JP2023511501A - Novel intracellular delivery method - Google Patents

Abstract

An isolated, non-naturally occurring cell membrane penetrating peptide (CPP) comprising the amino acid sequence: RRSRTARAGRPGRNSSRPSAPR [SEQ ID NO:1] and a sequence having at least 60% similarity to SEQ ID NO:1. [Selection figure] None

Description

FIELD OF THE DISCLOSURE The present disclosure relates generally to cell membrane penetrating peptides and related compositions.

Peptides are attractive diagnostic and therapeutic agents because of their high potency and target specificity. However, one of the challenges to the wider adoption of peptides as therapeutic agents is that most peptides can be used in various ways within organs (e.g., the eye), since various tissue layers generally act as barriers to intracellular entry of peptides. organization is inaccessible. In addition, pre-existing peptides and any bound cargo are normally trapped in the endosomal and lysosomal compartments of the cell.

Cell membrane penetrating peptides (CPPs) are peptides that facilitate the cellular uptake/uptake of various molecular cargoes (from nano-sized particles to small chemical molecules, other peptides, proteins, oligonucleotides, and fragments of DNA). is a class. A "cargo" is attached to a peptide either through a covalent chemical bond or through non-covalent interactions. The function of CPPs is to deliver cargo to cells, a process that normally occurs by endocytosis. The lack of cell specificity in CPP-mediated cargo delivery limits its current use.

The in vivo failure of most in vitro-validated CPP modalities is evidenced by the lack of CPP-delivered drug in the clinic. The problem is that the complexity of the problem of CPP-mediated delivery increases significantly as single cell entry progresses from an in vitro environment to an in vivo environment. Canonical CPPs such as R8, Tat, and penetratin show in vitro and in vivo uptake as evidenced by fluorescently labeled CPP traces. However, none of these examples have led to meaningful functional changes in disease states when combined with therapeutic cargo. When the utility of CPP-mediated cargo delivery is combined with the limited and lack of cell-specificity of existing peptides, it appears that any relevant cargo is normally trapped in cellular endosomal and lysosomal compartments.

In vivo, linear CPPs containing highly charged cationic peptides with consecutive positively charged amino acids are known to be sequestered by glycosylation and trapped in endosomes/lysosomes, causing membrane deformation. It has been demonstrated to bind phospholipid headgroups. Enhancing CPP activity by increasing amphiphilicity is a known design strategy to increase uptake in vitro and possibly in vivo due to toxicity caused by increased membrane deformation and disruption. does not improve delivery in

Furthermore, the ubiquitous presence of trypsin and serine endopeptidases, as well as other proteases in vivo, cause rapid degradation of cation-rich peptides.

Therefore, to fully exploit the advantages of cell membrane permeable peptide delivery therapeutics, compositions and methods for delivery of peptides and associated payloads to specific tissues within tissues and organs in vivo. There is a continuing need to develop methods.

The present invention seeks to provide improved or alternative cell membrane penetrating peptides.

The previous discussion of the background art is only intended to facilitate understanding of the invention. The discussion does not constitute an admission or admission that any of the referenced material was or was part of the general knowledge at the priority date of the application.

The present invention provides the amino acid sequence RRSRTARAGRPGRNSSRPSAPR [SEQ ID NO: 1]
and an isolated, non-naturally occurring cell membrane penetrating peptide (CPP) comprising a sequence having at least 60% similarity to SEQ ID NO:1.

The sequences of the invention are at least 65%, 70%, 75%, 80% or 85% similar, preferably at least about 90, 95% or 98% similar to SEQ ID NO: 1 at the amino acid level. may have gender.

Preferably, the CPP is modified with one or more of the following non-canonical amino acids, fatty acids, detectable labels, oligonucleotides, cholesterol, and the use of reactive groups.

Preferably, the CPP is conjugated to the molecule of interest. Molecules of interest may be selected from the following therapeutic agents, oligonucleotides, additional peptides or proteins, reactive groups, fatty acids, cholesterol, or detectable labels. Preferably, conjugation is performed using covalent or non-covalent interactions.

The present invention further provides a CPP of SEQ ID NO: 1 and a sequence having at least 60% similarity to SEQ ID NO: 1, or a CPP of SEQ ID NO: 1 and at least 60% to SEQ ID NO: 1 conjugated to a molecule of interest. A modified cell is provided that contains a sequence having similarity to

The present invention further provides CPPs of SEQ ID NO: 1 and sequences having at least 60% similarity to SEQ ID NO: 1, CPPs and sequences of SEQ ID NO: 1 conjugated to molecules of interest in the manufacture of pharmaceuticals or diagnostics. Use of sequences having at least 60% similarity to number 1, or modified cells containing any of these is provided.

A CPP of SEQ ID NO: 1 and a sequence having at least 60% similarity to SEQ ID NO: 1, a CPP of SEQ ID NO: 1 and a sequence having at least 60% similarity to SEQ ID NO: 1, conjugated to a molecule of interest as a drug or diagnostic agent Use of sequences with similarity, or modified cells containing any of these.

(i) the CPP of SEQ ID NO: 1 and a sequence having at least 60% similarity to SEQ ID NO: 1, the CPP of SEQ ID NO: 1 and having at least 60% similarity to SEQ ID NO: 1, conjugated to the molecule of interest; A kit comprising a sequence, or a modified cell comprising either of these, and (ii) instructions for use.

Further features of the invention are more fully described in the following description of some non-limiting embodiments thereof. This description is included only for the purpose of illustrating the invention. It should not be construed as a limitation on the above broad summary, disclosure or description of the invention. The description will be made with reference to the accompanying drawings.

Graph of efficacy of SMN1 exon 7 skipping 48 hours after treatment with peptide-SMN1 conjugates and SMN1 alone. Graph of cell viability after 48 hours of treatment with peptide-SMN1 conjugates and SMN1 alone. FIG. 4 is a graph of the efficacy of Smn exon 7 skipping generated with CPP of SEQ ID NO: 1 conjugated to Smn PMO in RPE/choroidal cells in vivo. FIG. 4 is a graph of the efficacy of Smn exon 7 skipping generated with CPP of SEQ ID NO: 1 conjugated to Smn PMO in retinal cells in vivo. Graph of GFAP in vivo toxicity of CPP of SEQ ID NO: 1 conjugated to Smn PMO 5 days after injection.

Cell membrane penetrating peptides Characteristics of cell membrane penetrating peptides (CPPs) involved in enhancing in vitro performance, e.g., linear CPPs comprising highly charged cationic peptides with consecutive positively charged amino acids, are often It does not lead to in vivo results. Efficacy of CPPs is closely related to toxicity, and an optimal balance between efficacy and toxicity is required for both good in vitro and in vivo CPPs. One of the key hurdles to overcome is trapping CPP cargo moieties within endosomes and lysosomes. Here, we present an assay that requires nuclear localization of CPP cargoes to provide a functional readout and thus, if effective, endosomal/lysosomal escape and/or Shows nuclear delivery. The inventors have identified CPPs that lead to good delivery of cargoes, such as amino acid sequences, including antisense oligonucleotides, to the nucleus of cells.

Thus the amino acid sequence:
RRSRTARAGRPGRNSSRPSAPR [SEQ ID NO: 1]
and a sequence having at least 60% similarity to SEQ ID NO:1.

Preferably, the CPP contains 10-100 residues. For example, a CPP may comprise 10-50 residues, 20-30 residues, 20-40 residues, 30-70 residues, 40-60 residues, or 25-50 residues.

Amino acid sequence analogs of SEQ ID NO: 1 include those having an amino acid sequence in which one or more of the amino acids are replaced with another amino acid, the replacement substantially rendering the molecule's biological activity (cell penetration ability). do not change substantially. These amino acid sequence analogs preferably have conservative amino acid substitutions when compared to SEQ ID NO:1.

In the context of the present invention, an analog sequence spans at least 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 100, or 200 amino acids at the amino acid level. is at least 60%, 65%, 70%, 75%, 80% or 85% similar, preferably at least about 90, 95% or 98% similar to the amino acid sequence set forth in SEQ ID NO: 1 is intended to include CCP amino acid sequences having a specific character. In particular, similarity should generally be considered with respect to those regions of the sequence that are known to be essential for the function of the CPP encoded by SEQ ID NO: 1, rather than non-essential flanking sequences.

Similar sequences are at least about 60%, 65%, 70%, 75%, 80%, 85% identical, preferably at least about 90%, 95% or 98% identical to SEQ ID NO:1 (ie identical residues). Analog sequences have at least about 60%, 65%, 70%, 75%, 80%, 85% similarity, preferably at least about 90%, 95%, or 98% similarity with SEQ ID NO:1. (ie residues conserved with similar physico-chemical properties).

