CN109776678A - A kind of humanization PD-L1 monoclonal antibody, preparation method and application - Google Patents

Abstract

The present invention relates to bio-pharmaceutical engineer technology domains, more particularly to a kind of anti-PD-L1 humanization rabbit monoclonal antibody.The present invention provides a kind of new humanization rabbit-anti PD-L1 monoclonal antibodies, disclose the amino acid sequence of this humanization rabbit monoclonal antibody, corresponding expression vector and the host cell that can express the antibody, and the production method of antibody of the present invention.Specifically, anti- PD-L1 monoclonal antibody provided by the invention is immunized after rabbit through humanization modified gained, expression quantity with higher in mammalian cells, can specific bond in extracellular region PD-L1 albumen, with the apparent ability for inhibiting ligand-receptor to combine, the combination for blocking PD1 and PD-L1, restores the function of T cell.It can be used as immunologic test point inhibitor, especially treat and prevent or diagnose the purposes in PD-L1 relevant case such as tumour.

Description

A kind of humanization PD-L1 monoclonal antibody, preparation method and application

Technical field

The invention belongs to bio-pharmaceutical engineer technology domains, and in particular to a kind of humanization rabbit PD-L1 monoclonal antibody, its Preparation method and application.

Background technique

Rabbit is well-known, and can generate Multiple Antibodies for many antigens, be included in mouse and do not have immunogenicity Phosphoeptide, carbohydrate and immunogene.Polyclonal antibody from rabbit has been demonstrated highly useful in the lab.So And the inconsistent and limited antibody yield of immune period hinders its clinical application, until can produce rabbit monoclonal antibodies. Currently, commercialized rabbit monoclonal antibody had been developed for two generations: the first generation is the monoclonal antibody large scale preparation based on hybridoma technology Platform；The second generation is the large scale preparation platform based on display technique of bacteriophage.But the development pole of first generation rabbit monoclonal antibody The earth receives the limitation of myeloma cell line, and the reason of patent, at high price in addition.And the appearance of second generation rabbit monoclonal antibody, ingeniously The limitation for having got around myeloma cell wonderfully passes through warm display technique of bacteriophage, genetic engineering antibody technology and a variety of expression And purification technique, potent antibodies are directly screened, developing again for rabbit monoclonal antibody product is successfully realized.With traditional various sources Antibody compare, rabbit monoclonal antibody at least has wider antibody repertoire, immunoglobulin structure simple, more high specific and affine A variety of advantages such as power, the candidate application for being easy to humanization and high-quality monoclonal antibody medicine.

Numerous RabMAb is widely used to various applications such as IHC, WB, IP and FCM of life science.RabMAb The excellent reagent in immunohistochemistry (IHC) is had proven to, and in the posttranslational modification of detection protein, such as phosphorus Acidification and activation performance are fabulous.In addition, scientist also developed some RabMAb, it is directed in the targeted therapy of cancer for detecting Biomarker.Rabbit monoclonal antibody is also growing day by day in the demand of field of scientific study, so providing good rabbit monoclonal antibody product Also it is particularly important.

Wider antibody repertoire: from the point of view of the experience that antibody is developed, it is more unique that the immune system of rabbit can produce identification The antibody of epitope.It is well known that rabbit has the immune response mechanism different from the mankind and mouse, it is immunized when with external antigen When, rabbit can generate the immune response for being better than people and mouse.Multiple VH, D and the JH that people and mouse pass through combination connection heavy chain The multiple V (γ) and J (γ) genetic fragment of genetic fragment and light chain generate their main antibody pedigree.Second stage, body The VJ and VDJ that the super mutation of cell causes gene rearrangement and generates further enrich antibody repertoire, increase the multiplicity of affinity of antibody Property.Although the main antibody pedigree generation mechanism of rabbit is similar with people and mouse, in the generation of second stage antibody pedigree In mechanism, not only there is somatic hypermutation process, additional there are one transcription frequency mechanism, this just further enriches rabbit Antibody repertoire.Also just because of this, rabbit-anti even can be with the anti-antigen that cannot be identified of identification division mouse.When necessary in your experimental applications When using antigen with weak immunogene, selecting rabbit-anti system is very wise strategy.

Immunoglobulin structure is simpler: it is well known that immunoglobulin is five classes, they are defined by its heavy chain type: IgG is C γ；C μ is used for IgM；C α is used for IgA；IgE is C ε, and IgD is C δ.The study found that rabbit immunoglobulin is that four classes (are free of IgD).The most abundant immunoglobulin is IgG, serum-concentration 5-20mg/ml in rabbit anteserum.It is different from the IgG of other animals, Rabbit igg does not have subclass.Compared with mouse and human IgG, rabbit igg tends to the amino acid for having less in N-terminal and D-E ring, And there is additional disulfide bond in the variable region of heavy chain, this may be so that the higher reason of rabbit monoclonal antibody stability.Exactly by In this simpler structure of rabbit igg and more stable property, just make the molecular cloning of key antibody in antibody drug exploitation What is become is more easier, but also the various application experiment results in laboratory are more stable.

More high-affinity: high-affinity is the successful premise of immunity test, and the basis of one high-quality monoclonal antibody of measurement refers to Mark.The non-specific interaction of antibody drug can cause side effect, therefore high-affinity is for preparing some high-quality antibody medicines Object is extremely important.The dissociation constant (Kd) of most of monoclonal antibodies in nanomole or sub-nanometer rank, but rabbit monoclonal antibody in picomole Grade has more high-affinity.The high-affinity and high specific of rabbit monoclonal antibody, so that it is with better experimental applications potentiality.Rabbit Outstanding representation of the monoclonal antibody in IHC application also demonstrates our viewpoint, and simple and reliable rabbit monoclonal antibody has become part science " hispid Chinese knotweed root " of family.

It is easy to humanization: the immunogenicity in order to reduce monoclonal antibody medicine, currently, can make in antibody there are many method Animal gene content minimize, it is most widely used be exactly CDR transplant.The essence of this method is exactly to encode CDR appropriate Section is inserted into human antibody frame, and residue more crucial in some structures in framework region is mutated and returns to parent's residue, The affinity and specificity of original antigen are rebuild with this.90% sequence is source of people after CDR transplanting, and even so he also deposits It needs to solve in some problems: first, we are also difficult to the specific effect for predicting those specific residues to antibody.Therefore, it needs The version after different humanizations is tested in vitro and in vivo than comparatively dense.The antibody of second, CDR transplanting is shown to it The affinity of antigen reduces, and needs to restore the affinity in humanized antibody based on external affinity maturation.

It is developed recently a kind of new humanization technologies, referred to as Mutational Lineage-Guided (MLG) source of people Change technology is more easier RabMAb humanization.MLG humanization is conceptually and technically all different from CDR transplantation method.It will The amino acid sequence of the variable region of heavy chain and light chain (VH and VL) from IgG arrangement set is aligned to form phylogenetic tree. Associated antibodies are grouped according to the similitude of its sequence.Conserved sequence in pedigree relevant group represents structure and function to IgG It can vital residue.Since these variable positions are usually from one group of antibody of a parental generation B cell, so they are necessary It is effectively checked by animal immune system.Therefore, the amino acid substitution humanized antibody at these positions should be good resistance to It receives, does not sacrifice antibody specificity and affinity.Importantly, these variations are not only found in frame area, but also It is also found in CDR.Therefore, MLG humanization can be applied to frame area and the humanization of CDR.Since rabbit spleen lymph is thin Born of the same parents are large number of, and can produce by MLG humanization enough have a bioactivity RabMAb and filter out source of people of good performance The RabMAb of change.

