WO2020119666A1 - Anti-h7n9 fully human monoclonal antibody 3f12, preparation method therefor and use thereof - Google Patents

Abstract

Provided are an anti-H7N9 fully human monoclonal antibody 3F12, a preparation method therefor and use thereof. Said antibody can target hemagglutinin HA binding to H7N9 virus, and has significant neutralization activity against H7N9 viral infection. Said antibody does not produce toxic side effects such as anti-mouse antibody reaction, and has better biocompatibility, being more suitable and more potential to be a macromolecular drug for treating influenza virus.

Description

Anti-H7N9 fully human monoclonal antibody 3F12 and its preparation method and application Technical field

The present application belongs to the field of immunology, and specifically relates to anti-H7N9 fully human monoclonal antibody 3F12 and its preparation method and application.

Background technique

Among the top ten best-selling drugs in the world in 2015, 6 were fully humanized or humanized monoclonal antibody drugs. Ranked first is Humira, an anti-TNFa monoclonal antibody for arthritis, which is a fully human monoclonal antibody. It has been the king of medicine for more than 10 billion sales for three consecutive years. Since the launch of the first monoclonal antibody drug in 1986, monoclonal antibody drugs have undergone murine monoclonal antibody drugs (such as Orthoclone OKT3), chimeric monoclonal antibody drugs (Rituximab), humanized monoclonal antibody drugs (Herceptin) and the whole person Source monoclonal antibody drugs (Humira) and other stages. Due to the anti-mouse antibody reaction (HAMA) in the human body, murine monoclonal antibodies and chimeric monoclonal antibodies have been gradually phased out. The monoclonal antibody drugs currently occupying the market are all humanized monoclonal antibody drugs. Compared with the international advanced human antibody production technology, Shenzhen and even China have a large gap, mainly manifested in the weak innovation ability in the field of human antibody drugs, the independent research and development varieties are few, there is currently no original humanized monoclonal According to reports on the listing of antibody drugs, the huge antibody drug market is occupied by foreign pharmaceutical companies. In order to change the backward situation and compete for the domestic and foreign antibody drug markets with huge consumption potential, it is urgent to overcome the technology of fully human monoclonal antibodies.

Human-derived monoclonal antibodies are highly specific and effective in treating inflammation, cancer, and particularly influenza. Influenza is an infectious disease caused by influenza virus, which seriously threatens human health. About 1 billion people worldwide are infected with the seasonal influenza virus each year, and 250,000 to 500,000 of them die. The H7N9 virus is an influenza virus that is resistant to the traditional antiviral drugs amantadine and rimantadine, and there is currently no effective treatment. When the H7N9 virus invades the cell, it needs to rely on the specific molecule expressed by the virus itself to bind to the receptor on the human cell in order to infect the cell and further expand. Human antibodies that neutralize viruses are specific antibodies produced by human B lymphocytes, which can bind to antigens on the surface of the virus, thereby preventing the virus from attaching to target cell receptors, preventing the virus from invading cells, and effectively preventing H7N9 influenza.

Summary of the invention

In one aspect, the present application relates to anti-H7N9 fully human monoclonal antibody 3F12 or a biologically active fragment derived from the monoclonal antibody capable of neutralizing H7N9 virus.

On the other hand, the present application relates to a gene encoding the anti-H7N9 fully human monoclonal antibody 3F12 or a biologically active fragment derived from the monoclonal antibody capable of specifically binding H7N9, and a vector or cell containing the gene.

On the other hand, the present application relates to a method for producing the anti-H7N9 fully human monoclonal antibody 3F12.

On the other hand, the present application relates to a pharmaceutical composition comprising the anti-H7N9 fully human monoclonal antibody 3F12 or a biologically active fragment derived from the monoclonal antibody capable of specifically binding H7N9.

On the other hand, the present application relates to the use of the anti-H7N9 fully human monoclonal antibody 3F12 described in the present application or a biologically active fragment derived from the monoclonal antibody capable of specifically binding H7N9 or the pharmaceutical composition.

On the other hand, the present application relates to a kit for detecting H7N9 virus.

BRIEF DESCRIPTION

FIG. 1 is a flow cytometry result diagram of CD40L expression by NTH-3T3 in Example 1. FIG.

2 is a graph showing the results of sorting memory B cells by flow cytometry in Example 1. FIG.

3 is a graph of the ELISA experiment results in Example 1.

4 is a graph of the neutralization experiment results of Example 3. FIG.

detailed description

In order to have a clearer understanding of the technical features, purposes and beneficial effects of the present invention, the technical solutions of the present invention will now be described in detail below, but it cannot be understood as limiting the scope of the present invention.

