WO2020130547A1 - Transmembrane domain derived from human lrrc24 protein - Google Patents

Transmembrane domain derived from human lrrc24 protein Download PDF

Info

Publication number
WO2020130547A1
WO2020130547A1 PCT/KR2019/017829 KR2019017829W WO2020130547A1 WO 2020130547 A1 WO2020130547 A1 WO 2020130547A1 KR 2019017829 W KR2019017829 W KR 2019017829W WO 2020130547 A1 WO2020130547 A1 WO 2020130547A1
Authority
WO
WIPO (PCT)
Prior art keywords
protein
peptide
cargo
lrrc24p
cell
Prior art date
Application number
PCT/KR2019/017829
Other languages
French (fr)
Korean (ko)
Inventor
김성준
김균도
황인수
구근본
김천생
김범태
안대균
김해수
권영찬
Original Assignee
한국화학연구원
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from KR1020190144779A external-priority patent/KR102351041B1/en
Application filed by 한국화학연구원 filed Critical 한국화학연구원
Priority to CN201980079173.8A priority Critical patent/CN113166216A/en
Priority to SG11202105169WA priority patent/SG11202105169WA/en
Priority to EP19898351.2A priority patent/EP3875113A4/en
Priority to CA3122428A priority patent/CA3122428A1/en
Priority to AU2019403533A priority patent/AU2019403533A1/en
Priority to US17/296,622 priority patent/US20220306718A1/en
Priority to JP2021531077A priority patent/JP7193633B2/en
Priority to BR112021012019A priority patent/BR112021012019A2/en
Publication of WO2020130547A1 publication Critical patent/WO2020130547A1/en
Priority to PH12021551150A priority patent/PH12021551150A1/en

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/04—Peptides having up to 20 amino acids in a fully defined sequence; Derivatives thereof
    • A61K38/08—Peptides having 5 to 11 amino acids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/385—Haptens or antigens, bound to carriers
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals

Definitions

  • the present invention relates to a cell membrane permeation domain derived from human LRRC24 protein and an intracellular delivery system comprising the same.
  • Biopharmaceuticals include therapeutic proteins, antibodies, vaccines for prevention or treatment, gene therapy, and cell therapy.
  • recombinant protein drugs are drugs that are produced in large quantities using gene recombination technology for therapeutic proteins that are difficult to produce through a living body. Growth hormone, erythropoietin, interferon, colony stimulating factor (CSF), and blood coagulation factor (Recombinant human insulin) for the treatment of diabetes in the early 1980s were first approved by the U.S. FDA.
  • a representative method is a protein transduction domain (PTD) or cell permeation peptide.
  • PTD protein transduction domain
  • CPP Cell Penetrating Peptides
  • MPG GLFLGFLGAAGSTMGAWSQPKKKRKV
  • bovine prion protein-derived BPrPr MVKSKIGSWILVLFVAMWSDVGLCKKRP
  • human Hph-1 protein-derived Hph-1 YARVRRRGPRR
  • human NLBP protein-derived NP2 KIKKVKKKGRK
  • TAT-JBD20 cell-penetrating peptides are developed for the treatment of cerebral vascular disease (Cerebral ischemia) and degenerative brain disease (Alzheimer's disease) using TAT-JBD20, the treatment of amyotrophic lateral sclerosis using TAT-BH4, MPG-8/siRNA and TAT -Preclinical experiments such as cancer treatments using DRBD/siRNA are in progress.
  • TAT- ⁇ PKC inhibitor a treatment for hearing loss and inflammation using TAT-JBD20
  • a treatment for brain tumor using p28 are in clinical trials.
  • cell permeation peptides having high permeation efficiency among human derived peptides, human LRRC24 (Leucine rich repeat containing) 24)
  • human LRRC24 Leucine rich repeat containing 24
  • the protein-derived cell-penetrating peptide was invented, and similarity to the existing cell-penetrating peptides was confirmed for peptides present in human-derived proteins, thereby completing the present invention.
  • 6.dNP2 is a blood-brain barrier-permeable peptide enabling ctCTLA-4 protein delivery to ameliorate experimental autoimmune encephalomyelitis. Nat Commun. 8244 (2015), pp. 1-13
  • An object of the present invention is to provide a novel cell membrane permeation domain that exhibits high cell permeation efficiency and can minimize side effects.
  • Another object of the present invention is to provide an intracellular delivery system including a cell membrane permeation domain to which a cargo of an intracellular transport target is bound to the end of a peptide.
  • Another object of the present invention is to provide a method for transporting a cargo into a cell, the method comprising contacting a cell membrane permeation domain to which a cell of the intracellular transport target is bound to the cell at the end of the peptide.
  • the present invention is to provide a cell membrane permeation domain comprising a polypeptide of any one of SEQ ID NOs: 1 to 22 derived from human LRRC24 (Leucine rich repeat containing 24) protein.
  • cell penetrating peptide refers to a peptide having the ability to transport the cargo (Cargo) of the transport target into the cell in vitro and / or non-compensation, the term “cell membrane Transmission domain”.
  • the term'peptide' or'peptide' means a polymer in the form of a chain formed by combining 4 to 1000 amino acid residues by a peptide or peptide bond, and mixed with'polypeptide' or'polypeptide' It is possible.
  • the present invention in order to minimize the side effects that occur when the cargo material is delivered through the cell permeation peptide into the human body, unlike the cell permeation peptide derived from a virus or other species, it is a peptide existing in a human-derived protein.
  • a novel human-derived cell membrane permeation domain or cell permeation peptide capable of minimizing side effects when treated to the human body and having a very high delivery efficiency into cells.
  • the present invention provides a recombinant cargo cell membrane permeability improved, comprising a cell fused to the N- or C-terminal of the cell membrane permeation domain and the cell membrane permeation domain.
  • the cargo may be a recombinant cargo that is a protein, nucleic acid, lipid, or compound.
  • the cargo may be an adjuvant or antigen.
  • the cargo is a hormone, an immunoglobulin, an antibody, a structural protein, a signaling peptide, a storage peptide, a membrane peptide, a transmembrane peptide, an inner peptide, an outer peptide, a secretory peptide, a viral peptide, a native (native) It may be a peptide, a glycosylated protein, a fragmented protein, a disulfide peptide, a recombinant protein, a chemically modified protein, and a recombinant cargo that is any one selected from the group of prions.
  • the term'recombinant cargo means a complex formed by recombination of cell membrane permeation domains and one or more cargoes by genetic fusion or chemical bonding.
  • the term'contact' means that the cargo is in contact with eukaryotic or prokaryotic cells, and the cargo is transferred into the eukaryotic or prokaryotic cells.
  • the cargo may be any one of a recombinant cargo selected from the group consisting of nucleic acids, coding nucleic acid sequences, mRNA, antisense RNA molecules, carbohydrates, lipids, and glycolipids.
  • the cargo may be a recombinant cargo that is a contrast agent, drug, or chemical.
  • the term “contrast material” refers to all materials used for imaging biological structures or fluids in medical imaging.
  • the contrast material may include, but is not limited to, radiopaque contrast material, paramagnetic contrast material, superparamagnetic contrast material, CT contrast material, or other contrast material.
  • it may include radiopaque metals and salts thereof (e.g., silver, platinum, platinum, etc.) and other radiopaque chemicals (e.g., calcium salts, barium salts such as barium sulfate, tantalum and tantalum oxide). have.
  • Paramagnetic contrast materials include gadolinium proliferatives, MR imaging, and other gadolinium, manganese, iron, dysprosium, copper europium, erbium, chromium, Nickel and cobalt complex hydroxybenzylethylene diamine diacetic acid (HBED).
  • the superparamagnetic contrast material may include magnetite, superparamagnetic iron oxide, ultrafine, superparamagnetic iron oxide, and monocrystalline iron oxide.
  • Other suitable contrast materials may include iodized and non-iodinated, ionic and nonionic CR compositions, and contrast materials such as spin-labels, or other diagnostic actives. When expressed in a cell, it may include a marker gene encoding an easily detectable protein.
  • Various labels such as radionuclides, fluorescent substances, enzyme cofactors, and enzyme inhibitors can be used.
  • the cargo according to the present invention is a protein or a peptide
  • the transport peptide and the transport peptide form a fusion protein form a fusion protein form You can combine objects.
  • a specific example of binding by a fusion protein is as follows: When preparing a primer for producing a fusion protein, a nucleotide encoding a transport peptide is attached to a nucleotide expressing a moving target, and then the obtained nucleotide is vectored as a restriction enzyme. (Example: PET vector), and BL-21 (DE3) is introduced into cells and expressed.
  • the carrier peptide is a dye or fluorescent substance, specifically fluorescein ithiosia Nate (FITC, fluorescein isothiocyanate), luciferase (Luc), green fluorescent protein (GFP), enhanced green fluorescent protein (EGFP), Tag GFP, Superfolder GFP, PA GFP , AcGFP, PS-GFP2, Yellow fluorescent protein (YFP), enhanced yellow fluorescent protein (EYFP), SYFP, TagYFP, PhiYFP, Azurite, mKalamal, blue fluorescent protein (Cyan fluorescent protein, CFP), enhanced Cyan fluorescent protein (ECFP), TagCFP, PS-CFP2, Red fluorescent protein (RFP), Tag RFP, Tag RFP657, mRFP1, PaTagRFP, Turbo RFP, RFP693, tdRFP ,
  • FITC fluorescein ithiosia Nate
  • FITC fluorescein isothiocyanate
  • Luc green fluorescent protein
  • GFP enhanced green fluorescent protein
  • the present invention provides a gene construct comprising a polynucleotide encoding the cell membrane permeation domain.
  • the present invention provides an expression vector for expressing a recombinant cargo protein having improved cell membrane permeability, including a gene construct.
  • the present invention also includes the step of administering to a subject a pharmaceutical composition comprising a conjugate with a bioactive peptide bound to the cell membrane permeation domain and a pharmaceutically acceptable carrier, cervical cancer, prostate cancer, ovarian cancer, and uterus. It is to provide a method of preventing or treating diseases such as endometrial cancer, uterine cancer, bladder cancer, esophageal cancer, head and neck cancer Wilms' tumor, soft tissue sarcoma, stomach cancer, pancreatic cancer, breast cancer, and bronchial cancer.
  • diseases such as endometrial cancer, uterine cancer, bladder cancer, esophageal cancer, head and neck cancer Wilms' tumor, soft tissue sarcoma, stomach cancer, pancreatic cancer, breast cancer, and bronchial cancer.
  • the pharmaceutical composition according to the present invention can be used in the form of an oral dosage form such as powder, granule, tablet, capsule, suspension, emulsion, syrup aerosol, external preparation, suppository, and sterile injectable solution, respectively, according to a conventional method. have.
  • Carriers, excipients and diluents that may be included in the composition include lactose, textrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl Cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil.
  • Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc. These solid preparations contain at least one excipient such as starch, calcium carbonate, sucrose or lactose, gelatin, etc. in the extract. Is prepared. Also, lubricants such as magnesium stearate and talc are used in addition to simple excipients. Liquid preparations for oral use include suspensions, intravenous solutions, emulsions, syrups, etc.
  • Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, and suppositories.
  • non-aqueous solvent suspension propyl glycol, polyethylene glycol, vegetable oil such as olive oil, and injectable ester such as ethyl oleate may be used.
  • injectable ester such as ethyl oleate
  • Witepsol Macrogol, Tween 61, cacao butter, laurin butter, and glycerogelatin may be used.
  • the preferred dosage of the composition of the present invention depends on the patient's condition and body weight, the degree of disease, the drug form, the route and duration of administration, but can be appropriately selected by those skilled in the art. However, for the desired effect, the composition of the present invention is administered at 0.0001 to 500 mg/kg per day, preferably 0.001 to 250 mg/kg per day. Administration may be administered once a day, or may be divided into several times. The above dosage does not limit the scope of the present invention in any way.
  • the cell permeation peptide of the present invention exhibits significantly improved permeation efficiency or cell permeability compared to conventional peptides, thereby allowing the carried cargo or biologically active molecule to be introduced into the cell, effectively maintaining activity, and significantly reducing cost. .
  • FIG. 1 shows a schematic diagram of a gene composite for making a gene composite expressing the LRRC24P-EGFP recombinant fusion protein.
  • FIG. 2 shows that a gene composite expressing a protein in which a human permeable peptide LRRC24P derived from LRRC24 protein and Enhanced Green Fluorescent Protein (EGFP) fusion protein are fused is observed through agarose gel electrophoresis.
  • EGFP Green Fluorescent Protein
  • Figure 3 shows that the result was confirmed by processing a restriction enzyme on the bound gene composite by inserting the LRRC24P-EGFP gene composite into the protein expression vector pET28a+.
  • FIG. 4 shows that the LRRC24P-EGFP-pET28a+ vector was transformed into Rosetta(DE3) receptor cells, followed by inducing protein production, followed by sonication, and observed through polyacrylamide gel electrophoresis.
  • Figure 5 shows that the LRRC24P-EGFP recombinant fusion protein produced using Rosetta (DE3) receptor cells was purified and observed through polyacrylamide gel electrophoresis.
  • FIG. 6 shows the comparison of cell permeation efficiency with a flow cytometer after treatment of a recombinant protein fused with EGFP and LRRC24P-EGFP recombinant protein to a human T immune cell line (Jurkat).
  • FIG. 7 shows the comparison of permeation efficiency in cells with a flow cytometer after processing the recombinant proteins fused with the cell permeation peptide by concentration.
  • FIG. 9 shows that the LRRC24P-EGFP recombinant protein was treated on the cervical cancer cell line (HeLa) and observed the distribution pattern of the LRRC24P-EGFP recombinant protein permeated into the cell using a confocal microscope.
  • Figure 10 shows the results of confirming the efficiency of introduction into cells by flow cytometry (FACS) after processing the intracellular delivery efficiency of the LRRC24P mutant-EGFP fusion protein of the present invention to a human T immune cell line (Jurkat).
  • FACS flow cytometry
  • the present invention provides a cell membrane permeation domain or cell permeation peptide comprising the polypeptide of any one of SEQ ID NOs: 1-22 derived from human LRRC24 (Leucine rich repeat containing 24) protein.
  • the cell penetrating peptide represented by SEQ ID NO: 1 is a cell penetrating peptide of LRRC24P consisting of the 427th to 436th amino acid sequences in human LRRC24 protein, and the amino acid and nucleotide sequence information used for the invention are as follows.
  • LRRC24P-EGFP fusion protein (253 amino acid) nucleotide sequence information expressing an EGFP fluorescent protein (Enhanced Green fluorescent protein) linked to the base sequence expressing the LRRC24P peptide is the same as nucleotide sequence 25, SEQ ID NO: 26
  • the LRRC24P cell penetrating peptide is 10 amino acids, hydrophilic and has a positive charge.
  • the cell permeation peptides or cell membrane permeation domains represented by SEQ ID NOs: 2 to 22 of the present invention are mutated cell permeation peptides of the LRRC24P cell permeation peptide, and LRRC24P, which replaces the ninth amino acid alanine of the LRRC24P with another amino acid. It is a LRRC24P mutant cell membrane domain or cell permeation peptide that has deleted mutant and N- and C-terminal amino acids one by one.
  • the cell membrane permeation domain or cell permeation peptide derived from the human LRRC24 protein of the present invention is shown in Table 1 below.
  • Table 1 Cell membrane permeation domains or cell permeation peptides derived from human LRRC24 protein
  • Example 1 Construction of a plasmid vector expressing a protein in which a human LRRC24 protein-derived cell permeation peptide (LRRC24P) and an EGFP fluorescent protein are fused
  • LRRC24P human LRRC24 protein-derived cell permeation peptide
  • the LRRC24P base sequence was converted to a base sequence expressing the same peptide through codon optimization during artificial gene synthesis, and was synthesized by attaching a gene expressing EGFP fluorescent protein after the base sequence of the LRRC24P cell penetration peptide to verify cell permeability (FIG. 2).
  • linker sequencing was added between the cell-penetrating peptide and the EGFP protein to increase flexibility.
  • the artificial synthetic gene was introduced into the pET28a+ plasmid vector treated with NheI restriction enzyme and XhoI restriction enzyme through T4 ligase after treatment with NheI restriction enzyme and XhoI restriction enzyme.
  • the pET-28a plasmid vector used herein expresses six histidines (6 x His) at the N-terminus in front of the LRRC24P-EGFP fusion protein, allowing protein purification through Ni-NTA Resin.
  • the pET28a+ plasmid vector into which the LRRC24P-EGFP fusion protein artificial gene has been introduced is transformed into Top10 recipient cells and cultured in LB agar plates containing Kanamycin to incubate the grown colonies in LB medium for about 16 hours.
  • Example 2 Human LRRC24 protein-derived cell permeation peptide (LRRC24P) and EGFP fluorescence protein fused protein expression conditions established and high purity purification
  • LRRC24P cell-penetrating peptide derived from human LRRC24 protein and EGFP fluorescence protein are fused
  • the plasmid vector prepared in Example 1 was transformed into Rosetta (DE3) recipient cells, and then cultured for about 16 hours in LB medium containing Kanamycin. Here, 100 times more LB medium was added and cultured until an OD value of 0.4-0.6 was reached, followed by addition of IPTG (Isopropyl ⁇ to a final concentration of 1 mM), followed by incubation at 37°C for 5 hours or at 20°C for 16 hours.
  • IPTG Isopropyl ⁇ to a final concentration of 1 mM
  • the LRRC24P-EGFP fusion protein increased the water solubility and expression efficiency of the protein under the condition of incubating at 20°C for 16 hours after adding IPTG. Therefore, in order to purify the high-purity LRRC24P-EGFP fusion protein, the transformed Rosetta (DE3) recipient cells were cultured under the same conditions, and then the culture solution was centrifuged to obtain a cell pellet and lysis buffer (50 mM NaH 2 PO 4 , 300 mM). NaCl, 10 mM Imidazole).
  • the supernatant was recovered by centrifugation, filtered through a 45 ⁇ m filter, and the supernatant was passed through a Ni-NTA agarose column to bind the recombinant protein.
  • the Ni-NTA agarose column is washed with a washing buffer (50 mM NaH 2 PO 4 , 300 mM NaCl, 20 mM Imidazole) and then added to the Ni-NTA agarose column.
  • a washing buffer 50 mM NaH 2 PO 4 , 300 mM NaCl, 20 mM Imidazole
  • the recombinant protein was eluted using an elution buffer (50 mM NaH 2 PO 4 , 300 mM NaCl, 500 mM Imidazole). After the solution containing the LRRC24P-EGFP fusion protein was replaced with PBS using the PD-10 desalting column, it was confirmed by polyacrylamide gel electrophoresis and Coomassie blue staining (FIG. 5).
  • an elution buffer 50 mM NaH 2 PO 4 , 300 mM NaCl, 500 mM Imidazole.
  • CPP Cell penetrating peptide
  • TAT amino acid sequence: YGRKKRRQRRR, Diabetes 2001 Aug; 50(8): 1706-1713, Proteins
  • Hph-1 amino acid sequence: YARVRRRGPRR, Nature Medicine 12(5):574-9, June 2006, Intranasal delivery of the cytoplasmic domain of CTLA-4 using a novel protein transduction domain prevents allergic inflammation
  • NP2 amino acid sequence: KIKKVKKKGRK, Nature Communications volume 6, Article number: 8244 (2015), dNP2 is a blood-brain barrier-permeable peptide enabling ctCTLA-4 protein delivery to ameliorate experimental autoimmune encephalomyelitis
  • a plasmid vector expressing the protein fused to the EGFP fluorescent protein was produced in the same manner as the plasmi
  • CPP-EGFP fusion protein was also performed in the same way as the LRRC24P-EGFP fusion protein.
  • Jurkat cells were dispensed into 24 well plates at 1.5 X 10 6 / well, and then suspended in 2 ml of RPMI 1640 medium containing 10% Fetal Bovine Serum and 1% penicillin/streptomycin to finalize the concentration of CPP-EGFP fusion protein. After treatment with 5 ⁇ M, the cells were cultured in a 5% CO 2 incubator maintained at 37° C. for 2 hours. Thereafter, the medium containing the cells was transferred to a 5 ml tube, followed by centrifugation to remove the supernatant and washing three times with PBS solution.
  • a comparative experiment was conducted using EGFP and TAT-EGFP fusion proteins.
  • the EGFP, TAT-EGFP, and LRRC24P-EGFP fusion proteins were each treated with Jurkat cells at a final concentration of 5 ⁇ M and cultured for 0.5, 1, 2, 4, 6 hours, respectively, and the introduction efficiency was confirmed through the same procedure as in the previous experiment ( Fig. 8).
  • the LRRC24P-EGFP fusion protein was introduced into the cell in a time-dependent manner, and it was confirmed that it showed a significantly higher delivery efficiency at all times compared to the TAT-EGFP fusion protein.
  • HeLa cells are dispensed into a 24 well cell culture slide with 2 X 10 4 /well, and 10% Fetal Bovine Serum and 1% penicillin/streptomycin are included.
  • the cells were suspended in 500 ⁇ l of DMEM medium and cultured for 18 hours in a 5% CO 2 incubator maintained at 37°C. Thereafter, EGFP and LRRC24P-EGFP fusion proteins were treated with cells at a final concentration of 1 ⁇ M, respectively, and cultured for 1 hour. After this, the culture solution was removed, washed three times with PBS solution, and then treated with 4% PFA solution at room temperature for 30 minutes to fix it.
  • LRRC24P mutant (mutation) replacing alanine, the ninth amino acid of LRRC24P with another amino acid, and LRRC24P mutant that deleted each of N and C terminal amino acids one by one
  • a plasmid vector expressing the LRRC24 mutant-EGFP fusion protein was produced and then purified by expressing the protein.
  • cell experiments were performed with the peptides of the sequence names LRRC24P M1 to M8 (SEQ ID NOS: 2 to 7, or SEQ ID NOS: 21 and 28).
  • Jurkat cells were dispensed into a 24 well plate at 1.5 X 10 6 /well, and then suspended in 2 ml of RPMI 1640 medium containing 10% Fetal Bovine Serum and 1% penicillin/streptomycin, LRRC24P -EGFP and LRRC24P mutant-
  • the EGFP fusion protein was treated with a final concentration of 5 ⁇ M and incubated for 2 hours in a 5% CO 2 incubator maintained at 37°C. Thereafter, the medium containing the cells was transferred to a 5 ml tube, followed by centrifugation to remove the supernatant and washing three times with PBS solution.
  • the Jurkat cells were suspended in 650 ⁇ l of PBS, and then fluorescence of LRRC24P mutant-EGFP fusion proteins introduced into the cells was measured through a flow cytometer to confirm the efficiency of cell introduction (FIG. 10). Through this, it was confirmed that the LRRC24P mutants exhibited a change in introduction efficiency through mutation, but the cell permeation ability was maintained (FIG. 10 ).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Chemical & Material Sciences (AREA)
  • Public Health (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Immunology (AREA)
  • Epidemiology (AREA)
  • Mycology (AREA)
  • Microbiology (AREA)
  • Virology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Engineering & Computer Science (AREA)
  • Communicable Diseases (AREA)
  • Oncology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

