KR20200076604A - Cell penetrating Domain derived from human GPATCH4 protein - Google Patents

Abstract

The present invention relates to a cell membrane penetrating domain derived from human GPATCH4 protein. Particularly, the present invention relates to a cell membrane penetrating domain (GPATCH4P1 cell membrane penetrating domain) or cell penetrating peptide derived from human GPATCH4 protein, and to an intracellular delivery system including the same. The cell membrane penetrating domain derived from human GPATCH4 protein can be used to deliver cargo materials, such as compounds, biomolecules and various polymeric materials, into cells. The GPATCH4P1 cell membrane penetrating domain shows higher cell penetration efficiency as compared to the conventional cell penetrating peptides, is derived from a human protein and can avoid side reactions and immune reactions caused by foreign protein-derived peptides, and thus can be used advantageously for a method for delivering compounds, biomolecules and various polymeric materials applied to the human body effectively into cells.

Description

Cell membrane penetration domain derived from human GPATCH4 protein}

The present invention relates to a cell membrane permeation domain derived from human GPATCH4 protein and an intracellular delivery system comprising the same.

Medicines used to treat disease or relieve symptoms are largely divided into low-molecular-weight compound medicines and high-molecular biopharmaceuticals. Biopharmaceuticals include therapeutic proteins, antibodies, vaccines for prevention or treatment, gene therapy, and cell therapy. In particular, recombinant protein drugs are drugs that are produced in large quantities using gene recombination technology for therapeutic proteins that are difficult to produce through a living body. Growth hormone, erythropoietin, interferon, colony stimulating factor (CSF), and blood coagulation factor (Recombinant human insulin) for the treatment of diabetes in the early 1980s were first approved by the U.S. FDA. Various recombinant protein drugs, such as blood factors, have been released. However, most polymer materials including recombinant proteins or nucleic acids are very difficult to transfer into cells compared to low-molecular compound drugs that are relatively easy to enter the cell and show activity through the cell membrane. have. Therefore, electroporation, microinjection, cationic lipid vesicle, viral vector, virus-like particles, and genes for intracellular delivery of high molecular weight materials Methods using genetically-modified bacteria have been used or studied. However, the above methods are difficult to directly use in a living body, or there is a difficulty in injecting a cell separated from a living body and then re-injecting it into a living body. In addition, it causes a side effect inducing apoptosis or an immune response in vivo, and thus has great limitations in application.

Research for new drug delivery technology and polymer biopharmaceutical development that can overcome the above problems has been actively conducted, and among them, a representative method is a protein transduction domain (PTD) or cell permeation peptide. (Cell Penetrating Peptides, CPP).

The cell-penetrating peptide was first discovered to have the properties of the HIV virus' TAT protein and the polypeptides present in the TAT protein (GRKKRRQRRRPPG, RKKRRQRRR, YGRKKRRQRRR) to pass through the cell membrane. Derived MPG (GALFLGFLGAAGSTMGAWSQPKKKRKV), bovine prion protein-derived BPrPr (MVKSKIGSWILVLFVAMWSDVGLCKKRP), human Hph-1 protein-derived Hph-1 (YARVRRRGPRR), human NLBP protein-derived NP2 (KIKKVKK. Since then, studies using the cell-penetrating peptide as described above have been actively conducted, and through this, it has been found that cargo substances such as DNA, siRNA, peptide nucleic acid (PNA), protein, and liposome nanoparticles can be effectively delivered into cells.

Prior studies have shown that cell-penetrating peptides are energy-independent through direct penetration and that polymer materials can be delivered into cells even at low temperatures, and that they can also penetrate through endocytosis.

Currently, cell-penetrating peptides are developed for the treatment of cerebral vascular disease (Cerebral ischemia) and degenerative brain disease (Alzheimer's disease) using TAT-JBD20, the treatment of amyotrophic lateral sclerosis using TAT-BH4, MPG-8/siRNA and TAT -Preclinical experiments such as cancer treatments using DRBD/siRNA are in progress. In addition, the development of a treatment for myocardial infarction using TAT-δPKC inhibitor, a treatment for hearing loss and inflammation using TAT-JBD20, and a treatment for brain tumor using p28 are in clinical trials.

As described above, research on cell-penetrating peptides and development of several new drug candidates using the same are actively progressing, but there are problems to be overcome, and for this, the cell-penetrating efficiency is improved, and the cell-penetrating peptides and cargo substances bound thereto are used in vivo. There is a need to develop new cell-penetrating peptides that can minimize side effects and unintended immune responses.