In one aspect, the present application provides an anti-H7N9 fully human monoclonal antibody 3F12 or a biologically active fragment derived from the monoclonal antibody capable of specifically binding H7N9, wherein the amino acid sequence of the heavy and light chain CDR1, CDR2 and CDR3 regions of the antibody They are as follows:

Heavy chain CDR1: GYIFNSYD

Heavy chain CDR1: MTPDSGDN

Heavy chain CDR3: ANGTADCSSGGSCYTWFDP

Light chain CDR1: RALRSYY

Light chain CDR2: GKT

Light chain CDR3: TSRDNSGYHLV.

In some embodiments, the amino acid sequence of the heavy chain variable region of the antibody is shown in SEQ ID NO: 2, or an amino acid sequence with equivalent functions formed by replacing, deleting, or adding one or several amino acids to the sequence; and/ or

The amino acid sequence of the light chain variable region of the antibody is shown in SEQ ID NO: 4, or an amino acid sequence with equivalent functions formed by replacing, deleting or adding one or several amino acids to the sequence.

In some embodiments, the heavy chain amino acid sequence of the antibody is shown in SEQ ID NO: 6, or an amino acid sequence with equivalent functions formed by replacing, deleting, or adding one or more amino acids to the sequence; and/or

The light chain amino acid sequence of the antibody is shown in SEQ ID NO: 8, or an amino acid sequence with equivalent functions formed by replacing, deleting or adding one or several amino acids to the sequence.

It has been verified by ELISA experiments that the anti-H7N9 fully human monoclonal antibody 3F12 described in this application can target hemagglutinin HA that binds to the H7N9 virus, with an affinity of 3.5×10 ^-9 M; in a virus-infected cell model, its IC ₅₀ value Only about 14.35uM. The antibodies described in this application are fully human monoclonal antibodies. Compared with murine antibodies, the genes of fully human antibodies are completely derived from human genes, without the components of other species, and no anti-mouse anti-antibodies occur in the human body. Toxic and side effects, with better biocompatibility, more suitable and more potential to become a macromolecular drug for the treatment of influenza virus.

On the other hand, the present application provides a gene encoding the anti-H7N9 fully human monoclonal antibody 3F12 described herein. In some embodiments, the gene comprises a nucleotide sequence encoding the amino acid shown in SEQ ID NO: 2, in some embodiments, the nucleotide sequence is shown in SEQ ID NO: 1; and/or

The gene contains a nucleotide sequence encoding the amino acid shown in SEQ ID NO: 4, and in some embodiments, the nucleotide sequence is shown in SEQ ID NO: 3.

In some embodiments, the gene comprises a nucleotide sequence encoding an amino acid having SEQ ID NO: 6, in some embodiments, the nucleotide sequence is shown in SEQ ID NO: 5; and/or

The gene includes a nucleotide sequence encoding the amino acid shown in SEQ ID NO: 8, and in some embodiments, the nucleotide sequence is shown in SEQ ID NO: 7.

The sequence of SEQ ID NO: 1～8 in this application is shown in the sequence table, in which:

(1) Sequences 76 to 99 in SEQ ID NO: 1 and 124 to 147 in SEQ ID NO: 5: used to encode heavy chain CDR1 region sequences;

(2) Sequences 151-174 in SEQ ID NO: 1 and sequences 199-222 in SEQ ID NO: 5: Used to encode heavy chain CDR2 region sequences;

(3) 289-345th sequence in SEQ ID NO:1 and 337-393th sequence in SEQ ID NO:5: used to encode heavy chain CDR3 region sequence;

(4) Sequences 76-96 in SEQ ID NO: 3 and 124-144 in SEQ ID NO: 7: used to encode the light chain CDR1 region sequence;

(5) Sequences 148-156 in SEQ ID NO: 3 and sequences 196-204 in SEQ ID NO: 7: used to encode the light chain CDR2 region sequence;

(6) 265-297th sequence in SEQ ID NO: 3 and 313-345th sequence in SEQ ID NO: 7: used to encode the light chain CDR3 region sequence;

(7) Sequences 1 to 48 in SEQ ID NO: 5 and SEQ ID NO: 7 are sequences used to encode signal peptides.

(8) The amino acid sequences at positions 26-33 in SEQ ID NO: 2 and SEQ ID NO: 6 are heavy chain CDR1 sequences; the amino acid sequences at positions 51-58 in SEQ ID NO: 2 and SEQ ID NO: 6 are Heavy chain CDR2 sequence; the amino acid sequence at positions 97-115 in SEQ ID NO: 2 and SEQ ID NO: 6 is the heavy chain CDR3 sequence.

