CN109957012B

CN109957012B - Fully human monoclonal antibody 8E17 against H7N9, and preparation method and application thereof

Info

Publication number: CN109957012B
Application number: CN201711338959.6A
Authority: CN
Inventors: 万晓春; 李俊鑫; 刘绿艳
Original assignee: Shenzhen Institute of Advanced Technology of CAS
Current assignee: Shenzhen Institute of Advanced Technology of CAS
Priority date: 2017-12-14
Filing date: 2017-12-14
Publication date: 2021-04-09
Anticipated expiration: 2037-12-14
Also published as: CN109957012A

Abstract

The invention relates to an anti-H7N 9 fully human monoclonal antibody 8E17, a preparation method and application thereof, and an anti-H7N 9 fully human monoclonal antibody 8E17 or a bioactive fragment which is derived from the monoclonal antibody and can be specifically combined with H7N9, wherein the antibody has a heavy chain variable region and a light chain variable region, and the heavy chain variable region and the light chain variable region respectively have 3 Complementary Determining Regions (CDRs). The antibody 8E17 can be combined with hemagglutinin HA of H7N9 virus in a targeted mode, and can be applied to virus detection of influenza patients.

Description

Fully human monoclonal antibody 8E17 against H7N9, and preparation method and application thereof

Technical Field

The invention relates to a fully human monoclonal antibody against H7N9, a preparation method and application thereof, in particular to a fully human monoclonal antibody 8E17 against H7N9, a preparation method and application thereof, belonging to the technical field of immunology.

Background

Six of the ten well-sold drugs worldwide in 2015 were all human or humanized monoclonal antibody drugs. The first one is Humira, a fully human monoclonal antibody, which is a monoclonal antibody and is sold in 100 hundred million over 3 years. Since the first monoclonal antibody drug was marketed in 1986, the monoclonal antibody drugs underwent the stages of murine monoclonal antibody drug (Orthoclone OKT3), chimeric monoclonal antibody drug (Rituximab), humanized monoclonal antibody drug (Herceptin), and fully human monoclonal antibody drug (Humira). Because human bodies have anti-mouse antibody reaction (HAMA), murine monoclonal antibody drugs and chimeric monoclonal antibody drugs are gradually eliminated, and the monoclonal antibody drugs occupying the market at present are all humanized monoclonal antibody drugs. Compared with the internationally advanced human antibody production technology, Shenzhen and even China have great gap, mainly manifested in the weak innovation ability of the human antibody drug field, few varieties of independent research and development, no report of the market of original humanized monoclonal antibody drug exists at present, and the huge antibody drug market is occupied by foreign drug enterprises. China changes the lagging situation and strives for antibody drug markets with huge consumption potential at home and abroad, and the humanized monoclonal antibody technology needs to be overcome urgently.

The humanized antibody refers to the antibody gene sequence completely derived from the human antibody gene sequence. The humanized antibody has high specificity, less side effect and high disease preventing and treating effect, and is the main development direction of monoclonal antibody medicine in future. The current common techniques for preparing human monoclonal antibodies mainly comprise phage display technology and single B cell PCR technology. The humanized monoclonal antibody prepared by the phage display technology has the advantages of low production cost and no complicated work such as immunization, cell fusion and the like. However, the disadvantage is also obvious, and the antibody obtained from the non-immune antibody library is often insufficient in affinity, limited by the conversion rate of foreign genes, insufficient in library capacity of the antibody library to cover the antibody diversity of animals, and the like. In recent years, the emerging single B cell PCR technology refers to the separation of B cells secreting functional antibodies from the blood of patients, then RNA extraction and cDNA synthesis, cloning of the genes secreting the target antibodies, and finally recombination and expression of fully human monoclonal antibodies. The technology is simple and quick to operate, the produced humanized antibody has high affinity and specificity, and the technology of separating the monoclonal antibody with the virus neutralizing function or the tumor killing function from the memory B cell which is improved recently greatly reduces the complicated operation and cost. The technology of preparing humanized monoclonal antibodies by single B cells is a development trend of developing humanized monoclonal antibodies.