Therefore, in order to overcome the disadvantage that the existing cell permeation peptides are mainly invented from non-human proteins such as viruses and Drosophila or have low permeation efficiency, cell permeation peptides having high permeation efficiency among human derived peptides, human GPATCH4 (G-Patch Domain Containing 4) The protein-derived cell-penetrating peptide was invented, and the peptides present in the human-derived protein were confirmed for similarity to existing cell-penetrating peptides, thereby completing the present invention.

1. Mutational analysis of a human immunodeficiency virus type 1 Tat protein transduction domain which is required for delivery of an exogenous protein into mammalian cells. J. Gen. Virol., 83 (2002), pp. 1173-1181 2.The third helix of the Antennapedia homeodomain translocates through biological membranes. J. Biol. Chem., 269 (1994), pp. 10444-10450 3.A new peptide vector for efficient delivery of oligonucleotides into mammalian cells. Nucleic Acids Res. 14 (1997) pp. 2730-2736. 4.N-terminal peptides from unprocessed prion proteins enter cells by macropinocytosis. Biochem. Biophys. Res. Commun., 348 (2006), pp. 379-385 5.Intranasal delivery of the cytoplasmic domain of CTLA-4 using a novel protein transduction domain prevents allergic inflammation. Nat Med, 12 (2006), pp. 574-579 6.dNP2 is a blood-brain barrier-permeable peptide enabling ctCTLA-4 protein delivery to ameliorate experimental autoimmune encephalomyelitis. Nat Commun. 8244 (2015), pp. 1-13

An object of the present invention is to provide a novel cell membrane permeation domain that exhibits high cell permeation efficiency and can minimize side effects.

Another object of the present invention is to provide an intracellular delivery system including a cell membrane permeation domain to which a cargo of an intracellular transport target is bound to the end of a peptide.

Another object of the present invention is to provide a method for transporting a cargo into a cell, the method comprising contacting a cell membrane permeation domain to which a cell of the intracellular transport target is bound to the cell at the end of the peptide.

In order to achieve the above object, the present invention is to provide a cell membrane permeation domain comprising the polypeptide of any one of SEQ ID NOs: 1 to 7 derived from human GPATCH4 (G-Patch Domain Containing 4) protein.

In the present invention, the term "cell penetrating peptide (Cell penetrating peptide, CPP)" refers to a peptide having the ability to carry a cargo (Cargo) of a transport target into a cell in vitro or in-compensation, the term "cell membrane permeation domain ”.

In addition, in the present invention, the term'peptide' or'peptide' means a polymer in the form of a chain formed by combining 4 to 1000 amino acid residues by a peptide or peptide bond, and mixed with'polypeptide' or'polypeptide' It is possible.

In the present invention, in order to minimize the side effects that occur when the cargo material is delivered through the cell permeation peptide into the human body, unlike the cell permeation peptide derived from a virus or other species, it is a peptide existing in a human-derived protein. In comparison, a novel human-derived cell membrane permeation domain or cell permeation peptide capable of minimizing side effects when treated to the human body and having a very high delivery efficiency into cells.

The present invention provides a recombinant cargo cell membrane permeability improved, comprising a cell fused to the N- or C-terminal of the cell membrane permeation domain and the cell membrane permeation domain.

The cargo may be a recombinant cargo that is a protein, nucleic acid, lipid, or compound. In addition, the cargo may be an adjuvant or antigen.

According to one embodiment, the cargo is a hormone, an immunoglobulin, an antibody, a structural protein, a signaling peptide, a storage peptide, a membrane peptide, a transmembrane peptide, an inner peptide, an outer peptide, a secretory peptide, a viral peptide, a native peptide , Glycated protein, fragmented protein, disulfide peptide, recombinant protein, chemically modified protein, and any one selected from the prion group.

In the present invention, the term'recombination cargo' means a complex formed by recombination of cell membrane permeation domains and one or more cargoes by genetic fusion or chemical bonding.

In the present invention, the term'contact' means that the cargo is in contact with eukaryotic or prokaryotic cells, and the cargo is transferred into the eukaryotic or prokaryotic cells.

In addition, in the present invention, it is used interchangeably with expressions such as transporting, penetrating, transporting, transferring, or passing for introducing proteins, peptides, etc. into cells.

In addition, according to one embodiment, the cargo may be any one of a recombinant cargo selected from the group consisting of nucleic acids, coding nucleic acid sequences, mRNA, antisense RNA molecules, carbohydrates, lipids, and glycolipids.