Similarity comparisons can be performed visually or, more commonly, using readily available sequence comparison programs. These commercially available computer programs can calculate % similarity between two or more sequences. % similarity may be calculated for contiguous sequences, i.e., one sequence is aligned with the other sequence and each amino acid of one sequence is compared with that of the other sequence, one residue at a time. A direct comparison is made with the corresponding amino acid. This is called an "ungapped" alignment. Usually, such ungapped alignments are performed only over a relatively short number of residues (eg, less than 50 contiguous amino acids).

Although this is a very simple and consistent method, for example, in a pair of otherwise nearly identical sequences, a single insertion or deletion causes the following amino acid residues to fall out of alignment, thereby , potentially resulting in a drastic reduction in % similarity and identity when global alignments are performed. Accordingly, most sequence comparison methods are designed to produce optimal alignments that take into account possible insertions and deletions without penalizing unduly the overall similarity score. This is accomplished by inserting "gaps" in the sequence alignment in an attempt to maximize local homology.

Amino acid sequence identities and similarities may be determined using the EMBOSS pairwise alignment algorithm tool available from the European Bioinformatics Institute, part of the European Molecular Biology Institute (EMBL-EBI). This tool is available at www. ebi. ac. It is accessible from the website at uk/Tools/emboss/align/. This tool utilizes the Needleman-Wunsch global alignment algorithm (Needleman and Wunsch, 1970). Default settings are utilized including Gap Open: 10.0 and Gap Extend 0.5. The default matrix "Blosum62" is used for the amino acid sequence and default matrix.

The term "cell membrane penetrating peptide" (CPP) refers to peptides that are capable of crossing the cell membrane. In one example, CPPs are able to translocate across mammalian cell membranes and enter cells. In another example, a CPP can direct a conjugate to a desired intracellular compartment. Thus, CPPs can direct or facilitate penetration of molecules of interest across phospholipids, cells, mitochondria, endosomes, lysosomes, vesicles, or nuclear membranes. CPPs may be translocated across membranes and the amino acid sequence may be intact or partially degraded.

CPPs can direct molecules of interest from outside the cell across the plasma membrane to the cytoplasm or desired intracellular compartment. Alternatively or additionally, CPPs may direct molecules of interest across the blood-brain, transmucosal, blood-retinal, skin, gastrointestinal and/or lung barriers.

The ability of CPPs to translocate across membranes may be energy dependent or independent and/or receptor dependent or independent. In some examples, a CPP is a peptide that is demonstrated to translocate across the plasma membrane, as determined by the methods described herein. CPPs are (i) peptides that are internalized into the cell but are then trapped in endosomes or lysosomes, and (ii) not only internalized into the cell, but also into endosomes and lysosomes. and/or peptides capable of escaping from lysosomal compartments and also mediating intracellular delivery to the cytosol and nucleus, mitochondria, Golgi apparatus, and other intracellular compartments.

In some examples, the peptide has 1-2, 1-5, or 10 conservative amino acid substitutions, eg, 1, 2, 3, 4, 5, compared to any of the sequences described herein. , 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 conservative amino acid substitutions. Conservative substitutions (also called conservative mutations or conservative substitutions) are those in which an amino acid residue is replaced with another amino acid residue with a side chain that has similar physicochemical properties, resulting in a protein with a different amino acid sequence. Amino acid substitutions that result in similar biochemical properties (eg, charge, hydrophobicity, and size).

Amino acid residues with side chains having similar physico-chemical properties are known in the art and include amino acids with basic side chains (e.g. lysine, arginine, histidine), amino acids with acidic side chains (e.g. , aspartic acid, glutamic acid), amino acids with uncharged polar side chains (e.g. glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine, tryptophan), amino acids with nonpolar side chains (e.g. alanine, valine, leucine , isoleucine, proline, phenylalanine, methionine), beta-branched side chains (eg, threonine, valine, isoleucine) and amino acids with aromatic side chains (eg, tyrosine, phenylalanine, tryptophan, histidine). Conservative amino acid substitutions include those with amino acids that are substituted with non-naturally occurring amino acids and non-proteinogenic amino acids that are therefore not among the normal amino acids encoded in the genetic code. . Conservative amino acid substitutions also include D-amino acids.

The term "basic amino acid" refers to an isoelectric point greater than 6.3 (measured according to Kice & Marvell "Modern Principles of Organic Chemistry" (Macmillan, 1974) or Matthews and van Holde "Biochemistry" Cummings Publishing Company, 1996). Any amino acid, including natural and unnatural amino acids having Included in this definition are arginine, lysine, histidine, and homoarginine (Har), and derivatives thereof. Suitable non-natural basic amino acids are described in US Pat. No. 6,858,396.

In some examples, the amino acid sequence of any of the CPP peptides is 20-100 residues, such as 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or another number of 20-100 residues. In other examples, the amino acid sequence of any of the above peptides has 30-70 residues, such as 35, 40, 45, 48, 50, 52, 60, 65, or another number of 30-70 residues. consists of residues of In other examples, the amino acid sequence of any of the above peptides has 40-60 residues, such as 42, 43, 45, 48, 50, 52, 54, 57, 58, or another 40-60 residues. number of residues. In some examples, the amino acid sequence of any of the peptides described above is 35-50 residues, such as another consists of a number of residues. In still other examples, the amino acid sequence of any of the above peptides has 20-50 residues, such as 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 32, , 37, 38, 40, 42, 46, 48, or another number of 20-50 residues.

In one example, the amino acid sequence of the peptide consists of the amino acid sequence corresponding to SEQ ID NO:1. For the avoidance of doubt, in such instances the amino acid sequence of the peptide consists of the amino acid sequence corresponding to SEQ ID NO: 1, although the peptide may nevertheless contain chemical modifications that do not alter the amino acid sequence. should be understood. Such modifications include the use of non-canonical amino acids, fatty acids, detectable labels, polynucleotides, cholesterol, and reactive groups; conjugation of CPPs with non-peptide linkers; conjugation of CPPs with molecules of interest ( therapeutic agents, oligonucleotides, and detectable labels). In other examples, the CPP consists of the amino acid sequence corresponding to SEQ ID NO:1.

In one embodiment, the CCP comprises multiple copies of the amino acid sequence corresponding to SEQ ID NO: 1 and sequences having at least 60% similarity to SEQ ID NO: 1, referred to herein as multimeric peptides. In some examples, the multimeric peptide has 2-10 copies of the amino acid sequence corresponding to SEQ ID NO:1, such as 2, 3, 4, 5, 6, 7, 8, Contains 9 or 10 copies. In one embodiment, the CCP comprises multiple copies of the amino acid sequence corresponding to SEQ ID NO:1 and sequences having at least 60% similarity to SEQ ID NO:1.

Modified CPP
CPPs may be modified by using non-canonical amino acids, fatty acids, detectable labels, polynucleotides, cholesterol, and reactive groups. Such modified peptides may be added to CPPs to enhance detection of peptide entry, localize intracellularly, enhance entry into cells, and/or reduce peptide degradation in vitro or in vivo. may be given the function of

Non-Canonical Amino Acids In some examples, CPPs are modified peptides that include non-canonical amino acids. Suitable non-canonical amino acids include α-amino-n-butyric acid, norvaline, norleucine, alloisoleucine, t-leucine, ornithine, allothreonine, β-alanine, β-amino-n-butyric acid, n-isopropylglycine, isoserine. , sarcosine, 6-aminohexanoic acid, gamma-aminobutyric acid, and 5-aminovaleric acid.

Reactive Groups In another example, the modified CPP may include reactive groups. Suitable reactive groups include, but are not limited to, azide groups, amine-reactive groups, thiol-reactive groups, and carbonyl-reactive groups. In some examples, the reactive group is part of a chemical tag. Suitable chemical tags include, but are not limited to, SNAP tags, CLIP tags, HaloTag, or TMP tags. In one example, the chemical tag is a SNAP tag or a CLIP tag. SNAP and CLIP fusion proteins allow the specific covalent attachment of virtually any molecule to a protein or peptide of interest, eg, as described in Correa 2015 (Methods Mol Biol, 1266:55-79). In another example, the chemical tag is HaloTag. HaloTag comprises a modular protein tagging system that allows covalent attachment of a variety of molecules in solution, in live cells, or in chemically fixed cells. In another example, the chemical tag is a TMP tag. The TMP tag can label intracellular proteins with high selectivity, but not on the cell surface.

Fatty Acids In some examples, modified CPPs may include fatty acids. Suitable fatty acids for modified peptides include, but are not limited to, palmitic acid, myristic acid, caprylic acid, lauric acid, n-octanoic acid, and n-decanoic acid.

Cholesterol In another example, a modified CPP may comprise cholesterol.