(9) The amino acid sequence at positions 26-32 in SEQ ID NO: 4 and SEQ ID NO: 8 is the light chain CDR1 sequence; the amino acid sequence at positions 50-52 in SEQ ID NO: 4 and SEQ ID NO: 8 is The light chain CDR2 sequence; the amino acid sequence at positions 89-99 in SEQ ID NO: 4 and SEQ ID NO: 8 is the light chain CDR3 sequence.

On the other hand, the present application provides a vector containing the gene as described above.

In yet another aspect, the present application provides cells containing the gene as described above or the vector as described above.

In another aspect, the present application provides a method for producing the anti-H7N9 fully human monoclonal antibody 3F12 or a biologically active fragment derived from the monoclonal antibody capable of specifically binding H7N9, the method comprising culturing The above-mentioned genes of the heavy and light chains of the human monoclonal antibody 3F12 or genetically engineered cells of the above vector or directly culture the above cells, collect and purify the anti-H7N9 fully human monoclonal antibody 3F12.

In the prior art, there is a method for preparing human monoclonal antibodies against H7N9 virus by using phage display technology. Although this method has the advantages of low production cost and no tedious work such as immunization and cell fusion, its disadvantages are also obvious. The antibodies obtained in the immune antibody library often have insufficient affinity, are limited by the conversion rate of foreign genes, and the library capacity of the antibody library is insufficient to cover the animal's antibody diversity. This application isolates B cells secreting functional antibodies from the blood of a patient, then extracts RNA and synthesizes cDNA, clones genes for secreting the antibody of interest, and finally recombines and expresses fully human monoclonal antibodies. The technology is simple and quick to operate, and the human antibodies produced have high affinity and specificity. In addition, the improved monoclonal antibody technology described in this application for isolating virus functions or killing tumor functions from memory B cells can be further used. It also greatly reduces the tedious operation and cost.

On the other hand, the present application provides a pharmaceutical composition comprising the anti-H7N9 fully human monoclonal antibody 3F12 described herein or a biologically active fragment derived from the monoclonal antibody capable of specifically binding H7N9.

On the other hand, the present application provides the anti-H7N9 fully human monoclonal antibody 3F12 or a biologically active fragment derived from the monoclonal antibody capable of specifically binding H7N9 or the pharmaceutical composition is prepared for treatment by H7N9 Application of drugs for diseases caused by viruses.

On the other hand, the present application provides a kit for detecting the level of H7N9 virus, which contains the anti-H7N9 fully human monoclonal antibody 3F12 or a biologically active fragment derived from the monoclonal antibody capable of specifically binding H7N9 ; In some embodiments, the kit further contains a second antibody and an enzyme or fluorescent or radioactive marker for detection, and a buffer; the second antibody is, for example, anti-monoclonal antibody 3F12 of the present application Anti-antibody.

Compared with the prior art, this application has the following beneficial effects:

(1) The anti-H7N9 fully human monoclonal antibody 3F12 described in this application can target hemagglutinin HA that binds to the H7N9 virus, and has significant neutralizing activity against H7N9 virus infection.

(2) Compared with murine antibodies, the genes of fully human antibodies of this application are entirely derived from human genes, without the components of other species, and no toxic and side effects such as anti-mouse anti-antibodies occur in the human body, and have a better biological phase Capacitive, more suitable and more potential to become a macromolecular drug for the treatment of influenza virus.

(3) Compared with the method for preparing anti-H7N9 human monoclonal antibody by the phage display technology provided by the prior art, the application of a single B cell to develop the anti-H7N9 virus antibody in this application has simple and quick operation, and the produced human antibody has High affinity and specificity.

In order to have a clearer understanding of the technical features, purposes, and beneficial effects of the present application, the technical solutions of the present application are described in detail below in conjunction with specific embodiments. It should be understood that these examples are only used to illustrate the application and not to limit the scope of the application . In the examples, each original reagent material is commercially available, and the experimental method without specifying the specific conditions is conventional methods and conventional conditions well known in the art, or according to the conditions recommended by the instrument manufacturer.