The present invention relates to a transmembrane domain derived from human LRRC24 protein. More specifically, the present invention relates to a transmembrane domain derived from the human LRRC24 protein (LRRC24P transmembrane domain) or a cell-penetrating peptide, and an intracellular delivery system comprising same. The transmembrane domain derived from the human LRRC24 protein of the present invention can be used to deliver cargo materials such as compounds, biomolecules, and various polymer materials into cells. Since the LRRC24P transmembrane domain of the present invention exhibits higher cell penetration efficiency compared to conventional cell-penetrating peptides and is derived from human proteins, thus avoiding side effects and immune responses caused by peptides derived from foreign proteins, it can be usefully used as an effective intracellular delivery method for compounds, biomolecules, and various polymer materials applied to the human body.

Description

인간 엘알알씨24 단백질 유래 세포막 투과 도메인Cell membrane permeation domain derived from human LCC24 protein
본 발명은 인간 LRRC24 단백질 유래의 세포막 투과 도메인 및 이를 포함하는 세포내 전달 시스템에 관한 것이다. The present invention relates to a cell membrane permeation domain derived from human LRRC24 protein and an intracellular delivery system comprising the same.
질병을 치료하거나 증상을 완화하는 데 쓰이는 의약품은 크게 저분자 화합물 의약품과 고분자 바이오 의약품으로 구분되며 바이오 의약품에는 치료용 단백질, 항체, 예방 또는 치료를 위한 백신, 유전자 치료제 그리고 세포 치료제 등이 포함된다. 특히 재조합 단백질 의약품은 생체를 통한 생산이 힘든 치료용 단백질을 유전자 재조합 기술을 이용하여 대량 생산한 의약품이다. 1980년대 초에 당뇨병 치료를 위한 재조합 인간 인슐린(Recombinant human insulin)이 최초로 미국 FDA의 승인을 받은 후에 성장호르몬(Growth hormone), 에리스로포이에틴, 인터페론(Interferon), 콜로니자극인자(CSF), 혈액응고인자(Blood factors)등의 다양한 재조합 단백질 의약품이 출시되었다. 그러나 세포막을 통과하여 세포 내부에 들어가 활성을 나타내기가 비교적 용이한 저분자 화합물 의약품에 비하여 재조합 단백질이나 핵산 등을 포함한 대부분의 고분자 물질은 세포 내로의 전달이 매우 어려워 의약품으로의 효능이 나타나기에 큰 어려움이 있다. 따라서 고분자 물질의 세포 내 전달을 위해 전기 천공법(Electroporation), 미세주입법(Microinjection), 양이온성 지질 소포체(Cationic lipid vesicle), 바이러스 벡터(Viral vector), 바이러스 유사입자(Virus-like-particles)등을 이용한 방법들이 사용되거나 연구되어 왔다. 하지만 위와 같은 방법들은 생체에 직접 이용이 어렵거나 생체에서 분리한 세포에 전달 후 다시 생체로 주입해야 하는 어려움이 따르며 그에 따른 시간과 비용 증가가 크다는 어려움이 있다. 또한 생체 내에서 세포사멸 또는 면역반응 등을 유도하는 부작용을 일으키기도 하여 적용에 큰 한계를 가지고 있다.Medicines used to treat disease or relieve symptoms are largely divided into low-molecular-weight compound medicines and high-molecular biopharmaceuticals. Biopharmaceuticals include therapeutic proteins, antibodies, vaccines for prevention or treatment, gene therapy, and cell therapy. In particular, recombinant protein drugs are drugs that are produced in large quantities using gene recombination technology for therapeutic proteins that are difficult to produce through a living body. Growth hormone, erythropoietin, interferon, colony stimulating factor (CSF), and blood coagulation factor (Recombinant human insulin) for the treatment of diabetes in the early 1980s were first approved by the U.S. FDA. Various recombinant protein drugs, such as blood factors, have been released. However, most polymer materials including recombinant proteins or nucleic acids are very difficult to deliver into cells compared to low-molecular compound drugs that are relatively easy to enter the cell and show activity through the cell membrane. have. Therefore, electroporation, microinjection, cationic lipid vesicle, viral vector, virus-like-particles, etc. Methods using or have been studied. However, the above methods are difficult to directly use in a living body, or there is a difficulty in injecting a cell separated from a living body and then re-injecting it into a living body. In addition, it causes a side effect inducing apoptosis or an immune response in vivo, and thus has great limitations in application.
위와 같은 문제점들을 극복할 수 있는 새로운 약물 전달 기술(Drug delivery system) 및 고분자 바이오 의약품 개발을 위한 연구들이 활발히 진행되고 있으며 그 중 대표적인 방법이 바로 단백질전달도메인(Protein Transduction Domain, PTD) 또는 세포 투과 펩타이드(Cell Penetrating Peptides, CPP)로 알려진 전달체이다. 세포 투과 펩타이드는 HIV 바이러스의 TAT단백질 및 TAT단백질 내 존재하는 폴리펩타이드들(GRKKRRQRRRPPG, RKKRRQRRR, YGRKKRRQRRR)이 세포막을 통과하는 성질을 가진 것으로 최초로 밝혀진 후 초파리 유래의 Penetratin(RQIKIWFQNRRMKWKK), HIV glycoprotein 41 유래의 MPG(GALFLGFLGAAGSTMGAWSQPKKKRKV), 소의 프리온단백질 유래의 BPrPr(MVKSKIGSWILVLFVAMWSDVGLCKKRP), 인간 Hph-1단백질 유래의 Hph-1 (YARVRRRGPRR), 인간 NLBP 단백질 유래의 NP2(KIKKVKKKGRK)등의 새로운 세포 투과 펩타이드들이 개발되었다. 이 후 위와 같은 세포 투과 펩타이드를 이용한 연구들이 활발히 진행되고 있으며 이를 통해 DNA, siRNA, PNA(Peptide nucleic acid), 단백질, liposome nanoparticle과 같은 카고 물질들을 효과적으로 세포 내로 전달할 수 있다는 것이 밝혀졌다. Researches to develop new drug delivery systems and polymer biopharmaceuticals that can overcome the above problems are being actively conducted, and among them, a representative method is a protein transduction domain (PTD) or cell permeation peptide. (Cell Penetrating Peptides, CPP). The cell-penetrating peptide was first discovered to have the properties of the HIV virus' TAT protein and the polypeptides present in the TAT protein (GRKKRRQRRRPPG, RKKRRQRRR, YGRKKRRQRRR) to pass through the cell membrane. MPG (GALFLGFLGAAGSTMGAWSQPKKKRKV), bovine prion protein-derived BPrPr (MVKSKIGSWILVLFVAMWSDVGLCKKRP), human Hph-1 protein-derived Hph-1 (YARVRRRGPRR), and human NLBP protein-derived NP2 (KIKKVKKKGRK. Since then, studies using the cell-penetrating peptide as described above have been actively conducted, and through this, it has been found that cargo substances such as DNA, siRNA, peptide nucleic acid (PNA), protein, and liposome nanoparticles can be effectively delivered into cells.
선행 연구들을 통해 세포 투과 펩타이드가 직접 투과(Direct penetration) 를 통해 에너지 비의존적이며 낮은 온도에서도 고분자 물질을 세포 내로 전달 가능하다는 것이 밝혀졌으며 엔도사이토시스(Endocytosis) 통한 투과 또한 가능하다는 것이 밝혀졌다. Prior studies have shown that cell-penetrating peptides are energy-independent through direct penetration and that polymer materials can be delivered into cells even at low temperatures, and that they can also penetrate through endocytosis.
현재 세포 투과 펩타이드는 TAT-JBD20를 이용한 뇌혈관질환(Cerebral ischemia) 및 퇴행성 뇌질환(Alzheimer's disease) 치료제 개발, TAT-BH4를 이용한 루게릭병 (amyotrophic lateral sclerosis) 치료제 개발, MPG-8/siRNA 및 TAT-DRBD/siRNA 를 이용한 암치료제 등의 전임상 실험이 진행되고 있다. 또한 TAT-δPKC inhibitor 를 이용한 심근경색(Myocardial infarction) 치료제 개발, TAT-JBD20를 이용한 청력 손실 및 염증 치료제 개발, p28을 이용한 뇌종양 치료제 등이 임상 실험 중에 있다. Currently, cell-penetrating peptides are developed for the treatment of cerebral vascular disease (Cerebral ischemia) and degenerative brain disease (Alzheimer's disease) using TAT-JBD20, the treatment of amyotrophic lateral sclerosis using TAT-BH4, MPG-8/siRNA and TAT -Preclinical experiments such as cancer treatments using DRBD/siRNA are in progress. In addition, the development of a treatment for myocardial infarction using TAT-δPKC inhibitor, a treatment for hearing loss and inflammation using TAT-JBD20, and a treatment for brain tumor using p28 are in clinical trials.
위와 같이 세포 투과 펩타이드에 관한 연구 및 이를 이용한 여러 신약 후보 물질의 개발이 활발히 진행되고 있으나 극복해야 할 문제점들이 존재하며 이를 위해 세포 투과 효율을 개선하고 세포 투과 펩타이드 및 이와 결합된 카고 물질에 의한 생체 내 부작용과 의도치 않은 면역반응을 최소화 할 수 있는 새로운 세포 투과 펩타이드의 개발이 필요하다.As described above, research on cell-penetrating peptides and development of several new drug candidates using the same are actively progressing, but there are problems to be overcome, and for this, the cell-penetrating efficiency is improved, and the cell-penetrating peptides and cargo substances bound thereto are used in vivo. There is a need to develop new cell-penetrating peptides that can minimize side effects and unintended immune responses.
이에 기존 세포 투과 펩타이드가 바이러스와 초파리 등의 비인간 유래의 단백질에서 주로 발명되었거나 투과 효율이 낮은 단점을 극복하기 위하여, 인간 유래의 펩타이드 중 높은 투과 효율을 가지는 세포 투과 펩타이드, 인간 LRRC24(Leucine rich repeat containing 24) 단백질 유래 세포 투과 펩타이드를 발명하게 되었고, 인간 유래 단백질 내 존재하는 펩타이드를 대상으로 기존 세포 투과 펩타이드들과 유사성을 확인하였으며, 이를 통해 본 발명을 완성하였다. Therefore, in order to overcome the disadvantages of existing cell permeation peptides mainly from non-human proteins such as viruses and Drosophila or to overcome the low permeation efficiency, cell permeation peptides having high permeation efficiency among human derived peptides, human LRRC24 (Leucine rich repeat containing) 24) The protein-derived cell-penetrating peptide was invented, and similarity to the existing cell-penetrating peptides was confirmed for peptides present in human-derived proteins, thereby completing the present invention.
선행문헌으로 비특허 문헌, 1. Mutational analysis of a human immunodeficiency virus type 1 Tat protein transduction domain which is required for delivery of an exogenous protein into mammalian cells. J. Gen. Virol., 83 (2002), pp. 1173-1181Non-patent literature as prior literature, 1. Mutational analysis of a human immunodeficiency virus type 1 Tat protein transduction domain which is required for delivery of an exogenous protein into mammalian cells. J. Gen. Virol., 83 (2002), pp. 1173-1181
2. The third helix of the Antennapedia homeodomain translocates through biological membranes. J. Biol. Chem., 269 (1994), pp. 10444-104502.The third helix of the Antennapedia homeodomain translocates through biological membranes. J. Biol. Chem., 269 (1994), pp. 10444-10450
3. A new peptide vector for efficient delivery of oligonucleotides into mammalian cells. Nucleic Acids Res. 14 (1997) pp. 2730-2736.3.A new peptide vector for efficient delivery of oligonucleotides into mammalian cells. Nucleic Acids Res. 14 (1997) pp. 2730-2736.
4. N-terminal peptides from unprocessed prion proteins enter cells by macropinocytosis. Biochem. Biophys. Res. Commun., 348 (2006), pp. 379-3854.N-terminal peptides from unprocessed prion proteins enter cells by macropinocytosis. Biochem. Biophys. Res. Commun., 348 (2006), pp. 379-385
5. Intranasal delivery of the cytoplasmic domain of CTLA-4 using a novel protein transduction domain prevents allergic inflammation. Nat Med, 12 (2006), pp. 574-5795.Intranasal delivery of the cytoplasmic domain of CTLA-4 using a novel protein transduction domain prevents allergic inflammation. Nat Med, 12 (2006), pp. 574-579
6. dNP2 is a blood-brain barrier-permeable peptide enabling ctCTLA-4 protein delivery to ameliorate experimental autoimmune encephalomyelitis. Nat Commun. 8244 (2015), pp. 1-136.dNP2 is a blood-brain barrier-permeable peptide enabling ctCTLA-4 protein delivery to ameliorate experimental autoimmune encephalomyelitis. Nat Commun. 8244 (2015), pp. 1-13
을 참조하였다. Was referenced.
본 발명의 목적은 높은 세포 투과 효율을 나타내며 부작용을 최소화 할 수 있는 신규한 세포막 투과 도메인을 제공하는 데 있다. An object of the present invention is to provide a novel cell membrane permeation domain that exhibits high cell permeation efficiency and can minimize side effects.
본 발명의 다른 목적은 펩타이드의 말단에 세포내 운반 대상의 카고(cargo)가 결합되어 있는 세포막 투과 도메인을 포함하는 세포내 전달 시스템을 제공하는데 있다. Another object of the present invention is to provide an intracellular delivery system including a cell membrane permeation domain to which a cargo of an intracellular transport target is bound to the end of a peptide.
본 발명의 또 다른 목적은 펩타이드의 말단에 세포내 운반 대상의 카고(cargo)가 결합되어 있는 세포막 투과 도메인을 세포에 접촉시키는 단계를 포함하는 카고를 세포 내로 운반하는 방법을 제공하는 데 있다. Another object of the present invention is to provide a method for transporting a cargo into a cell, the method comprising contacting a cell membrane permeation domain to which a cell of the intracellular transport target is bound to the cell at the end of the peptide.