Oligonucleotides In some examples, a modified CPP may comprise an oligonucleotide. In such cases, the oligonucleotide may be an antisense oligonucleotide, siRNA, microRNA, RNAi, single-stranded DNA or RNA oligonucleotide, double-stranded DNA oligonucleotide, mRNA, or plasmid.

Detectable Labels In some examples, a modified CPP may include a detectable label. The term "detectable label" refers to any type of molecule that can be detected by optical, fluorescent, isotopic imaging or by mass spectrometric techniques or by performing simple enzymatic assays. . Any detectable label known in the art may be used. In some examples, the detectable label is selected among reporter proteins, fluorophores, fluorescent substrates, luminescent substrates, and biotin.

A detectable label may be a reporter protein. Suitable reporter proteins include fluorescent proteins as described herein, beta-lactamases, haloalkane dehalogenases, or luciferases as described in Qureshi (2007), Biotechniques, 42(1):91-95. In some examples, the reporter protein comprises a beta-lactamase amino acid sequence.

A detectable label may be a fluorescent tag. For example, fluorescent tags include fluorophores such as fluorescein isothiocyanate, fluorescein thiosemicarbazide, rhodamine, Texas Red, CyDye, such as Cy3, Cy5, and Cy5.5, Alexa Fluor (eg, Alexa488, Alexa555, Alexa594, and Alexa647), or a near-infrared fluorescent dye. Fluorescent tags include fluorescent proteins such as green fluorescent protein (GFP), enhanced green fluorescent protein (EGFP), AcGFP or TurboGFP, emerald, thistle green, ZsGreen, EBFP, sapphire, T-sapphire, ECFP, mCFP, cerulean, CyPet , AmCyanl, Acropora, mTFPl (Teal), Enhanced Yellow Fluorescent Protein (EYFP), Topaz, Venus, mCitrine, YPet, PhiYFP, ZsYellowl, mBanana, Kusabira, ange, mOrange, dTomato, dTomato-Tandem, AsRed2, mdRFPl, Jred , mCherry, HcRedl, mRaspberry, HcRedl, HcRed-Tandem, mPlum, AQ143. Fluorescent tags may be quantum dots. Fluorescent tags can be pH sensitive fluorophores such as naphthofluorescein, pHrodo™ Green (ThermoFisher), and pHrodo™ Red (ThermoFisher). Fluorescent tags may be detected using fluorescence microscopy, eg, epifluorescence or confocal microscopes, fluorescence scanners, eg, microarray readers, spectrofluorometers, microplate readers, and/or flow cytometers.

A detectable label may be a luminescent substrate. Suitable luminescent substrates include, but are not limited to D-luciferin, L-luciferin, coelenterazine.

A detectable label may be an epitope tag. For example, the epitope tag can be a polyhistidine tag, such as a hexahistidine tag or dodecahistidine, FLAG tag, Myc tag, HA tag, GST tag, or V5 tag. Epitope tags are routinely detected with commercially available antibodies. One skilled in the art will recognize that epitope tags can facilitate purification and/or detection. For example, a CPP containing a hexahistidine tag is contacted with a sample containing protein, for example nickel-nitrilotriacetic acid (Ni-NTA), which specifically binds to the hexahistidine tag immobilized on a solid or semi-solid support. and washing the sample to remove unbound protein, followed by elution of bound protein, using methods known in the art. Alternatively or additionally, ligands or antibodies that bind epitope tags may be used in affinity purification methods.

The detectable label may be a mass tag or an isobaric tag. Such tags may be used for relative absolute quantification (iTRAQ). Masstags are chemical labels used for mass spectrometry-based quantification of proteins and peptides. In such methods, the mass spectrometer recognizes the difference in mass between labeled and unlabeled forms of a protein or peptide, see for example Bantscheff et al. Quantification is achieved by comparing the respective signal intensities as described in 2007. Examples of master tags include TMTzero, TMTduplex, TMTsixplex, and TMT 10-plex. Isobaric tags for relative and absolute quantification (iTRAQ) are described, for example, in Wiese et al. 2007, are chemical tags used in quantitative proteomics by tandem mass spectrometry to determine the abundance of proteins from different sources in a single experiment.

Conjugated Cargo CPPs may be conjugated to a molecule of interest (ie, "cargo") to increase delivery of the molecule of interest to the cell. Molecules of interest include therapeutic agents, oligonucleotides, additional peptides or proteins, reactive groups, fatty acids, cholesterol, or detectable labels. Conjugation may be through covalent or non-covalent interactions. For example, a CPP may be conjugated to an oligonucleotide via a "peptide linker." Moieties may be designed to act on specific intracellular targets or to direct trafficking to specific intracellular compartments.

A molecule of interest may be covalently attached to an amino acid of a CPP peptide. In one example, the covalently attached molecule of interest is covalently attached to the N-terminus of the CPP amino acid sequence. In another example, the covalently binding molecule of interest is covalently attached to the C-terminus of the CPP amino acid sequence. In other examples, the covalently attached molecule of interest is covalently attached via an amino acid residue side chain (eg, at an internal lysine or cysteine residue) of the CPP. Those skilled in the art recognize that this includes, but is not limited to, peptide bond formation, amide bond formation, binding via reactive amines, hydrazone formation, disulfide formation, ether bonding, click chemistry (both copper-catalyzed and strain-facilitated), stau We recognize that this can be accomplished through a variety of chemical reactions, including the Dinger reaction, native chemical ligation, and conjugation chemistry, eg, SpyCatcher/SpyTag isopeptide bond formation.

In some examples, the molecule of interest comprises, for example, one or more charged amino acid residues in the CPP and one or more functional groups within the molecule of interest that are oppositely charged to the one or more CPP amino acid residues. It is non-covalently bound to the CPP via non-covalent interactions between the groups. Non-covalent interactions can be electrostatic interactions, van der Waals forces, pi bond interactions, and hydrophobic interactions.

Therapeutic Agents In some examples, a conjugate molecule of interest can be a therapeutic agent, preferably a small molecule compound (generally less than about 900 daltons in size). In some examples, small molecule therapeutics are chemotherapeutic agents, cytotoxic molecules, or cytostatic molecules.

Oligonucleotides In some examples, a conjugate molecule of interest may be an oligonucleotide. Oligonucleotides may be antisense oligonucleotides, siRNA, microRNA, RNAi, single-stranded DNA or RNA oligonucleotides, double-stranded DNA oligonucleotides, mRNA, or plasmids. Oligonucleotides may include morpholino oligonucleotides (PMO), peptide nucleic acids (PNA), locked nucleic acids (LNA), and 2'-O-methyl oligonucleotides. Oligonucleotides have (i) modified backbone structures, e.g., backbones other than the standard phosphodiester linkages found in naturally occurring oligonucleotides and polynucleotides, and/or (ii) modified sugar moieties, e.g. It may have a morpholino moiety rather than a deoxyribose moiety.

Peptides or Proteins In some examples, a conjugate molecule of interest may be a protein or peptide. The proteins or peptides are pro-apoptotic peptides, targeting proteins, cytotoxic proteins, enzymatic proteins, reporter proteins, peptide-based protein-protein interaction inhibitors, proteolytic targeting chimeric (PROTAC) peptides, and dominant-negative peptides. good.

In some examples, the enzymatic protein can be ASS-1 (Quinonez and Thoene 2004) or beta-lactamase (Stone et al 2018); the peptide interaction inhibitor blocks the KRAS/SOS-1 protein interaction. can be peptides (eg, Leshchiner et al 2015); proteolytic targeting chimeric (PROTAC) peptide sequences are described in Sakamoto et al 2001 or Gu et al. 2018.

In some examples, the protein or peptide may be a pro-apoptotic peptide.

In some examples, a protein or peptide may be a target protein. Target proteins can confer increased specificity to the peptide conjugate by binding to specific cell surface antigens (eg, receptors), which are then internalized into endosomes. Examples of target proteins include, but are not limited to, affibodies, scFvs, single chain antibodies, and other selective binding proteins using alternative scaffolds (eg, peptide aptamers). Alternatively, the targeting protein may be a genomic targeting protein (eg, a Cas9 genomic targeting protein or a Cpf1 genomic targeting protein).

In other examples, the protein or peptide may be a cytotoxic protein (eg, buganin or diphtheria toxin) that induces rapid cell death upon internalization and escape from the endosome.

In some examples, the protein or peptide may be a dominant negative peptide. Dominant-negative peptides generally act to inhibit one or more functions of the protein from which they are derived and/or the functions of the full-length protein's interaction partners. Usually they act by interfering with the interaction of a protein with one or more of its binding partners. In some examples, the dominant-negative transcription factor peptide is an anti-cancer peptide. Suitable anti-cancer peptides include activating transcription factor 5 (ATF5) dominant negative peptide d/n-ATF5 as described in Massler et al (2016), Clin Cancer Res, 22(18):4698-4711 - anti-Ras-p21 dominant, such as ras-p21 96-110 (PNC-2) and ras-p21 35-47 described in S1, Adler et al (2008), Cancer Chemother Pharmacol, 62(3):491-498 Negative peptides include, but are not limited to.