Example 1

(1) Construction of NTH-3T3 cell line stably expressing CD40L (3T3-CD40L)

Lentivirus was used to establish 3T3-CD40L feeder cells. The lentiviral expression vector pLVX-CD40L was constructed, transfected into 293T cells, and the viral supernatant was collected on the fourth day of transfection. Activate NIH-3T3 cells, infect with lentivirus after culturing for 3 generations, continue culturing and pass 3 times. Use flow cytometry to sort the cells whose FITC fluorescence intensity is near the MFI, re-add to the culture flask, culture and test at 37℃, 5% CO ₂ incubator. The test results are shown in Figure 1. CD40L 3T3 cells and empty vector pLVX (with ZxGreen) transfected 3T3 cells were stained with anti-CD40L with APC, and then analyzed by flow cytometry. As a result, it was found that all 3T3-CD40L feeder cells expressed CD40L. When the cells grow to 80% to 90%, the cells are digested and collected at a concentration of 1×10 ⁷ cells per ml. Place in a radiometer for 5000 rads radiation, resuspend the cells in the cryopreservation solution at a concentration of 3.5×10 ⁷ cells per ml, aliquot 1 ml in a frozen vial, and freeze in liquid nitrogen (can be stored for 2 years).

(2) Sorting and activation of memory B cells

Lymph separation solution was used to separate and freeze the PBMC of rehabilitation patients who had been infected with H7N9 virus. Each tube contains 10-50×10 ⁶ cells, and is frozen in a liquid nitrogen tank. Prepare PBMC flow dyeing solution, its composition is shown in Table 1 below

Table 1 PBMC flow dyeing solution

antibody	Volume (μL)
CD19-PE-Cy7	0.5
IgM-PE	1.0
IgA-APC	2.5
IgD-FITC	2.5
PBS-1% (wt/vol) BSA	43.5

Thaw PBMC, add the above PBMC flow staining solution and sort on the flow cytometer. The results are shown in Figure 2. CD19 ⁺ IgM ^- IgA ^- IgD ^- memory B cells are sorted. The cell purity must be more than 90% If it is lower than 90%, repeat the sorting process. Prepare a mixed medium for activating B cells, as shown in Table 2 below:

Table 2

Component	volume
Complete IMDM medium	336mL
IL-2(10,000U mL -1 )	3.5mL
IL-21(100μg mL -1 )	175μL
3T3-CD40L obtained in step (1)	10mL

The memory B cells were added to the mixed medium. After mixing, the cells were diluted in a 384-well plate with a limit of 1 cell per well and the volume was 50 μl. The cells were placed in a 37°C, 5% CO ₂ incubator and cultured statically. After 13 days, the supernatant was taken for ELISA.

(3) Obtaining human monoclonal antibody 3F12

Influenza virus hemagglutinin HA is a columnar antigen on the surface of the viral envelope. It can bind to a variety of red blood cell receptors such as humans, chickens, and guinea pigs to cause red blood cell aggregation. It is immunogenic and anti-hemagglutinin antibodies can neutralize influenza viruses. In the present invention, B cells capable of secreting the antibody 3F12 binding to the H7N9 virus were found by ELISA, and the human monoclonal antibody 3F12 secreted by it can target the hemagglutinin HA binding to the H7N9 virus (FIG. 3 ).

Specific operation of ELISA experiment:

(1) 100ng/100μl of HA protein of H7N9 virus (purchased from ACROBiosystems) was coated in a 96-well microplate, 100μl per well;

(2) Place in 4℃ refrigerator overnight;

(3) Wash three times with PBST solution, add 200μl of 5% skimmed milk powder solution to each well, and incubate at 37℃ for 1 hour;

(4) Wash three times with PBST solution, add 100 μl of normal human serum (negative control) without virus infection or virus infected patient serum or anti-H7N9 fully human monoclonal antibody 3F12, three replicates each;

(5) After incubating at 37°C for 1 hour, wash three times with PBST solution;

(6) Dilute the anti-human IgG antibody (abcam) with HRP at 1:5000, add to the enzyme plate, 100μl per well;

(7) After incubating at 37°C for 1 hour, wash three times with PBST solution;

(8) Add 100μl TMB substrate solution (Thermo Scientific) to each well, 37℃ for 5 minutes;

(9) Add 100μl of 2M sulfuric acid to each well and immediately detect the absorbance at 450nm in a microplate reader. The results are shown in FIG. 3, and ELISA experiments show that the human monoclonal antibody 3F12 obtained in this application can target hemagglutinin HA that binds to the H7N9 virus.

Example 2 Cloning, recombination, expression and purification of humanized monoclonal antibody 3F12 gene

The B cells obtained in Example 1 capable of secreting the 3F12 antibody that binds to the H7N9 virus were lysed, and the lysate was taken for reverse transcription of RNA to obtain the PCR template cDNA of the human antibody gene. Design and synthesize primers for cloning antibody genes, clone the heavy and light chain genes of antibodies using cDNA as a template, and recombine them in eukaryotic cells 293F or HEK293 for expression and purification. specifically:

(1) Transfer the lysed B cell fluid to a 96-well plate (Eppendorf, 030133366).

