제공하고, 상기 유전자 컨스트럭트 포함하는 세포막 투과율이 향상된 재조합 카고 단백질 발현용 발현 벡터를 제공한다. 상기 벡터는 상기 세포막 투과 도메인과 단백질의 카고가 융합된 재조합 카고 단백질이 발현 될 수 있도록, 카고 단백질을 코딩하는 유전자를 추가적으로 포함하는 것을 특징으로 한다.
또한 본 발명은 상기 세포막 투과 도메인의 N-말단 또는 C-말단에 카고가 융합된 재조합 카고를 제조하는 단계; 및 상기 제조된 재조합 카고를 세포와 접촉시키는 단계를 포함하는 세포 내로의 카고 전달 방법을 제공한다.
상기 GPATCH4P1의 세포 투과 효율을 실험하기 위해 다음과 같이 인공유전자 합성을 진행하였다. 도 1과 같이 5’-NheI 제한효소 인식서열-GPATCH4P1 염기서열-Linker 염기서열-EGFP 단백질 염기서열-종결코돈-XhoI 제한효소 인식서열-3’을 합성하였다.
특히 GPATCH4P1 염기서열은 인공유전자 합성시 코돈 최적화를 통해 동일한 펩타이드를 발현하는 염기서열로 전환하였으며 세포 투과성을 검증하기 위하여 GPATCH4P1펩타이드의 염기 서열 뒤에 EGFP 형광단백질을 발현하는 유전자를 붙여 합성하였다(도 2). 또한 세포 투과 펩타이드와 EGFP 단백질 사이에 linker 염기서열을 넣어 유연성을 높여주었다. 인공합성 유전자를 NheI 제한효소와 XhoI 제한효소를 처리 후 마찬가지로 NheI 제한효소와 XhoI 제한효소를 처리한 pET28a+ 플라즈미드 벡터에 T4 연결효소를 통해 도입하였다. 여기서 사용된 pET-28a 플라즈미드 벡터는 N-말단에 6개의 히스티딘(6 x His)을 GPATCH4P1-EGFP 융합단백질 앞에 발현하여 Ni-NTA Resin 통한 단백질 정제를 가능하게 한다. GPATCH4P1-EGFP 융합단백질 인공 유전자가 도입된 pET28a+ 플라즈미드 벡터는 Top10 수용세포에 형질전환 후 카나마이신(Kanamycin)이 포함된 LB agar plate에서 배양하여 자라난 콜로니(Colony) 들을 LB배지에서 약 16시간 배양한다. 이 후 DNA 추출 실험을 통해 플라즈미드를 얻고 이를 NheI 제한효소와 XhoI 제한효소로 처리한 후 아가로스 겔 전기영동법을 통해 GPATCH4P1-EGFP 융합단백질 인공 유전자가 pET-28a 플라즈미드 벡터에 성공적으로 도입된 것을 확인하였다(도 3). 상기와 같이 상기 세포막 투과 도메인 (GPATCH4P1)에 카고가 융합된 재조합 카고를 제조하였다. 본 발명의 세포 내로의 카고 전달 방법은 1) 상기의 재조합 카고를 제조하는 단계; 및 2) 상기 단계에서 제조된 재조합 카고를 세포와 접촉시키는 단계를 포함한다. 상기 2)의 제조합 카고와 세포의 접촉은 인 비트로(in vitro) 또는 인 비보(in vivo) 상에서 수행될 수 있다. 상기 접촉은 인 비트로(in vitro) 상에서 진행될 경우, 시험관 내의 세포에 재조합 카고가 포함된 배지를 처리하여 세포를 배양 시키는 과정에 의해 상기 접촉이 이루어진다.
또한 상기 접촉인 인 비보(in vivo) 상에서 진행될 경우, 상기 재조합 카고는 근육내(intramuscular), 복막내(intra-peritoneal), 정맥내(intravein), 경구(oral), 비내(nasal), 피하(subsutaneous), 피하(intradermal), 점막(muscosal), 또는 흡입 (inhale)등의 경로를 통해 생체 내로 주입(injection) 되고, 생체 내에서 세포와 재조합 카고의 접촉이 이루어지게 된다.
<실시예 2> GPATCH4P1-EGFP 융합 단백질의 발현 조건 확립 및 고순도 정제