Reactive Groups In some examples, a conjugate molecule of interest can be a reactive group. Suitable reactive groups include, but are not limited to, azide groups, amine-reactive groups, thiol-reactive groups, and carbonyl-reactive groups. In some examples, the reactive group is part of a chemical tag. Suitable chemical tags include, but are not limited to, SNAP tags, CLIP tags, HaloTag, or TMP tags. In one example, the chemical tag is a SNAP tag or a CLIP tag. SNAP and CLIP fusion proteins allow the specific covalent attachment of virtually any molecule to a protein or peptide of interest, eg, as described in Correa 2015 (Methods Mol Biol, 1266:55-79). In another example, the chemical tag is HaloTag. HaloTag comprises a modular protein tagging system that allows covalent attachment of a variety of molecules in solution, in live cells, or in chemically fixed cells. In another example, the chemical tag is a TMP tag. The TMP tag can label intracellular proteins with high selectivity, but not on the cell surface.

Fatty Acids In some examples, a conjugate molecule of interest can be a fatty acid. Suitable fatty acids for modified peptides include, but are not limited to, palmitic acid, myristic acid, caprylic acid, lauric acid, n-octanoic acid, and n-decanoic acid.

Cholesterol In some examples, a conjugate molecule of interest may be cholesterol.

Detectable Labels In some examples, the conjugate molecule of interest is a detectable label. Detectable labels can be any type of molecule that can be detected by optical, fluorescent, isotopic imaging, by mass spectrometric techniques, or by performing simple enzymatic assays. Any detectable label known in the art may be used. In some examples, the detectable label is selected among reporter proteins, fluorophores, fluorescent substrates, luminescent substrates, and biotin.

A detectable label may be a reporter protein. Suitable reporter proteins include fluorescent proteins as described herein, beta-lactamases, haloalkane dehalogenases, or luciferases as described in Qureshi (2007), Biotechniques, 42(1):91-95. In some examples, the reporter protein comprises a beta-lactamase amino acid sequence.

A detectable label may be a fluorescent tag. For example, fluorescent tags include fluorophores such as fluorescein isothiocyanate, fluorescein thiosemicarbazide, rhodamine, Texas Red, CyDye, such as Cy3, Cy5, and Cy5.5, Alexa Fluor (eg, Alexa488, Alexa555, Alexa594, and Alexa647), or a near-infrared fluorescent dye. Fluorescent tags include fluorescent proteins such as green fluorescent protein (GFP), enhanced green fluorescent protein (EGFP), AcGFP or TurboGFP, emerald, thistle green, ZsGreen, EBFP, sapphire, T-sapphire, ECFP, mCFP, cerulean, CyPet , AmCyanl, Acropora, mTFPl (Teal), Enhanced Yellow Fluorescent Protein (EYFP), Topaz, Venus, mCitrine, YPet, PhiYFP, ZsYellowl, mBanana, Kusabira, ange, mOrange, dTomato, dTomato-Tandem, AsRed2, mdRFPl, Jred , mCherry, HcRedl, mRaspberry, HcRedl, HcRed-Tandem, mPlum, AQ143. Fluorescent tags may be quantum dots. Fluorescent tags can be pH sensitive fluorophores such as naphthofluorescein, pHrodo™ Green (ThermoFisher), and pHrodo™ Red (ThermoFisher). Fluorescent tags may be detected using fluorescence microscopy, eg, epifluorescence or confocal microscopes, fluorescence scanners, eg, microarray readers, spectrofluorometers, microplate readers, and/or flow cytometers.

A detectable label may be a luminescent substrate. Suitable luminescent substrates include, but are not limited to D-luciferin, L-luciferin, coelenterazine.

A detectable label may be an epitope tag. For example, the epitope tag can be a polyhistidine tag, such as a hexahistidine tag or dodecahistidine, FLAG tag, Myc tag, HA tag, GST tag, or V5 tag. Epitope tags are routinely detected with commercially available antibodies. One skilled in the art will recognize that epitope tags can facilitate purification and/or detection. For example, a CPP containing a hexahistidine tag is contacted with a sample containing protein, for example nickel-nitrilotriacetic acid (Ni-NTA), which specifically binds to the hexahistidine tag immobilized on a solid or semi-solid support. and washing the sample to remove unbound protein, followed by elution of bound protein, using methods known in the art. Alternatively or additionally, ligands or antibodies that bind epitope tags may be used in affinity purification methods.

The detectable label may be a mass tag or an isobaric tag. Such tags may be used for relative absolute quantification (iTRAQ). Masstags are chemical labels used for mass spectrometry-based quantification of proteins and peptides. In such methods, the mass spectrometer recognizes the difference in mass between labeled and unlabeled forms of a protein or peptide, see for example Bantscheff et al. Quantification is achieved by comparing the respective signal intensities as described in 2007. Examples of master tags include TMTzero, TMTduplex, TMTsixplex, and TMT 10-plex. Isobaric tags for relative and absolute quantification (iTRAQ) are described, for example, in Wiese et al. 2007, are chemical tags used in quantitative proteomics by tandem mass spectrometry to determine the abundance of proteins from different sources in a single experiment.

Synthesis Any CPP of the present disclosure may be synthesized using chemical methods known to those skilled in the art. For example, synthetic peptides are prepared using known techniques of solid phase, liquid phase, or peptide enrichment, or any combination thereof, and can include natural and/or unnatural amino acids.

Any peptide of the disclosure may be expressed by recombinant means. For example, a nucleic acid encoding a peptide may be placed in operable connection with a promoter or other regulatory sequence capable of regulating expression in a cell system or organism. Representative promoters suitable for expression in bacterial cells include, for example, the lacz promoter, the Ipp promoter, the temperature sensitive λL or λR promoters, the T7 promoter, the T3 promoter, the SP6 promoter, or semi-artificial promoters such as the IPTG-inducible tac promoter. Alternatively, the lacUV5 promoter can be mentioned. Many other genetic construct systems for expressing peptides of the invention in bacterial cells are well known in the art, see, for example, Ausubel et al. (1988), and Sambrook et al. (2001).

A large number of expression vectors have been described for the expression of recombinant peptides in bacterial cells, e.g. Including the expression vector suite (Invitrogen), or the pBAD/Thio-TOPO series of vectors containing an arabinose-inducible promoter (Invitrogen).

For example, Pichia pastoris, S. cerevisiae, and S. Representative promoters suitable for expression in yeast cells, such as yeast cells selected from the group comprising pombe, include the ADH1 promoter, GAL1 promoter, GAL4 promoter, CUP1 promoter, PH05 promoter, nmt promoter, RPR1 promoter, or TEF1 promoter. include, but are not limited to.

Expression vectors for expression in yeast cells are preferred, such as pACT vector (Clontech), pDBleu-X vector, pPIC vector suite (Invitrogen), pGAPZ vector suite (Invitrogen), pHYB vector (Invitrogen), pYD1 vector (Invitrogen). , and pNMT1, pNMT41, pNMT81 TOPO vectors (Invitrogen), pPC86-Y vectors (Invitrogen), pRH series of vectors (Invitrogen), pYESTrp series of vectors (Invitrogen).

Preferred vectors for expression in mammalian cells include, for example, the pcDNA vector suite (Invitrogen), the pTARGET series of vectors (Promega), and the pSV vector suite (Promega).

Suitable methods for transforming and transfecting host cells are described in Sambrook et al. 2001 and other laboratory texts. In one example, nucleic acids may be introduced into prokaryotic cells using, for example, electroporation or calcium chloride-mediated transformation. In another example, the nucleic acid is transfected, for example, by microinjection, co-precipitation of calcium phosphate or calcium chloride, DEAE-dextran-mediated transfection, such as Lipofectamine (Invitrogen) and/or Cellfectin (Invitrogen), PEG-mediated DNA uptake, electrolysis. Liposome-mediated transfection by using transduction with poration, adenovirus, herpes virus, togavirus, or retrovirus, and microenvironment, for example, by using DNA-coated tungsten or gold particles. It may also be introduced into animal cells using particle irradiation. Alternatively, nucleic acids may be introduced into yeast cells using conventional techniques such as, for example, electroporation and PEG-mediated transformation.

After production/expression/synthesis, any protein or peptide of this disclosure can be purified using methods known in the art, such as HPLC. See Scope (Protein Purification: Principles and Practice, Third Edition, Springer Verlag, 1994).