본 발명은 상기 목적을 달성하기 위하여, 인간 LRRC24(Leucine rich repeat containing 24) 단백질 유래 서열번호 1 내지 22 중 어느 하나의 폴리펩티드를 포함하는 세포막 투과 도메인을 제공하는 데 있다. In order to achieve the above object, the present invention is to provide a cell membrane permeation domain comprising a polypeptide of any one of SEQ ID NOs: 1 to 22 derived from human LRRC24 (Leucine rich repeat containing 24) protein.
본 발명에서 용어 “세포 투과 펩타이드(Cell penetrating peptide, CPP)”는 인 비트로 및/ 또는 인 비보상에서 운반 대상의 카고(Cargo)를 세포 내로 운반할 수 있는 능력을 가진 펩타이드를 의미하여, 용어 “세포막 투과 도메인”과 혼용된다. In the present invention, the term "cell penetrating peptide (Cell penetrating peptide, CPP)" refers to a peptide having the ability to transport the cargo (Cargo) of the transport target into the cell in vitro and / or non-compensation, the term "cell membrane Transmission domain”.
또한 본 발명에서 용어 ‘펩티드’또는 ‘펩타이드’는 펩티드 또는 펩타이드 결합에 의해 4개 내지 1000개의 아미노산 잔기들이 서로 결합되어 형성된 사슬 형태의 고분자를 의미하며, ‘폴리펩티드’ 또는 ‘폴리펩타이드’와 상호 혼용 가능한 의미이다. In addition, in the present invention, the term'peptide' or'peptide' means a polymer in the form of a chain formed by combining 4 to 1000 amino acid residues by a peptide or peptide bond, and mixed with'polypeptide' or'polypeptide' It is possible.
본 발명에서는 인체 내로 세포 투과 펩타이드를 통해 카고 물질 전달 시 생겨나는 부작용을 최소화 하기 위해 기존의 바이러스 또는 다른 종에서 유래된 세포 투과 펩타이드와 달리 인간 유래 단백질 내에 존재하는 펩타이드이기 때문에, 기존 세포 투과 펩타이드와 비교하여 세포내로 매우 높은 전달 효율을 가지며 인체에 처리시 부작용을 최소화 할 수 있는 신규 인간 유래 세포막 투과 도메인 또는 세포 투과 펩타이드를 제공한다. In the present invention, in order to minimize the side effects that occur when the cargo material is delivered through the cell permeation peptide into the human body, unlike the cell permeation peptide derived from a virus or other species, it is a peptide existing in a human-derived protein. In comparison, a novel human-derived cell membrane permeation domain or cell permeation peptide capable of minimizing side effects when treated to the human body and having a very high delivery efficiency into cells.
본 발명은 상기 세포막 투과 도메인 및 상기 세포막 투과 도메인의 N 말단 또는 C 말단에 융합된 카고를 포함하는 세포막 투과율이 향상된 재조합 카고를 제공한다. The present invention provides a recombinant cargo cell membrane permeability improved, comprising a cell fused to the N- or C-terminal of the cell membrane permeation domain and the cell membrane permeation domain.
상기 카고는 단백질, 핵산, 지질 또는 화합물인 재조합 카고 일 수 있다. 또한 상기 카고는 아주반트 또는 항원일 수 있다. The cargo may be a recombinant cargo that is a protein, nucleic acid, lipid, or compound. In addition, the cargo may be an adjuvant or antigen.
일 구현예에 따른면 상기 카고는 호르몬, 면역글로불린, 항체, 구조 단백질, 신호전달 펩타이드, 저장 펩타이드, 막 펩타이드, 막관통 펩타이드, 내부 펩타이드, 외부 펩타이드, 분비성 펩타이드, 바이러스 펩타이드, 천연(native)펩타이드, 당화 단백질, 단편화된 단백질, 디설파이트(Disulfide peptide), 재조합 단백질, 화학적으로 변형된 단백질 및 프리온 군으로부터 선택되는 어느 하나인 재조합 카고 일 수 있다. According to one embodiment, the cargo is a hormone, an immunoglobulin, an antibody, a structural protein, a signaling peptide, a storage peptide, a membrane peptide, a transmembrane peptide, an inner peptide, an outer peptide, a secretory peptide, a viral peptide, a native (native) It may be a peptide, a glycosylated protein, a fragmented protein, a disulfide peptide, a recombinant protein, a chemically modified protein, and a recombinant cargo that is any one selected from the group of prions.
또한 본 발명에서 용어 ‘ 재조합 카고’란 세포막 투과 도메인 및 한 개이상의 카고가 유전적 융합이나 화학결합에 의해 재조합되어 형성된 복합체를 의미한다. In the present invention, the term'recombinant cargo' means a complex formed by recombination of cell membrane permeation domains and one or more cargoes by genetic fusion or chemical bonding.
또한 본 발명에서 용어 ‘접촉’ 이란 카고가 진핵 또는 원핵세포와 접하는 것을 의미하며, 이러한 접촉에 의하여 상기 카고가 상기 진핵 또는 원핵 세포의 내로 전달된다. In the present invention, the term'contact' means that the cargo is in contact with eukaryotic or prokaryotic cells, and the cargo is transferred into the eukaryotic or prokaryotic cells.
또한 본 발명에서 단백질, 펩티드 등을 세포 내로 도입 시키는 것에 대하여 운반, 침투, 수송, 전달 또는 통과 한다는 표현들과 상호 혼용 한다. In addition, in the present invention, it is used interchangeably with expressions that convey, infiltrate, transport, deliver, or pass for introducing proteins, peptides, etc. into cells.
또한 일 구현예에 따르면 상기 카고는 핵산, 코딩 핵산 서열, mRNA, 안티센스 RNA 분자, 탄수화물, 지질 및 당지질로 이루어진 군으로부터 선택되는 어느 하나인 재조합 카고 일 수 있다. In addition, according to one embodiment, the cargo may be any one of a recombinant cargo selected from the group consisting of nucleic acids, coding nucleic acid sequences, mRNA, antisense RNA molecules, carbohydrates, lipids, and glycolipids.
또한 일 구현예에 따르면, 상기 카고는 조영물질, 약물 또는 화학물질인 재조합 카고 일 수 있다. In addition, according to one embodiment, the cargo may be a recombinant cargo that is a contrast agent, drug, or chemical.
본 발명에서 용어 ‘조영물질’은 의학적 영상 촬영(Imaging)에서 생체 구조 또는 유체의 조영을 위해 사용되는 모든 물질을 의미한다. 상기 조영물질은 방사선 비투과성 조영물질, 상자성 조영물질, 초상자성 조영물질, CT 조영물질 또는 기타 조영 물질을 포함할 수 있으나, 이에 한정되는 것은 아니다. 예를 들면 방사선비투과 금속 및 그의 염(예를 들면, 은, 금 백금 등) 및 기타 방사선비투과 화학물(예를 들면, 칼슘염, 황산바륨과 같은 바륨염, 탄탈룸 및 산화 탄탈룸)을 포함 할 수 있다. 상자성 조영물질(MR 영상용)은 가돌리늄 디엔틸렌 트리아민펜타아세트산 및 그의 유도체 및 기타 가돌리늄, 망간, 철, 디스프로시움(dysprosium), 구리 유로피움(europium), 에르비움(erbium), 크롬, 니켈 및 코발트 복합체 히드록시벤질에틸렌 디아민 디아세트산(HBED)을 포함할 수 있다. 초상자성 조영물질(MR 영상용)은 자철석(magentite), 초상자성 산화철, 초소, 초상자성 산화철 및 단결정성 산화철을 포함할 수 있다. 다른 적합한 조영물질은 요오드화 및 비요오드화, 이온성 및 비이온성 CR 조성물질, 및 스핀-표지(spin-label)와 같은 조영물질, 또는 기타 진단 활성제를 포함 할 수 있다. 세포에서 발현되는 경우, 용이하게 검출가능한 단백질을 코딩하는 마커 유전자를 포함할 수 있다. 방사선핵종, 형광물질, 효소보조인자, 효소 저해제 등과 같은 다양한 표지들이 이용될 수 있다.In the present invention, the term “contrast material” refers to all materials used for imaging biological structures or fluids in medical imaging. The contrast material may include, but is not limited to, radiopaque contrast material, paramagnetic contrast material, superparamagnetic contrast material, CT contrast material, or other contrast material. For example, it may include radiopaque metals and salts thereof (e.g., silver, platinum, platinum, etc.) and other radiopaque chemicals (e.g., calcium salts, barium salts such as barium sulfate, tantalum and tantalum oxide). have. Paramagnetic contrast materials (for MR imaging) include gadolinium dientylene triaminepentaacetic acid and its derivatives and other gadolinium, manganese, iron, dysprosium, copper europium, erbium, chromium, Nickel and cobalt complex hydroxybenzylethylene diamine diacetic acid (HBED). The superparamagnetic contrast material (for MR imaging) may include magnetite, superparamagnetic iron oxide, ultrafine, superparamagnetic iron oxide, and monocrystalline iron oxide. Other suitable contrast materials may include iodized and non-iodinated, ionic and nonionic CR compositions, and contrast materials such as spin-labels, or other diagnostic actives. When expressed in a cell, it may include a marker gene encoding an easily detectable protein. Various labels such as radionuclides, fluorescent substances, enzyme cofactors, and enzyme inhibitors can be used.
일 예로서, 본 발명에 따른 카고가 단백질 또는 펩티드인 경우, 이동 대상을 발현하는 DNA에 운반 펩티드를 발현하는 DNA를 결합시킨 후 이를 발현시킴으로써, 이동 대상과 펩티드의 융합 단백질 형태로 운반 펩티드와 이동 대상을 결합 시킬 수 있다. 융합 단백질에 의한 결합의 구체적인 예는 다음과 같다: 융합 단백질을 생산하기 위한 프라이머(primer) 제작시 이동 대상을 발현하는 뉴클레오티드 앞에 운반 펩티드를 코딩하는 뉴클레오티드를 붙인 다음, 수득한 뉴클레오티드를 제한 효소로 벡터(예: PET 벡터)에 삽입하고, BL-21(DE3)을 세포에 도입(transformation)하여 발현시킨다. 이때, IPTG(Isopropyl β-D-1-thiogalactopyranosid)와 같은 발현 유도제를 처리하여, 융합 단백질을 정제한 후 PBS를 처리하면, 상기 운반 펩티드는 염색 물질 또는 형광 물질, 구체적으로 플루오레세인 이오티오시아네이트(FITC, fluorescein isothiocyanate), 루시퍼라아제(Luciferase, Luc), 녹색형광단백질 (Green fluorescent protein, GFP), 증강된 녹색형광단백질(enhanced green fluorescent protein, EGFP), Tag GFP, Superfolder GFP, PA GFP, AcGFP, PS-GFP2, 노랑형광단백질(Yellow fluorescent protein, YFP), 증강된 노랑형광단백질 (enhanced Yellow fluorescent protein, EYFP), SYFP, TagYFP, PhiYFP, Azurite, mKalamal, 청색 형광 단백질 (Cyan fluorescent protein, CFP), 증강된 청색 형광 단백질 (enhanced Cyan fluorescent protein, ECFP), TagCFP, PS-CFP2, 빨강형광 단백질 (Red fluorescent protein, RFP), Tag RFP, Tag RFP657, mRFP1, PaTagRFP, Turbo RFP, RFP693, tdRFP, 파랑형광단백질(Blue fluorescent protein, BFP), mTag BFP, 노랑녹색형광단백질(Yellow-green fluorescent protein, mNeongreen), 밝은 형광단백질(Bright monomeric fluorescent protein, Scarlet-i), 엠플럼(mplum), 엠체리(monomeric cherry fluorescent protein, mcherry), PAmcherry, 엠스트로베리(monomeric strawberry fluorescent proteins, mStrawberry), 엠오렌지 (monomeric orange fluorescent protein, mOrange), PSmOrange, 엠라지베리 (mRasberry), 엠케이트(mKate), mKate2, 엠티에프피(monomeric teal fluorescent protein, mTFP), 엠넵튠(mNeptune), 엠루비(mRubby), mRubby2, 엠바나나(mBanana), 디에스레드(Discosoma sp, red fluorescent protein, DSRed), 엠시트린 (mCitrine), 에메랄드(Emerald), 티-사파이어(T-Sapphire), 엠에플(mApple), 엠그레이프(mgrape), 비너스(Venus), 토페즈(Topaz), 제이-레드(J-Red), 티디토마토 (tdTomato), mTurquoise, mTurquosie2, mKO, mKO2, mUKG. IFP1.4, mEos2, mEos4, mHoneydew, Dronpa, katushka, Ypet, CyPet, Clover, kaede , KikGR, mTangerine, Zsgreen, ZsYellow, 세루리안(Cerulean), 베타-갈락토시다아제 (Beta-galactosidase, LacZ), 베타-람타메이즈(β-lactamase, BLA), 베타-글루쿠로니데이즈(Beta-glucuronidase, GUS), 알카라인 포스파타아제, 클로람페니콜 아세틸트랜스퍼라아제 또는 퍼록시다아제(Peroxidase)와 결합할 수 있다. As an example, when the cargo according to the present invention is a protein or a peptide, by binding the DNA expressing the transport peptide to the DNA expressing the transport target and expressing it, the transport peptide and the transport peptide form a fusion protein form You can combine objects. A specific example of binding by a fusion protein is as follows: When preparing a primer for producing a fusion protein, a nucleotide encoding a transport peptide is attached to a nucleotide expressing a moving target, and then the obtained nucleotide is vectored as a restriction enzyme. (Example: PET vector), and BL-21 (DE3) is introduced into cells and expressed. At this time, by treating an expression inducer such as IPTG (Isopropyl β-D-1-thiogalactopyranosid), and then purifying the fusion protein, and then treating PBS, the carrier peptide is a dye or fluorescent substance, specifically fluorescein ithiosia Nate (FITC, fluorescein isothiocyanate), luciferase (Luc), green fluorescent protein (GFP), enhanced green fluorescent protein (EGFP), Tag GFP, Superfolder GFP, PA GFP , AcGFP, PS-GFP2, Yellow fluorescent protein (YFP), enhanced yellow fluorescent protein (EYFP), SYFP, TagYFP, PhiYFP, Azurite, mKalamal, blue fluorescent protein (Cyan fluorescent protein, CFP), enhanced Cyan fluorescent protein (ECFP), TagCFP, PS-CFP2, Red fluorescent protein (RFP), Tag RFP, Tag RFP657, mRFP1, PaTagRFP, Turbo RFP, RFP693, tdRFP , Blue fluorescent protein (BFP), mTag BFP, Yellow-green fluorescent protein (mNeongreen), Bright monomeric fluorescent protein (Scarlet-i), Emblem, Emblem Cherry (monomeric cherry fluorescent protein, mcherry), PAmcherry, monosonic strawberry (monomeric strawberry fluorescent proteins, mStrawberry), mOrange (monomeric orange fluorescent protein, mOrange), PSmOrange, mRasberry, mKate, mKate2, monomeric teal fluorescent protein (mTFP), mNeptune, M Ruby (mRubby), mRubby2, mBanana, Discosoma sp, red fluorescent protein (DSRed), mCitrine, Emerald, T-Sapphire, Mapple mApple, mgrape, Venus, Topaz, J-Red, tdTomato, mTurquoise, mTurquosie2, mKO, mKO2, mUKG. IFP1.4, mEos2, mEos4, mHoneydew, Dronpa, katushka, Ypet, CyPet, Clover, kaede, KikGR, mTangerine, Zsgreen, ZsYellow, Serulean, Beta-galactosidase, LacZ, Beta-lactamase (BLA), beta-glucuronidase (GUS), alkaline phosphatase, chloramphenicol acetyltransferase or peroxidase.