The human monoclonal antibody has high specificity and obvious curative effect on inflammation, cancer, especially influenza. Influenza is an infectious disease caused by influenza virus, and seriously threatens human health. About 10 million people worldwide are infected with seasonal influenza virus each year, with 25-50 million people dying. The H7N9 virus is an influenza virus, has drug resistance to traditional antiviral drugs amantadine and rimantadine, and has no effective treatment means at present. The H7N9 virus needs to be bound with a receptor on a human cell by a specific molecule expressed by the virus itself when invading the cell, so that the cell can be infected and further amplified. The human antibody for neutralizing the virus is a certain specific antibody generated by human B lymphocytes, can be combined with the antigen on the surface of the virus, thereby preventing the virus from adhering to a target cell receptor, preventing the virus from invading cells and effectively preventing and treating the H7N9 influenza.

Therefore, it is of great significance to provide fully human monoclonal antibodies against H7N9 and methods for their preparation.

Disclosure of Invention

One of the purposes of the present invention is to provide the fully human monoclonal antibody 8E17 against H7N9 or a biologically active fragment derived from the monoclonal antibody and capable of specifically binding to H7N 9.

Another objective of the invention is to provide a gene encoding the anti-H7N 9 fully human monoclonal antibody 8E17 or a biologically active fragment derived from the monoclonal antibody and capable of specifically binding to H7N9, and a vector or a cell containing the gene.

Another object of the present invention is to provide a method for producing the anti-H7N 9 fully human monoclonal antibody 8E 17.

Another objective of the invention is to provide a pharmaceutical composition comprising the anti-H7N 9 fully human monoclonal antibody 8E17 or a biologically active fragment derived from the monoclonal antibody and capable of specifically binding to H7N 9.

Another objective of the invention is to provide application of the anti-H7N 9 fully human monoclonal antibody 8E17 or a biologically active fragment derived from the monoclonal antibody and capable of specifically binding to H7N9 or the pharmaceutical composition.

The invention also aims to provide a kit for detecting the H7N9 virus.

In order to achieve the above objects, the present invention provides an anti-H7N 9 fully human monoclonal antibody or a biologically active fragment derived from the monoclonal antibody and capable of specifically binding to H7N 9. The antibody is named 8E17 in the present invention.

According to a specific embodiment of the present invention, the antibody of the present invention has a heavy chain variable region and a light chain variable region each having 3 Complementarity Determining Regions (CDRs), wherein:

an anti-H7N 9 fully human monoclonal antibody 8E17, or a biologically active fragment derived therefrom that specifically binds H7N9, wherein said antibody has a heavy chain variable region and a light chain variable region each having 3 Complementarity Determining Regions (CDRs), wherein:

the amino acid sequence of CDR1 of the heavy chain variable region is: GFIFSNYG (SEQ ID NO:5),

the amino acid sequence of CDR2 of the heavy chain variable region is: IWSDGTTT (SEQ ID NO:6),

the amino acid sequence of CDR3 of the heavy chain variable region is: ARGDLDVVQVAAVTKLWDY (SEQ ID NO:7),

the amino acid sequence of CDR1 of the light chain variable region is: SSDVGGYNY (SEQ ID NO:8),

the amino acid sequence of CDR2 of the light chain variable region is: an EVT (electrically driven variable) is provided,

the amino acid sequence of CDR3 of the light chain variable region is: SSYAVSNNFV (SEQ ID NO: 9).

According to a particular embodiment of the invention, the heavy chain of the antibody of the invention is represented by SEQ ID NO 2.

According to a particular embodiment of the invention, the light chain of the antibody of the invention is represented by SEQ ID NO 4.

The invention also provides a polynucleotide encoding the heavy chain variable region and/or the light chain variable region of the antibody of the invention, or encoding the heavy chain and/or the light chain of the antibody. Preferably, the polynucleotide comprises at least one of the following sequences:

1, 3 and 10 to 14 SEQ ID NOs.

According to a particular embodiment of the invention, SEQ ID NO 1 is a polynucleotide encoding SEQ ID NO 2; SEQ ID NO. 3 is a polynucleotide encoding SEQ ID NO. 4; SEQ ID NO. 10 is a polynucleotide encoding SEQ ID NO. 5; SEQ ID NO. 11 is a polynucleotide encoding SEQ ID NO. 6; 12 is a polynucleotide encoding SEQ ID NO. 7; 13 is a polynucleotide encoding SEQ ID NO. 8; SEQ ID NO. 14 is a polynucleotide encoding SEQ ID NO. 9. The polynucleotide sequence of the amino acid sequence EVT encoding the CDR2 of the light chain variable region may be: GAAGTCACT are provided.