Cellular Expression Also described herein are modified cells containing either a CPP or a CPP conjugated to a molecule of interest as described herein.

Therefore, the present invention provides a CPP of SEQ ID NO: 1 and a sequence having at least 60% similarity to SEQ ID NO: 1, or a CPP of SEQ ID NO: 1 and at least 60 to SEQ ID NO: 1 conjugated to a molecule of interest. % similarity.

The present invention further provides CPPs of SEQ ID NO: 1 and sequences having at least 60% similarity to SEQ ID NO: 1, CPPs and sequences of SEQ ID NO: 1 conjugated to molecules of interest in the manufacture of pharmaceuticals or diagnostics. Use of sequences having at least 60% similarity to number 1, or modified cells containing any of these is provided.

In some examples, modified cells are prokaryotic cells. In other examples, modified cells are eukaryotic cells. Suitable eukaryotic cells include yeast cells and mammalian cells, including but not limited to human cells. In some examples, modified mammalian cells are derived from cell lines. Suitable cell lines include, but are not limited to ARPE-19, CHO-K1, HEK-293, COS7, HeLa, N2a, and NIH 3T3.

In some examples, the modified cell expresses one or more genetically encoded CPPs or CPPs conjugated to a molecule of interest. In other examples, modified cells are primary mammalian cells.

In other examples, the modified cell does not contain an exogenous nucleic acid encoding a CPP or a CPP conjugated to a molecule of interest, but is modified with protein transduction of a CPP or a CPP conjugated to a molecule of interest. .

Preferably, the modified cells are eukaryotic cells. More preferably, eukaryotic cells are mammalian cells. Most preferably, mammalian cells are human cells. In some examples, the human cells are human stem cells. Such human stem cells include, but are not limited to, embryonic stem cells, induced pluripotent stem cells, and mesenchymal stem cells. In further examples, human cells include, but are not limited to, cardiomyocytes, neurons, hepatocytes, and pancreatic islet cells. In other examples, mammalian cells are cancer cells (eg, human cancer cells).

Uses The present disclosure also provides any one of a CPP, a CPP conjugated to a molecule of interest, or a modified cell for use as a drug or diagnostic agent. The disclosure also provides any one of the CPPs, the CPPs conjugated to a molecule of interest, or the modified cells for use in the manufacture of drugs or diagnostic agents.

Therefore, the present invention provides CPP of SEQ ID NO: 1 and sequences having at least 60% similarity to SEQ ID NO: 1, CPP of SEQ ID NO: 1 and CPP of SEQ ID NO: 1 conjugated to a molecule of interest in the manufacture of a medicament or diagnostic agent. Use is provided for sequences having at least 60% similarity to SEQ ID NO: 1, or modified cells containing any of these.

The present invention further provides CPP of SEQ ID NO: 1 and sequences having at least 60% similarity to SEQ ID NO: 1, CPP of SEQ ID NO: 1 and SEQ ID NO: conjugated to a molecule of interest, as pharmaceuticals or diagnostic agents. Sequences with at least 60% similarity to 1, or modified cells containing either of these are provided.

The sequences of the invention are at least 65%, 70%, 75%, 80% or 85% similar, preferably at least about 90, 95% or 98% similar to SEQ ID NO: 1 at the amino acid level. may have gender.

Preferably, the CPP is modified with one or more of the following non-canonical amino acids, fatty acids, detectable labels, oligonucleotides, cholesterol, and the use of reactive groups.

Preferably, the CPP is conjugated to the molecule of interest. Molecules of interest may be selected from the following therapeutic agents, oligonucleotides, additional peptides or proteins, reactive groups, fatty acids, cholesterol, or detectable labels. Preferably, conjugation is performed using covalent or non-covalent interactions.

Kits The present disclosure also provides kits comprising the CPPs of the invention and instructions for use.

Therefore, the present invention provides (i) the CPP of SEQ ID NO: 1 and a sequence having at least 60% similarity to SEQ ID NO: 1, the CPP of SEQ ID NO: 1 and at least SEQ ID NO: 1, conjugated to a molecule of interest. A kit is provided that includes a sequence with 60% similarity, or a modified cell containing either of these, and (ii) instructions for use.

The sequences of the invention are at least 65%, 70%, 75%, 80% or 85% similar, preferably at least about 90, 95% or 98% similar to SEQ ID NO: 1 at the amino acid level. may have gender.

Preferably, the CPP is modified with one or more of the following non-canonical amino acids, fatty acids, detectable labels, oligonucleotides, cholesterol, and the use of reactive groups.

Preferably, the CPP is conjugated to the molecule of interest. Molecules of interest may be selected from the following therapeutic agents, oligonucleotides, additional peptides or proteins, reactive groups, fatty acids, cholesterol, or detectable labels. Preferably, conjugation is performed using covalent or non-covalent interactions.

DEFINITIONS The term "canonical amino acid" refers to amino acids directly encoded by codons of the universal genetic code. Canonical amino acids are alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, and valine.

The term "endogenous" or "endogenously encoded" with respect to a nucleotide or amino acid sequence refers to a virus, cell, or Indicates that it is unique to an organism.

The term "non-naturally occurring" with respect to a peptide means that (i) there is no endogenous gene or open reading frame encoding an amino acid sequence consisting of the amino acid sequence of the peptide in question; will be understood to indicate the absence of endogenous protein fragments consisting of peptides of For example, a peptide consisting of the amino acid sequence of a fragment of an endogenously expressed protein is naturally occurring if the protein fragment itself is not naturally expressed or usually does not occur as a by-product of the endogenously expressed protein. Considered as a non-existing peptide.

The term "peptide" is intended to include compounds composed of amino acid residues linked by amide bonds. Peptides may be naturally or non-naturally occurring ribosome-encoded, or synthetically derived. Usually peptides will consist of 2-200 amino acids. For example, the peptide may be 10-20 amino acids or 10-30 amino acids or 10-40 amino acids or 10-50 amino acids or 10-60 amino acids or 10-70 amino acids or It may have a length in the range of 10-80 amino acids or 10-90 amino acids or 10-100 amino acids. Peptides comprise or consist of less than about 150 amino acids, or less than about 125 amino acids, or less than about 100 amino acids, or less than about 90 amino acids, or less than about 80 amino acids, or less than about 70 amino acids, or less than about 60 amino acids, or less than about 50 amino acids. good too.

Peptides referred to herein are "inverso" peptides in which all L-amino acids are replaced by the corresponding D-amino acids, and peptides in which the sequence of amino acids is reversed, in which all L-amino acids are D - contains "retro-inverso" peptides that are substituted with amino acids.

A peptide may contain both L and/or D amino acids. For example, both L and D forms may be used for various amino acids within the same peptide sequence. In some examples, amino acids within a peptide sequence are in the L form, such as natural amino acids. In some examples, amino acids within a peptide sequence are a combination of L and D forms. In some instances, all amino acids within the peptide sequence are in the D form.

Peptides may be synthesized using well-known solid-phase peptide synthesis and purification techniques.

The term "protein" refers to a single polypeptide chain, i.e., a series of contiguous amino acids joined together by peptide bonds, or a series of polypeptide chains covalently or non-covalently bound to each other (i.e. , polypeptide complexes). For example, a series of polypeptide chains can be covalently linked using suitable chemical or disulfide bonds. Examples of non-covalent bonds include hydrogen bonds, ionic bonds, van der Waals forces, and hydrophobic interactions.

General Those skilled in the art will appreciate that the invention described herein is susceptible to variations and modifications other than those specifically described. The invention includes all such variations and modifications. The present invention includes all steps, features, formulations, and compounds referred to or indicated herein, individually or collectively, and any and all combinations of steps or features or any two or more thereof. include.

Each document, reference, patent application, or patent cited in the text is hereby expressly incorporated by reference in its entirety, this being understood that it is read by the reader as part of the text and It means that it must be considered. It is solely for reasons of brevity that documents, references, patent applications, or patents cited in the text are not repeated in the text.

The manufacturer's instructions, descriptions, product specifications, and product sheets for any product mentioned herein or in any document incorporated herein by reference are hereby incorporated by reference herein. , may be used in the practice of the present invention.

This invention should not be limited in scope by any of the specific embodiments described herein. These embodiments are intended for illustrative purposes only. Functionally equivalent products, formulations and methods are clearly within the scope of the invention described herein.

The invention described herein may include one or more ranges of values (eg, size, displacement, electric field strength, etc.). A range of values includes all values within the range, including the value defining the range and the values adjacent to the range that yield the same or substantially the same results as the values immediately adjacent to that value defining the boundaries of the range. It will be understood to include Accordingly, unless indicated to the contrary, the numerical parameters set forth in the specification and claims are approximations that may vary depending on the desired properties sought to be obtained by the present invention. Thus, "about 80%" also means "about 80%" and "80%." Conservatively, each numerical parameter should be interpreted in light of the number of significant digits and the usual rounding approach.