(2) Reverse transcription system: 150ng random primer (invitrogen, 48190-011), 0.5μl 10mM dNTP (Invitrogen, 18427-088), 1μl 0.1M DTT (Invitrogen, 18080-044), 0.5% v/v Igepal CA -630 (Sigma, I3021-50ML), 4U RNAsin (Promega), 6U Prime RNAse Inhibitor (Eppendorf) and 50U

III reverse transcriptase (Invitrogen, 18080-044), supplemented with DEPC water to 14 μl/well.

(3) Reverse transcription reaction program: 42℃, 10min; 25℃, 10min; 50℃, 60min; 94℃, 5min.

(4) cDNA is stored at -20°C.

(5) Primer design and synthesis:

Forward primer 5′-3′ sequence (Forward Primer 5′-3′ sequence)

Heavy chain variable region PCR primers:

5′VH1CTGCAACCGGTGTACATTCCCAGGTGCAGCTGGTGCAG(SEQ ID NO: 9)

5′VH1/5CTGCAACCGGTGTACATTCCGAGGTGCAGCTGGTGCAG(SEQ ID NO: 10)

5′VH3CTGCAACCGGTGTACATTCTGAGGTGCAGCTGGTGGAG (SEQ ID NO: 11)

5′VH3-23CTGCAACCGGTGTACATTCTGAGGTGCAGCTGTTGGAG(SEQ ID NO: 12)

5′VH4CTGCAACCGGTGTACATTCCCAGGTGCAGCTGCAGGAG(SEQ ID NO: 13)

5′VH 4-34CTGCAACCGGTGTACATTCCCAGGTGCAGCTACAGCAGTG (SEQ ID NO: 14)

5′VH 1-18CTGCAACCGGTGTACATTCCCAGGTTCAGCTGGTGCAG (SEQ ID NO: 15)

5′VH 1-24CTGCAACCGGTGTACATTCCCAGGTCCAGCTGGTACAG (SEQ ID NO: 16)

5′VH3-33CTGCAACCGGTGTACATTCTCAGGTGCAGCTGGTGGAG(SEQ ID NO: 17)

5′VH 3-9CTGCAACCGGTGTACATTCTGAAGTGCAGCTGGTGGAG (SEQ ID NO: 18)

5′VH4-39CTGCAACCGGTGTACATTCCCAGCTGCAGCTGCAGGAG (SEQ ID NO: 19)

5′VH 6-1CTGCAACCGGTGTACATTCCCAGGTACAGCTGCAGCAG (SEQ ID NO: 20)

3′JH1/2/4/5TGCGAAGTCGACGCTGAGGAGACGGTGACCAG(SEQ ID NO: 21)

3′JH 3TGCGAAGTCGACGCTGAAGAGACGGTGACCATTG (SEQ ID NO: 22)

3′JH 6TGCGAAGTCGACGCTGAGGAGACGGTGACCGTG (SEQ ID NO: 23)

κ light chain variable region PCR products

5′Vκ1-5CTGCAACCGGTGTACATTCTGACATCCAGATGACCCAGTC(SEQ ID NO: 24)

5′Vκ1-9TTGTGCTGCAACCGGTGTACATTCAGACATCCAGTTGACCCAGTCT (SEQ ID NO: 25)

5′Vκ1D-43CTGCAACCGGTGTACATTGTGCCATCCGGATGACCCAGTC(SEQ ID NO: 26)

5′Vκ2-24CTGCAACCGGTGTACATGGGGATATTGTGATGACCCAGAC(SEQ ID NO:27)

5′Vκ2-28CTGCAACCGGTGTACATGGGGATATTGTGATGACTCAGTC (SEQ ID NO: 28)

5′Vκ2-30CTGCAACCGGTGTACATGGGGATGTTGTGATGACTCAGTC (SEQ ID NO: 29)

5′Vκ3-11TTGTGCTGCAACCGGTGTACATTCAGAAATTGTGTTGACACAGTC(SEQ ID NO: 30)

5′Vκ3-15CTGCAACCGGTGTACATTCAGAAATAGTGATGACGCAGTC(SEQ ID NO: 31)

5′Vκ3-20TTGTGCTGCAACCGGTGTACATTCAGAAATTGTGTTGACG CAGTCT (SEQ ID NO: 32)

5′Vκ4-1CTGCAACCGGTGTACATTCGGACATCGTGATGACCCAGTC (SEQ ID NO: 33)

3′Jκ1/4GCCACCGTACGTTTGATYTCCACCTTGGTC(SEQ ID NO: 34)