The screening application of high-quality monoclonal antibody medicine: at the beginning of 21 century, biological medicine is quickly grown, and monoclonal antibody medicine has occupied biological medicament Very big specific gravity.We are also desirable that through screening high-quality monoclonal antibody and drug target, to find the potential medicine for curing tumour and cancer Object.In this respect, rabbit equally has advantage than mouse, because the spleen of rabbit, which contains, has more 50 times of leaching than mouse spleen Bar cell.Hundreds of antibody libraries can be generated from each immune spleen, the separate single of greater number of identification different epitopes is provided Clonal antibody.Therefore, can be readily available one group of biologically active RabMAb for further selection antibody drug. The robustness that RabMAb is generated provides higher success rate, is most managed within the relatively short time so RabMAb has The drug potentiality thought.

PD-1/PD-L1 signal path plays important work in adjusting immune tolerance, microorganism infection and tumor immune escape With.Mainly expression is immune thin in T cell etc. by PD-1 (programmed cell death 1, programmed cell death factors 1) Born of the same parents, and the ligand PD-L1 of PD-1 is mainly in many mankind tumor tissues in high expression.Using immunohistochemical method, first Afterwards breast cancer, lung cancer, gastric cancer, intestinal cancer, the cancer of the esophagus, oophoroma, cervical carcinoma, kidney, bladder cancer, cancer of pancreas, glioma, The expression of PD-L1 albumen, and the clinic of the expression of PD-L1 and patient are detected in a variety of mankind tumor tissues such as melanoma And prognosis is closely related.

It blocks PD-1/PD-L1 signal path that can make repressed t cell activation, and then attacks cancer cell.Block PD-1/ PD-L1 signal can promote the proliferation of specific for tumour antigen T cell, play the effect of killing tumor cell, and then inhibition office Portion's tumour growth；PD-L1 monoclonal antibody can raise the secretion of infiltration CD8+T cell IFN-γ, show PD-1/PD-L1 signal path It blocks and plays a role in tumor immune response for the purpose of to induce immune response.In addition, PD-L1 in vivo can also be with B7-1 is combined.Existing research shows that PD-L1/B7-1 compound is also the negative signal of T cell activation, and the combination of the two can cause The expression of T cell surface activation markers declines, and inhibits T cell proliferation etc..

Currently, industry generally believes that the antibody for PD-L1 access will bring the breakthrough for the treatment of kinds of tumors treatment Progress: for treating lung cancer in non-cellule type, clear-cell carcinoma, oophoroma, melanoma (Homet M.B., Parisi G., etal.,Anti-PD1Therapy in Melanoma.Semin Oncol.2015Jun；42 (3): 466-473), leukaemia with And anemia (Held SA, Heine A, et al., Advances in immunotherapy of chronic myeloid leukemia CML.Curr Cancer Drμg Targets.2013 Sep；13(7):768-74).Therefore, new tool is developed There is the anti-PD-L1 antibody of better joint efficiency, can effectively block the combination of PD-1 and PD-L1, T cell is made to restore to live Power, to enhance immune response.Currently, the antibody of more plants of anti-PD-1 and PD-L1 has listed, for the treatment of kinds of tumors, such as Nivolumab (anti-PD-1 antibody), Keytruda (anti-PD-L1 antibody) etc..

The action target spot of the Atezolizumab (trade name Tecentriq) of Roche (Roche) company be PD-L1,2016 FDA mentioned the first four months and ratified it and be used to treat as Second line Drug a kind of to be called urothelialcarcinoma's on May 19, Most common advanced bladder carcinoma, it is considered to be one of most promising immunotherapy of new generation.

AstraZeneca (AstraZeneca) is directed to the immunotherapeutic agents Imfinzi (Durvalumab) of PD-L1 target spot, It is achieved in 3 clinical trial phases of 3 phases of non-small cell lung cancer (NSCLC) and non-small cell lung cancer (NSCLC) in the recent period Breakthrough progress.Researcher indicates that anti-PD-L1 drug has higher selectivity than anti-PD-1 drug, and is likely to reduced The inflammation of lungs and other organs.

High parent is prepared using recombined human PD-L1 extracellular region (rhPD-L1) albumen as antigen, by SMab screening in the present invention It is and active by its high-performance bio of inside and outside experimental verification with the anti-PD-L1 monoclonal antibody specific of power.

Summary of the invention

The primary purpose of the present invention is that a kind of humanization human PD-L 1 monoclonal antibody of new amino acid sequence is provided, Encode carrier, the host cell and application thereof of the nucleotide of the monoclonal antibody.By antibody gene variable region of the present invention Sequence, full length antibody molecule can be constructed, as drug for clinically play inhibit tumor cell proliferation effect.

To achieve the above object, the technical solution adopted by the present invention is that:

Antigen PD-L1 expression vector pcDNA-hPD-L1-His is constructed first, and recombinant plasmid is transiently transfected 293 cell of FreeStyleTM, culture were purified cell conditioned medium by nickel column after five days, the albumen purified i.e. antigen Human PD-L 1-His.

Preparation and reorganization human PD-L 1 antigen protein is chosen rabbit 2 (number 6109 and 6110), and subcutaneous injection is immune.First 400 μ g antigens of secondary injection and immunologic adjuvant, after inject 200 μ g antigens and immunologic adjuvant respectively three times, the 5th time respectively with 200 μ g (number 6109) and 400 μ g (number 6110) antigens and immunologic adjuvant are immunized 5 times altogether, and about 3 months period is immunized.It is immune to terminate After take rabbit anteserum, utilize Enzyme-linked Immunosorbent Assay (ELISA) method detection Post-immunisation serum block PD1/PD-L1 activity.It chooses No. 6110 rabbits, are screened using SMab.Finally in 1613 clones, there are 270 expression quantity > 100ng/ml ELISA sun Property clone, then blocking detection is carried out to these clones, obtains 13 clones with potential PDL1 inhibitory activity.Choose 3 tools There are PD-L1/PD1 blocking activity and 1 to have and combine active candidate clone, extracted total RNA utilizes antibody subtype (Isotype) specific primer or universal primer carry out reverse transcription PCR, expand antibody's light chain variable region VL respectively and heavy chain can Become area VH gene, be subsequently connected to cloning vector and carry out DNA sequencing analysis, 4 clones all obtain complete VL and VH DNA and Amino acid sequence.