The invention also provides vectors comprising the polynucleotides of the invention.

The invention also provides cells comprising a polynucleotide of the invention or a vector of the invention.

The invention also provides a method for producing the anti-H7N 9 fully human monoclonal antibody 8E17 or a biologically active fragment derived from the monoclonal antibody and capable of specifically binding to H7N9, wherein the method is used for preparing the anti-H7N 9 fully human monoclonal antibody 8E17 by adopting a single B cell method.

In the prior art, a method for preparing an anti-H7N 9 virus humanized monoclonal antibody by adopting a phage display technology exists, although the method has the advantages of low production cost and no complicated work such as immunization, cell fusion and the like, the method has obvious defects, and the antibody obtained from a non-immune antibody library is often insufficient in affinity, limited by the conversion rate of an exogenous gene, insufficient in library capacity of the antibody library to cover the antibody diversity of animals and the like. The invention adopts single B cell PCR technology to separate B cells secreting functional antibodies from blood of a patient, then extracts RNA and synthesizes cDNA, clones genes secreting target antibodies from the RNA and the cDNA, and finally recombines and expresses fully human monoclonal antibodies. The technology is simple and quick to operate, the produced humanized antibody has high affinity and specificity, and in addition, the technology of the improved monoclonal antibody with the virus neutralizing or tumor killing function separated from the memory B cells can be further adopted, so that the complicated operation and cost are greatly reduced.

The invention also provides a pharmaceutical composition, which comprises the anti-H7N 9 fully human monoclonal antibody 8E17 or a bioactive fragment which is derived from the monoclonal antibody and can specifically bind to H7N 9.

The invention also provides application of the anti-H7N 9 fully human monoclonal antibody 8E17 or a bioactive fragment which is derived from the monoclonal antibody and can specifically bind to H7N9, or application of the pharmaceutical composition in preparing a medicament for treating diseases caused by H7N9 virus.

The invention also provides a kit for detecting the H7N9 virus level, which contains the anti-H7N 9 fully human monoclonal antibody 8E17 or a bioactive fragment which is derived from the monoclonal antibody and can be specifically bound with H7N 9; preferably, the kit further comprises a second antibody and an enzyme or fluorescent or radioactive label for detection, and a buffer; preferably, the second antibody is an anti-antibody against monoclonal antibody 8E17 of the present invention.

Compared with the prior art, the invention has the following beneficial effects:

(1) the H7N 9-resistant fully-humanized monoclonal antibody 8E17 can be combined with hemagglutinin HA of H7N9 virus in a targeted mode, and can be applied to virus detection of influenza patients.

(2) Compared with the mouse antibody, the gene of the fully human antibody is completely derived from the human gene, has no components of other species, does not generate toxic and side effects such as anti-mouse antibody and the like in a human body, has better biocompatibility, and is more suitable and has more potential to become a macromolecular medicament for treating influenza virus.

(3) Compared with the method for preparing the H7N9 virus-resistant human monoclonal antibody by using the phage display technology provided by the prior art, the method for developing the H7N 9-resistant antibody by using the single B cell has the advantages of simple and rapid operation, high affinity and specificity of the produced human antibody and the like.

Drawings

FIG. 1 is a graph showing the results of flow-based assay of example 1 in which NTH-3T3 expresses CD 40L.

FIG. 2 is a graph showing the results of sorting memory B cells by flow cytometry in example 1.

FIG. 3 is a graph showing the results of ELISA experiments in example 1.

FIG. 4 is a graph showing the result of Western blot agarose gel electrophoresis in example 2.

FIG. 5 is a schematic sequence diagram of the heavy chain variable region and the light chain variable region of 8E 17.

Detailed Description

For a more clear understanding of the technical features, objects and advantages of the present invention, reference is now made to the following detailed description of the embodiments of the present invention taken in conjunction with the accompanying drawings, which are included to illustrate and not to limit the scope of the present invention. In the examples, each raw reagent material is commercially available, and the experimental method not specifying the specific conditions is a conventional method and a conventional condition well known in the art, or a condition recommended by an instrument manufacturer.