3′Jκ2GCCACCGTACGTTTGATCTCCAGCTTGGTC(SEQ ID NO: 35)

3′Jκ3GCCACCGTACGTTTGATATCCACTTTGGTC(SEQ ID NO: 36)

3′Jκ5GCCACCGTACGTTTAATCTCCAGTCGTGTC(SEQ ID NO: 37)

(6) PCR using KOD-Plus-Neo (TOYOBO, KOD401) kit to amplify the heavy and light chains of antibody genes respectively, 40μL system: 3.5μL cDNA, 20nM mixed primers, 4μL buffer, 4μL 2mM dNTPs , 2.4 μL MgSO ₄ , 1 μL KOD.

(7) Reaction procedure: 94°C, 2 min; 45 cycles: 98°C, 10s; 58°C, 30s; 68°C, 28s.

(8) Agarose gel was applied to the amplified product, and it was found that the light chain size of the antibody was 327 bp and the heavy chain size was 375 bp.

(9) The sequencing result of the PCR product of the variable region of the heavy chain of the antibody gene is shown in the sequence shown in SEQ ID NO: 1, and the corresponding amino acid sequence is shown in the sequence shown in SEQ ID NO: 2. The sequencing result of the PCR product of the light chain variable region of the antibody gene is shown in the sequence shown in SEQ ID NO: 3, and the corresponding amino acid sequence is shown in the sequence shown in SEQ ID NO: 4.

Based on the obtained heavy and light chain variable region sequences, design and commission Invitrogen to synthesize the full-length H gene of the antibody gene heavy chain with BamH1/EcoR1 double restriction sites; and the full-length L gene of the antibody gene light chain with the Not1/Xho1 double digestion site.

(10) BamH1/EcoR1 double enzyme digestion of H gene and pcDNA3.1 were respectively connected to form pcDNA3.1-H vector.

(11) The L gene and pcDNA3.1 were not digested with Not1/Xho1 and then connected to form the pcDNA3.1-L vector.

(12) Culture 293F cells.

(13) 20μg pcDNA3.1-H (the nucleotide sequence of the H gene is shown in SEQ ID NO: 5) vector and 10μg pcDNA3.1-L (the nucleotide sequence of the L gene is shown in SEQ ID NO: 7 (Shown) The vector was co-transfected with 293F cells and cultured for 96 hours.

(14) Take the supernatant for ELISA (ABC is the supernatant, DEF is the positive control, GH is the negative control); the specific experimental steps of ELISA are as described above, and the results of the ELISA experiments are shown in Table 3 and Figure 3 below:

table 3

data	450nm	data	450nm
A	2.311	E	1.185
B	2.781	F	1.201
C	2.056	G	0.0675
D	1.114	H	0.0554

From the data in Table 3 and Figure 3, it can be seen that the supernatant contains antibodies capable of binding to the H7N9 virus.

(15) Purification process, specifically, the purification process of fully human monoclonal antibody 3F12 is:

(a) 200μg pcDNA3.1-L vector and 100μg pcDNA3.1-H vector were co-transfected into 300ml 293F cells and cultured for 96 hours.

(b) Collect the supernatant, add proteinA affinity chromatography column, wash with 10 times PBS, add 2ml pH3.0, 0.1M glycine to collect antibody. Add 100 μl of neutralization buffer (1M Tri-HCL) to the collection tube in order to neutralize the pH value of the eluted antibody solution in time.

(c) Dialysis in phosphate buffered saline (PBS). After dialysis, it should be stored at 4℃ in the near future and -20℃ in the long term. A total of 500μg of 3F12 pure antibody was obtained. Its heavy chain amino acid sequence is shown in SEQ ID NO: 6, and the light chain amino acid sequence is shown in SEQ ID NO: 8.

Example 3 Purified fully human monoclonal antibody 3F12 neutralization experiment and antibody affinity experiment

(1) Experimental purpose

Using a virus-infected cell model (canine kidney cell MDCK), the inhibitory effect and effect of the 3F12 antibody against the H7N9 influenza virus were evaluated by a micro-neutralization-ELISA experiment, and the antibody anti-influenza virus activity was detected.

(2) Experimental steps

(2.1) Cell plating

Trypsin digestion of MDCK canine kidney cells in logarithmic growth phase, after termination, centrifugal collection, evenly disperse, prepare single cell suspension; adjust cell concentration to 5×10 ⁴ cells/ml with cell culture solution, and inoculate in 96-well cell culture Plates, cells were incubated overnight at 37°C in a 5% CO ₂ incubator.