본 발명의 다른 양태에 따르면, 본 발명은 상기 세포막 투과 도메인을 코딩하는 폴리뉴클레오티드를 포함하는 유전자 컨스트럭트(Gene construct)를 제공한다. According to another aspect of the present invention, the present invention provides a gene construct comprising a polynucleotide encoding the cell membrane permeation domain.
또한 본 발명은 유전자 컨스트럭트를 포함하는, 세포막 투과율이 향상된 재조합 카고 단백질 발현용 발현 벡터를 제공한다. In addition, the present invention provides an expression vector for expressing a recombinant cargo protein having improved cell membrane permeability, including a gene construct.
본 발명은 또한, 상기 세포막 투과 도메인에 생리활성 펩타이드가 결합되어 있는 결합체 및 약학적으로 허용가능한 담체를 포함하는 약학 조성물을 개체에 투여하는 단계를 포함하는, 자궁경부암, 전립선암, 난소암, 자궁내막암, 자궁암, 방광암, 식도암, 두경부암 윌름즈종양, 연부조직육종, 위암, 췌장암, 유방암, 기관지암 등의 질환 예방 또는 치료 방법을 제공하는 데 있다. The present invention also includes the step of administering to a subject a pharmaceutical composition comprising a conjugate with a bioactive peptide bound to the cell membrane permeation domain and a pharmaceutically acceptable carrier, cervical cancer, prostate cancer, ovarian cancer, and uterus. It is to provide a method of preventing or treating diseases such as endometrial cancer, uterine cancer, bladder cancer, esophageal cancer, head and neck cancer Wilms' tumor, soft tissue sarcoma, stomach cancer, pancreatic cancer, breast cancer, and bronchial cancer.
본 발명에 따른 약학 조성물은 각각 통상의 방법에 따라 산제, 과립제, 정제, 캡슐제, 현탁액, 에멀젼, 시럽 에어로졸 등의 경구형 제형, 외용제, 좌제 및 멸균 주사용액의 형태로 제형화하여, 사용될 수 있다. 조성물에 포함될 수 있는 담체, 부형체 및 희석제로는 락토즈, 텍스트로즈, 수크로즈, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말티톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로즈, 미정질 셀룰로스, 폴리비닐 피롤리돈, 물, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 탈크, 마그네슘 스테아레이트 및 광물유를 들 수 있다. The pharmaceutical composition according to the present invention can be used in the form of an oral dosage form such as powder, granule, tablet, capsule, suspension, emulsion, syrup aerosol, external preparation, suppository, and sterile injectable solution, respectively, according to a conventional method. have. Carriers, excipients and diluents that may be included in the composition include lactose, textrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl Cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil.
제제화할 경우에는 보통 사용하는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제된다. 경구투여를 위한 고형제제에는 정제, 환제, 산제, 과립제, 캡슐제 등이 포함되며, 이러한 고형제제는 상기 추출물에 적어도 하나 이상의 부형제 예를 들면 전분, 칼슘카보네이트, 수크로스 또는 락토오스, 젤라틴 등을 섞어 조제된다. 또한 단순한 부형제 이외에 마그네슘 스테아레이트, 탈크 같은 윤활제들도 사용된다. 경구를 위한 액상 제제로는 현탁제, 내용액제, 유제, 시럽제 등이 해당되는데 흔히 사용되는 단순희석제인 물, 리퀴드 파라핀 이외에 여러가지 부형제, 예를 틀면 습윤제, 감미제, 방향제, 보존제 등이 포함될 수 있다. 비경구 투여를 위한 제제에는 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조 제제, 좌제가 포함된다. 비수성용제 현탁제로는 프로필레글리콜, 폴리에틸렌글리콜, 올리브 오일과 같은 식물성 기름, 에틸올에이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다. 좌제의 기제로는 위텝솔, 마크로골, 트윈61, 카카오지, 라우린지, 글리세로제라틴 등이 사용될 수 있다. In the case of formulation, it is prepared using diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrating agents and surfactants. Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc. These solid preparations contain at least one excipient such as starch, calcium carbonate, sucrose or lactose, gelatin, etc. in the extract. Is prepared. Also, lubricants such as magnesium stearate and talc are used in addition to simple excipients. Liquid preparations for oral use include suspensions, intravenous solutions, emulsions, syrups, etc. In addition to water and liquid paraffin, which are commonly used simple diluents, various excipients, such as wetting agents, sweeteners, fragrances, and preservatives, can be included. Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, and suppositories. As the non-aqueous solvent suspension, propyl glycol, polyethylene glycol, vegetable oil such as olive oil, and injectable ester such as ethyl oleate may be used. As a base for suppositories, Witepsol, Macrogol, Tween 61, cacao butter, laurin butter, and glycerogelatin may be used.
본 발명의 조성물의 바람직한 투여량은 환자의 상태 및 체중, 질병의 정도, 약물형태, 투여경로 및 기간에 따라 다르지만, 당업자에 의해 적절하게 선택될 수 있다. 그러나 바람직한 효과를 위해서 본 발명의 조성물은 1일 0.0001 내지 500mg/kg으로, 바람직하게는 0.001 내지 250mg/kg으로 투여하는 것이 좋다. 투여는 하루에 한번 투여할 수도 있고, 수회 나누어 투여할 수도 있다. 상기 투여량은 어떠한 면으로든 본 발명의 범위를 한정하는 것은 아니다. The preferred dosage of the composition of the present invention depends on the patient's condition and body weight, the degree of disease, the drug form, the route and duration of administration, but can be appropriately selected by those skilled in the art. However, for the desired effect, the composition of the present invention is administered at 0.0001 to 500 mg/kg per day, preferably 0.001 to 250 mg/kg per day. Administration may be administered once a day, or may be divided into several times. The above dosage does not limit the scope of the present invention in any way.
본 발명의 다른 양태에 따르면, 상기 세포막 투과 도메인의 N 말단 또는 C 말단에 카고가 융합된 재조합 카고를 제조하는 단계; 및 상기 제조된 재조합 카고를 분리된 세포와 접촉시키는 단계를 포함하는 세포 내로의 카고 전달 방법을 제공한다. According to another aspect of the present invention, the step of preparing a recombinant cargo fused to the N-terminal or C-terminal of the cell membrane permeation domain; And contacting the prepared recombinant cargo with isolated cells.
또한 본 발명의 다른 양태에 따르면, 상기 세포막 투과 도메인의 N 말단 또는 C 말단에 카고가 융합된 재조합 카고를 제조하는 단계; 및 상기 제조된 재조합 카고를 인간을 제외한 동물에게 투여하는 단계;를 포함하는 동물 내로의 카고 전달 방법을 제공한다. In addition, according to another aspect of the invention, the step of preparing a recombinant cargo fused to the N-terminal or C-terminal of the cell membrane permeation domain; And administering the prepared recombinant cargo to animals other than humans.
세포막 투과 도메인과 세포막의 접촉에서 특별하게 요구되는 조건, 예컨대, 제한적인 시간, 온도 및 농도 등의 조건은 없으며, 당업계에서 세포막 투과에 적용되는 일반적인 조건으로 실시 될 수 있다. There are no special requirements for the contact between the cell membrane permeation domain and the cell membrane, such as limited time, temperature, and concentration, and can be carried out as general conditions applied to cell membrane permeation in the art.
본 발명의 세포 투과 펩타이드는 기존 펩타이드와 비교하여 크게 향상된 투과 효율 또는 세포 투과능을 나타냄으로 운반된 카고 또는 생물학적 활성 분자를 세포 내로 도입시키고, 효과적으로 활성을 유지하도록 하고, 비용 또한 크게 절감시킬 수 있다. The cell permeation peptide of the present invention exhibits significantly improved permeation efficiency or cell permeability compared to conventional peptides, thereby allowing the carried cargo or biologically active molecule to be introduced into the cell, effectively maintaining activity, and significantly reducing cost. .
또한, 세포 투과 펩타이드 또는 세포막 투과 도메인을 통해 전달되는 카고 물질의 효과를 증대시킬 수 있다. In addition, it is possible to increase the effect of the cargo material delivered through the cell permeation peptide or cell membrane permeation domain.
또한, 인간 단백질 유래의 세포 투과 펩타이드이기 때문에 비인간 단백질 유래의 펩타이드들이 유발 하는 부작용을 최소화 할 수 있다. In addition, since it is a cell-penetrating peptide derived from human protein, side effects caused by peptides derived from non-human protein can be minimized.
다만, 본 발명의 효과는 상기에서 언급한 효과로 제한되지 아니하며, 언급되지 않는 또 다른 효과들은 하기의 기재로부터 당업자에게 명확히 이해될 수 있을 것이다. However, the effects of the present invention are not limited to the above-mentioned effects, and other effects not mentioned will be clearly understood by those skilled in the art from the following description.
도 1은 LRRC24P-EGFP 재조합 융합 단백질을 발현하는 유전자 합성물을 만들기 위한 유전자 합성물의 모식도를 나타낸 것이다. 1 shows a schematic diagram of a gene composite for making a gene composite expressing the LRRC24P-EGFP recombinant fusion protein.
도 2는 인간 LRRC24 단백질 유래의 세포 투과 펩타이드 LRRC24P와 Enhanced Green Fluorescent Protein(EGFP) 형광단백질이 융합된 단백질을 발현하는 유전자 합성물을 아가로스 겔 전기영동법을 통해 관찰한 것을 나타낸다. FIG. 2 shows that a gene composite expressing a protein in which a human permeable peptide LRRC24P derived from LRRC24 protein and Enhanced Green Fluorescent Protein (EGFP) fusion protein are fused is observed through agarose gel electrophoresis.
도 3은 단백질 발현 벡터 pET28a+ 에 LRRC24P-EGFP 유전자 합성물을 삽입하여 결합된 유전자 합성물에 제한 효소를 처리하여 그 결과를 확인한 것을 나타낸다. Figure 3 shows that the result was confirmed by processing a restriction enzyme on the bound gene composite by inserting the LRRC24P-EGFP gene composite into the protein expression vector pET28a+.
도 4는 LRRC24P-EGFP-pET28a+ 벡터를 Rosetta(DE3) 수용세포에 형질전환 후 단백질 생산을 유도하고 초음파 분해한 뒤에 폴리아크릴아마이드 겔 전기 영동법을 통해 관찰한 것을 나타낸다. FIG. 4 shows that the LRRC24P-EGFP-pET28a+ vector was transformed into Rosetta(DE3) receptor cells, followed by inducing protein production, followed by sonication, and observed through polyacrylamide gel electrophoresis.
도 5는 Rosetta(DE3) 수용세포를 이용해 생산한 LRRC24P-EGFP 재조합 융합 단백질을 정제하여 폴리아크릴아마이드 겔 전기 영동법을 통해 관찰한 것을 나타낸다. Figure 5 shows that the LRRC24P-EGFP recombinant fusion protein produced using Rosetta (DE3) receptor cells was purified and observed through polyacrylamide gel electrophoresis.
도 6은 기존의 세포 투과 펩타이드가 EGFP와 융합한 재조합 단백질과 LRRC24P-EGFP 재조합 단백질을 인간 T 면역 세포주(Jurkat) 에 처리한 후 유세포분석기로 세포 내 투과 효율을 비교한 것을 나타낸 것이다. FIG. 6 shows the comparison of cell permeation efficiency with a flow cytometer after treatment of a recombinant protein fused with EGFP and LRRC24P-EGFP recombinant protein to a human T immune cell line (Jurkat).
도 7은 세포 투과 펩타이드가 융합한 재조합 단백질들을 농도별로 처리한 후 유세포분석기로 세포 내 투과 효율을 비교한 것을 나타낸 것이다. FIG. 7 shows the comparison of permeation efficiency in cells with a flow cytometer after processing the recombinant proteins fused with the cell permeation peptide by concentration.
도 8은 세포 투과 펩타이드가 융합한 재조합 단백질들을 시간별로 처리한 후 유세포분석기로 세포 내 투과 효율을 비교한 결과를 나타낸 것이다. 8 shows the results of comparing the permeation efficiency in cells with a flow cytometer after processing the recombinant proteins fused with the cell permeation peptide by time.
도 9는 LRRC24P-EGFP 재조합 단백질을 자궁경부암 세포주(HeLa)에 처리한 후 공초점 현미경(Confocal Microscope)를 이용해 세포 내로 투과된 LRRC24P-EGFP 재조합 단백질의 분포 양상을 관찰한 것을 나타낸 것이다. FIG. 9 shows that the LRRC24P-EGFP recombinant protein was treated on the cervical cancer cell line (HeLa) and observed the distribution pattern of the LRRC24P-EGFP recombinant protein permeated into the cell using a confocal microscope.
도 10은 본 발명의 LRRC24P 변이(mutant)-EGFP 융합 단백질의 세포 내 전달 효율을 인간 T 면역 세포주(Jurkat)에 처리한 후 유세포분석기(FACS) 로 세포 내 도입 효율을 확인한 결과를 나타낸 것이다. Figure 10 shows the results of confirming the efficiency of introduction into cells by flow cytometry (FACS) after processing the intracellular delivery efficiency of the LRRC24P mutant-EGFP fusion protein of the present invention to a human T immune cell line (Jurkat).
본 명세서에서 달리 정의되어 있지 않는 한, 사용된 모든 기술 및 과학 용어는 당업계에 통상의 기술자가 통상적으로 이해하는 바와 같은 의미를 가진다. 본 명세서에 포함되는 용어를 포함하는 다양한 과학적 사건이 잘 알려져 있고, 당업계에서 이용 가능하다. Unless defined otherwise herein, all technical and scientific terms used have the meaning as commonly understood by one of ordinary skill in the art. Various scientific events, including the terms included herein, are well known and available in the art.
본 발명은 인간 LRRC24(Leucine rich repeat containing 24) 단백질 유래 서열번호 1 내지 22 중 어느 하나의 폴리펩티드를 포함하는 세포막 투과 도메인 또는 세포투과 펩타이드를 제공한다. The present invention provides a cell membrane permeation domain or cell permeation peptide comprising the polypeptide of any one of SEQ ID NOs: 1-22 derived from human LRRC24 (Leucine rich repeat containing 24) protein.