Throughout this specification, unless the context requires otherwise, the word "comprising" or variations such as "including" or "including" include the specified integer or group of integers, but any other integer or It will be understood to mean excluding integer groups. Also, in the present disclosure, and particularly in the claims and/or paragraphs, terms such as "comprise," "included," "comprising" and the like may have the meanings ascribed thereto under United States patent law, e.g. , they can mean “including,” “included,” “including,” etc., and terms such as “consisting essentially of” and “consisting essentially of” are have a meaning in law ascribed to them, e.g., they enable elements not explicitly recited but affect elements found in the prior art or basic or novel features of the invention It is emphasized that elements are excluded.

Other definitions for selected terms used herein may be found within the detailed description of the invention and apply throughout. Unless otherwise defined, all other scientific and technical terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The term "active agent" may mean one active agent or include two or more active agents.

The following examples are not limited to describing the best mode contemplated for carrying out the various aspects of the invention, but serve to more fully explain how to use the above invention. It is understood that these methods in no way serve to limit the true scope of this invention, but rather are presented for illustrative purposes.

Further features of the present invention are more fully described in the following non-limiting examples. This description is included only for the purpose of illustrating the invention. The above should not be taken as limitations on the general description of the invention.

Example 1
Potential CPP peptides were attached to phosphorodiamidate oligonucleotides (PMOs) targeting exon 7 of the SMN1 gene using strain-accelerated (SPAAC) click chemistry (Agard et al. 2004, Dommerholt et al. 2016). combined (Flynn et al 2018). Peptide-PMO conjugates were incubated on ARPE-19 cells in complete medium for 2 days. Efficacy of internalization was measured by the degree of exon 7 skipping of SMN1 gene RNA transcripts by RNA extraction. Peptide-PMOs with %d7 transcripts higher than PMO treatment alone were considered CPPs.

Introduction of the In Vitro CPP-SMN1 Assay The Survival Motor Neuron (SMN1) gene is ubiquitously expressed and plays an important role in spliceosome assembly and ribonucleoprotein biogenesis. Splicing regulation of the SMN1 gene has been elucidated (Singh et al 2012). A splice variant of SMN1 that skips exon 7 is a known isoform that results in a shorter SMN protein called D7-SMN1. Exon skipping using cell-membrane-penetrating peptide-delivering phosphorodiamidate morpholino oligomers (PMOs) has been established as a viable route to test the efficacy of CPPs (Wu et al. 2007).

Using the SMN1 gene, an exon-skipping assay targeting the SMN1 gene (Flynn et al 2018) at exon 7 using phosphorodiamidate morpholino oligonucleotides (PMOs) conjugated to various CPPs was performed in this study. The inventors have constructed This assay was used to identify CPPs that could efficiently deliver PMO cargo to the nucleus and affect exon skipping of SMN1. Efficiency of delivery and function was determined by measuring changes in D7-SMN1 RNA transcripts using RNA extraction, cDNA generation, and PCR using SMN1-specific primers. Efficiency was interpreted as the higher the percentage of D7-SMN1 transcripts, the better the delivery to the nucleus by CPPs.

Given the nature of this assay, features of the native L-peptide are undesirable due to protease digestion in the presence of full media. To adequately assess the CPP capacity of peptides, peptides were synthesized either as mixed L/D-amino acid-containing peptides, in which all basic residues are D-amino acids, or as fully D-amino acid-containing peptides. Both approaches protected the peptide from proteolysis during incubation in cells.

Methods ARPE-19 cells were obtained from mammalian tissue culture ATCC (ATCC® CRL-2302). Cell lines were maintained in complete medium (DMEM/F12 1:1, 10% FCS; 10 mM HEPES, 1x GlutaMAX™, Pen/Strep 100u) in a 37°C humidified incubator with 5% _CO2 . /ml; Gibco, Thermo Fisher Scientific, Waltham, MA, USA).

Synthesis of Peptides and PMOs, and Conjugation of PPMOs CPPs were synthesized using standard Fmoc SPPS-based methods (Pepscan GmbH, Lelystad, The Netherlands, and Mimotopes, Molgrave, VIC, Australia). All sequences contained a C-terminal azidridine residue that allowed coupling to the PMO. All N-termini were acetylated and C-termini amidated.

SMN1 PMO (ACTTTCCTTCTTTTTTTTTGTCT) [SEQ ID NO: 2] containing a 5' cyclooctyne handle was generated at Gene Tools (Gene Tools LLC, Philomas, Oreg., USA) using a method developed by Summerton and Weller (1997).

Using strain-enhanced click chemistry (SPAAC; Agard et al. 2004; Dommerholt et al. 2016), a CPP peptide with a C-terminal azidridine was chemoselectively conjugated with a 5'-cycloocythine PMO. Cycloaddition reactions between azide-functionalized peptides and cyclooctyne-functionalized PMOs were carried out in phosphate-buffered saline containing 5% DMSO at 37° C. for 3-4 days. Peptide-PMO (PPMO) conjugates were separated from unreacted material by ion exchange chromatography (IEX) and desalted. Final fractions were analyzed by analytical reverse phase HPLC and LC/MS.

In vitro SMN1 efficacy assay Exon skipping assay and PCR detection were performed according to published protocols (Mann et al 2002, Gene Med, 4, 644-654).

Immortalized retinal pigment epithelial cells (ARPE-19) cells were treated with CPP-PMO conjugates at various concentrations (4 uM, 2 uM, 1 uM, in duplicate) and SMN1 cells were isolated 48 hours after treatment with RNA extraction and purification. Transcript levels were evaluated followed by cDNA production and PCR.

Cells were plated in 24-well plates (ARPE-19, 2.5×10 ⁴ cells/well) in complete medium (DMEM/F12 1:1, 10% FCS; 10 mM HEPES, 1×GlutaMAX™, Pen/Strep 100 u/ml; Gibco, Thermo Fisher Scientific, Waltham, MA, USA). Cells were incubated overnight (37° C., 5% CO ₂ ) to allow cell attachment. On the day of assay, media was aspirated and treated media (DMEM/F12 1:1, 10% FCS; 10 mM HEPES, 1×GlutaMAX™, Pen/Strep 100 u/ml; Gibco, Thermo Fisher Scientific, Massachusetts, USA). Waltham, BC) diluted with CPP-PMO or PMO alone, followed by incubation for 24 hours (37° C., 5% CO ₂ ). The next day, fresh medium 1:1 was added and the cells were returned to the incubator for another 24 hours.

After 48 hours of treatment, cell medium was carefully aspirated and cells were rinsed with PBS. RNA from treated cells was obtained using a commercially available RNA extraction kit (Bio-Rad Aurum total RNA96 kit; RNA yield quantification; Quant-iT RNA BR kit) according to the manufacturer's protocol.

Extracted RNA was purified, quantified, and then diluted to 10 ng/ul. cDNA was generated using a commercially available reverse transcription kit according to the manufacturer's protocol (BioRad iScript). DNA was amplified using the generated cDNA as a template with primers designed to amplify the region of interest. The full-length (FL SMN1) and exon-7 skipping fragment (D7-SMN1) of the SMN1 gene (LC-GX Nucleic Acid Analyzer) were quantified and the efficiency of exon skipping was determined by calculating the percentage. The higher the percentage of D7-SMN1 DNA, the higher the efficiency of CPP delivery.

In vitro SMN1 Viability Assay Cells were plated in 96-well plates (ARPE-19, 4×10 ³ cells/well) in complete medium (DMEM/F12 1:1, 10% FCS; 10 mM HEPES, 1×GlutaMAX™). , Pen/Strep 100 u/ml; Gibco, Thermo Fisher Scientific, Waltham, MA, USA). Cells were incubated overnight (37° C., 5% CO ₂ ) to allow cell attachment. On the day of the assay, the medium was aspirated and various concentrations (32, 16, 8, 4, 2, and 1 uM) of treatment medium (DMEM/F12 1:1, 10% FCS; Trademark), Pen/Strep 100 u/ml; Gibco, Thermo Fisher Scientific, Waltham, Massachusetts, USA), followed by incubation for 24 h (37° C., 5% CO ₂ ). The next day, fresh medium 1:1 was added and the cells were returned to the incubator for another 24 hours.

After 48 hours of treatment, cell viability was measured using the commercially available CellTiter-Glo® Luminescent Cell Viability Assay (Promega, Australia). Briefly, the CellTiter-Glo reagent lyses cells and produces a luminescent signal proportional to the amount of ATP present, which is directly proportional to the number of viable cells present in culture. All assays were performed using melittin, a known cytotoxic agent (Renata et al. 2007), and a cell-only control. Cell viability was used to determine the level of toxicity caused by the CPP-PMO conjugates. High viability corresponds to low toxicity and low viability corresponds to high toxicity.