In addition, according to one embodiment, the cargo may be a recombinant cargo that is a contrast agent, drug, or chemical.

In the present invention, the term “contrast material” refers to all materials used for imaging biological structures or fluids in medical imaging. The contrast material may include, but is not limited to, radiopaque contrast material, paramagnetic contrast material, superparamagnetic contrast material, CT contrast material, or other contrast material. For example, it may include radiopaque metals and salts thereof (e.g., silver, platinum, platinum, etc.) and other radiopaque chemicals (e.g., calcium salts, barium salts such as barium sulfate, tantalum and tantalum oxide). have. Paramagnetic contrast materials (for MR imaging) include gadolinium dientylene triaminepentaacetic acid and its derivatives and other gadolinium, manganese, iron, dysprosium, copper europium, erbium, chromium, Nickel and cobalt complex hydroxybenzylethylene diamine diacetic acid (HBED). The superparamagnetic contrast material (for MR imaging) may include magnetite, superparamagnetic iron oxide, ultrafine, superparamagnetic iron oxide, and monocrystalline iron oxide. Other suitable contrast materials may include iodized and non-iodinated, ionic and nonionic CR compositions, and contrast materials such as spin-labels, or other diagnostic actives. When expressed in a cell, it may include a marker gene encoding an easily detectable protein. Various labels such as radionuclides, fluorescent substances, enzyme cofactors, and enzyme inhibitors can be used.

As an example, when the cargo according to the present invention is a protein or a peptide, by binding the DNA expressing the transport peptide to the DNA expressing the transport target and expressing it, the transport peptide and the transport peptide form a fusion protein form You can combine objects. A specific example of binding by a fusion protein is as follows: When preparing a primer for producing a fusion protein, a nucleotide encoding a transport peptide is attached to a nucleotide expressing a moving target, and then the obtained nucleotide is vectored as a restriction enzyme. (Example: PET vector), and BL-21 (DE3) is introduced into cells and expressed. At this time, by treating an expression inducer such as IPTG (Isopropyl β-D-1-thiogalactopyranosid), and then purifying the fusion protein, and then treating PBS, the carrier peptide is a dye or fluorescent substance, specifically fluorescein ithiosia Nate (FITC, fluorescein isothiocyanate), luciferase (Luc), green fluorescent protein (GFP), enhanced green fluorescent protein (EGFP), Tag GFP, Superfolder GFP, PA GFP , AcGFP, PS-GFP2, Yellow fluorescent protein (YFP), enhanced yellow fluorescent protein (EYFP), SYFP, TagYFP, PhiYFP, Azurite, mKalamal, Cyan fluorescent protein, CFP), enhanced Cyan fluorescent protein (ECFP), TagCFP, PS-CFP2, Red fluorescent protein (RFP), Tag RFP, Tag RFP657, mRFP1, PaTagRFP, Turbo RFP, RFP693, tdRFP , Blue fluorescent protein (BFP), mTag BFP, Yellow-green fluorescent protein (mNeongreen), Bright monomeric fluorescent protein (Scarlet-i), Emblem, M Cherry (monomeric cherry fluorescent protein, mcherry), PAmcherry, mono strawberry fluorescent protein (m Strawberry, monomeric orange fluorescent protein (mOrange), PSmOrange, mRasberry, mKate, mKate2, monomeric teal fluorescent protein (mTFP), mNeptune, m Ruby (mRubby), mRubby2, mBanana, DSRed, mCitrine, Emerald, T-Sapphire, Mpple, Mampape ), Venus, Topaz, J-Red, tdTomato, mTurquoise, mTurquosie2, mKO, mKO2, mUKG. IFP1.4, mEos2, mEos4, mHoneydew, Dronpa, katushka, Ypet, CyPet, Clover, kaede, KikGR, mTangerine, Zsgreen, ZsYellow, Serulean, Beta-galactosidase, LacZ, Β-lactamase (BLA), beta-glucuronidase (GUS), alkaline phosphatase, chloramphenicol acetyltransferase (CAT) or peroxidase Can be combined with

According to another aspect of the present invention, the present invention provides a gene construct comprising a polynucleotide encoding the cell membrane permeation domain.

In addition, the present invention provides an expression vector for expressing a recombinant cargo protein having improved cell membrane permeability, including a gene construct.

According to another aspect of the invention, the step of producing a recombinant cargo fused to the N- terminal or C- terminal of the cell membrane permeation domain; And contacting the prepared recombinant cargo with isolated cells.