GPATCH4P1-EGFP 융합 단백질의 발현 조건 확립하기 위해 상기 실시예 1에서 제작된 플라즈미드 벡터를 BL21(DE3) 수용세포에 형질전환 후에 카나마이신(Kanamycin) 이 포함된 LB 배지에서 약 16시간 배양한다. 여기에 다시 100배의 LB 배지를 추가하여 O.D값이 0.4-0.6에 도달할 때까지 배양한 후 IPTG(Isopropyl β-D-1-thiogalactopyranoside)를 최종 농도 1mM이 되도록 첨가한 뒤 37 ℃에서 5시간 또는 20 ℃에서 16시간 배양한다. 이 후 원심 분리를 통해 얻은 세포를 초음파 분해하여 다시 원심분리를 통해 상등액과 cell pellet으로 분리하여 이를 폴리아크릴아마이드 겔 전기 영동법과 Coomassie blue 염색을 통해 단백질의 발현된 양과 수용성을 확인하였다(도 4).
이를 통해 GPATCH4P1-EGFP 융합단백질이 IPTG를 첨가 후 20 ℃에서 16시간 배양한 조건에서 단백질의 수용성 및 발현 효율이 높아짐을 확인하였다. 따라서 고순도의 GPATCH4P1-EGFP 융합단백질을 정제하기 위하여 같은 조건으로 형질 전환 된 BL21(DE3) 수용세포를 배양한 후 배양액을 원심 분리하여 cell pellet을 얻었으며 lysis buffer(50 mM NaH2PO4, 300mM NaCl, 10mM Imidazole)로 현탁하였다. 이를 초음파 분해하여 다시 원심분리를 통해 상등액을 회수하여 45μm 필터로 걸러준 후 Ni-NTA agarose column에 상등액을 통과시켜 재조합 단백질을 결합시켰다. Ni-NTA agarose column에 비특이적으로 결합한 단백질을 제거하기 위하여 washing buffer(50 mM NaH2PO4, 300mM NaCl, 20mM Imidazole)를 이용하여 Ni-NTA agarose column을 세척한 후 Ni-NTA agarose column에 결합한 재조합 단백질을 회수하기 위하여 elution buffer(50 mM NaH2PO4, 300mM NaCl, 500mM Imidazole)를 이용하여 재조합 단백질을 용출시켰다. PD-10 desalting column을 이용하여 GPATCH41-EGFP 융합단백질이 포함된 용액을 PBS로 교체한 후 이를 폴리아크릴아마이드 겔 전기 영동법과 Coomassie blue 염색을 통해 확인하였다(도 5).
<실시예 3> GPATCH4P1-EGFP 융합 단백질의 세포 내 전달 효율 확인
GPATCH4P1-EGFP 융합 단백질의 세포 내 전달 효율을 확인하기 위하여 종래에 알려져 있는 세포 투과 펩타이드 TAT, Hph-1 그리고 NP2가 각각 EGFP 형광단백질이 융합된 단백질을 발현하는 플라스미드 벡터를 GPATCH4P1-EGFP 융합 단백질을 발현하는 플라스미드 벡터와 동일한 방법으로 제작하였다. 종래의 CPP-EGFP 융합단백질의 발현 및 정제 또한 GPATCH4P1-EGFP 융합 단백질과 동일한 방법으로 진행하였다. 세포 실험을 위하여 Jurkat 세포를 1.5 X 106/well로 24 well plate에 분주한 후 10% Fetal Bovine Serum과 1% penicillin/streptomycin이 포함된 RPMI 1640 배지 2ml 에 부유시켜 CPP-EGFP 융합단백질을 최종 농도 5μM로 처리 후 37°C로 유지되는 5% CO2 배양기에서 2시간 동안 배양하였다. 이 후 세포가 포함된 배지를 5 ml 튜브에 옮긴 후 원심 분리하여 상등액을 제거하고 PBS 용액으로 세척하는 것을 3회 반복하였다. 이 후 Jurkat세포를 650μl의 PBS에 부유시킨 후 유세포분석기를 통해 세포 내로 도입된 CPP-EGFP의 형광을 측정하여 세포 내 도입 효율을 확인하였다 (도 6). 이를 통해 상기 GPATCH4P1가 기존의 세포 투과 펩타이드들 보다 높은 효율을 나타냄을 확인하였다.
실시예 3에서 이용된 재조합 단백질
실시예 3에서 이용된 재조합 단백질
음성대조군 Wild type EGFP
실험군 실시예 2에서 정제한 재조합 GPATCH4P1의 융합 단백질, GPATCH4P1-EGFP
양성대조군 TAT-EGFP
(Hph-1)-EGFP
NP2 EGFP