Example 1

(1) Construction of NTH-3T3 cell line stably expressing CD40L

Lentivirus was used to establish 3T3-CD40L feeder cells. Constructing a lentivirus expression vector pLVX-CD40L, transfecting 293T cells, and collecting virus supernatant on the fourth day of transfection. NIH-3T3 cells were activated, cultured for 3 passages, infected with lentivirus, cultured further and passaged 3 times. Sorting cells with FITC fluorescence intensity near MFI by using a flow cytometer, adding the cells into a culture bottle again at 37 ℃ and 5% CO₂The cells were cultured in an incubator and tested as shown in FIG. 1, in which 3T3 cells expressing CD40L and 3T3 cells transfected with an empty vector pLVX (with ZxGreen) were stained with anti-CD 40L with APC, respectively, and then analyzed by flow cytometry. As a result, all 3T3-CD40L feeder cells were found to express CD 40L. When the cells grow to 80% -90%, the cells are collected by digestion at a concentration of 1X 10 per ml⁷A cell. Placing in an irradiator for 5000rads irradiation, and resuspending the cells in the frozen stock solution at a concentration of 3.5 × 10/ml⁷The cells are packed in 1ml of freezing tubules and frozen in liquid nitrogen (can be stored for 2 years).

(2) Sorting and activation of memory B cells

Isolation and cryopreservation of PBMC from convalescent patients infected with H7N9 virus using lymph isolate, 10-50X 10 per tube⁶Cells, frozen in liquid nitrogen tank. A PBMC flow staining solution was prepared, the composition of which is shown in table 1 below:

table 1: PBMC (Poly-beta-phenylene PBMC) flow type staining solution

Thawing PBMC, adding the above PBMC flow staining solution and sorting on flow cytometer, and sorting out CD19 as shown in FIG. 2⁺IgM^–IgA^–IgD^–The memory B cell of (a) is,the purity of the cells needs to be more than 90%, and if the purity of the cells is less than 90%, the sorting process is repeated.

A mixed B-cell activating medium was prepared, the composition of which is shown in table 2 below:

TABLE 2

Components	Volume of
		Complete IMDM Medium	336mL
IL-2(10,000U mL^-1)	3.5mL
		IL-21(100μg mL^-1)	175μL
3T3-CD40L	10mL

Adding memory B cells into mixed culture medium, mixing, diluting in 384-well plate with 1 cell per well and 50 μ l volume, standing at 37 deg.C and 5% CO₂And (5) standing and culturing in an incubator. After 13 days, the supernatant was subjected to ELISA.

(3) Obtaining human monoclonal antibody 8E17 against H7N9 Virus

The influenza virus hemagglutinin HA is a virus envelope surface columnar antigen, can be combined with a plurality of erythrocyte receptors such as human, chicken, guinea pig and the like to cause erythrocyte agglutination, HAs immunogenicity, and can neutralize influenza virus by an anti-hemagglutinin antibody. In the present invention, B cells secreting antibody 8E17 binding to H7N9 virus were found by ELISA, and the secreted human monoclonal antibody 8E17 could target hemagglutinin HA binding to H7N9 virus (fig. 3).

The specific operation of the ELISA experiment is as follows:

(1) coating 100ng/100 ul of HA protein of H7N9 virus in a 96-well enzyme label plate, wherein each well is 100 ul;

(2) standing in a 4-degree refrigerator overnight;

(3) washing with PBST solution for three times, adding 5% skimmed milk powder solution 200 μ l to each well, and incubating at 37 deg.C for 1 hr;

(4) washing with PBST solution for three times, adding 100ul of normal human serum without virus infection (negative control) or patient serum infected with virus or anti-H7N 9 fully human monoclonal antibody, each repeating for three times;

(5) after incubation for 1 hour at 37 degrees, washed three times with PBST solution;

(6) diluting an anti-human IgG antibody with HRP at a ratio of 1:5000, and adding the diluted anti-human IgG antibody into an enzyme label plate, wherein each hole is 100 mu l;

(7) after incubation for 1 hour at 37 degrees, washed three times with PBST solution;

(8) adding 100 mul of TMB substrate solution into each hole, and keeping the temperature at 37 ℃ for 5 minutes;

(9) the stop solution 2M sulfuric acid 100. mu.l was added to each well, and the absorbance was immediately measured at a wavelength of 450nm in a microplate reader. As shown in FIG. 3, ELISA experiments showed that the human monoclonal antibody 8E17 obtained by the present invention can target hemagglutinin HA binding to H7N9 virus.