In addition, according to another aspect of the invention, the step of producing a recombinant cargo fused to the N- terminal or C- terminal of the cell membrane permeation domain; And administering the prepared recombinant cargo to animals other than humans.

There are no special requirements for the contact between the cell membrane permeation domain and the cell membrane, such as limited time, temperature, and concentration, and can be carried out as general conditions applied to cell membrane permeation in the art.

The cell permeation peptide of the present invention exhibits significantly improved permeation efficiency or cell permeability compared to conventional peptides, thereby allowing the carried cargo or biologically active molecule to be introduced into the cell, effectively maintaining activity, and significantly reducing cost. .

In addition, it is possible to increase the effect of the cargo material delivered through the cell permeation peptide or cell membrane permeation domain.

In addition, since it is a cell-penetrating peptide derived from human protein, side effects caused by peptides derived from non-human protein can be minimized.

However, the effects of the present invention are not limited to the above-mentioned effects, and other effects not mentioned will be clearly understood by those skilled in the art from the following description.

1 shows a schematic diagram of a gene composite for making an expression gene composite of the GPATCH4P1-EGFP recombinant fusion protein.
Figure 2 shows the results obtained by observing a gene composite expressing a protein fused with a human permeable peptide GPATCH4P1 derived from human GPATCH4 protein and Enhanced Green Fluorescent Protein (EGFP) fluorescence protein through agarose gel electrophoresis.
Figure 3 shows that by inserting the GPATCH4P1-EGFP gene composite into the protein expression vector pET28a+ and processing the restriction enzyme to the combined gene composite to confirm the results.
FIG. 4 shows that the GPATCH4P1-EGFP-pET28a+ vector was transformed into BL21(DE3) receptor cells, and then induced by protein production, followed by sonication, and observed through polyacrylamide gel electrophoresis.
FIG. 5 shows the observation of polyacrylamide gel electrophoresis by purifying the GPATCH4P1-EGFP recombinant fusion protein produced using BL21(DE3) recipient cells.
Figure 6 shows the results of comparing the permeation efficiency in cells with a flow cytometer after treating the recombinant protein fused with EGFP and the GPATCH4P1-EGFP recombinant protein in a human T immune cell line (Jurkat).
7 shows the results of comparing the permeation efficiency in cells with a flow cytometer after processing the recombinant proteins fused with the cell permeation peptide by concentration.
8 shows the results of comparing the permeation efficiency in cells with a flow cytometer after processing the recombinant proteins fused with the cell permeation peptide by time.
FIG. 9 shows that the distribution pattern of the GPATCH4P1-EGFP recombinant protein observed into the cell was observed using a confocal microscope after treating the GPATCH4P1-EGFP recombinant protein on the cervical cancer cell line (HeLa).
Figure 10 shows the results of confirming the efficiency of introduction into cells by flow cytometry (FACS) after processing the intracellular delivery efficiency of the GPATCH4P1 mutant-EGFP fusion protein of the present invention to a human T immune cell line (Jurkat).

Unless defined otherwise herein, all technical and scientific terms used have the meaning as commonly understood by one of ordinary skill in the art. Various scientific events, including the terms included herein, are well known and available in the art.

The present invention provides a cell membrane permeation domain or cell permeation peptide comprising a polypeptide of any one of SEQ ID NOs: 1 to 7 derived from human GPATCH4 (G-Patch Domain Containing 4) protein.

Conventional conventional cell permeation peptides are mainly invented from non-human proteins such as viruses and Drosophila, or have a disadvantage of low permeation efficiency. To overcome this, the present inventors used the GPATCH4P1 peptide KKKKKKRRRRKK (SEQ ID NO: 1) consisting of amino acid sequences 203 to 212 in human GPATCH4 (G-Patch Domain Containing 4) protein, which is expected to have cell permeability among human-derived peptides. Found.

The gene sequence information expressing GPATCH4P1 in the base sequence of the human-derived GPATCH4 protein is aaaaaaaagaaaaagaaaaggaggcagaaa (SEQ ID NO: 8) and was converted to aaaaaaaagaagaagaaacggagacaaaaa (SEQ ID NO: 9) through codon optimization during gene synthesis. In order to verify cell permeability, the base sequence expressing the EGFP fluorescent protein linked after the base sequence expressing the GPATCH4P1 peptide is represented by SEQ ID NO: 10, and the base sequence of the linker portion between the GPATCH4P1 peptide and the EGFP protein is ggaggtgggggctcg (SEQ ID NO: 11). .