종래의 기존 세포 투과 펩타이드는 바이러스와 초파리 등의 비인간 유래의 단백질에서 주로 발명되었거나 투과 효율이 낮은 단점을 가지고 있다. 이를 극복하기 위하여, 본 발명자들은 인간 유래의 펩타이드 중 세포 투과성을 가질 것으로 예상되는 인간 LRRC24 단백질에서 427번째에서 436번째 아미노산서열로 이루어진 LRRC24P 펩타이드를 발견하였다. Conventional conventional cell permeation peptides are mainly invented from non-human proteins such as viruses and Drosophila, or have a disadvantage of low permeation efficiency. To overcome this, the present inventors have discovered a LRRC24P peptide consisting of the 427th to 436th amino acid sequences in the human LRRC24 protein, which is expected to have cell permeability among human-derived peptides.
상기 서열번호 1로 표시되는 세포투과 펩타이드는 인간 LRRC24 단백질에서 427번째에서 436번째 아미노산서열로 이루어진 LRRC24P의 세포 투과 펩타이드이며, 발명을 위해 사용된 아미노산 및 염기 서열 정보는 하기와 같다.The cell penetrating peptide represented by SEQ ID NO: 1 is a cell penetrating peptide of LRRC24P consisting of the 427th to 436th amino acid sequences in human LRRC24 protein, and the amino acid and nucleotide sequence information used for the invention are as follows.
1. LRRC24P 펩타이드 아미노산 서열(서열번호 1): RRRRRRKKAR1. LRRC24P peptide amino acid sequence (SEQ ID NO: 1): RRRRRRKKAR
2. LRRC24P 발현 유전자 염기서열(서열번호 23): cgccggcgccgcaggcgaaaaaaggcgcgg2. LRRC24P expression gene base sequence (SEQ ID NO: 23): cgccggcgccgcaggcgaaaaaaggcgcgg
3. LRRC24P 유전자 합성 염기서열(서열번호 24): cgccgccgtagaagacgtaaaaaggcaaga3. LRRC24P gene synthesis base sequence (SEQ ID NO: 24): cgccgccgtagaagacgtaaaaaggcaaga
유전자 합성시에는 코돈 최적화를 위해, 상기와 같이 전환하여 사용하였다. 세포 투과성을 검증하기 위하여 LRRC24P 펩타이드를 발현하는 염기 서열 뒤에 연결된 EGFP 형광단백질(Enhanced Green fluorescent protein)을 발현하는 LRRC24P-EGFP 융합단백질(253 아미노산) 염기 서열 정보는 염기서열 25와 같으며, 서열번호 26로 기재되는 실시예에서 사용한 LRRC24P 세포 투과 펩타이드 또는 세포막 투과 도메인과 EGFP 단백질 사이에 linker 부분의 염기서열은 ggaggtgggggctcg이다. 상기 LRRC24P 세포 투과 펩타이드는 10개이 아미노산이며, 친수성이며 양전하를 가진다. In the case of gene synthesis, it was converted and used as above for codon optimization. In order to verify cell permeability, LRRC24P-EGFP fusion protein (253 amino acid) nucleotide sequence information expressing an EGFP fluorescent protein (Enhanced Green fluorescent protein) linked to the base sequence expressing the LRRC24P peptide is the same as nucleotide sequence 25, SEQ ID NO: 26 The base sequence of the linker portion between the LRRC24P cell permeation peptide or cell membrane permeation domain and the EGFP protein used in the examples described as is ggaggtgggggctcg. The LRRC24P cell penetrating peptide is 10 amino acids, hydrophilic and has a positive charge.
본 발명의 서열번호 2 내지 22로 표시되는 세포 투과 펩타이드 또는 세포막 투과 도메인은 상기 LRRC24P 세포 투과 펩타이드의 변이(mutant)된 세포 투과 펩타이드로, 상기 LRRC24P의 9번째 아미노산인 알라닌을 다른 아미노산으로 치환한 LRRC24P 변이(mutant) 및 N 말단과 C 말단의 아미노산을 각각 하나씩 결실한 LRRC24P 변이(mutant) 된 세포막 도메인 또는 세포 투과 펩타이드이다. 본 발명의 인간 LRRC24 단백질 유래 세포막 투과 도메인 또는 세포 투과 펩타이드는 하기 표 1과 같다. The cell permeation peptides or cell membrane permeation domains represented by SEQ ID NOs: 2 to 22 of the present invention are mutated cell permeation peptides of the LRRC24P cell permeation peptide, and LRRC24P, which replaces the ninth amino acid alanine of the LRRC24P with another amino acid. It is a LRRC24P mutant cell membrane domain or cell permeation peptide that has deleted mutant and N- and C-terminal amino acids one by one. The cell membrane permeation domain or cell permeation peptide derived from the human LRRC24 protein of the present invention is shown in Table 1 below.
표 1:인간 LRRC24 단백질 유래 세포막 투과 도메인 또는 세포 투과 펩타이드Table 1: Cell membrane permeation domains or cell permeation peptides derived from human LRRC24 protein
서열번호Sequence number 서열명칭 Sequence name 서열(Sequence) Sequence
서열번호 1SEQ ID NO: 1 LRRC24P LRRC24P RRRRRRKKARRRRRRRKKAR
서열번호 2SEQ ID NO: 2 LRRC24P-M1LRRC24P-M1 RRRRRRKKSRRRRRRRKKSR
서열번호 3SEQ ID NO: 3 LRRC24P-M2LRRC24P-M2 RRRRRRKKVRRRRRRRKKVR
서열번호 4SEQ ID NO: 4 LRRC24P-M3LRRC24P-M3 RRRRRRKKYRRRRRRRKKYR
서열번호 5SEQ ID NO: 5 LRRC24P-M4LRRC24P-M4 RRRRRRKKERRRRRRRKKER
서열번호 6SEQ ID NO: 6 LRRC24P-M5LRRC24P-M5 RRRRRRKKQRRRRRRRKKQR
서열번호 7SEQ ID NO: 7 LRRC24P-M6LRRC24P-M6 RRRRRRKKRRRRRRRRKKRR
서열번호 8SEQ ID NO: 8 LRRC24P-MNLRRC24P-MN RRRRRRKKNRRRRRRRKKNR
서열번호 9SEQ ID NO: 9 LRRC24P-MDLRRC24P-MD RRRRRRKKDRRRRRRRKKDR
서열번호 10SEQ ID NO: 10 LRRC24P-MCLRRC24P-MC RRRRRRKKCRRRRRRRKKCR
서열번호 11SEQ ID NO: 11 LRRC24P-MGLRRC24P-MG RRRRRRKKGRRRRRRRKKGR
서열번호 12SEQ ID NO: 12 LRRC24P-MHLRRC24P-MH RRRRRRKKHRRRRRRRKKHR
서열번호 13SEQ ID NO: 13 LRRC24P-MILRRC24P-MI RRRRRRKKIRRRRRRRKKIR
서열번호 14SEQ ID NO: 14 LRRC24P-MLLRRC24P-ML RRRRRRKKLRRRRRRRKKLR
서열번호 15SEQ ID NO: 15 LRRC24P-MKLRRC24P-MK RRRRRRKKKRRRRRRRKKKR
서열번호 16SEQ ID NO: 16 LRRC24P-MMLRRC24P-MM RRRRRRKKMRRRRRRRKKMR
서열번호 17SEQ ID NO: 17 LRRC24P-MFLRRC24P-MF RRRRRRKKFRRRRRRRKKFR
서열번호 18SEQ ID NO: 18 LRRC24P-MPLRRC24P-MP RRRRRRKKPRRRRRRRKKPR
서열번호 19SEQ ID NO: 19 LRRC24P-MTLRRC24P-MT RRRRRRKKTRRRRRRRKKTR
서열번호 20SEQ ID NO: 20 LRRC24P-MWLRRC24P-MW RRRRRRKKWRRRRRRRKKWR
서열번호 21SEQ ID NO: 21 LRRC24P-M7LRRC24P-M7 RRRRRKKARRRRRRKKAR
서열번호 22SEQ ID NO: 22 LRRC24P-M8LRRC24P-M8 RRRRRRKKARRRRRRKKA
본 발명의 이점 및 특징, 그리고 그것들을 달성하는 방법은 상세하게 후술되어있는 실시예들을 참조하면 명확해질 것이다. 이하에서는 본 발명을 실시예에 의하여 더욱 상세히 설명한다. 단, 하기 실시예는 본 발명을 예시하는 것일 뿐 본 발명의 내용을 하기 실시예에 한정하는 것은 아니다.Advantages and features of the present invention, and methods for achieving them will be clarified with reference to embodiments described below in detail. Hereinafter, the present invention will be described in more detail by examples. However, the following examples are merely illustrative of the present invention, and the contents of the present invention are not limited to the following examples.
<실시예 1> 인간 LRRC24 단백질 유래의 세포 투과 펩타이드 (LRRC24P)와 EGFP 형광단백질이 융합된 단백질을 발현하는 플라스미드 벡터의 제작<Example 1> Construction of a plasmid vector expressing a protein in which a human LRRC24 protein-derived cell permeation peptide (LRRC24P) and an EGFP fluorescent protein are fused
LRRC24의 세포 투과 효율을 실험하기 위해 다음과 같이 인공유전자 합성을 진행하였다. 도 1과 같이 5'-NheI 제한효소 인식서열-LRRC24P 염기서열-Linker 염기서열-EGFP 단백질 염기서열-종결코돈-XhoI 제한효소 인식서열-3' 합성하였다. To test the cell permeation efficiency of LRRC24, artificial gene synthesis was performed as follows. 5'-NheI restriction enzyme recognition sequence-LRRC24P base sequence-Linker sequence-EGFP protein sequence-terminated codon-XhoI restriction enzyme recognition sequence-3' was synthesized as shown in FIG.
특히 LRRC24P 염기 서열은 인공유전자 합성시 코돈 최적화를 통해 동일한 펩타이드를 발현하는 염기 서열로 전환하였으며 세포 투과성을 검증하기 위하여 LRRC24P 세포 투과 펩타이드의 염기 서열 뒤에 EGFP 형광단백질을 발현하는 유전자를 붙여 합성하였다(도 2). 또한 세포 투과 펩타이드와 EGFP 단백질 사이에 linker 염기서열을 넣어 유연성을 높여주었다. 인공합성 유전자를 NheI 제한효소와 XhoI 제한효소를 처리 후 마찬가지로 NheI 제한효소와 XhoI 제한효소를 처리한 pET28a+ 플라즈미드 벡터에 T4 연결효소를 통해 도입하였다. 여기서 사용된 pET-28a 플라즈미드 벡터는 N-말단에 6개의 히스티딘(6 x His)을 LRRC24P-EGFP 융합단백질 앞에 발현하여 Ni-NTA Resin 통한 단백질 정제를 가능하게 한다. LRRC24P-EGFP 융합단백질 인공 유전자가 도입된 pET28a+ 플라즈미드 벡터는 Top10 수용세포에 형질전환 후 카나마이신(Kanamycin)이 포함된 LB agar plate에서 배양하여 자라난 콜로니(Colony) 들을 LB배지에서 약 16시간 배양한다. 이 후 DNA 추출 실험을 통해 플라즈미드를 얻고 이를 NheI 제한효소와 XhoI 제한효소로 처리한 후 아가로스 겔 전기영동법을 통해 LRRC24P-EGFP 융합단백질 인공 유전자가 pET-28a 플라즈미드 벡터에 성공적으로 도입된 것을 확인하였다(도 3). In particular, the LRRC24P base sequence was converted to a base sequence expressing the same peptide through codon optimization during artificial gene synthesis, and was synthesized by attaching a gene expressing EGFP fluorescent protein after the base sequence of the LRRC24P cell penetration peptide to verify cell permeability (FIG. 2). In addition, linker sequencing was added between the cell-penetrating peptide and the EGFP protein to increase flexibility. The artificial synthetic gene was introduced into the pET28a+ plasmid vector treated with NheI restriction enzyme and XhoI restriction enzyme through T4 ligase after treatment with NheI restriction enzyme and XhoI restriction enzyme. The pET-28a plasmid vector used herein expresses six histidines (6 x His) at the N-terminus in front of the LRRC24P-EGFP fusion protein, allowing protein purification through Ni-NTA Resin. The pET28a+ plasmid vector into which the LRRC24P-EGFP fusion protein artificial gene has been introduced is transformed into Top10 recipient cells and cultured in LB agar plates containing Kanamycin to incubate the grown colonies in LB medium for about 16 hours. Thereafter, a plasmid was obtained through a DNA extraction experiment, treated with NheI restriction enzyme and XhoI restriction enzyme, and confirmed that the LRRC24P-EGFP fusion protein artificial gene was successfully introduced into the pET-28a plasmid vector through agarose gel electrophoresis. (Figure 3).
<실시예 2> 인간 LRRC24 단백질 유래의 세포 투과 펩타이드 (LRRC24P) 와 EGFP 형광단백질이 융합된 단백질의 발현 조건 확립 및 고순도 정제<Example 2> Human LRRC24 protein-derived cell permeation peptide (LRRC24P) and EGFP fluorescence protein fused protein expression conditions established and high purity purification
인간 LRRC24 단백질 유래의 세포 투과 펩타이드(LRRC24P)와 EGFP 형광단백질이 융합된 단백질의 발현 조건 확립하기 위해 실시예 1에서 제작된 플라즈미드 벡터를 Rosetta(DE3) 수용세포에 형질전환 후에 카나마이신(Kanamycin) 이 포함된 LB 배지에서 약 16시간 배양한다. 여기에 다시 100배의 LB 배지를 추가하여 O.D값 0.4- 0.6에 도달할 때까지 배양한 후 IPTG(Isopropyl β를 최종 농도 1mM이 되도록 첨가한 뒤 37 ℃ 에서 5시간 또는 20 ℃ 에서 16 시간 배양한다. 이 후 원심 분리를 통해 얻은 세포를 초음파 분해(Sonication) 하여 다시 원심분리를 통해 상등액과 cell pellet으로 분리하여 이를 폴리아크릴아마이드 겔 전기 영동법과 Coomassie blue 염색을 통해 단백질의 발현된 양과 수용성을 확인하였다(도 4). To establish the expression conditions of a protein in which a cell-penetrating peptide (LRRC24P) derived from human LRRC24 protein and EGFP fluorescence protein are fused The plasmid vector prepared in Example 1 was transformed into Rosetta (DE3) recipient cells, and then cultured for about 16 hours in LB medium containing Kanamycin. Here, 100 times more LB medium was added and cultured until an OD value of 0.4-0.6 was reached, followed by addition of IPTG (Isopropyl β to a final concentration of 1 mM), followed by incubation at 37°C for 5 hours or at 20°C for 16 hours. Afterwards, the cells obtained through centrifugation were sonicated and again separated into supernatant and cell pellet through centrifugation to confirm the expressed amount and water solubility of proteins through polyacrylamide gel electrophoresis and Coomassie blue staining. (Figure 4).
이를 통해 LRRC24P-EGFP 융합단백질이 IPTG를 첨가 후 20 ℃ 에서 16시간 배양한 조건에서 단백질의 수용성 및 발현 효율이 높아짐을 확인하였다. 따라서 고순도의 LRRC24P-EGFP 융합단백질을 정제하기 위하여 같은 조건으로 형질 전환 된 Rosetta (DE3) 수용세포를 배양한 후 배양액을 원심 분리하여 cell pellet을 얻었으며 lysis buffer(50 mM NaH2PO4, 300 mM NaCl, 10 mM Imidazole)로 현탁하였다. 이를 초음파 분해하여 다시 원심분리를 통해 상등액을 회수하여 45μm 필터로 걸러준 후 Ni-NTA agarose column에 상등액을 통과시켜 재조합 단백질을 결합시켰다. Ni-NTA agarose column에 비특이적으로 결합한 단백질을 제거하기 위하여 washing buffer(50 mM NaH2PO4, 300 mM NaCl, 20 mM Imidazole)를 이용하여 Ni-NTA agarose column을 세척한 후 Ni-NTA agarose column에 결합한 재조합 단백질을 회수하기 위하여 elution buffer(50 mM NaH2PO4, 300 mM NaCl, 500 mM Imidazole)를 이용하여 재조합 단백질을 용출시켰다. PD-10 desalting column을 이용하여 LRRC24P-EGFP융합단백질이 포함된 용액을 PBS로 교체한 후 이를 폴리아크릴아마이드 겔 전기 영동법과 Coomassie blue 염색을 통해 확인하였다(도 5).Through this, it was confirmed that the LRRC24P-EGFP fusion protein increased the water solubility and expression efficiency of the protein under the condition of incubating at 20°C for 16 hours after adding IPTG. Therefore, in order to purify the high-purity LRRC24P-EGFP fusion protein, the transformed Rosetta (DE3) recipient cells were cultured under the same conditions, and then the culture solution was centrifuged to obtain a cell pellet and lysis buffer (50 mM NaH 2 PO 4 , 300 mM). NaCl, 10 mM Imidazole). After supernatant, the supernatant was recovered by centrifugation, filtered through a 45 μm filter, and the supernatant was passed through a Ni-NTA agarose column to bind the recombinant protein. In order to remove the protein that is non-specifically bound to the Ni-NTA agarose column, the Ni-NTA agarose column is washed with a washing buffer (50 mM NaH 2 PO 4 , 300 mM NaCl, 20 mM Imidazole) and then added to the Ni-NTA agarose column. To recover the bound recombinant protein, the recombinant protein was eluted using an elution buffer (50 mM NaH 2 PO 4 , 300 mM NaCl, 500 mM Imidazole). After the solution containing the LRRC24P-EGFP fusion protein was replaced with PBS using the PD-10 desalting column, it was confirmed by polyacrylamide gel electrophoresis and Coomassie blue staining (FIG. 5).