EXAMPLE 2 cloning, recombination and expression of humanized monoclonal antibody 8E17 Gene

The B cells capable of secreting antibody 8E17 that binds to H7N9 virus obtained in example 1 were lysed, and the lysates were subjected to reverse transcription of RNA to obtain PCR template cDNA of the human antibody gene. The genes of the heavy chain and the light chain of the antibody are cloned by taking the cDNA as a template, and are recombined and expressed and purified in the eukaryotic cell 293F or HEK 293.

Specifically, the method comprises the following steps:

(1) the B cell fluid was transferred to a 96-well plate (Eppendorf, 030133366).

(2) Reverse transcription system: 150ng random primer (invitrogen, 4819)0-011),0.5ul 10mM dNTP(Invitrogen,18427-088),1μl 0.1M DTT(Invitrogen,18080-044),0.5％v/v Igepal CA-630(Sigma,I3021-50ML),4U RNAsin(Promega),6U Prime RNAse Inhibitor(Eppendorf)and 50U

III reverse transcriptase (Invitrogen,18080-044), DEPC water was supplied to 14. mu.l/well.

(3) Reverse transcription reaction procedure: 42 ℃ for 10 min; at 25 ℃ for 10 min; 50 ℃ for 60 min; 94 ℃ for 5 min.

(4) The cDNA was stored at-20 ℃.

(5) Heavy and light chains of the antibody gene were PCR amplified using the KOD-Plus-Neo (TOYOBO, KOD401) kit, respectively, in a 40. mu.L system: 3.5. mu.L of cDNA, 20nM mixed primer, 4. mu.L of buffer (buffer), 4. mu.L of 2mM dNTPs, 2.4. mu.L of MgSO 2₄，1μL KOD。

(6) Reaction procedure: 94 ℃ for 2 min; 45 cycles: [98 ℃,10 s; 58 ℃ (IgH/Ig kappa) or 60 ℃ (Ig lambda), 30 s; 68 ℃ for 28s (1)^stPCR) or 23s (2)^nd PCR)]。

(7) The result of subjecting the amplification product to agarose gel analysis is shown in FIG. 4, which shows that the antibody light chain variable region is kappa and 336bp in size and the antibody heavy chain variable region is 378bp in size.

(8) The sequencing results of the antibody gene PCR products were as follows:

the heavy chain variable region gene of 8E17 (SEQ ID NO: 1):

CAAGTGCAGCTGGTGGAGTCTGGGGGAGGCGTGGTCCAGCCTGGGAGGTCCCTGAGACTCTCCTGTGCTGCGTCTGGATTCATCTTCAGTAATTATGGCATGCACTGGGTCCGCCAGGCTCCAGGCAGGGGACTGGAGTGGGTTGCAGTTATATGGTCCGATGGAACCACTACGTACTATGCAGACTCCTTTAAGGGCCGATTCACCATCTCCAGTGACAATTCGAAGAACACGGTCTATCTGCAAATGAACAGCCTGAGAGCCGACGACTCGGCTATATATTACTGTGCGAGAGGGGACTTAGATGTTGTACAAGTAGCGGCTGTTACGAAGCTATGGGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCA

the light chain variable region gene of 8E17 (SEQ ID NO: 3):

CAGTCTGTGCTGACTCAGCCACCCTCCGCGTCCGGGTCTCTTGGACGGTCAGTCACCATCTCCTGCACTGGAACCAGCAGTGATGTTGGTGGTTATAACTATGTCTCTTGGTACCAACAACACCCAGGCAAAGTCCCCAAACTCTTGGTTTATGAAGTCACTAAGCGGCCCTCAGGGGTCCCTGATCGCTTCTCTGGCTCCAAGTCTGGCAACACGGCCTCCCTGACCGTCTCTGGGCTCCAGGCTGAGGATGAGGCTGATTATTACTGCAGTTCATATGCAGTCAGCAACAATTTTGTCTTCGGAACTGGGACCAAGCTGACCGTCACAGTATCG

(9) the H gene and pcDNA3.1 are respectively subjected to BamH1/EcoR1 double enzyme digestion and then connected to form pcDNA3.1-H vector.