The cell permeation peptides or cell membrane permeation domains represented by SEQ ID NOs: 2 to 7 of the present invention are mutated cell permeation peptides of the GPATCH4P1 cell permeation peptide, and GPATCH4P1 mutant which replaces glutamine, the ninth amino acid of GPATCH4P1, with another amino acid. And GPATCH4P1 mutant mutated cell membrane domain or cell permeation peptide with N-terminal and C-terminal amino acids removed one by one.

The cell membrane permeation domain or cell permeation peptide derived from the human GPATCH4P1 protein of the present invention is shown in Table 1 below.

Cell membrane permeation domain or cell permeation peptide derived from human GPATCH4P1 protein Sequence number Sequence name Sequence SEQ ID NO: 1 GPATCH4P1 KKKKKKRRQK SEQ ID NO: 2 GPATCH4P1-M1 KKKKKKRRYK SEQ ID NO: 3 GPATCH4P1-M2 KKKKKKRREK SEQ ID NO: 4 GPATCH4P1-M3 KKKKKKRRKK SEQ ID NO: 5 GPATCH4P1-M4 KKKKKKRRGK SEQ ID NO: 6 GPATCH4P1-M5 KKKKKKRRQ SEQ.ID No. 7 GPATCH4P1-M6 KKKKKRRQK

Advantages and features of the present invention, and methods for achieving them will be clarified with reference to embodiments described below in detail. Hereinafter, the present invention will be described in more detail by examples. However, the following examples are merely illustrative of the present invention, and the contents of the present invention are not limited to the following examples.

<Example 1> Construction of a plasmid vector expressing a protein obtained by fusion of a cell-penetrating peptide (GPATCH4P1) derived from human GPATCH4 protein and EGFP fluorescent protein

The present invention provides a gene construct comprising a polynucleotide encoding a cell membrane permeation domain (GPATCH4P1 cell permeation peptide, GPATCH4P1), and for expressing a recombinant cargo protein having improved cell membrane permeability comprising the gene construct An expression vector is provided. The vector is characterized in that it further comprises a gene encoding a cargo protein, so that a recombinant cargo protein in which the cargo of the cell membrane permeation domain and the protein is fused can be expressed.

In addition, the present invention comprises the steps of preparing a recombinant cargo fused to the N- terminal or C- terminal of the cell membrane permeation domain; And contacting the prepared recombinant cargo with cells.

To test the cell permeation efficiency of GPATCH4P1, artificial gene synthesis was performed as follows. As shown in FIG. 1, 5'-NheI restriction enzyme recognition sequence-GPATCH4P1 base sequence-Linker sequence sequence-EGFP protein sequence sequence-termination codon-XhoI restriction enzyme recognition sequence-3' was synthesized.

In particular, the GPATCH4P1 base sequence was converted to a base sequence expressing the same peptide through codon optimization during artificial gene synthesis, and was synthesized by attaching a gene expressing the EGFP fluorescent protein to the base sequence of the GPATCH4P1 peptide to verify cell permeability (FIG. 2). . In addition, linker sequencing was added between the cell-penetrating peptide and the EGFP protein to increase flexibility. The artificial synthetic gene was introduced into the pET28a+ plasmid vector treated with NheI restriction enzyme and XhoI restriction enzyme through T4 ligase after treatment with NheI restriction enzyme and XhoI restriction enzyme. The pET-28a plasmid vector used herein allows protein purification through Ni-NTA Resin by expressing 6 histidines (6 x His) at the N-terminus in front of the GPATCH4P1-EGFP fusion protein. The pET28a+ plasmid vector into which the GPATCH4P1-EGFP fusion protein artificial gene has been introduced is transformed into Top10 recipient cells and cultured in LB agar plates containing kanamycin to incubate grown colonies in LB medium for about 16 hours. Thereafter, a plasmid was obtained through a DNA extraction experiment, treated with NheI restriction enzyme and XhoI restriction enzyme, and confirmed that the artificial gene GPATCH4P1-EGFP fusion protein was successfully introduced into the pET-28a plasmid vector through agarose gel electrophoresis. (Figure 3). As described above, a recombinant cargo in which cargo was fused to the cell membrane permeation domain (GPATCH4P1) was prepared. The method of delivering cargo to cells of the present invention comprises the steps of: 1) preparing the recombinant cargo; And 2) contacting the recombinant cargo prepared in the step with cells. Preparation 2) The contact between the cargo and the cell can be performed in vitro or in vivo. When the contact is performed in vitro, the contact is made by culturing the cell by treating the medium containing the recombinant cargo to cells in vitro.