(2.2) 3F12 antibody and H7N9 virus (the virus A/Anhui/1/2013 was taken from the Institute of Microbiology, Chinese Academy of Sciences)

The 3F12 antibody was established with 10 concentration gradients, which were sequentially diluted ^{10 to 10} times, and 3 parallel wells were set for each concentration of each group.

(2.3) Virus infection

Discard the cell culture supernatant cultured in step (2.1) and wash 3 times with PBS. The antibody premixed - virus mixed solution ^(10-fold serially diluted to 10-10 monoclonal antibody 3F12 10 ² μg / ml, and the concentration of each antibody 3F12 respectively equal volume of virus 100TCID ₅₀ mixing the mixture obtained ). Add 96-well cell culture plate, incubate at 37℃ for 1h, aspirate the mixed solution, and wash twice with PBS.

(2.4) Configure maintenance fluid

TPCK-Trypsin (maintenance solution) with a final concentration of 2 μg/ml was added to serum-free DMEM. The PBS in the 96-well plate was discarded, 100 μl of maintenance solution was added to each well, and incubated at 37° C. in a 5% CO ₂ incubator for 20 h.

(2.5) Neutralization experiment-ELISA method

(2.5.1) Discard the maintenance solution in the microplate;

(2.5.2) Wash cells once with 100μl PBS;

(2.5.3) Discard PBS (don't let the cells dry), add 50μl/well fixative (volume ratio is acetone: absolute ethanol = 2:3);

(2.5.4) Cover the microplate and fix the cells at room temperature for 10 min;

(2.5.5) Discard the fixative solution, wash the cells with 100 μl of PBS solution, and repeat the washing 3 times (slightly shaking to avoid strong washing) to remove residual acetone.

(2.5.6) Block the cells with 5% skimmed milk powder at room temperature for 1 hour, and wash the cells once with 100 μl PBS solution;

(2.5.7) Dilute 1 antibody (commercially available anti-H7N9 NP monoclonal antibody) with PBS 1:2000, add 50 μl diluted to each well, and act at room temperature for 1 hour.

(2.5.8) Wash the plate 5 times with 100 μl PBST to remove 1 antibody;

(2.5.9) Dilute 2 antibodies (anti-mouse IgG antibody with HRP) 1:2000 with PBS, add 50μl to each well, and incubate at room temperature for 1 hour.

(2.5.10) Wash the plate 6 times with 100 μl PBST to remove the 2 antibodies.

(2.5.11) Add 50μl of TMB color developing solution to each well.

(2.5.12) After developing at room temperature for about 10 minutes in the dark, add 50μl of 2M hydrochloric acid to each well to stop the reaction.

(2.5.13) Read the OD value of each well on the ELISA measuring instrument (450 nm).

(3) Statistical analysis

Using GraphPad Prism 6.0.1 Data were analyzed and plotted the dose - response curves, and calculate the IC _50. Inhibition rate calculation formula:

Inhibition rate=[(OD virus well-OD negative cell control well)-(OD drug well-OD negative cell control well)]/(OD virus well-OD negative cell control well)×100%.

The resulting structure is shown in FIG. 4, from which it can be seen that the IC _{50 of} 3F12 = 14.35 ug/ml.

As can be seen from Example 3, this application 3F12 good IC ₅₀ values for H7N9, prove good virus neutralizing capacity 3F12.

This application compares the single file submitted to the State Intellectual Property Office of China on May 10, 2016 with the application number "201610303416.X" and the invention titled "Anti-H7N9 Fully Humanized Monoclonal Antibody 2L11 and its Preparation and Application". Cloned antibody 2L11, and submitted to the State Intellectual Property Office of China on May 03, 2016, the application number is "201610288358.8", the name of the invention is "anti-H7N9 fully human monoclonal antibody 2J17 and its preparation and application". Antibody 2J17. The IC ₅₀ of the neutralizing activity of this application is 14.35 ug/ml, while the 2L11 and 2J17 antibodies have no neutralizing activity.

Antibody affinity testing:

The instrument of affinity detection is Fortebio of PALL. Prepare 200μl 50μg/ml 3F12 antibody, bind proteinA sensor for 120 seconds, HA antigen prepare 100nM, 50nM, 2.5nM, 12.5nM and 6.25nM and 0nM concentration solutions, bind antibody for 120 seconds, dissociation time is 5 minutes, display 3F12 pair The H7N9 virus has a high affinity, KD=3.5×10 ^-9 M.