It is humanization modified for downstream to choose the more excellent and clone with PD-L1 inhibitory activity of 1 characteristic.Use " CDR shifting Plant " technology carries out the anti-PD-L1 rabbit monoclonal antibody of more excellent clone humanization modified.Respectively by light chain variable region VL and heavy chain variable region The rabbit source Framework Region amino acid sequence replacing of VH gene is source of people Framework Region amino acid sequence, remains each 3 CDR region amino acid Sequence, and back mutation is designed for some possible amino acid for influencing antibody physicochemical property.5 source of people are designed for VL gene Change amino acid sequence, design 3 humanization amino acid sequences for VH gene, raw 15 mutant of VL and VH combination common property are used It is constructed in subsequent recombination antibody expressing plasmid.

It is overall length IgG molecule by obtained antibody construction, completes affinity, cell activity and animal activity in vivo etc. A series of measurements, then these antibody variable regions especially CDR sequence is retrieved, determine have inhibition tumor cell proliferation effect The heavy chain variable region CDR sequence and light chain variable region CDR sequence of the monoclonal antibody of anti-PD-L1.

The beneficial effect that above-mentioned technical proposal generates is: said monoclonal antibody provided by the invention is used as anti-PD- The antibody of L1.The antibody can be used for enhancing the function of T cell to raise cell-mediated immune response and for treating T cell function Energy dysfunctional illness, such as tumour immunity, and the purposes for treating cancer.The PD-L1 humanization rabbit monoclonal antibody monoclonal Antibody has the characteristics that low immunogenicity, and can specifically bind the PD-L1 of kinds of tumor cells surface expression, and it is thin to restore T The function of born of the same parents promotes the proliferation of T cell, the secretion of activation and relevant cell factor (such as IL-2 and IFN-γ), so that enhancing is exempted from Epidemic disease response, the treatment for kinds of tumors.

Detailed description of the invention

Fig. 1 is that agarose gel electrophoresis detects PD-L1 gene.Wherein, swimming lane 1 is 1kb DNA ladder, and swimming lane 2 is to draw PD-L1 gene after object amplification, with expected 345bp size position consistency.

Fig. 2 is the purity that SDS-PAGE (polyacrylamide gel electrophoresis) detects PD-L1 albumen.Wherein, swimming lane 1 is albumen Ladder, swimming lane 2 are reproducibility PD-L1 albumen (+DTT).Swimming lane 3 is irreducibility PD-L1 albumen (- DTT), the results showed that PD-L1 purity of protein after purification is higher, and exists in the form of monomer.

Fig. 3 is the blocking activity for the rabbit anteserum that ELISA measures number 6109 and 6110.ELISA the result shows that, number 6110 Rabbit anteserum have preferably PD-1/PD-L1 blocking activity, the splenocyte and SP2/0 myeloma cell for choosing No. 6110 rabbits melt It closes.

Fig. 4 is the combination activity that ELISA measures candidate rabbit monoclonal antibody.ELISA the result shows that, PD-L1 rabbit monoclonal antibody can with again Group source of people PD-L1 (rhPD-L1) specific antigen combines.

Fig. 5 is the blocking activity that ELISA measures candidate rabbit monoclonal antibody.ELISA the result shows that, PD-L1 rabbit monoclonal antibody can block The combination of recombination human source PD-L1 (rhPD-L1) and hPD1-mFc.

Fig. 6 is the combination activity that ELISA measures PD-L1 humanization rabbit monoclonal antibody.ELISA the result shows that, PD-L1 humanization rabbit Monoclonal antibody can be in conjunction with recombination human source PD-L1 (rhPD-L1) specific antigen.

Fig. 7 is the blocking activity that ELISA measures PD-L1 humanization rabbit monoclonal antibody.ELISA the result shows that, PD-L1 humanization rabbit Monoclonal antibody can block the combination of recombination human source PD-L1 (rhPD-L1) and hPD1-mFc.

Fig. 8 is the cross reaction that ELISA measures PD-L1 humanization rabbit monoclonal antibody and hPD-L2 and mPD-L1.ELISA result table Bright, PD-L1 humanization rabbit monoclonal antibody can identify hPD-L1, but not in conjunction with hPD-L2 and m-PD-L1.

Fig. 9 is the combination activity that FACS measures PD-L1 humanization rabbit monoclonal antibody.Flow cytometer detection the result shows that, PD-L1 source of people The PD-L1 albumen of cell surface can be identified by changing rabbit monoclonal antibody, and show concentration gradient dependency characteristic.

Figure 10 is the blocking activity that FACS measures PD-L1 humanization rabbit monoclonal antibody.Flow cytometer detection the result shows that, PD-L1 people Source rabbit monoclonal antibody can block PD-L1 albumen and the combination of hPD-1-mFc of cell surface, and show concentration gradient and rely on spy Property.

Figure 11 is the binding kinetics constant that SPR measures PD-L1 humanization rabbit monoclonal antibody, its KD (M) value measured is about 7.197e-10。

Figure 12 is the combination of PD-L1 MAbs blocking CHO-PD-L1-TCR/Jurkat-PD-1-NFAT cell；The result shows that PD-L1 humanization rabbit monoclonal antibody can block the combination of CHO-PD-L1-TCR/Jurkat-PD-1-NFAT cell PD-L1 and PD-1, and Medium effective concentration is respectively 0.19 μ g/ml.

Figure 13 is that MLR measures PD-L1 monoclonal antibody to the activation results of T cell, wherein 13 (a) be PD-L1 monoclonal antibody to IFN-γ Horizontal influence, 13 (b) the horizontal influence for PD-L1 monoclonal antibody to IL-2.

Figure 14 is that PD-L1 antibody acts on internal transplantable tumor；Wherein 14 (a) be PD-L1 Antibody on Mouse weight influence, 14 (b) be the influence of PD-L1 antibodies on tumor volume size.

Specific embodiment

Following will be combined with the drawings in the embodiments of the present invention, and technical solution in the embodiment of the present invention carries out clear, complete Site preparation description, it is clear that described embodiments are only a part of the embodiments of the present invention, instead of all the embodiments.

Equipment and reagent:

One, equipment:

NI-NTA resin: QiagenGE company, article No. 30210 are purchased from；

Ultra-filtration centrifuge tube: Millipore company, specification 3KD are purchased from；

Microplate reader: BIOTEK company, model ELX800 are purchased from；

Streaming instrument: Beckman company, model CytoFLEX are purchased from；

CO2 biochemical cultivation case；Purchased from Thermo company, model HERAcell 240i；

CountStar cell counter: Shanghai Rui Jue biotechnology company, model IC 1000 are purchased from；

Vortex instrument: Shanghai Hu Xi analysis instrument Co., Ltd., Factory, model WH-2 are purchased from；

Inverted microscope: Ningbo ShunYu Instruments Co., Ltd, model XD are purchased from；

Super-clean bench workbench: Purifying Equipment Co., Ltd., Suzhou, model SW-CJ-2F are purchased from；

Centrifuge: Hunan Xiang Yi Laboratory Instruments development corporation, Ltd., model L535-1 are purchased from；

Two, reagent:

Prime STAR HS DNA Polymerase: Takara, article No. R010A are purchased from；

FD BamH I: Thermo company, article No. FD0054 are purchased from；

FD Xho I: Thermo company, article No. FD0694 are purchased from；

T4DNA Ligase: Thermo company, article No. EL0011 are purchased from；

ExpiFectamine: Invitrogen company, article No. A14524 are purchased from；

PCDNA3.1+: it is purchased from Invitrogen company；

Source of mouse anti-His primary antibody: Wuhan Sanying Bio-Technology Co., Ltd., article No. 66005-1-Ig are purchased from；

Goat-anti people's HRP secondary antibody: Pierce company, article No. 31413 are purchased from；

Sheep anti mouse FITC secondary antibody: Jackson company, article No. 115-095-166 are purchased from；

RhPD-L2 antigen: Acro company, article No. PD2-H5220 are purchased from；

MPD-L1 antigen: Acro company, article No. PD1-M5220 are purchased from；

RhPD-L1 antigen: it grinds certainly；

RhPD1-mFc antigen: it grinds certainly；

Bio-rhPD-L1-AVI-His antigen: it grinds certainly；

OPD: Chinese name o-phenylenediamine is purchased from Sigma company, article No. P8412；

H2SO4: Chinese medicines group, specification 500ml are purchased from；

CHO-rPD-L1 cell: autonomous building；

CHO-PDLI-TCR cell: it is purchased from BPS company；

Jurkat-PD1-NFAT cell: it is purchased from BPS company；

T cell: it is isolated from Healthy People blood；

DC cell: separating CD14+ cell from Healthy People blood and stimulates differentiation and obtains；

Lowlenthal serum: purchased from doctor's moral biotech firm of doctor, article No. AR0009；

Biotin: Genecopoeia company, article No. BIRA500 are purchased from；

TPBS (100ml): 0.1mlTween20+99.9mlPBS；

FACS buffer (100ml): 99mlPBS+1mlBSA；

OptiMEM: Thermo company, article No. 22600-134 are purchased from；

DMEM culture medium: Sigma company, article No. D6429 are purchased from；

PBS buffer solution；Purchased from Hyclone company, article No. SH30256.01；

Pancreatin: Hyclone company, article No. SH30042.01 are purchased from；

Penicillin-Streptomycin: Hyclone company, article No. SV30010 are purchased from；

The expression and purification of embodiment 1:PD-L1 antigen

1.1 synthesis PD-L1 genes

Ncbi database retrieves the gene order (GenBank Accession:AY714881.1) of PD-L1, analyzes its core Nucleotide sequence carries out the transformation such as decorrelation restriction enzyme site or reduction loop-stem structure for nucleotide sequence, entrusts general biology department (Anhui) Co., Ltd's full genome of uniting synthesizes anti human PD-L 1 full-length gene, and nucleotide sequence is as shown in SEQ ID NO:7, ammonia Base acid sequence is as shown in SEQ ID NO:8.

1.2 clone's PD-L1 genes

1.2.1PCR expanding BamH I-PD-L1-XhoI

Design the upstream and downstream primer P1 and P2 of PD-L1 gene:

P1:AATGGATCCACTGGTGACGCATTTACTGTCACGGTTCC (underscore is BamH I restriction enzyme site)

P2:AATCTCGAGTTAGTGGTGGTGGTGGTGGTGACCTCCTCCATTGACTTTCACAGTAATTCGCTTGT (underscore is XhoI restriction enzyme site)

With the plasmid (P-PD-L1) containing PD-L1 gene of synthesis for template, Prime STAR HS polymerase is used (Takara company), PCR amplification obtains PD-L1 genetic fragment.Its amplification system, specific as follows:

PCR response procedures, specific as follows:

1.2.2 double digestion

BamH I/XhoI digestion carrier pCD-cAVI-HIS (being adapted from pCDNA3.1+) and target fragment BamH I-PD- L1-XhoI, digestion products are after the recycling of DNA glue for connecting conversion.Digestion system is as follows:

1.2.3 connection conversion and sequencing

3 μ l enzyme-linked products are taken, DH-5a competent cell is transformed into, clone is chosen after coating ammonia benzyl plate and send sequencing, that is, is obtained true Nuclear expression plasmid pCD-PD-L1-AVI-His, sequencing identification carrier sequence are correct.

1.3 antigen PD-L1 protein expressions and purifying

1.3.1PD-L1 expression and identification

Expi293 cell, inoculum density 2.5~3 × 10 are inoculated with into 24 well culture plates⁶Cells/ml, inoculum concentration 1ml/ Hole, Cell viability is greater than 90% when transfection.1 μ g DNA (pCD-PD-L1-AVI-His) is diluted in 50 μ l OptiMEM, gently It is muddy even, then 2.7 μ l are diluted in 50 μ l OptiMEM, it is gently muddy even, incubation at room temperature after five minutes by gained DNA dilution and The mixing of gained ExpiFectamine dilution, it is gently muddy even, it is incubated at room temperature 20 minutes, by gained DNA--ExpiFectamine Compound (about 100 μ l of total volume) is added in culture orifice plate, and the culture plate that rocks back and forth makes it be evenly distributed.Cell is put into culture Case continues to cultivate 16h, and transfection is added according to the adding proportion that transfection Enhancer1,50 μ l/ml is added in the adding proportion of 5 μ l/ml Antibiotic is added in the adding proportion of Enhancer2,1 μ l/ml, mixes gently, and continues culture 4 days or Cell viability is lower than 50% When, collect whole cell centrifugations.

It uses source of mouse anti-His as primary antibody, the pCD-PD-L1- of Expi293 cell transfecting is detected by Western blot The expression of AVI-His, as a result as shown in Fig. 1.Wherein, swimming lane 1 is 1kb DNA ladder, and swimming lane 2 is after primer amplification PD-L1 gene, with expected 345bp size position consistency.After confirming PD-L1 antigen presentation, expand rotaring redyeing system to 30ml (operation is same as above).

1.3.2PD-L1 the purifying of albumen and Purity

It is then 3kDa with molecular cut off that medium supernatant, which is collected, with Ni-NTA purifying resin PD-L1-AVI-His Ultra-filtration centrifuge tube be concentrated by ultrafiltration PD-L1-AVI-His, verify its purity through SDS-PAGE, as a result as shown in Fig. 2: where Swimming lane 1 is albumen Ladder, and swimming lane 2 is reproducibility PD-L1 albumen (+DTT).Swimming lane 3 be irreducibility PD-L1 albumen (- DTT).Attached drawing 2 shows: PD-L1 purity of protein after purification is higher, and is monomer.

Embodiment 2: the generation of humanization PD-L1 rabbit monoclonal antibody

The generation of 3.1PD-L1 rabbit monoclonal antibody

Preparation and reorganization human PD-L 1 antigen protein is chosen rabbit 2 (number 6109 and 6110), and subcutaneous injection is immune.First 400 μ g antigens of secondary injection and immunologic adjuvant, after inject 200 μ g antigens and immunologic adjuvant respectively three times, the 5th time respectively with 200 μ g (number 6109) and 400 μ g (number 6110) antigens and immunologic adjuvant are immunized 5 times altogether, and about 3 months period is immunized.