In addition, when the contact proceeds in vivo, the recombinant cargo is intramuscular, intra-peritoneal, intravenous, oral, or subcutaneous (nasal). Subsutaneous, subcutaneous (intradermal), mucosal (muscosal), or inhaled (inhale) through a path such as injection (injection) into the body, in vivo cells and the recombinant cargo is made contact.

<Example 2> GPATCH4P1-EGFP fusion protein expression conditions established and high purity purification

In order to establish the expression conditions of the GPATCH4P1-EGFP fusion protein, the plasmid vector prepared in Example 1 above was transformed into BL21(DE3) recipient cells and cultured in LB medium containing Kanamycin for about 16 hours. Here, 100 times more LB medium was added, incubated until the OD value reached 0.4-0.6, and then IPTG (Isopropyl β-D-1-thiogalactopyranoside) was added to a final concentration of 1 mM, followed by 5 hours at 37°C. Or incubate at 20 ℃ for 16 hours. Thereafter, the cells obtained through centrifugation were ultrasonically decomposed, and again, the supernatant and the cell pellet were separated through centrifugation to confirm the expressed amount and water solubility of the protein through polyacrylamide gel electrophoresis and Coomassie blue staining (FIG. 4). .

Through this, it was confirmed that the GPATCH4P1-EGFP fusion protein increased the water-soluble and expression efficiency of the protein under the condition of incubating at 20° C. for 16 hours after adding IPTG. Therefore, in order to purify the high-purity GPATCH4P1-EGFP fusion protein, BL21(DE3) transformed cells transformed under the same conditions were cultured, and then the culture solution was centrifuged to obtain a cell pellet and lysis buffer (50 mM NaH2PO4, 300 mM NaCl, 10 mM Imidazole ). After supernatant, the supernatant was recovered through centrifugation, filtered through a 45 μm filter, and the supernatant was passed through a Ni-NTA agarose column to bind the recombinant protein. In order to remove the protein non-specifically bound to the Ni-NTA agarose column, after washing the Ni-NTA agarose column using washing buffer (50 mM NaH2PO4, 300 mM NaCl, 20 mM Imidazole), the recombinant protein bound to the Ni-NTA agarose column is recovered. To do this, the recombinant protein was eluted using elution buffer (50 mM NaH2PO4, 300 mM NaCl, 500 mM Imidazole). After replacing the solution containing the GPATCH41-EGFP fusion protein with PBS using the PD-10 desalting column, it was confirmed by polyacrylamide gel electrophoresis and Coomassie blue staining (FIG. 5).

<Example 3> GPATCH4P1-EGFP fusion protein intracellular delivery efficiency confirmation

In order to confirm the intracellular delivery efficiency of the GPATCH4P1-EGFP fusion protein, the plasmid vector expressing the protein in which the EGFP fluorescent protein is fused with the cell permeation peptides TAT, Hph-1, and NP2, respectively, expresses the GPATCH4P1-EGFP fusion protein It was prepared in the same manner as the plasmid vector. Expression and purification of the conventional CPP-EGFP fusion protein was also performed in the same manner as GPATCH4P1-EGFP fusion protein. For cell experiments, Jurkat cells were dispensed into 24 well plates at 1.5 X 10 ⁶ /well, and then suspended in 2 ml of RPMI 1640 medium containing 10% Fetal Bovine Serum and 1% penicillin/streptomycin to finalize the CPP-EGFP fusion protein. After treatment with 5 μM, the cells were cultured in a 5% CO ₂ incubator maintained at 37° C. for 2 hours. Thereafter, the medium containing the cells was transferred to a 5 ml tube, and then centrifuged to remove the supernatant and washed three times with PBS solution. Thereafter, the Jurkat cells were suspended in 650 μl of PBS, and then the fluorescence of CPP-EGFP introduced into the cells was measured through a flow cytometer to confirm the efficiency of cell introduction (FIG. 6). Through this, it was confirmed that the GPATCH4P1 showed higher efficiency than the existing cell permeation peptides.