GPATCH41P-EGFP 융합단백질의 농도별 도입 효율을 확인하기 위하여 EGFP 단백질 그리고 현재 가장 폭넓게 사용 중인 세포 투과 펩타이드인 TAT와 EGFP의 융합단백질을 이용하여 비교 실험을 진행하였다. EGFP, TAT-EGFP 그리고 GPATCH4P1-EGFP 융합단백질을 각각 최종 농도 0.5, 1, 2, 5, 10μM로 Jurkat 세포에 처리하였으며 앞선 실험과 동일한 과정을 통해 도입 효율을 확인하였다(도 7). 이를 통해 GPATCH4P1-EGFP 융합단백질이 농도의존적으로 세포 내로 도입됨을 확인하였으며 TAT-EGFP 융합단백질과 비교하여 모든 농도에서 더 높은 전달 효율을 보이는 것을 확인하였다.
다음으로 GPATCH4P1-EGFP 융합단백질의 시간 별 도입 효율을 확인하기 위하여 EGFP, TAT-EGFP 융합단백질을 이용하여 비교 실험을 진행하였다. EGFP, TAT-EGFP 그리고 GPATCH4P1-EGFP 융합단백질을 각각 최종 농도 5μM로 Jurkat세포에 처리한 후 각각 0.5, 1, 2, 4, 6시간 동안 배양하였으며 상기 농도별 도입 효율 실험과 동일한 과정을 통해 도입 효율을 확인하였다(도 8). 이를 통해 GPATCH4P1-EGFP 융합단백질이 시간 의존적으로 세포 내로 도입됨을 확인하였으며 TAT-EGFP 융합단백질과 비교하여 모든 시간에서 더 높은 전달 효율을 보이는 것을 확인하였다.
<실시예 4> GPATCH4P1-EGFP 융합 단백질의 세포 내 전달 양상 확인
세포 내로 도입된 GPATCH4P1-EGFP 융합 단백질을 공초점현미경으로 확인하기 위하여 먼저 HeLa 세포를 2 X 104/well로 24 well cell culture slide에 분주한 후 10% Fetal Bovine Serum과 1% penicillin/streptomycin이 포함된 DMEM 배지 500μl 에 부유시켜 37°C로 유지되는 5% CO2배양기에서 18시간 배양하였다. 이 후 EGFP 그리고 GPATCH4P1-EGFP 융합단백질을 각각 최종 농도 10μM로 세포에 처리한 후 1시간 동안 배양하였다. 이 후 배양액을 제거한 후 PBS 용액으로 3회 세척 후 4% PFA 용액을 상온에서 30분간 처리하여 고정하였다. PFA 용액을 제거한 후 다시 PBS 용액으로 3회 세척 한 뒤 mounting medium 을 처리하고 커버 슬라이드를 덮어 공초점현미경으로 관찰하였다(도 9). 이를 통해 GPATCH4P1-EGFP 융합단백질이 HeLa세포 내로 효과적으로 도입되었음을 확인하였다.
<실시예 5> GPATCH4P1 mutant-EGFP 융합 단백질의 세포 내 전달 효율 확인
GPATCH4P1 변이체의 세포 내 전달 효율을 연구하기 위하여 GPATCH4P1의 9번째 아미노산인 글루타민을 다른 아미노산으로 치환한 GPATCH4P1 mutant 및 N-말단과 C- 말단의 아미노산을 각각 하나씩 제거한 GPATCH4P1 mutant 를 설계하였다. 이 후 GPATCH4P1 mutant-EGFP 융합 단백질을 발현하는 플라스미드 벡터를 제작한 후 단백질을 발현시켜 정제하였다. 세포 실험을 위하여 Jurkat 세포를 1.5 X 106/well로 24 well plate에 분주한 후 10% Fetal Bovine Serum과 1% penicillin/streptomycin 이 포함된 RPMI 1640 배지 2ml에 부유시켜 CPP-EGFP 융합단백질을 최종 농도 5μM로 처리 후 37°C로 유지되는 5% CO2 배양기에서 2시간 동안 배양하였다. 이 후 세포가 포함된 배지를 5ml 튜브에 옮긴 후 원심분리하여 상등액을 제거하고 PBS 용액으로 세척하는 것을 3회 반복하였다. 이 후 Jurkat 세포를 650μl의 PBS에 부유시킨 후 유세포분석기를 통해 세포 내로 도입된 GPATCH4P1 mutant-EGFP 융합단백질들의 형광을 측정하여 세포 내 도입 효율을 확인하였다(도 10). 이를 통해 GPATCH4P1 mutant들이 변이를 통해 도입 효율의 변화를 나타내지만 세포 투과 능력이 유지됨을 확인하였다.
전자파일 첨부하였음.