Rabbit anteserum is taken after immune, blocks PD1/ using Enzyme-linked Immunosorbent Assay (ELISA) method detection Post-immunisation serum The activity of PD-L1.No. 6110 rabbits are chosen, are screened using SMab platform.Finally in 1613 clones, there are 270 expression The ELISA positive colony of amount > 100ng/ml, then blocking detection is carried out to these clones, obtaining 13, there is potential PDL1 to inhibit Active clone.

Choosing 3 has with PD-L1/PD1 blocking activity and 1 in conjunction with active candidate clone, extracted total RNA, benefit Reverse transcription PCR is carried out with antibody subtype (Isotype) specific primer or universal primer, expands antibody's light chain variable region respectively VL and heavy chain variable region VH gene are subsequently connected to cloning vector and carry out DNA sequencing analysis, and 4 clones all obtain complete VL With the DNA and amino acid sequence of VH.

3.2PD-L1 rabbit monoclonal antibody it is humanization modified

It is humanization modified for downstream to choose the more excellent and clone's (number 103) with PD-L1 inhibitory activity of 1 characteristic. By the analysis of the framework sequence to existing humanized antibody, it is especially in the antibody of clinical research, has first been determined The amino acid of light and weight chain framework region, the CDR region amino acid for then cloning light and weight chain for No. 103 spell the framework region of access specific, i.e., Form humanization rabbit monoclonal antibody precursor light and weight chain: Hr-103-VL and Hr-103-VH.According to the amino acid sequence of light and weight chain, optimization is compiled Its nucleotide sequence (refer to http://sg.idtdna.com/CodonOpt) of code, such as avoids common digestion position as far as possible Point, the codon site for avoiding the continuous high site GC, avoiding mammalian cell Preference low, optimize potential introne and cut Sequence is cut, potential loop-stem structure of its mRNA etc. is optimized.

Hr-103-VL the and Hr-103-VH nucleotide sequence that gene chemical synthesis has optimized.Design primer is simultaneously directed to some possibility Influence amino acid (comprising CDR region and framework region) design back mutation of antibody physicochemical property.For light chain Hr-103-VL gene 5 humanization amino acid sequences (Hr-103-VL-53/531/532/532K/541) are designed, for heavy chain Hr-103-VH gene 3 humanization amino acid sequences (Hr-103-VH-233/2331/2332) are designed, light and weight chain primer sequence is shown in Tables 1 and 2, will Raw 15 mutant of VL and VH combination common property, as humanization PD-L1 rabbit monoclonal antibody candidate clone, are used for subsequent recombination antibody expression Plasmid construction.

Table 1: light chain primer sequence

Primer name	Primer sequence
		L53-F	:ATTGGATCCACTGGTGACATCCAGATG
L531-R	TGTTAGAGTACACGCTCTGGCTGGACCGGCAAGTGATGG
		L531-F	ATCACTTGCCGGTCCAGCCAGAGCGTGTACTCTAACAAT
L532-R	TGATGGCACTCCGGATTCGAGGGAGCTGGCCTTATAGATCAGGAGCTT
		L532-F	CTCCTGATCTATAAGGCCAGCTCCCTCGAATCCGGAGTGCCATCAAG
L53-R	AATGGTACCCTGACCGAAGGTGTACAG
		L532K-R	TGATGGCACTCCGGATTCGAGGGAGCTGGCCCAATAGATCAGGAGCTT
L532K-F	CTCCTGATCTATTGGGCCAGCTCCCTCGAATCCGGAGTGCCATCAAG
		L541-R	TGATGGCACTCCGGATTCGAGGGTGCTGGTCCAATAGATCAGGAGCTT
L541-F	CTCCTGATCTATTGGACCAGCACCCTCGAATCCGGAGTGCCATCAAG

Table 2: heavy chain primer sequence

Primer name	Primer sequence
		H233-F	ATTGGATCCACTGGTGACGTGCAGCTT
H2331-R	TCATAGGAGCTCAGGGAGAAGCCAGACACGGTAC
		H2331-F	ACCGTGTCTGGCTTCTCCCTGAGCTCCTATGAC
H233-R	AATGGTACCCTGTCCCCACAG
		H2332-R	AATGGTACCCTGTCCCCACAGGTTGGTGGCAGCGCCATTGGGCCTGTCT

The blocking activity of embodiment 3:ELISA measurement rabbit anteserum

RhPD1-mFc antigen diluent washs 3 times to 1 μ g/mL, 4 DEG C of plate overnights, TPBS, and 37 DEG C of baking ovens close 1h, TPBS The rabbit anteserum (being clearly that concentration does 3 times of gradient dilutions in fact with pure blood) and biotin mark of number 6109 and 6110 are added after washing 3 times The PD-L1 of note, PD-L1 antibody do 3 times of gradient dilutions, 100 hole μ l/ from 8 μ g/mL of initial concentration, successively dilute eight concentration ladders Degree, the concentration of the PD-L1 of biotin labeling are 50ng/mL.Room temperature concussion is incubated for 1h, and goat-anti people HRP bis- is added after washing 3 times in TPBS Anti-, room temperature concussion is incubated for 30min.TPBS is washed 3 times, and OPD colour developing is added, uses H₂SO₄It terminates.

Microplate reader measures OD490mm light absorption value, as a result as shown in Fig. 3.Attached drawing 3 shows: the rabbit anteserum tool of number 6110 There is preferably PD-1/PD-L1 blocking activity.

Embodiment 4:ELISA measures the combination activity of PD-L1 rabbit monoclonal antibody

RhPD-L1 antigen diluent is to 0.2 μ g/mL, 4 DEG C of plate overnights, and TPBS (PBS+0.5%Tween-20) is washed 3 times, 37 DEG C of incubators close 1h.It is washed 3 times with TPBS again after closing, PD-L1 rabbit monoclonal antibody is then added, does 3 from 1 μ g/mL of initial concentration Times 100 hole μ l/ of gradient dilution successively dilutes eight concentration gradients.Room temperature concussion is incubated for 1h, and goat-anti people is added after washing 3 times in TPBS HRP secondary antibody, room temperature concussion are incubated for 30min.TPBS is washed 3 times, OPD colour developing is added, and use H₂SO₄It terminates.

Microplate reader measures OD490mm light absorption value, as a result as shown in Fig. 4.Attached drawing 4 shows: PD-L1 rabbit monoclonal antibody can with again Group source of people PD-L1 (rhPD-L1) antigentic specificity combines.

The blocking activity of embodiment 5:ELISA measurement PD-L1 rabbit monoclonal antibody

RhPD1-mFc antigen diluent washs 3 times to 1 μ g/mL, 4 DEG C of plate overnights, TPBS, and 37 DEG C of baking ovens close 1h, TPBS It is added the PD-L1 of PD-L1 antibody and biotin labeling after washing 3 times, it is dilute that PD-L1 antibody from 8 μ g/mL of initial concentration does 3 times of gradients 100 holes μ l/ are released, eight concentration gradients are successively diluted, the concentration of the PD-L1 of biotin labeling is 50ng/mL.Room temperature concussion is incubated for Goat-anti people HRP secondary antibody is added in 1h, TPBS after washing 3 times, room temperature concussion is incubated for 30min.TPBS is washed 3 times, and OPD colour developing is added, uses H₂SO₄It terminates.