Results In FIG. 1 and Table 1, CPP of SEQ ID NO: 1 conjugated to SMN1 PMO at 4 uM, 2 uM and 1 uM yields more truncated D7-SMN1 transcripts than SMN1 PMO alone. The efficacy of induced SMN1 exon skipping follows the dose-response curve of the applied peptide-PMO conjugates. Peptide-PMO conjugates are more efficient in inducing SMN1 exon skipping than treatment with SMN1 PMO alone (1.2-fold at 2 uM). Thus, the peptide set forth in SEQ ID NO: 1 is an effective cell membrane permeant and nuclear delivery agent.

Figure 2 and Table 2 show that the viability of ARPE-19 cells treated with 32uM peptide-PMO conjugate versus PMO alone for 48 hours indicates that the addition of peptide-PMO conjugate had a greater impact on cell viability than PMO alone. It clearly shows that the toxicity is low (1.05 times). This indicates that the cell membrane penetrating and nuclear delivery effects of the peptide are not detrimental to cell health and do not cause the inherent toxicity normally associated with cationic cell membrane penetrating peptides.

Example 2
The in vitro SMN1 efficacy assay described in Example 1 is equally applicable to an in vivo setting given the ubiquitous distribution of the Smn gene in mice, Smn being the mouse orthologue of human SMN1. Due to the large number of proteases present in the body, the use of natural L-peptides is undesirable in an in vivo setting. To adequately assess the cell membrane penetrating ability of peptides, peptides were synthesized either as mixed L/D amino acid-containing peptides, in which all basic residues are D-amino acids, or as fully D-amino acid-containing peptides. Both approaches have been established to protect peptides from proteolytic degradation during systemic administration to animals.

By measuring changes in Smn transcript levels in the retina, RPE, and choroidal cell layers after 5, 7, 21, and 28 days of administration into the vitreous humor of mice, CPP-PMO increased Smn cargo intraocularly. was assessed for its ability to deliver in vivo to RPE cells in the posterior part of the . Inventive CPP (SEQ ID NO: 1) and control CPP Pip6a (SEQ ID NO: 3) conjugated to Smn PMO (SEQ ID NO: 2) were administered by intravitreal injection of 1.6 ug (0.5 ul volume) per eye. bottom. At the desired time points after treatment, animals were sacrificed, eyes dissected, tissue layers homogenized, and RNA extracted using the same protocol as in Example 1.

Control CPP Pip6a contains unnatural amino acids (X and B):
RXRRBRRXRYQFLIRXRBRXRB [SEQ ID NO:3]
Arg Ahx Arg Arg Beta-Ala Arg Arg Ahx Arg Tyr Gln Phe Leu Ile Arg Ahx Arg Beta-Ala Arg Ahx Arg Beta-Ala
(where X = Ahx = aminohexanoic acid; B = beta-alanine = beta-alanine)
contains

By measuring changes in Smn RNA transcripts from full-length to exon-7 skip fragment (D7-Smn) RNA transcripts using RNA extraction, cDNA generation, and PCR using Smn-specific primers, various delivery to different organs and efficiency of action was determined. Efficiency was interpreted as the higher the percentage of D7-Smn transcripts, the better the tissue delivery by CPPs.

Glial fibrillary acidic protein (GFAP) is a cytoskeletal protein of intermediate filaments. GFAP levels are strongly affected by injury or stress in several cell types, making GFAP expression an important marker of central nervous system injury. In the eye, Müller glial cells, which proliferate significantly after retinal injury, normally express low levels of GFAP. Peptides that induce relatively increased GFAP expression after intravitreal (IVT) administration are considered more toxic.

Methods Peptide and PMO Synthesis and Peptide-PMO Conjugation CPPs were synthesized using standard Fmoc SPPS-based methods (Pepscan GmbH, Lelystad, The Netherlands, and Mimotopes, Molgrave, VIC, Australia). All sequences contained a C-terminal azidridine residue that allowed coupling to the PMO. All N-termini were acetylated and C-termini amidated.

An Smn PMO (ACTTTCCTTCTTTTTTTATTTTGTCT; SEQ ID NO: 2) containing a 5' cyclooctyne handle was produced by Gene Tools (Gene Tools LLC, Philomas, Oreg., USA).

Using strain-enhanced click chemistry (SPAAC; Agard et al. 2004; Dommerholt et al. 2016), a CPP peptide containing a C-terminal azidridine was chemoselectively conjugated with a 5′-cycloocythine PMO and subjected to ion-exchange chromatography. and quantified by LC-MS.

In vivo Smn efficacy assay (IVT administration)
Exon skipping assay and RT-PCR detection were performed according to published protocols (Mann et al 2002, Gene Med, 4, 644-654).

Mice (C57B/6; 7 weeks old) were supplied by Australian BioResources (ABR). Selected CPP-PMOs were injected at 1.6 ug (0.5 ul) per eye into the vitreous of 1-3 mice per treatment group.

Forty-eight hours after treatment, mice were sacrificed and the following ocular tissues were harvested: retina, RPE layer, or combined RPE/choroid. Tissues were homogenized and RNA was obtained using a commercially available RNA extraction kit (Bio-Rad Aurum total RNA96 kit; RNA yield quantification; Quant-iT RNA BR kit) according to the manufacturer's protocol.

Extracted RNA was purified, quantified, and then diluted to 10 ng/ul. cDNA was generated using a commercially available reverse transcription kit according to the manufacturer's protocol (BioRad iScript). DNA was amplified using the generated cDNA as a template with primers designed to amplify the region of interest. The effectiveness of exon skipping was determined by quantifying the full length (FL Smn) and exon-7 skipping fragment (D7-Smn) of the Smn gene (LC-GX Nucleic Acid Analyzer) and calculating the percentage. The higher the percentage of D7-Smn DNA, the higher the efficiency of CPP delivery.

GFAP In Vivo Toxicity Assay GFAP mRNA expression was quantified via amplification of cDNA obtained as part of the in vivo Smn efficacy assay described above. BioRad droplet generator and reader (QX200 DG8) and thermocycler (T100), specific probes of mouse Gfap (dMmuCPE5116126) and housekeeping genes Gapdh, Eef1a1 and Rpl27 (dMmuCPE5195283, dMmuCPE5101732, and dMmuCPE5197083) probes and ddPCR, ddPCR was performed using the master mix (#1863024) and other ddPCR specific consumables from BioRad (#1863005, 12001925, 1863004, 1864007).

Assay results were obtained in copies/uL with the BioRad ddPCR software. This was then normalized to housekeeping genes for comparison between experiments. Peptides that induce relatively increased GFAP expression are considered more toxic.

Results In Figures 3 and 4 and Tables 3 and 4, the CPP of SEQ ID NO: 1 conjugated to the Smn PMO makes more truncated D7-Smn transcripts than the Smn PMO alone. Peptide-PMO conjugates are more efficient at inducing Smn exon skipping than treatment of Smn PMO alone or the competitor CPP Pip6a (Betts et. al. 2012). Thus, the peptide set forth in SEQ ID NO: 1 is an effective in vivo cell membrane permeant and nuclear delivery agent.

In Figure 5 and Table 5, CPP of SEQ ID NO: 1 conjugated to Smn PMO induces little expression of GFAP, no higher than PMO alone at 5 days and much lower than competitor CPP Pip6a. Therefore, the peptide set forth in SEQ ID NO: 1 is considered non-toxic in vivo when administered intravitreally at clinically relevant concentrations.