<실시예 3> LRRC24P-EGFP 융합 단백질의 세포 내 전달 효율 확인<Example 3> LRRC24P-EGFP fusion protein intracellular delivery efficiency confirmation
LRRC24P-EGFP 융합 단백질의 세포 내 전달 효율을 연구하기 위하여 기존에 알려져 있는 세포 투과 펩타이드(Cell penetrating peptide, CPP), TAT (아미노산 서열 : YGRKKRRQRRR, Diabetes 2001 Aug; 50(8): 1706-1713, Proteins Linked to a Protein Transduction Domain Efficiently Transduce Pancreatic Islets), Hph-1 (아미노산 서열: YARVRRRGPRR, Nature Medicine 12(5):574-9, June 2006, Intranasal delivery of the cytoplasmic domain of CTLA-4 using a novel protein transduction domain prevents allergic inflammation) 그리고 NP2(아미노산 서열: KIKKVKKKGRK, Nature Communications volume 6, Article number: 8244 (2015), dNP2 is a blood-brain barrier-permeable peptide enabling ctCTLA-4 protein delivery to ameliorate experimental autoimmune encephalomyelitis)에 각각 EGFP 형광단백질이 융합된 단백질을 발현하는 플라스미드 벡터를 LRRC24P-EGFP 융합 단백질을 발현하는 플라스미드 벡터와 동일한 방법으로 제작하였다. 기존의 CPP-EGFP 융합단백질의 발현 및 정제 또한 LRRC24P-EGFP 융합 단백질과 동일한 방법으로 진행하였다. 세포 실험을 위하여 Jurkat 세포를 1.5 X 106 / well로 24 well plate 에 분주한 후 10% Fetal Bovine Serum과 1% penicillin/streptomycin이 포함된 RPMI 1640 배지 2ml 에 부유시켜 CPP-EGFP 융합단백질을 최종 농도 5μM 로 처리 후 37°C로 유지되는 5% CO2 배양기에서 2시간 동안 배양하였다. 이 후 세포가 포함된 배지를 5 ml 튜브에 옮긴 후 원심분리하여 상등액을 제거하고 PBS 용액으로 세척하는 것을 3회 반복하였다. 이 후 Jurkat 세포를 650μl의 PBS 에 부유시킨 후 유세포분석기를 통해 세포 내로 도입된 CPP-EGFP 융합단백질들의 형광을 측정하여 세포 내 도입 효율을 확인하였다(도 6).이를 통해 LRRC24P 세포 투과 펩타이드가 기존의 세포 투과 펩타이드들과 비교하여 약 3-5배의 효율을 나타냄을 확인하였다(도 6). Cell penetrating peptide (CPP), TAT (amino acid sequence: YGRKKRRQRRR, Diabetes 2001 Aug; 50(8): 1706-1713, Proteins) known to study the efficiency of intracellular delivery of LRRC24P-EGFP fusion protein Linked to a Protein Transduction Domain Efficiently Transduce Pancreatic Islets), Hph-1 (amino acid sequence: YARVRRRGPRR, Nature Medicine 12(5):574-9, June 2006, Intranasal delivery of the cytoplasmic domain of CTLA-4 using a novel protein transduction domain prevents allergic inflammation) and NP2 (amino acid sequence: KIKKVKKKGRK, Nature Communications volume 6, Article number: 8244 (2015), dNP2 is a blood-brain barrier-permeable peptide enabling ctCTLA-4 protein delivery to ameliorate experimental autoimmune encephalomyelitis), respectively A plasmid vector expressing the protein fused to the EGFP fluorescent protein was produced in the same manner as the plasmid vector expressing the LRRC24P-EGFP fusion protein. Expression and purification of the existing CPP-EGFP fusion protein was also performed in the same way as the LRRC24P-EGFP fusion protein. For cell experiments, Jurkat cells were dispensed into 24 well plates at 1.5 X 10 6 / well, and then suspended in 2 ml of RPMI 1640 medium containing 10% Fetal Bovine Serum and 1% penicillin/streptomycin to finalize the concentration of CPP-EGFP fusion protein. After treatment with 5 μM, the cells were cultured in a 5% CO 2 incubator maintained at 37° C. for 2 hours. Thereafter, the medium containing the cells was transferred to a 5 ml tube, followed by centrifugation to remove the supernatant and washing three times with PBS solution. Thereafter, Jurkat cells were suspended in 650 μl of PBS, and then fluorescence of CPP-EGFP fusion proteins introduced into the cells was measured through a flow cytometer to confirm the efficiency of intracellular introduction (FIG. 6). Through this, the LRRC24P cell permeation peptide was existing. It was confirmed that it shows an efficiency of about 3-5 times compared to the cell permeation peptides of (Fig. 6).
표 2 : 실시예 3에서 이용된 재조합 단백질Table 2: Recombinant protein used in Example 3
실시예 3에서 이용된 재조합 단백질Recombinant protein used in Example 3
음성대조군Eumseong Control Wild type EGFPWild type EGFP
실험군Experimental group 실시예 2에서 정제한 재조합 LRRC24P의 융합 단백질, LRRC24P-EGFPRecombinant LRRC24P fusion protein purified in Example 2, LRRC24P-EGFP
양성대조군Positive control TAT-EGFPTAT-EGFP
(Hph-1)-EGFP(Hph-1)-EGFP
NP2 EGFPNP2 EGFP
LRRC24P-EGFP 융합단백질의 농도별 도입 효율을 확인하기 위하여 EGFP 단백질 그리고 현재 가장 폭넓게 사용 중인 세포 투과 펩타이드인 TAT 과 EGFP의 융합단백질을 이용하여 비교 실험을 진행하였다. EGFP, TAT-EGFP 그리고 LRRC24P-EGFP 융합단백질을 각각 최종 농도 0.5, 1, 2, 5, 10μM로 Jurkat 세포에 처리하였으며 앞선 실험과 동일한 과정을 통해 도입 효율을 확인하였다(도 7). 이를 통해 LRRC24P-EGFP 융합단백질이 농도의존적으로 세포 내로 도입됨을 확인하였으며 TAT-EGFP 융합단백질과 비교하여 모든 농도에서 월등히 높은 전달 효율을 보이는 것을 확인하였다. In order to confirm the introduction efficiency of each concentration of LRRC24P-EGFP fusion protein, a comparative experiment was conducted using the EGFP protein and the fusion protein of TAT and EGFP, the most widely used cell permeation peptides. EGFP, TAT-EGFP and LRRC24P-EGFP fusion proteins were treated in Jurkat cells at final concentrations of 0.5, 1, 2, 5, and 10 μM, respectively, and the introduction efficiency was confirmed through the same procedure as in the previous experiment (FIG. 7). Through this, it was confirmed that the LRRC24P-EGFP fusion protein was introduced into cells in a concentration-dependent manner, and it was confirmed that it showed a significantly higher delivery efficiency at all concentrations compared to the TAT-EGFP fusion protein.
다음으로 LRRC24P-EGFP 융합단백질의 시간 별 도입 효율을 확인하기 위하여 EGFP, TAT-EGFP 융합단백질을 이용하여 비교 실험을 진행하였다. EGFP, TAT-EGFP 그리고 LRRC24P-EGFP 융합단백질을 각각 최종 농도 5μM 로 Jurkat 세포에 처리한 후 각각 0.5, 1, 2, 4, 6시간 동안 배양하였으며 앞선 실험과 동일한 과정을 통해 도입 효율을 확인하였다(도 8). 이를 통해 LRRC24P-EGFP 융합단백질이 시간 의존적으로 세포 내로 도입됨을 확인하였으며 TAT-EGFP 융합단백질과 비교하여 모든 시간에서 월등히 높은 전달 효율을 보이는 것을 확인하였다.Next, in order to confirm the introduction efficiency of the LRRC24P-EGFP fusion protein by time, a comparative experiment was conducted using EGFP and TAT-EGFP fusion proteins. The EGFP, TAT-EGFP, and LRRC24P-EGFP fusion proteins were each treated with Jurkat cells at a final concentration of 5 μM and cultured for 0.5, 1, 2, 4, 6 hours, respectively, and the introduction efficiency was confirmed through the same procedure as in the previous experiment ( Fig. 8). Through this, it was confirmed that the LRRC24P-EGFP fusion protein was introduced into the cell in a time-dependent manner, and it was confirmed that it showed a significantly higher delivery efficiency at all times compared to the TAT-EGFP fusion protein.
<실시예 4> LRRC24P-EGFP 융합 단백질의 세포 내 전달 양상 확인<Example 4> LRRC24P-EGFP fusion protein intracellular delivery pattern confirmation
세포 내로 도입된 LRRC24P-EGFP 융합 단백질을 공초점현미경으로 확인하기 위하여 먼저 HeLa세포를 2 X 104/well로 24 well cell culture slide에 분주한 후 10% Fetal Bovine Serum 과 1% penicillin/streptomycin이 포함된 DMEM 배지 500μl 에 부유시켜 37°C로 유지되는 5% CO2 배양기에서 18 시간 배양하였다. 이 후 EGFP 그리고 LRRC24P-EGFP 융합단백질을 각각 최종 농도 1μM로 세포에 처리한 후 1 시간 동안 배양하였다. 이 후 배양액을 제거한 후 PBS 용액으로 3회 세척 후 4% PFA 용액을 상온에서 30분간 처리하여 고정하였다. PFA 용액을 제거한 후 다시 PBS 용액으로 3회 세척 한 뒤 mounting medium 을 처리하고 커버 슬라이드를 덮어 공초점현미경으로 관찰하였다(도 9). 이를 통해 LRRC24P-EGFP 융합단백질이 HeLa 세포 내로 효과적으로 도입되었음을 확인하였다.In order to confirm the LRRC24P-EGFP fusion protein introduced into the cell by confocal microscopy, first HeLa cells are dispensed into a 24 well cell culture slide with 2 X 10 4 /well, and 10% Fetal Bovine Serum and 1% penicillin/streptomycin are included. The cells were suspended in 500 μl of DMEM medium and cultured for 18 hours in a 5% CO 2 incubator maintained at 37°C. Thereafter, EGFP and LRRC24P-EGFP fusion proteins were treated with cells at a final concentration of 1 μM, respectively, and cultured for 1 hour. After this, the culture solution was removed, washed three times with PBS solution, and then treated with 4% PFA solution at room temperature for 30 minutes to fix it. After removing the PFA solution, washed again with PBS solution three times, treated with a mounting medium, covered with a cover slide, and observed with a confocal microscope (FIG. 9). Through this, it was confirmed that the LRRC24P-EGFP fusion protein was effectively introduced into HeLa cells.
<실시예 5> LRRC24P mutant-EGFP 융합 단백질의 세포 내 전달 효율 확인<Example 5> LRRC24P mutant-EGFP fusion protein intracellular delivery efficiency confirmation
LRRC24P 세포 투과 펩타이드 변이(mutant)의 세포 내 전달 효율을 확인하기 위하여 LRRC24P의 9번째 아미노산인 알라닌을 다른 아미노산으로 치환한 LRRC24P mutant(변이) 및 N 말단과 C 말단의 아미노산을 각각 하나씩 결실한 LRRC24P mutant를 설계 한 후, LRRC24 mutant-EGFP 융합 단백질을 발현하는 플라스미드 벡터를 제작한 후 단백질을 발현시켜 정제하였다. 본 발명의 상기 LRRC24P 세포 투과 펩타이드 변이 중, 서열명칭 LRRC24P M1 내지 M8(서열번호 2 내지 7, 또는 서열번호 21 및 28) 펩타이드로, 세포 실험을 진행하였다. 상기 세포 실험을 위하여 Jurkat 세포를 1.5 X 106/well로 24 well plate에 분주한 후 10% Fetal Bovine Serum과 1% penicillin/streptomycin이 포함된 RPMI 1640 배지 2ml에 부유시켜 LRRC24P -EGFP 및 LRRC24P mutant-EGFP 융합단백질을 최종 농도 5μM로 처리 후 37°C로 유지되는 5% CO2 배양기에서 2시간 동안 배양하였다. 이 후 세포가 포함된 배지를 5 ml 튜브에 옮긴 후 원심분리하여 상등액을 제거하고 PBS 용액으로 세척하는 것을 3회 반복하였다. 이 후 Jurkat 세포를 650μl의 PBS 에 부유시킨 후 유세포분석기를 통해 세포 내로 도입된 LRRC24P mutant-EGFP 융합단백질들의 형광을 측정하여 세포 내 도입 효율을 확인하였다(도10). 이를 통해 LRRC24P mutant 들이 변이를 통해 도입 효율의 변화를 나타내지만 세포 투과 능력이 유지됨을 확인하였다(도10). To confirm the efficiency of intracellular delivery of LRRC24P cell permeation peptide mutant, LRRC24P mutant (mutation) replacing alanine, the ninth amino acid of LRRC24P with another amino acid, and LRRC24P mutant that deleted each of N and C terminal amino acids one by one After designing, a plasmid vector expressing the LRRC24 mutant-EGFP fusion protein was produced and then purified by expressing the protein. Among the LRRC24P cell permeation peptide variants of the present invention, cell experiments were performed with the peptides of the sequence names LRRC24P M1 to M8 (SEQ ID NOS: 2 to 7, or SEQ ID NOS: 21 and 28). For the above cell experiment, Jurkat cells were dispensed into a 24 well plate at 1.5 X 10 6 /well, and then suspended in 2 ml of RPMI 1640 medium containing 10% Fetal Bovine Serum and 1% penicillin/streptomycin, LRRC24P -EGFP and LRRC24P mutant- The EGFP fusion protein was treated with a final concentration of 5 μM and incubated for 2 hours in a 5% CO 2 incubator maintained at 37°C. Thereafter, the medium containing the cells was transferred to a 5 ml tube, followed by centrifugation to remove the supernatant and washing three times with PBS solution. Thereafter, the Jurkat cells were suspended in 650 μl of PBS, and then fluorescence of LRRC24P mutant-EGFP fusion proteins introduced into the cells was measured through a flow cytometer to confirm the efficiency of cell introduction (FIG. 10). Through this, it was confirmed that the LRRC24P mutants exhibited a change in introduction efficiency through mutation, but the cell permeation ability was maintained (FIG. 10 ).