Finally, it is explained that the above embodiments are only used to illustrate the implementation process and features of the present application, but not to limit the technical solutions of the present application. Although the present application has been described in detail with reference to the above embodiments, those of ordinary skill in the art should understand: Modifications or equivalent replacements can still be made to this application without departing from the spirit and scope of this application. Any modification or partial replacement should be covered in the scope of protection of this application.

Claims (10)

1. The anti-H7N9 fully human monoclonal antibody 3F12 or a biologically active fragment derived from the monoclonal antibody capable of specifically binding H7N9, wherein the amino acid sequences of the heavy and light chain CDR1, CDR2 and CDR3 regions of the antibody are as follows:

   Heavy chain CDR1: GYIFNSYD;

   Heavy chain CDR1: MTPDSGDN;

   Heavy chain CDR3: ANGTADCSSGGSCYTWFDP;

   Light chain CDR1: RALRSYY;

   Light chain CDR2: GKT;

   Light chain CDR3: TSRDNSGYHLV.
2. The anti-H7N9 fully human monoclonal antibody 3F12 according to claim 1 or a biologically active fragment derived from the monoclonal antibody capable of specifically binding H7N9, wherein the amino acid sequence of the heavy chain variable region of the antibody is as SEQ ID NO :2, or an amino acid sequence with equivalent functions formed by replacing, deleting or adding one or several amino acids to the sequence; and/or

   The amino acid sequence of the light chain variable region of the antibody is shown in SEQ ID NO: 4, or the sequence shown in SEQ ID NO: 4 is substituted, deleted or added with one or several amino acids to form an amino acid sequence with equivalent functions;

   Preferably, the heavy chain amino acid sequence of the antibody is shown in SEQ ID NO: 6, or the sequence shown in SEQ ID NO: 6 is substituted, deleted or added with one or several amino acids to form an amino acid sequence with equivalent functions; and/ or

   The light chain amino acid sequence of the antibody is shown in SEQ ID NO: 8, or the sequence shown in SEQ ID NO: 8 is substituted, deleted, or added with one or several amino acids to form an amino acid sequence with equivalent functions.
3. The gene encoding the anti-H7N9 fully human monoclonal antibody 3F12 according to claim 1 or 2 or a gene derived from the monoclonal antibody capable of specifically binding a biologically active fragment of H7N9; preferably, the gene comprises a gene encoding SEQ ID NO : 2 The nucleotide sequence of the amino acid shown in 2, more preferably, the nucleotide sequence of the gene is shown in SEQ ID NO: 1; and/or

   The gene includes a nucleotide sequence encoding the amino acid shown in SEQ ID NO: 4, preferably, the nucleotide sequence of the gene is shown in SEQ ID NO: 3.
4. The gene according to claim 3, wherein the gene comprises a nucleotide sequence encoding an amino acid having SEQ ID NO: 6, preferably, the nucleotide sequence of the gene is as SEQ ID NO: 5. Show; and/or

   The gene includes a nucleotide sequence encoding the amino acid shown in SEQ ID NO: 8, preferably, the nucleotide sequence of the gene is shown in SEQ ID NO: 7.
5. A vector containing the gene according to claim 3 or 4.
6. A cell containing the gene according to claim 3 or 4 or the vector according to claim 5.
7. A method for producing the anti-H7N9 fully human monoclonal antibody 3F12 according to claim 1 or 2 or a biologically active fragment derived from the monoclonal antibody capable of specifically binding H7N9, the method comprising: cultivating a human body containing a coding anti-H7N9 human Genetically engineered cells of the gene of claim 3 or 4 of the heavy and light chain of the monoclonal antibody 3F12, or the vector of claim 5, or the cell of claim 6 is directly cultured; collected and purified Anti-H7N9 fully human monoclonal antibody 3F12.
8. A pharmaceutical composition comprising the anti-H7N9 fully human monoclonal antibody 3F12 of claim 1 or 2 or a biologically active fragment derived from the monoclonal antibody capable of specifically binding H7N9.
9. The anti-H7N9 fully human monoclonal antibody 3F12 according to claim 1 or 2 or a biologically active fragment derived from the monoclonal antibody capable of specifically binding H7N9, or the pharmaceutical composition according to claim 8 is prepared for treatment Application of medicine for diseases caused by H7N9 virus.
10. A kit for detecting the level of H7N9 virus, comprising the anti-H7N9 fully human monoclonal antibody 3F12 according to claim 1 or 2 or a biologically active fragment derived from the monoclonal antibody capable of specifically binding H7N9; preferably, The kit further comprises: a second antibody and an enzyme or fluorescent or radioactive label for detection, and a buffer; preferably, the second antibody is anti-monoclonal antibody 3F12 according to claim 1 or 2. Anti-antibodies.

Images