Recombinant protein used in Example 3 Recombinant protein used in Example 3 Eumseong Control Wild type EGFP Experimental group Fusion protein of recombinant GPATCH4P1 purified in Example 2, GPATCH4P1-EGFP
Positive control TAT-EGFP (Hph-1)-EGFP NP2 EGFP

In order to confirm the efficiency of introduction of the GPATCH41P-EGFP fusion protein by concentration, a comparative experiment was conducted using the EGFP protein and the fusion protein of TAT and EGFP, the most widely used cell permeation peptides. EGFP, TAT-EGFP and GPATCH4P1-EGFP fusion proteins were treated in Jurkat cells at final concentrations of 0.5, 1, 2, 5, and 10 μM, respectively, and the introduction efficiency was confirmed through the same procedure as in the previous experiment (FIG. 7). Through this, it was confirmed that the GPATCH4P1-EGFP fusion protein was introduced into the cell in a concentration-dependent manner, and it was confirmed that it showed a higher delivery efficiency at all concentrations compared to the TAT-EGFP fusion protein.

Next, in order to confirm the efficiency of introduction of the GPATCH4P1-EGFP fusion protein by time, a comparative experiment was conducted using EGFP and TAT-EGFP fusion proteins. EGFP, TAT-EGFP, and GPATCH4P1-EGFP fusion proteins were treated with Jurkat cells at a final concentration of 5 μM, respectively, and cultured for 0.5, 1, 2, 4, and 6 hours, respectively. It was confirmed (Fig. 8). Through this, it was confirmed that the GPATCH4P1-EGFP fusion protein was introduced into cells in a time-dependent manner, and it was confirmed that it showed a higher delivery efficiency at all times compared to the TAT-EGFP fusion protein.

<Example 4> Confirmation of intracellular delivery pattern of GPATCH4P1-EGFP fusion protein

To confirm the GPATCH4P1-EGFP fusion protein introduced into the cell by confocal microscopy, first HeLa cells are dispensed into a 24 well cell culture slide with 2 X 10 ⁴ /well, and then contain 10% Fetal Bovine Serum and 1% penicillin/streptomycin The cells were suspended in 500 μl of DMEM medium and cultured for 18 hours in a 5% CO ₂ incubator maintained at 37°C. Thereafter, EGFP and GPATCH4P1-EGFP fusion proteins were treated with cells at a final concentration of 10 μM, and then cultured for 1 hour. After this, the culture solution was removed, washed three times with PBS solution, and then treated with 4% PFA solution at room temperature for 30 minutes to fix it. After removing the PFA solution, washed again with PBS solution three times, treated with a mounting medium, covered with a cover slide, and observed with a confocal microscope (FIG. 9). Through this, it was confirmed that the GPATCH4P1-EGFP fusion protein was effectively introduced into HeLa cells.

<Example 5> GPATCH4P1 mutant-EGFP fusion protein intracellular delivery efficiency confirmation

In order to study the efficiency of intracellular delivery of the GPATCH4P1 variant, the GPATCH4P1 mutant, which replaced glutamine, the ninth amino acid of GPATCH4P1 with another amino acid, and the GPATCH4P1 mutant, each of which was removed by one of the N-terminal and C-terminal amino acids, were designed. Thereafter, a plasmid vector expressing the GPATCH4P1 mutant-EGFP fusion protein was produced and then purified by expressing the protein. For cell experiments, Jurkat cells were dispensed into 24 well plates at 1.5 X 10 ⁶ /well, and then suspended in 2 ml of RPMI 1640 medium containing 10% Fetal Bovine Serum and 1% penicillin/streptomycin to finalize the concentration of the CPP-EGFP fusion protein. After treatment with 5 μM, the cells were cultured in a 5% CO ₂ incubator maintained at 37° C. for 2 hours. Thereafter, the medium containing the cells was transferred to a 5 ml tube, followed by centrifugation to remove the supernatant and washing three times with PBS solution. Thereafter, the Jurkat cells were suspended in 650 μl of PBS, and then the fluorescence of GPATCH4P1 mutant-EGFP fusion proteins introduced into the cells was measured through a flow cytometer to confirm the efficiency of intracellular introduction (FIG. 10 ). Through this, it was confirmed that GPATCH4P1 mutants exhibited a change in introduction efficiency through mutation, but maintained cell permeability.