Microplate reader measures OD490mm light absorption value, as a result as shown in Fig. 5.Attached drawing 5 shows: PD-L1 rabbit monoclonal antibody can block The combination of recombination human source PD-L1 (rhPD-L1) and hPD1-mFc.

Embodiment 6:ELISA measures the combination activity of PD-L1 humanization rabbit monoclonal antibody

RhPD-L1 antigen diluent is to 0.2 μ g/mL, 4 DEG C of plate overnights, and TPBS (PBS+0.5%Tween-20) is washed 3 times, 37 DEG C of incubators close 1h.It is washed 3 times with TPBS again after closing, PD-L1 humanization rabbit monoclonal antibody is then added, from 1 μ g/ of initial concentration ML does 3 times of gradient dilutions, 100 hole μ l/, successively dilutes eight concentration gradients.Room temperature concussion is incubated for 1h, and sheep is added after washing 3 times in TPBS Anti-human HRP secondary antibody, room temperature concussion are incubated for 30min.TPBS is washed 3 times, OPD colour developing is added, and use H₂SO₄It terminates.

Microplate reader measures OD490mm light absorption value, as a result as shown in Fig. 6.Attached drawing 6 shows: PD-L1 humanization rabbit monoclonal antibody can In conjunction with recombination human source PD-L1 (rhPD-L1) antigentic specificity.

The blocking activity of embodiment 7:ELISA measurement PD-L1 humanization rabbit monoclonal antibody

RhPD1-mFc antigen diluent washs 3 times to 1 μ g/mL, 4 DEG C of plate overnights, TPBS, and 37 DEG C of baking ovens close 1h, TPBS It is added the PD-L1 of PD-L1 antibody and biotin labeling after washing 3 times, it is dilute that PD-L1 antibody from 8 μ g/mL of initial concentration does 3 times of gradients 100 holes μ l/ are released, eight concentration gradients are successively diluted, the concentration of the PD-L1 of biotin labeling is 50ng/mL.Room temperature concussion is incubated for Goat-anti people HRP secondary antibody is added in 1h, TPBS after washing 3 times, room temperature concussion is incubated for 30min.TPBS is washed 3 times, and OPD colour developing is added, uses H₂SO₄It terminates.

Microplate reader measures OD490mm light absorption value, as a result as shown in Fig. 7.Attached drawing 7 shows: PD-L1 humanization rabbit monoclonal antibody can To block the combination of recombination human source PD-L1 (rhPD-L1) and hPD1-mFc.

The cross reaction of embodiment 8:ELISA measurement PD-L1 humanization rabbit monoclonal antibody and mPD-L1 and hPD-L2

RhPD-L1, mPD-L1 and hPD-L2 antigen are diluted to 0.2 μ g/mL, 4 DEG C of plate overnights with PBS respectively, and TPBS is washed It washs 3 times, 37 DEG C of baking ovens close 1h, and TPBS is added PD-L1 humanization rabbit monoclonal antibody after washing 3 times, does 5 times from 200 μ g/mL of initial concentration 100 hole μ l/ of gradient dilution successively dilutes eight concentration gradients.Room temperature concussion is incubated for 1h, and goat-anti people HRP is added after washing 3 times in TPBS Secondary antibody, room temperature concussion are incubated for 30min.TPBS is washed 3 times, and OPD colour developing is added, uses H₂SO₄It terminates.

Microplate reader measures OD490mm light absorption value, as a result as shown in Fig. 8.Attached drawing 8 shows: PD-L1 humanization rabbit monoclonal antibody energy Identify hPD-L1, but not in conjunction with hPD-L2 and m-PD-L1.

Embodiment 9:FACS measures the combination activity of PD-L1 humanization rabbit monoclonal antibody

CHO-rPD-L1 cell is digested with pancreatin, 5 pipes, every pipe about 2-8*10 are divided into after cell count⁵A cell, After culture medium is abandoned in 1000rpmx5min centrifugation, 200 l FACS buffer, 5 μ l Normal Goat Serums, ice bath closing is added in every pipe 30min.Cell is cleaned with 1ml FACS buffe 100 μ l FACS buffer are once added afterwards and to make 10 times of ladders from 10 μ g/mL It spends diluted PD-L1 humanization rabbit monoclonal antibody (i.e. 10,1,0.1,0.01 μ g/mL), is washed 2 times after ice bath 30min, add goat-anti people FITC secondary antibody (1:200) is washed 2 times after being protected from light ice bath 30min, and 400 μ l FACS buffer are added and are resuspended, on BeckmanCytoFLEX streaming machine testing.

Flow cytometer detection result is as shown in Fig. 9.Attached drawing 9 shows that PD-L1 humanization rabbit monoclonal antibody can identify cell surface PD-L1 albumen, and show concentration gradient dependency characteristic.

The blocking activity of embodiment 10:FACS measurement PD-L1 humanization rabbit monoclonal antibody

CHO-rPD-L1 cell is digested with pancreatin, 6 pipes, every pipe about 2-8*10 are divided into after cell count⁵A cell, 200 μ lFACS buffer, 5l Normal Goat Serums, ice bath closing is added in every pipe after culture medium is abandoned in 1000rpmx5min centrifugation 30min.Cell is cleaned with 1ml FACS buffe 100 μ l FACS buffer are once added afterwards and to make 10 times of ladders from 10 μ g/mL Spend diluted PD-L1 humanization rabbit monoclonal antibody (totally four concentration gradients, i.e., 10,1,0.1,0.01 μ g/mL) and 0.5 μ g/ml It is washed after hPD1-mFc, ice bath 60min 2 times, adds sheep anti mouse FITC secondary antibody (1:200), washed 2 times, add after being protected from light ice bath 30min Enter 400 μ l FACS buffer resuspension, upper BeckmanCytoFLEX streaming machine testing.

The result of flow cytometer detection is as shown in Fig. 10.Attached drawing 10 shows that PD-L1 humanization rabbit monoclonal antibody can block cell table The PD-L1 albumen in face and the combination of hPD-1-mFc, and show concentration gradient dependency characteristic.

The binding kinetics constant of embodiment 11:SPR measurement PD-L1 humanization rabbit monoclonal antibody and PD-L1

SA chip will be put into and be put into GE T200 chip slot, make mobile phase with PBS, Prime dilutes biotin twice, with PBS The Bio-rhPD-L1-AVI-His antigen of label stays channel 1 to do blank control to 50ng/ml mark channel 2.As the RU in 2 channels When value 30~40, stop flag.Then PBS will be used to dilute PD-L1 monoclonal antibody to 10 μ g/ml, and will do 2 times of concentration gradients dilutions, totally 6 Concentration gradient.Setting program is determined and is combined 2 minutes, is dissociated 10 minutes, is regenerated 1 minute.