Claims (10)

  1. 인간 GPATCH4(G-Patch Domain Containing 4) 단백질 유래 서열번호 1 내지 7 중 어느 하나의 폴리펩티드를 포함하는 세포막 투과 도메인.
  2. 제 1항의 세포막 투과 도메인 및 상기 세포막 투과 도메인의 N-말단 또는 C-말단에 융합된 카고를 포함하는 세포막 투과율이 향상된, 재조합 카고.
  3. 제 2항에 있어서, 상기 카고는 단백질, 핵산, 지질 또는 화합물인, 재조합 카고.
  4. 제 2항에 있어서, 상기 카고가 호르몬, 면역글로불린, 항체, 구조 단백질, 신호전달 펩타이드, 저장 펩타이드, 막 펩타이드, 막관통 펩타이드, 내부 펩타이드, 외부 펩타이드, 분비성 펩타이드, 바이러스 펩타이드, 천연(native) 펩타이드, 당화 단백질, 단편화된 단백질, 디설파이트(Disulfide peptide), 재조합 단백질, 화학적으로 변형된 단백질 및 프리온 군으로부터 선택되는 어느 하나인 재조합 카고.
  5. 제 2항에 있어서, 카고가 핵산, 코딩 핵산 서열, mRNA, 안티센스 RNA 분자, 탄수화물, 지질 및 당지질로 이루어진 군으로부터 선택되는 어느 하나인 재조합 카고.
  6. 제 2항에 있어서, 카고가 조영물질, 약물 또는 화학물질인 것인 재조합 카고.
  7. 제 1항의 세포막 투과 도메인을 코딩하는 폴리뉴클레오티드를 포함하는 유전자 컨스트럭트(Gene construct).
  8. 제 7항의 유전자 컨스트럭트를 포함하는 세포막 투과율이 향상된 재조합 카고 단백질 발현용 발현 벡터.
  9. 제 1항의 세포막 투과 도메인의 N-말단 또는 C-말단에 카고가 융합된 재조합 카고를 제조하는 단계; 및 상기 제조된 재조합 카고를 분리된 세포와 접촉시키는 단계;를 포함하는 세포 내로의 카고 전달 방법.
  10. 제 1항의 세포막 투과 도메인의 N-말단 또는 C-말단에 카고가 융합된 재조합 카고를 제조하는 단계; 및 상기 제조된 재조합 카고를 인간을 제외한 동물에게 투여하는 단계;를 포함하는 동물 내로의 카고 전달 방법.
PCT/KR2019/017830 2018-12-19 2019-12-16 인간 쥐피에이티씨에치4 단백질 유래 세포막 투과 도메인 Ceased WO2020130548A1 (ko)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR20180165439 2018-12-19
KR10-2018-0165439 2018-12-19
KR10-2019-0165874 2019-12-12
KR1020190165874A KR20200076604A (ko) 2018-12-19 2019-12-12 인간 gpatch4 단백질 유래 세포막 투과 도메인