<110> KRICT <120> Cell penetrating Domain derived from human GPATCH4 protein <130> M18-5795-A <150> KR 10-2018-0165439 <151> 2018-12-19 <160> 11 <170> KoPatentIn 3.0 <210> 1 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> GPATCH4P1 <400> 1 Lys Lys Lys Lys Lys Lys Arg Arg Gln Lys 1 5 10 <210> 2 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> GPATCH4P1-M1 <400> 2 Lys Lys Lys Lys Lys Lys Arg Arg Tyr Lys 1 5 10 <210> 3 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> GPATCH4P1-M2 <400> 3 Lys Lys Lys Lys Lys Lys Arg Arg Glu Lys 1 5 10 <210> 4 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> GPATCH4P1-M3 <400> 4 Lys Lys Lys Lys Lys Lys Arg Arg Lys Lys 1 5 10 <210> 5 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> GPATCH4P1-M4 <400> 5 Lys Lys Lys Lys Lys Lys Arg Arg Gly Lys 1 5 10 <210> 6 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> GPATCH4P1-M5 <400> 6 Lys Lys Lys Lys Lys Lys Arg Arg Gln 1 5 <210> 7 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> GPATCH4P1-M6 <400> 7 Lys Lys Lys Lys Lys Arg Arg Gln Lys 1 5 <210> 8 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> GPATCH4P1 expression nucleic acid <400> 8 aaaaaaaaga aaaagaaaag gaggcagaaa 30 <210> 9 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> GPATCH4P1 synthesis nucleic acid <400> 9 aaaaaaaaga agaagaaacg gagacaaaaa 30 <210> 10 <211> 720 <212> DNA <213> Artificial Sequence <220> <223> GPATCH4P1 EGFP nucleic acid <400> 10 atggtgagca agggcgagga gctgttcacc ggggtggtgc ccatcctggt cgagctggac 60 ggcgacgtaa acggccacaa gttcagcgtg tccggcgagg gcgagggcga tgccacctac 120 ggcaagctga ccctgaagtt catctgcacc accggcaagc tgcccgtgcc ctggcccacc 180 ctcgtgacca ccctgaccta cggcgtgcag tgcttcagcc gctaccccga ccacatgaag 240 cagcacgact tcttcaagtc cgccatgccc gaaggctacg tccaggagcg caccatcttc 300 ttcaaggacg acggcaacta caagacccgc gccgaggtga agttcgaggg cgacaccctg 360 gtgaaccgca tcgagctgaa gggcatcgac ttcaaggagg acggcaacat cctggggcac 420 aagctggagt acaactacaa cagccacaac gtctatatca tggccgacaa gcagaagaac 480 ggcatcaagg tgaacttcaa gatccgccac aacatcgagg acggcagcgt gcagctcgcc 540 gaccactacc agcagaacac ccccatcggc gacggccccg tgctgctgcc cgacaaccac 600 tacctgagca cccagtccgc cctgagcaaa gaccccaacg agaagcgcga tcacatggtc 660 ctgctggagt tcgtgaccgc cgccgggatc actctcggca tggacgagct gtacaagtaa 720 720 <210> 11 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> linker <400> 11 ggaggtgggg gctcg 15

Claims (10)

Cell membrane permeation domain comprising the polypeptide of any one of SEQ ID NOs: 1 to 7 derived from human GPATCH4 (G-Patch Domain Containing 4) protein
A recombinant cargo having improved cell membrane permeability, comprising a cell membrane permeation domain of claim 1 and a cargo fused to the N-terminal or C-terminal of the cell membrane permeation domain.
The recombinant cargo of claim 2, wherein the cargo is a protein, nucleic acid, lipid or compound.
The method according to claim 2, wherein the cargo is a hormone, an immunoglobulin, an antibody, a structural protein, a signaling peptide, a storage peptide, a membrane peptide, a transmembrane peptide, an inner peptide, an outer peptide, a secretory peptide, a viral peptide, a native (native). Recombinant cargo, which is any one selected from the group of peptides, glycosylated proteins, fragmented proteins, disulfide peptides, recombinant proteins, chemically modified proteins and prions.
3. The recombinant cargo of claim 2, wherein the cargo is any one selected from the group consisting of nucleic acids, coding nucleic acid sequences, mRNA, antisense RNA molecules, carbohydrates, lipids and glycolipids.
3. The recombinant cargo of claim 2, wherein the cargo is a contrast agent, drug or chemical.
A gene construct comprising a polynucleotide encoding the cell membrane permeation domain of claim 1.
An expression vector for expressing a recombinant cargo protein having improved cell membrane permeability, comprising the gene construct of claim 7
Preparing a recombinant cargo fused to the N-terminal or C-terminal of the cell membrane permeation domain of claim 1; And contacting the prepared recombinant cargo with isolated cells.
Preparing a recombinant cargo fused to the N-terminal or C-terminal of the cell membrane permeation domain of claim 1; And administering the prepared recombinant cargo to animals other than humans.

Images