Claims (10)

  1. 인간 LRRC24 (Leucine rich repeat containing 24 ) 단백질 유래 서열번호 1 내지 22 중 어느 하나의 폴리펩티드를 포함하는 세포막 투과 도메인. A cell membrane permeation domain comprising the polypeptide of any one of SEQ ID NOs: 1-22 derived from human LRRC24 (Leucine rich repeat containing 24) protein.
  2. 제 1항의 세포막 투과 도메인 및 상기 세포막 투과 도메인의 N 말단 또는 C 말단에 융합된 카고를 포함하는 세포막 투과율이 향상된, 재조합 카고.A recombinant cargo with improved cell membrane permeability comprising a cell membrane permeation domain of claim 1 and a cargo fused to the N or C terminus of the cell membrane permeation domain.
  3. 제 2항에 있어서, 상기 카고는 단백질, 핵산, 지질 또는 화합물인, 재조합 카고. The recombinant cargo of claim 2, wherein the cargo is a protein, nucleic acid, lipid or compound.
  4. 제 2항에 있어서, 상기 카고가 호르몬, 면역글로불린, 항체, 구조 단백질, 신호전달 펩타이드, 저장 펩타이드, 막 펩타이드, 막관통 펩타이드, 내부 펩타이드, 외부 펩타이드, 분비성 펩타이드, 바이러스 펩타이드, 천연(native) 펩타이드, 당화 단백질, 단편화된 단백질, 디설파이트(Disulfide peptide), 재조합 단백질, 화학적으로 변형된 단백질 및 프리온 군으로부터 선택되는 어느 하나인 재조합 카고. The method according to claim 2, wherein the cargo is a hormone, an immunoglobulin, an antibody, a structural protein, a signaling peptide, a storage peptide, a membrane peptide, a transmembrane peptide, an inner peptide, an outer peptide, a secretory peptide, a viral peptide, a native (native). Recombinant cargo, which is any one selected from the group of peptides, glycosylated proteins, fragmented proteins, disulfide peptides, recombinant proteins, chemically modified proteins and prions.
  5. 제 2항에 있어서, 카고가 핵산, 코딩 핵산 서열, mRNA, 안티센스 RNA 분자, 탄수화물, 지질 및 당지질로 이루어진 군으로부터 선택되는 어느 하나인 재조합 카고.3. The recombinant cargo of claim 2, wherein the cargo is any one selected from the group consisting of nucleic acids, coding nucleic acid sequences, mRNA, antisense RNA molecules, carbohydrates, lipids and glycolipids.
  6. 제 2항에 있어서, 카고가 조영물질, 약물 또는 화학물질인 것인 재조합 카고. 3. The recombinant cargo of claim 2, wherein the cargo is a contrast agent, drug or chemical.
  7. 제 1항의 세포막 투과 도메인을 코딩하는 폴리뉴클레오티드를 포함하는 유전자 컨스트럭트(Gene construct). A gene construct comprising a polynucleotide encoding the cell membrane permeation domain of claim 1.
  8. 제 7항의 유전자 컨스트럭트를 포함하는 세포막 투과율이 향상된 재조합 카고 단백질 발현용 발현 벡터.An expression vector for expressing a recombinant cargo protein having improved cell membrane permeability, comprising the gene construct of claim 7.
  9. 제 1항의 세포막 투과 도메인의 N 말단 또는 C 말단에 카고가 융합된 재조합 카고를 제조하는 단계; 및 상기 제조된 재조합 카고를 분리된 세포와 접촉시키는 단계;를 포함하는 세포 내로의 카고 전달 방법. Preparing a recombinant cargo fused to the N- or C-terminal of the cell membrane permeation domain of claim 1; And contacting the prepared recombinant cargo with isolated cells.
  10. 제 1항의 세포막 투과 도메인의 N 말단 또는 C 말단에 카고가 융합된 재조합 카고를 제조하는 단계; 및 상기 제조된 재조합 카고를 인간을 제외한 동물에게 투여하는 단계;를 포함하는 동물 내로의 카고 전달 방법. Preparing a recombinant cargo fused to the N- or C-terminal of the cell membrane permeation domain of claim 1; And administering the prepared recombinant cargo to animals other than humans.
PCT/KR2019/017829 2018-12-19 2019-12-16 Transmembrane domain derived from human lrrc24 protein WO2020130547A1 (en)