(10) The L gene and pcDNA3.1 were digested separately with Not1/Xho1 and ligated to form pcDNA3.1-L vector.

(11) 293F cells were cultured.

(12)20ug of pcDNA3.1-L vector and 10ug of pcDNA3.1-H vector were co-transfected into 293F cells and cultured for 96 hours.

(13) Taking the supernatant to perform ELISA (ABC is the supernatant, DEF is the positive control, GH is the negative control) and western blot; the results of the ELISA experiments are shown in Table 3 below:

TABLE 3

Data of	450	Data of	450
				A	3.0025	E	1.2087
B	3.1215	F	1.1470
				C	2.9562	G	0.0321
D	1.1463	H	0.1001

The above results show that the supernatant contains antibody 8E17 capable of binding H7N9 virus.

The Western blot experiment comprises the following specific processes:

running protein denaturation electrophoresis with supernatant, blocking with 5% skimmed milk powder solution for 1 hr after membrane conversion, then incubating with goat anti-human IgG antibody with HRP for 1 hr, and finally adding display substrate for exposure. The results of the experiment are shown in FIG. 4, and FIG. 4 shows the heavy and light chains of the fully human antibody, indicating that the supernatant contains the fully human monoclonal antibody 8E17 against H7N9 virus.

For monoclonal antibody 8E17 of this example, the amino acid sequence of SEQ ID NO:2 and SEQ ID NO:4 are the VH and VL amino acid sequences of the heavy chain variable region and light chain variable region of 8E17, respectively, obtained in this example. Referring to fig. 5, the heavy chain variable region and the light chain variable region each have 3 Complementarity Determining Regions (CDRs) numbered CDR1, CDR2, CDR3, wherein: heavy chain: CDR 1: GFIFSNYG (SEQ ID NO: 5); CDR 2: IWSDGTTT (SEQ ID NO: 6); CDR 3: ARGDLDVVQVAAVTKLWDY (SEQ ID NO: 7). Light chain: CDR 1: SSDVGGYNY (SEQ ID NO: 8); CDR 2: an EVT; CDR 3: SSYAVSNNFV (SEQ ID NO: 9).

Finally, the description is as follows: although the present invention has been described in detail with reference to the above embodiments, it should be understood by those skilled in the art that: modifications and equivalents may be made thereto without departing from the spirit and scope of the invention and it is intended to cover any modifications or equivalents as may fall within the scope of the invention.

Sequence listing

<110> Shenzhen advanced technology research institute of Chinese academy of sciences

<120> anti-H7N 9 fully human monoclonal antibody 8E17, and preparation method and application thereof

<130> GAI17CN3629

<160> 14

<170> SIPOSequenceListing 1.0

<210> 1

<211> 378

<212> DNA

<213> Artificial sequence ()

<220>

<223> 8E17 heavy chain variable region gene

<220>

<221> CDS

<222> (1)..(378)