Measurement result is as shown in Fig. 11.Attached drawing 11 shows: KD (M) value is about 7.197 × 10^-10。

The binding test of embodiment 12:PD-L1 antibody blocking CHO/Jurkat cell

The CHO-PDLI-TCR cell of logarithmic growth phase cultivates base weight with F12+10%FBS+1%PS after pancreatin digestion Outstanding cell makes cell concentration reach 5 X 10⁵cells/ml.100 μ l cell suspensions, each concentration 3 are added in 96 orifice plates Multiple holes, cell concentration 50000cells/well, and 100 μ l PBS buffer solution, CO is added in the healthy and free from worry 96 orifice plate surrounding of black₂Training Support case culture 16-24h.The final concentration of 100 μ g/ml of antibody is diluted with 1640+10%FBS culture medium, then does 3 times of gradient dilutions, Totally 9 gradients.Prepare Jurkat-PD1-NFAT cell, so that cell concentration is reached 6.25 X with theoretical Buffer suspension 10⁵cells/ml.Whole CHO-PDLI-TCR culture supernatant in 96 orifice plates is discarded, the 40 every hole μ l of PD-L1 monoclonal antibody dilution is added And after being incubated at room temperature 20min, 40 μ lJurkat-PD1-NFAT, cell concentration 25000cells/ is added in healthy and free from worry 96 orifice plate of black The PBS of 80 μ l is added around 96 orifice plates for hole, is subsequently placed into CO2 incubator every hole after cultivating 6h 80 μ l are added and have reached room The Promega Bio-GloTM luciferase Assary System of temperature, and it is placed on room temperature oscillator concussion 10min Upper machine testing afterwards.

Test result is as shown in Fig. 12.Attached drawing 12 shows: humanized PD-L1 monoclonal antibody can block CHO-PD-L1-TCR/ The combination of Jurkat-PD-1-NFAT cell PD-L1 and PD-1, and medium effective concentration is respectively 0.19 μ g/ml.

Activation of the embodiment 13:MLR reaction assay PD-L1 humanization rabbit monoclonal antibody to T lymphocyte

It is thin using paramagnetic particle method (CD14beads, Mitenyi Biotec) separation CD14 after Ficoll centrifugal process separates PBMC Born of the same parents, stimulation culture is divided into DC cell, at the 7th day of DC cell culture, takes out healthy volunteer 20ml blood system from PBMC, then separate CD4+T cell is resuspended in 1640 complete mediums (containing 50uM bta mercaptoethanol), adjustment cell density to 2x106/ml. DC cell is collected, 1640 complete mediums, cell count, adjustment DC cell density to 2x105/ml are resuspended in.Merge T cell and DC cell, passes the flat tissue culture plate in 96 holes, and every hole is added 100 μ l and (is equivalent to 1x10⁵CD4+T cell and 1x10⁴DC cell.Match (the PD-L1 antibody of 40,4,0.4 μ g/ml is added in experimental group, and negative control group is added for the test of various concentration processed or control antibodies 30nM PMA+3uM Ionomycin is added in the Trastuzumab monoclonal antibody of 40 μ g/ml, negative control group), 100 μ l of volume, each antibody It is parallel that concentration does 3.100 μ l cell conditioned mediums are collected in culture 3 days, are centrifuged 500g x10 minutes, supernatant is taken to use or save immediately In -80C refrigerator, Human IFN-γ Flex Set and Human IL-2Flex Set (BD company) kit detect INF- γ and IL-2 expression.

Activation results are as shown in Fig. 13.Wherein 13 (a) the horizontal influence for PD-L1 monoclonal antibody to IFN-γ, 13 (b) are Horizontal influence of the PD-L1 monoclonal antibody to IL-2.Trastuzumab is added in T cell and dendritic cells co-culture system not will lead to IFN-γ and IL-2 obviously discharge, but PMA and Ionomycin is added in the T cell of culture can be obviously promoted IFN-γ With the release of IL-2.In 0.4-40 μ g/mL concentration range, table of the PD-L1 humanization rabbit antibody mab to IFN-γ and IL-2 Up to apparent facilitation, and function and effect have significant ground concentration dependent.

Therapeutic effect of the embodiment 14:PD-L1 antibody to NSG mouse xenograft model

Flow cytometer surveys HCC827 cell surface PD-L1 high expression.Peripheral blood mononuclear cells obtains: under aseptic condition Healthy People blood 100ml is collected after heparin sodium anticoagulant tube is mixed by inversion, it is slowly inside again that Ficoll lymphocyte separation medium is added Blood, which is added, mixes volume 1:1, and vertical static 1min gently takes centrifuge tube to be placed in the centrifugation of Backman temperature-controlled centrifuge, centrifugation Pipe is from top to bottom divided into 4 layers: the milky white cytochrome of the gentle aspiration second layer washs secondary, abandoning supernatant, centrifugation with PBS, then washs, weight Cell count after 3 times multiple.Cell inoculation: by 5 X 10 of 0.1ml⁶A HCC827 cell subcutaneous inoculation is behind the right side of every mouse Back, 5 X 10 of 0.1ml after cell inoculation 7 days⁶-1ⅹ10⁷A peripheral blood mononuclear cells tail vein is inoculated in Mice Body, together When start that PD-L1 antibody 10 μ l/g, concentration 1mg/ml is administered, be biweekly administered and the tumor that weighs.

PD-L1 antibody acts on internal transplantable tumor as shown in Fig. 14.Wherein 14 (a) be PD-L1 antibodies on tumor volume The influence of size, 14 (b) be the influence of PD-L1 Antibody on Mouse weight.

Sequence table

<110>Anhui peace section bioengineering (group) limited liability company

<120>a kind of humanization PD-L1 monoclonal antibody, preparation method and application

<130> 2019

<160> 8

<170> SIPOSequenceListing 1.0

<210> 1

<211> 13

<212> PRT

<213>artificial sequence ()

<400> 1

Gln Gln Ser Gln Asn Val Tyr Ser Xaa Asn Arg Leu Ser Xaa Asn Asp

1 5 10 15

<210> 2

<211> 7

<212> PRT

<213>artificial sequence ()

<400> 2

Trp Thr Ser Xaa Leu Ala Ser Xaa Thr Phe

1 5 10

<210> 3

<211> 10

<212> PRT

<213>artificial sequence ()

<400> 3

Ala Gly Gly Tyr Ser Gly Asn Xaa Tyr Xaa Xaa Val Leu Xaa Thr Asn

1 5 10 15

<210> 4

<211> 7

<212> PRT

<213>artificial sequence ()

<400> 4

Gly Xaa Xaa Leu Xaa Xaa Tyr Xaa Ile Phe Xaa Asp Ser Xaa Ser Asn

1 5 10 15

Xaa Ser Asp

<210> 5

<211> 5

<212> PRT

<213>artificial sequence ()

<400> 5

Ser Tyr Xaa Xaa Xaa Xaa Val Tyr Xaa Ser Asp Xaa Arg Thr

1 5 10

<210> 6

<211> 10

<212> PRT

<213>artificial sequence ()

<400> 6

Asp Arg Pro Asp Gly Xaa Xaa Thr Asn Leu Xaa Ala Thr Xaa Ala Thr

1 5 10 15

<210> 7

<211> 636

<212> DNA

<213>artificial sequence ()