Priority Applications (9)

Application Number Priority Date Filing Date Title
CN201980079173.8A CN113166216A (en) 2018-12-19 2019-12-16 Transmembrane domain derived from human LRRC24 protein
SG11202105169WA SG11202105169WA (en) 2018-12-19 2019-12-16 Transmembrane domain derived from human lrrc24 protein
EP19898351.2A EP3875113A4 (en) 2018-12-19 2019-12-16 Transmembrane domain derived from human lrrc24 protein
CA3122428A CA3122428A1 (en) 2018-12-19 2019-12-16 Transmembrane domain derived from human lrrc24 protein
AU2019403533A AU2019403533A1 (en) 2018-12-19 2019-12-16 Transmembrane domain derived from human LRRC24 protein
US17/296,622 US20220306718A1 (en) 2018-12-19 2019-12-16 Transmembrane domain derived from human lrrc24 protein
JP2021531077A JP7193633B2 (en) 2018-12-19 2019-12-16 Transmembrane domain derived from human LLRC24 protein
BR112021012019A BR112021012019A2 (en) 2018-12-19 2019-12-16 Transmembrane domain derived from human lrrc24 protein, therapeutic use thereof, recombinant cargo, gene construct, expression vector and method for delivering a cargo to a cell
PH12021551150A PH12021551150A1 (en) 2018-12-19 2021-05-20 Transmembrane domain derived from human lrrc24 protein

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR10-2018-0165438 2018-12-19
KR20180165438 2018-12-19
KR10-2019-0144779 2019-11-13
KR1020190144779A KR102351041B1 (en) 2018-12-19 2019-11-13 Cell penetrating Domain derived from human LRRC24 protein

Publications (1)

Publication Number Publication Date
WO2020130547A1 true WO2020130547A1 (en) 2020-06-25

Family

ID=71100516

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2019/017829 WO2020130547A1 (en) 2018-12-19 2019-12-16 Transmembrane domain derived from human lrrc24 protein

Country Status (1)

Country Link
WO (1) WO2020130547A1 (en)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016161516A1 (en) * 2015-04-10 2016-10-13 Feldan Bio Inc. Polypeptide-based shuttle agents for improving the transduction efficiency of polypeptide cargos to the cytosol of target eukaryotic cells, uses thereof, methods and kits relating to same
KR101799904B1 (en) * 2012-07-11 2017-11-22 주식회사 젬백스앤카엘 Cell-penetrating peptide, conjugate comprising same and composition comprising same
KR20170128516A (en) * 2015-03-16 2017-11-22 아말 테라퓨틱스 에스에이 New complexes comprising cell permeable peptides, cargo and TLR peptide agonists
KR101848147B1 (en) * 2016-07-14 2018-04-11 건양대학교산학협력단 HOXA9 cell-permeable fusion protein and composition comprising the same for preventing or treating of lung cancer

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101799904B1 (en) * 2012-07-11 2017-11-22 주식회사 젬백스앤카엘 Cell-penetrating peptide, conjugate comprising same and composition comprising same
KR20170128516A (en) * 2015-03-16 2017-11-22 아말 테라퓨틱스 에스에이 New complexes comprising cell permeable peptides, cargo and TLR peptide agonists
WO2016161516A1 (en) * 2015-04-10 2016-10-13 Feldan Bio Inc. Polypeptide-based shuttle agents for improving the transduction efficiency of polypeptide cargos to the cytosol of target eukaryotic cells, uses thereof, methods and kits relating to same
KR101848147B1 (en) * 2016-07-14 2018-04-11 건양대학교산학협력단 HOXA9 cell-permeable fusion protein and composition comprising the same for preventing or treating of lung cancer

Non-Patent Citations (10)

* Cited by examiner, † Cited by third party
Title
"A new peptide vector for efficient delivery of oligonucleotides into mammalian cells", NUCLEIC ACIDS RES., vol. 14, 1997, pages 2730 - 2736
"dNP2 is a blood-brain barrier-permeable peptide enabling ctCTLA-4 protein delivery to ameliorate experimental autoimmune encephalomyelitis", NAT COMMUN, vol. 8244, 2015, pages 1 - 13
"Intranasal delivery of the cytoplasmic domain of CTLA-4 using a novel protein transduction domain prevents allergic inflammation.", NAT MED, vol. 12, 2006, pages 574 - 579
"Mutational analysis of a human immunodeficiency virus type 1 Tat protein transduction domain which is required for delivery of an exogenous protein into mammalian cells", J. GEN. VIROL., vol. 83, 2002, pages 1173 - 1181
"N-terminal peptides from unprocessed prion proteins enter cells by macropinocytosis", BIOCHEM. BIOPHYS. RES. COMMUN., vol. 348, 2006, pages 379 - 385
"The third helix of the Antennapedia homeodomain translocates through biological membranes", J. BIOL. CHEM., vol. 269, 1994, pages 10444 - 10450
DATABASE NCBI 21 July 2006 (2006-07-21), ANONYMOUS: "Leucine rich repeat containing 24 [Homo sapiens]", XP055720636, retrieved from Protein Database accession no. AAI11068.1 *
DIABETES, vol. 50, no. 8, August 2001 (2001-08-01), pages 1706 - 1713
NATURE COMMUNICATIONS, vol. 6, 2015
NATURE MEDICINE, vol. 12, no. 5, June 2006 (2006-06-01), pages 574 - 9

Similar Documents

Publication Publication Date Title
JP7041187B2 (en) Cell-permeable peptides, conjugates containing them, and compositions containing them.
JP7007423B2 (en) Cell-permeable peptides, conjugates containing them, and compositions containing them.
AU2016258423B2 (en) Production method for exosome comprising cargo protein, and method for transferring cargo protein into cytoplasm by using exosome produced by means of the production method
Ford et al. Protein transduction: an alternative to genetic intervention?
EP1966240B3 (en) Lactoferrin peptides useful as cell-penetrating peptides
ES2377660T3 (en) New peptide that penetrates cells
WO2014046481A1 (en) Cell penetrating peptide, conjugate comprising same, and composition comprising conjugate
Noguchi et al. Mechanism of PDX-1 protein transduction
JP4551058B2 (en) Modular transfection system
Rothe et al. Characterization of the cell-penetrating properties of the Epstein-Barr virus ZEBRA trans-activator
WO2015137705A1 (en) Cell penetrating peptide and method for delivering biologically active substance using same
WO2016036060A1 (en) Novel cell membrane-penetrating peptide, and use thereof as bioactive substance carrier
US11927589B2 (en) Carrier peptide fragment for nucleolar localization and use thereof
US10100284B2 (en) Method for inducing differentiation of pluripotent stem cells into endodermal cells
US20220306718A1 (en) Transmembrane domain derived from human lrrc24 protein
KR101064914B1 (en) Pharmaceutical composition for treating autoimmune, allergic and inflammatory diseases and delivery method thereof
KR101444199B1 (en) Cell Penetrating Peptides and Use thereof
CN110511273B (en) Preparation method and application of cell-penetrating polypeptide
WO2020130547A1 (en) Transmembrane domain derived from human lrrc24 protein
WO2020130548A1 (en) Cell membrane penetrating domain derived from human gpatch4 protein
WO2020130546A1 (en) Human clk2 protein-derived cell membrane-penetrating domain
KR102282692B1 (en) Cell penetrating Domain derived from human CLK2 protein
KR20140046994A (en) Cell penetrating peptide comprising np2 polypeptide or dnp2 polypeptide derived from human nlbp and cargo delivery system using the same
KR20090122769A (en) Method for delivering proteins into cells and peptide therefor
KR20200076604A (en) Cell penetrating Domain derived from human GPATCH4 protein

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 19898351

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2021531077

Country of ref document: JP

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 3122428

Country of ref document: CA

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2019403533

Country of ref document: AU

Date of ref document: 20191216

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2019898351

Country of ref document: EP

Effective date: 20210601

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112021012019

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 112021012019

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20210618