Publications (1)

Publication Number Publication Date
WO2020130548A1 true WO2020130548A1 (ko) 2020-06-25

Family

ID=71101338

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2019/017830 Ceased WO2020130548A1 (ko) 2018-12-19 2019-12-16 인간 쥐피에이티씨에치4 단백질 유래 세포막 투과 도메인

Country Status (1)

Country Link
WO (1) WO2020130548A1 (ko)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014086835A1 (en) * 2012-12-05 2014-06-12 Ruprecht-Karls-Universität Heidelberg Conjugates of proteins and multivalent cell-penetrating peptides and their uses
KR101475744B1 (ko) * 2013-03-08 2014-12-24 서울대학교산학협력단 세포 투과 펩타이드
KR101669203B1 (ko) * 2014-06-18 2016-10-25 한국과학기술연구원 신규 세포투과성 펩타이드 및 이의 용도
KR20170128516A (ko) * 2015-03-16 2017-11-22 아말 테라퓨틱스 에스에이 세포 투과 펩타이드, 카르고 및 tlr 펩타이드 작용제를 포함하는 신규 복합체

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014086835A1 (en) * 2012-12-05 2014-06-12 Ruprecht-Karls-Universität Heidelberg Conjugates of proteins and multivalent cell-penetrating peptides and their uses
KR101475744B1 (ko) * 2013-03-08 2014-12-24 서울대학교산학협력단 세포 투과 펩타이드
KR101669203B1 (ko) * 2014-06-18 2016-10-25 한국과학기술연구원 신규 세포투과성 펩타이드 및 이의 용도
KR20170128516A (ko) * 2015-03-16 2017-11-22 아말 테라퓨틱스 에스에이 세포 투과 펩타이드, 카르고 및 tlr 펩타이드 작용제를 포함하는 신규 복합체

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
DATABASE NCBI 19 January 2018 (2018-01-19), ANONYMOUS: "VGPATCH4 isoform 1 [Pan troglodytes", XP055720639, retrieved from Protein Database accession no. PNI30224.1 *

Similar Documents

Publication Publication Date Title
AU2016258423B8 (en) Production method for exosome comprising cargo protein, and method for transferring cargo protein into cytoplasm by using exosome produced by means of the production method
Ford et al. Protein transduction: an alternative to genetic intervention?
JP2022078262A (ja) 細胞透過性ペプチド、それを含んだコンジュゲート、及びそれを含んだ組成物
EP1966240B3 (en) Lactoferrin peptides useful as cell-penetrating peptides
CN106255699A (zh) 细胞穿透肽和使用其输送生物活性物质的方法
AU2019306821B2 (en) Solubilized apyrases, methods and use
WO2016036060A1 (ko) 신규 세포막 투과 펩티드 및 생리활성 물질 전달체로서의 그의 용도
EP4124621B1 (en) Carrier peptide fragment for nucleolar localization and use thereof
EP3088415A1 (en) Method for inducing differentiation of pluripotent stem cells into endodermal cells
US12202876B2 (en) Transmembrane domain derived from human LRRC24 protein
CN116284321B (zh) 一种细胞穿透肽及其应用
KR101444199B1 (ko) 세포막 투과용 단백질 및 그 용도
WO2020130546A1 (ko) 인간 씨엘케이2 단백질 유래 세포막 투과 도메인
WO2020130547A1 (ko) 인간 엘알알씨24 단백질 유래 세포막 투과 도메인
KR102282692B1 (ko) 인간 clk2 단백질 유래 세포막 투과 도메인
KR20200076604A (ko) 인간 gpatch4 단백질 유래 세포막 투과 도메인
KR20140046994A (ko) 인간 NLBP 유래의 NP2 폴리펩티드 또는 dNP2 폴리펩티드를 포함하는 세포 투과 펩티드 및 이를 이용한 카고 전달 시스템
KR20090122769A (ko) 세포내로 단백질을 전달하는 방법 및 이를 위한 펩타이드
WO2002085305A2 (en) Compositions and methods for inducing cancer cell death
KR101444197B1 (ko) 세포막 투과용 단백질 및 그 용도
US20250099534A1 (en) Ubiquitin high affinity cyclic peptides and methods of use thereof
CN105555796A (zh) 抑制肽对治疗炎性疾病的用途
KR20260012341A (ko) 퓨로마이신 아세틸트랜스퍼라제 도메인 및 tat 도메인을 포함하는 융합 단백질
WO2024228598A1 (ko) Lag3 결합 펩타이드를 융합한 페리틴 나노케이지 및 이의 항암면역치료제로서의 용도
HK40013352A (en) Cytoplasmic transduction peptide and intracellular messenger comprising same

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 19900864

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 19900864

Country of ref document: EP

Kind code of ref document: A1