<400> 7

gcatttactg tcacggttcc caaggaccta tatgtggtag agtatggtag caatatgaca 60

attgaatgca aattcccagt agaaaaacaa ttagacctgg ctgcactaat tgtctattgg 120

gaaatggagg ataagaacat tattcaattt gtgcatggag aggaagacct gaaggttcag 180

catagtagct acagacagag ggcccggctg ttgaaggacc agctctccct gggaaatgct 240

gcacttcaga tcacagatgt gaaattgcag gatgcagggg tgtaccgctg catgatcagc 300

tatggtggtg ccgactacaa gcgaattact gtgaaagtca atgccccata caacaaaatc 360

aaccaaagaa ttttggttgt cgatccagtc acctctgaac atgaactgac atgtcaggct 420

gagggctacc ccaaggccga agtcatctgg acaagcagtg accatcaagt cctgagtggt 480

aagaccacca ccaccaattc caagagagag gagaagctgt tcaatgtgac cagcacactg 540

agaatcaaca caacaactaa tgagattttc tactgcactt ttaggagatt agatcctgag 600

gaaaaccata cagctgaatt ggtcatccca gaacta 636

<210> 8

<211> 226

<212> PRT

<213>artificial sequence ()

<400> 8

Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly Gly

1 5 10 15

Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile

20 25 30

Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser His Glu

35 40 45

Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val His

50 55 60

Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Ala Ser Thr Tyr Arg

65 70 75 80

Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys

85 90 95

Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu

100 105 110

Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr

115 120 125

Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln Val Ser Leu

130 135 140

Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp

145 150 155 160

Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val

165 170 175

Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp

180 185 190

Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His

195 200 205

Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro

210 215 220

Gly Lys

225

Claims (11)

1. humanization PD-L1 monoclonal antibody, the antibody be IgG1 form antibody or IgG2 form or IgG4 form it is anti- Body or antigen-binding fragment are the monoclonal antibody of humanization rabbit, it is characterised in that: include light chain LCDR1, LCDR2, LCDR3 With heavy chain HCDR1, HCDR2, HCDR3；

The LCDR1 sequence is QQSQNVYSX1NRLS (SEQ ID NO:7) or has at least 80% sequence identity with it Homologous sequence；

The LCDR2 sequence is WTSX2LAS (SEQ ID NO:8) or has the homologous sequence of at least 80% sequence identity with it Column；

The LCDR3 sequence is AGGYSGNX3YX4 (SEQ ID NO:9) or has the same of at least 80% sequence identity with it Source sequence；

The HCDR1 sequence is GX5X6LX7X8Y (SEQ ID NO:10) or has the same of at least 80% sequence identity with it Source sequence；

The HCDR2 sequence is SYX9X10X11 (SEQ ID NO:11) or has the homologous of at least 80% sequence identity with it Sequence；

The HCDR3 sequence is DRPDGX12X13TNL (SEQ ID NO:12) or has at least 80% sequence identity with it Homologous sequence；

Wherein X1 is N or D；X2 is T or F；X3 is V or L；X4 is T or N；X5 is I or F；X6 is D or S；X7 is S or N；X8 is S Or D；X9 is V or Y, and X10 is S or D；X11 is R or T；X12 is A or T；X13 is A or T.

2. a kind of preparation method of humanization PD-L1 monoclonal antibody as described in claim 1, it is characterised in that: including such as Lower step:

(1) prepare PD-L1 antigen: building is true containing PD-L1-ECD sequence (GenBank Accession:AY714881.1's) The carrier pCD-PD-L1-AVI-His of nuclear expression collects supernatant after turning Expi293 cell wink, and Ni-NTA affine resin purifies To PD-L1 albumen；

(2) generation of rabbit monoclonal antibody: preparation and reorganization human PD-L 1 antigen protein chooses rabbit 2, and subcutaneous injection is immune, and being immunized terminates After take rabbit anteserum, utilize ELISA detection Post-immunisation serum to block the activity of PD1/PD-L1, choose the high rabbit of blocking activity, utilize SMab platform is screened, and 13 clones with potential PD-L1 inhibitory activity are finally obtained, and preferentially having chosen 3 has resistance Break active candidate clone, expands its antibody's light chain variable region VL and heavy chain variable region VH gene, is connected to cloning vector progress DNA sequencing analysis, 3 clones all obtain the DNA and amino acid sequence of complete VL and VH；

(3) rabbit-anti is humanization modified: choosing the more excellent and clone with PD-L1 inhibitory activity of 1 characteristic and is used for downstream humanization Transformation uses " CDR transplanting " technology to carry out the anti-PD-L1 rabbit monoclonal antibody of more excellent clone humanization modified, respectively by light chain variable The rabbit source Framework Region amino acid sequence replacing of area VL and heavy chain variable region VH gene is source of people Framework Region amino acid sequence, is remained Each 3 CDR region amino acid sequences, and back mutation is designed for some possible amino acid for influencing antibody physicochemical property.

3. a kind of a kind of humanization PD-L1 monoclonal antibody derivative as described in claim 1, which is characterized in that derivative For segment, antibody/antibody fragment-factor fusion protein or the antibody/antibody fragment-change of the anti-PD-L1 humanization rabbit monoclonal antibody Learn conjugate；The segment of the anti-PD-L1 human antibody be Fab, Fab ', F (ab ')², Fv or scFv.

4. a kind of polynucleotides, it is characterised in that: anti-PD-1 humanization rabbit described in coding claim 1-3 any claim The heavy chain of monoclonal antibody and/or the variable region of light chain or full length amino acid.

5. a kind of carrier or vehicle group, it is characterised in that: include polynucleotides as claimed in claim 4.

6. a kind of host cell, it is characterised in that: include the carrier or vehicle group described in claim 5, it is preferable that the host Cell is protokaryon or eukaryon, more preferably selected from yeast cells, mammalian cell or suitable for preparing antibody or it is anti- Other cells of former binding fragment.

7. a kind of immune conjugate, which is characterized in that the immune conjugate includes: to be connect with therapeutic agent or diagnosticum such as power Benefit requires humanization PD-L1 monoclonal antibody described in any one of 1-3.

8. a kind of pharmaceutical composition, which is characterized in that include humanization PD-L1 monoclonal antibody described in claim 1, or packet Containing the carrier or vehicle group described in claim 5, or comprising immune conjugate as claimed in claim 7, and can pharmaceutically connect The carrier and second therapeutic agent received, the second therapeutic agent be radiotherapy, chemotherapy, targeted therapies, gene therapy, immunotherapy, Medicament used in hormonotherapy, Agiogenesis inhibition, palliative treatment, surgical operation or combinations thereof.

9. a kind of kit, the kit includes the antibody or such as claim 8 as described in any one of claim 1-3 The pharmaceutical composition.

10. a kind of method for producing PD-L1 antibody, the method includes cultures such as power under conditions of expressing the polynucleotides Benefit require 6 described in host cell.

11. a kind of purposes of claim 8 described pharmaceutical composition, which is characterized in that described pharmaceutical composition is used to prepare medicine Object, the drug is for treating disease relevant to PD-L1 signal (access).