<400> 1

caa gtg cag ctg gtg gag tct ggg gga ggc gtg gtc cag cct ggg agg 48

Gln Val Gln Leu Val Glu Ser Gly Gly Gly Val Val Gln Pro Gly Arg

1 5 10 15

tcc ctg aga ctc tcc tgt gct gcg tct gga ttc atc ttc agt aat tat 96

Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Ile Phe Ser Asn Tyr

20 25 30

ggc atg cac tgg gtc cgc cag gct cca ggc agg gga ctg gag tgg gtt 144

Gly Met His Trp Val Arg Gln Ala Pro Gly Arg Gly Leu Glu Trp Val

35 40 45

gca gtt ata tgg tcc gat gga acc act acg tac tat gca gac tcc ttt 192

Ala Val Ile Trp Ser Asp Gly Thr Thr Thr Tyr Tyr Ala Asp Ser Phe

50 55 60

aag ggc cga ttc acc atc tcc agt gac aat tcg aag aac acg gtc tat 240

Lys Gly Arg Phe Thr Ile Ser Ser Asp Asn Ser Lys Asn Thr Val Tyr

65 70 75 80

ctg caa atg aac agc ctg aga gcc gac gac tcg gct ata tat tac tgt 288

Leu Gln Met Asn Ser Leu Arg Ala Asp Asp Ser Ala Ile Tyr Tyr Cys

85 90 95

gcg aga ggg gac tta gat gtt gta caa gta gcg gct gtt acg aag cta 336

Ala Arg Gly Asp Leu Asp Val Val Gln Val Ala Ala Val Thr Lys Leu

100 105 110

tgg gac tac tgg ggc cag gga acc ctg gtc acc gtc tcc tca 378

Trp Asp Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser

115 120 125

<210> 2

<211> 126

<212> PRT

<213> Artificial sequence ()

<220>

<223> Synthetic Construct

<400> 2

Gln Val Gln Leu Val Glu Ser Gly Gly Gly Val Val Gln Pro Gly Arg

1 5 10 15

Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Ile Phe Ser Asn Tyr

20 25 30

Gly Met His Trp Val Arg Gln Ala Pro Gly Arg Gly Leu Glu Trp Val

35 40 45

Ala Val Ile Trp Ser Asp Gly Thr Thr Thr Tyr Tyr Ala Asp Ser Phe

50 55 60

Lys Gly Arg Phe Thr Ile Ser Ser Asp Asn Ser Lys Asn Thr Val Tyr

65 70 75 80

Leu Gln Met Asn Ser Leu Arg Ala Asp Asp Ser Ala Ile Tyr Tyr Cys

85 90 95

Ala Arg Gly Asp Leu Asp Val Val Gln Val Ala Ala Val Thr Lys Leu

100 105 110

Trp Asp Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser

115 120 125

<210> 3

<211> 336

<212> DNA

<213> Artificial sequence ()

<220>

<223> 8E17 variable region in light chain

<220>

<221> CDS

<222> (1)..(336)

<400> 3

cag tct gtg ctg act cag cca ccc tcc gcg tcc ggg tct ctt gga cgg 48

Gln Ser Val Leu Thr Gln Pro Pro Ser Ala Ser Gly Ser Leu Gly Arg

1 5 10 15

tca gtc acc atc tcc tgc act gga acc agc agt gat gtt ggt ggt tat 96

Ser Val Thr Ile Ser Cys Thr Gly Thr Ser Ser Asp Val Gly Gly Tyr

20 25 30

aac tat gtc tct tgg tac caa caa cac cca ggc aaa gtc ccc aaa ctc 144

Asn Tyr Val Ser Trp Tyr Gln Gln His Pro Gly Lys Val Pro Lys Leu

35 40 45

ttg gtt tat gaa gtc act aag cgg ccc tca ggg gtc cct gat cgc ttc 192

Leu Val Tyr Glu Val Thr Lys Arg Pro Ser Gly Val Pro Asp Arg Phe

50 55 60

tct ggc tcc aag tct ggc aac acg gcc tcc ctg acc gtc tct ggg ctc 240

Ser Gly Ser Lys Ser Gly Asn Thr Ala Ser Leu Thr Val Ser Gly Leu

65 70 75 80

cag gct gag gat gag gct gat tat tac tgc agt tca tat gca gtc agc 288

Gln Ala Glu Asp Glu Ala Asp Tyr Tyr Cys Ser Ser Tyr Ala Val Ser

85 90 95

aac aat ttt gtc ttc gga act ggg acc aag ctg acc gtc aca gta tcg 336

Asn Asn Phe Val Phe Gly Thr Gly Thr Lys Leu Thr Val Thr Val Ser

100 105 110

<210> 4

<211> 112

<212> PRT

<213> Artificial sequence ()