References Verdurmen WPR, Thanos M, Ruttekolk IR, Gulbins E, Brock R.; Cationic cell-penetrating peptides induce ceramide formation via acid sphingomyelinase: Implications for uptake. J Control Release. 2010; 147:171-179. doi: 10.1016/j. jconrel. 2010.06.030.
- Zakeri, B.; Fierer, J.; O. Celik, E.; Chittock, E.; C. Schwarz-Linek, U.S.A.; Moy, V.; T. Howarth, M.; Peptide tag forming a rapid covalent bond to a protein, through engineering a bacterial adhesive. Proc. Natl. Acad. Sci. USA 2012, 109, E690-E697
- Milech, N.; Longville, B.; A. C. Cunningham, P.; T. Scobie, M.; N. Bogdawa, H.; M. Winslow, S.; Anastasas, M.; Connor, T.; ; Ong, F.; ; Stone, S.; R. ; et al. GFP-complementation assay to detect functional CPP and protein delivery into living cells. Sci. Rep. 2015, 5, 18329.
- Stone, S.; R. et al. β-Lactamase tools for establishing cell internalization and cytosolic delivery of cell penetrating peptides. Biomolecules 8, 51-62 (2018).
・Hoffmann K, Milech N, Juraja SM, Cunningham PT, Stone SR, Francis RW, Anastasas M, Hall CM, Heinrich T, Bogdawa HM, Winslow S, Scobie MN, Dewhurst RE, Florez L, Morgan F. D, Adams AM, Fletcher S, Viola HM, Hool LC, Connor T, Longville BAC, Tan YF, Kroeger K, Morath V, Weiss GA, Skerra A, Hopkins RM, Watt PM. A platform for discovery of functional cell-penetrating peptides for efficient multi-cargo intracellular delivery. Sci Rep. 2018 Aug 22;8(1):12538. doi: 10.1038/s41598-018-30790-2. PMID: 30135446; PMCID: PMC6105642.
- Guidotti G, Brambilla L, Rossi D. Cell-penetrating peptides: from basic research to clinics. Trends Pharmacol Sci. 2017;38:406-424. doi: 10.1016/j. tips. 2017.01.003.
- van den Berg A, Dowdy SF. Protein transduction domain of therapeutic macromolecules. Curr Opin Biotechnol. 2011;22:888-893. doi: 10.1016/j. cop bio. 2011.03.008.
- Erazo-Oliveras A, et al. Protein delivery into live cells by incubation with an endosomolytic agent. Nat Methods. 2014; 11:861-867. doi: 10.1038/nmeth. 2998.
- Wu et al. Cell-penetrating peptides as transporters for morpholino oligomers: effects of amino acid composition on intracellular delivery and cytotoxicity, Nucleic Acids Research 2007. 35, No. 15:5182-5191 doi:10.1093/nar/gkm478
・Singh NN, Seo J, Rahn SJ, Singh RN (2012) A Multi-Exon-Skipping Detection Assay Reveals Surprising Diversity of Splice Isoforms of Spinal Muscular Genetic Astroph. PLoS One 7(11): e49595. https://doi. org/10.1371/journal. pone. 0049595
- Summerton, J.; & Weller, D.; , 1997. Morpholino antisense oligomers: design, preparation, and properties. Antisense & nucleic acid drug development, 7(3), pp. 187-195
• Moulton, H.; M. et al. , 2004. Cellular uptake of antisense morpholino oligomers conjugated to arginine-rich peptides. Bioconjugate chemistry, 15(2), pp. 290-299.
• Dommerholt, J.; , Rutjes, F.; P. J. T. & Delft, F.; L. , 2016. Strain-Promoted 1,3-Dipolar Cycloaddition of Cycloalkynes and Organic Azides. Topics in Current Chemistry, 374(2), pp. 1-20.
• Agard, N.; J. , Prescher, J.; A. & Bertozzi, C.; R. , 2004. A strain-promoted [3 + 2] azide-alkyne cycloaddition for covalent modification of biomolecules in living systems. Journal of the American Chemical Society, 126(46), pp. 15046-15047
・Roman C. Hillig, Brice Sautier, Jens Schroeder, Dieter Moosmayer, Andre Hilpmann, Christian M.; Stegmann, Nicolas D.; Werbeck, Hans Briem, Ulf Boemer, Joerg Weiske, Volker Badock, Julia Mastouri, Kirstin Petersen, Gerhard Siemeister, Jan D. Kahmann, Dennis Wegener, Niels Bohnke, Knut Eis, Keith Graham, Lars Wortmann, Franz von Nussbaum, and Benjamin Bader
・PNAS February 12, 2019 116(7) 2551-2560; first published January 25, 2019 https://doi. org/10.1073/pnas. 1812963116
- Leshchiner ES, Parkhitko A, Bird GH, Luccarelli J, Bellairs JA, Escudero S, Opoku-Nsiah K, Godes M, Perrimon N, Walensky LD. Direct inhibition of oncogenic KRAS by hydrocarbon-stapled SOS1 helices. Proc Natl Acad Sci USA. 2015 Feb 10;112(6):1761-6. doi: 10.1073/pnas. 1413185112. Epub 2015 Jan 26. PMID: 25624485; PMCID: PMC4330742.
・Ｓｈａｎｓｈａｎ Ｇｕ，Ｄａｎｒｕｉ Ｃｕｉ，Ｘｉａｏｙｕ Ｃｈｅｎ，Ｘｉｕｆａｎｇ Ｘｉｏｎｇ，ａｎｄ Ｙｏｎｇｃｈａｏ Ｚｈａｏ，ＰＲＯＴＡＣｓ：Ａｎ Ｅｍｅｒｇｉｎｇ Ｔａｒｇｅｔｉｎｇ Ｔｅｃｈｎｉｑｕｅ ｆｏｒ Ｐｒｏｔｅｉｎ Ｄｅｇｒａｄａｔｉｏｎ ｉｎ Ｄｒｕｇ Ｄｉｓｃｏｖｅｒｙ，ＢｉｏＥｓｓａｙｓ，４０（４），２０１８，ｈｔｔｐｓ：／／ｄｏｉ． org/10.1002/bies. 201700247
・K. M. Sakamoto, K.; B. Kim, A. Kumagai, F.; Mercurio, C.; M. Crews, R. J. Deshaies, Proc. Natl. Acad. Sci. USA 2001, 98, 8554.
・Renata M. S. Terra, Jorge A.; Guimaraes, Hugo Verli, Structural and functional behavior of biologically active monomeric melittin, (2007,) Journal of Molecular Graphics and Modeling, 27-7: 7
- Chandler, R.; , Tarasenko, T.; , Cusmano-Ozog, K.; et al. Liver-directed adeno-associated virus serotype 8 gene transfer rescues a lethal murine model of citrullinemia type 1. Gene Ther 20, 1188-1191 (2013) doi: 10.1038/gt. 2013.53
- Stone, S.; R. et al. β-Lactamase tools for establishing cell internalization and cytosolic delivery of cell penetrating peptides. Biomolecules 8, 51-62 (2018).
- Quinonez SC, Thoene JG. Citrullinemia Type I.C. 2004 Jul 7 [Updated 2016 Sep 1]. In: Adam MP, Ardinger HH, Pagon RA, et al. , editors. GeneReviews® [Internet]. Seattle (WA): University of Washington, Seattle; 1993-2019. Available from: https://www. ncbi. nlm. nih. gov/books/NBK1458/
- Flynn LL, Mitrpant C, Pitout IL, Fletcher S, Wilton SD. Antisense Oligonucleotide-Mediated Terminal Intron Retention of the SMN2 Transcript. Mol The Nucleic Acids. 2018 Jun 1;11:91-102. doi: 10.1016/j. omtn. 2018.01.011. Epub 2018 Jan 31. PMID: 29858094; PMCID: PMC5854547.
• Betts, C.I. , Saleh, A.; F. , Arzumanov, A.; A. , Hammond, S.; M. , Godfrey, C.; , Coursindel, T.; , et al. (2012). Pip6-PMO, A New Generation of Peptide-oligonucleotide Conjugates With Improved Cardiac Exon Skipping Activity for DMD Treatment. Molecular Therapy--Nucleic Acids, 1, e38-13. http://doi. org/10.1038/mtna. 2012.30

Claims (10)

Amino acid sequence:
RRSRTARAGRPGRNSSRPSAPR [SEQ ID NO: 1]
and an isolated, non-naturally occurring cell membrane penetrating peptide (CPP) comprising a sequence having at least 60% similarity to SEQ ID NO:1. 2. The CPP of claim 1, having at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 98% similarity with SEQ ID NO: 1 at the amino acid level. 2. The CPP of claim 1 modified with one or more of the following non-canonical amino acids, fatty acids, detectable labels, oligonucleotides, cholesterol, and use of reactive groups. 2. The CPP of claim 1, conjugated to a molecule of interest. 5. The CPP of claim 4, wherein said molecule of interest is selected from the following therapeutic agents, oligonucleotides, additional peptides or proteins, reactive groups, fatty acids, cholesterol, or detectable labels. 5. The CPP of claim 4, wherein said conjugation is performed using covalent or non-covalent interactions. 5. A modified cell comprising a CPP of claim 1 or a CPP conjugated to a molecule of interest of claim 4. Use of a CPP according to claim 1, a CPP conjugated to a molecule of interest according to claim 4, or a modified cell according to claim 7, in the manufacture of a medicament or diagnostic. Use of a CPP according to claim 1, a CPP conjugated to a molecule of interest according to claim 4, or a modified cell according to claim 7, as a pharmaceutical or diagnostic agent. A kit comprising (i) the CPPs of claim 1, the CPPs conjugated to the molecule of interest of claim 4, or the modified cells of claim 7, and (ii) instructions for use. .

Images