<220>

<223> Synthetic Construct

<400> 4

Gln Ser Val Leu Thr Gln Pro Pro Ser Ala Ser Gly Ser Leu Gly Arg

1 5 10 15

Ser Val Thr Ile Ser Cys Thr Gly Thr Ser Ser Asp Val Gly Gly Tyr

20 25 30

Asn Tyr Val Ser Trp Tyr Gln Gln His Pro Gly Lys Val Pro Lys Leu

35 40 45

Leu Val Tyr Glu Val Thr Lys Arg Pro Ser Gly Val Pro Asp Arg Phe

50 55 60

Ser Gly Ser Lys Ser Gly Asn Thr Ala Ser Leu Thr Val Ser Gly Leu

65 70 75 80

Gln Ala Glu Asp Glu Ala Asp Tyr Tyr Cys Ser Ser Tyr Ala Val Ser

85 90 95

Asn Asn Phe Val Phe Gly Thr Gly Thr Lys Leu Thr Val Thr Val Ser

100 105 110

<210> 5

<211> 8

<212> PRT

<213> Artificial sequence ()

<220>

<223> VH-CDR1

<400> 5

Gly Phe Ile Phe Ser Asn Tyr Gly

1 5

<210> 6

<211> 8

<212> PRT

<213> Artificial sequence ()

<220>

<223> VH-CDR2

<400> 6

Ile Trp Ser Asp Gly Thr Thr Thr

1 5

<210> 7

<211> 19

<212> PRT

<213> Artificial sequence ()

<220>

<223> VH-CNR3

<400> 7

Ala Arg Gly Asp Leu Asp Val Val Gln Val Ala Ala Val Thr Lys Leu

1 5 10 15

Trp Asp Tyr

<210> 8

<211> 9

<212> PRT

<213> Artificial sequence ()

<220>

<223> VL-CDR1

<400> 8

Ser Ser Asp Val Gly Gly Tyr Asn Tyr

1 5

<210> 9

<211> 10

<212> PRT

<213> Artificial sequence ()

<220>

<223> VL-CDR3

<400> 9

Ser Ser Tyr Ala Val Ser Asn Asn Phe Val

1 5 10

<210> 10

<211> 24

<212> DNA

<213> Artificial sequence ()

<220>

<223> gene encoding VH-CDR1

<400> 10

ggattcatct tcagtaatta tggc 24

<210> 11

<211> 24

<212> DNA

<213> Artificial sequence ()

<220>

<223> gene encoding VH-CDR2

<400> 11

atatggtccg atggaaccac tacg 24

<210> 12

<211> 57

<212> DNA

<213> Artificial sequence ()

<220>

<223> gene encoding VH-CDR3

<400> 12

gcgagagggg acttagatgt tgtacaagta gcggctgtta cgaagctatg ggactac 57

<210> 13

<211> 27

<212> DNA

<213> Artificial sequence ()

<220>

<223> gene encoding VL-CDR1

<400> 13

agcagtgatg ttggtggtta taactat 27

<210> 14

<211> 30

<212> DNA

<213> Artificial sequence ()

<220>

<223> gene encoding VL-CDR3

<400> 14

agttcatatg cagtcagcaa caattttgtc 30

Claims

1. An anti-H7N 9 fully human monoclonal antibody 8E17, or a biologically active fragment derived therefrom that specifically binds H7N9, wherein said antibody has a heavy chain variable region and a light chain variable region each having 3 Complementarity Determining Regions (CDRs), wherein:

2. The antibody of claim 1, wherein the heavy chain of the antibody is represented by SEQ ID NO 2.

3. The antibody of claim 1 or 2, wherein the light chain of the antibody is represented by SEQ ID NO. 4.

4. A polynucleotide encoding the variable region of the heavy chain and the variable region of the light chain of the antibody of any one of claims 1 to 3, or encoding the heavy chain and the light chain of the antibody of any one of claims 1 to 3.

5. The polynucleotide of claim 4, comprising at least one of the following sequences:

1, 3 and 10 to 14 SEQ ID NOs.

6. A vector comprising the polynucleotide of claim 4 or 5.

7. A cell comprising the polynucleotide of claim 4 or 5 or comprising the vector of claim 6.

8. A kit for detecting the level of H7N9 virus, comprising the anti-H7N 9 fully human monoclonal antibody 8E17 of any one of claims 1 to 3 or a biologically active fragment derived therefrom that specifically binds to H7N 9.

9. The kit of claim 8, further comprising a second antibody and an enzyme for detection or a fluorescent or radioactive label, and a buffer.

10. The kit according to claim 9, wherein the second antibody is an anti-antibody against the monoclonal antibody 8E17 according to any one of claims 1 to 3.