WO2020102591A1 - Cd25 antibodies - Google Patents

Cd25 antibodies Download PDF

Info

Publication number
WO2020102591A1
WO2020102591A1 PCT/US2019/061552 US2019061552W WO2020102591A1 WO 2020102591 A1 WO2020102591 A1 WO 2020102591A1 US 2019061552 W US2019061552 W US 2019061552W WO 2020102591 A1 WO2020102591 A1 WO 2020102591A1
Authority
WO
WIPO (PCT)
Prior art keywords
antibody
amino acid
presented
acid sequence
antibodies
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2019/061552
Other languages
English (en)
French (fr)
Inventor
Bing Li
Matthew P. Greving
Phung Tu GIP
Matt LUNDBERG
Mohan Srinivasan
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Rubryc Therapeutics Inc
Original Assignee
Rubryc Therapeutics Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Rubryc Therapeutics Inc filed Critical Rubryc Therapeutics Inc
Priority to CA3120096A priority Critical patent/CA3120096A1/en
Priority to JP2021526461A priority patent/JP7619941B2/ja
Priority to CN201980088154.1A priority patent/CN113677359A/zh
Priority to EP19883467.3A priority patent/EP3880227A4/en
Publication of WO2020102591A1 publication Critical patent/WO2020102591A1/en
Priority to US17/320,125 priority patent/US12215163B2/en
Anticipated expiration legal-status Critical
Priority to JP2024158123A priority patent/JP2024175003A/ja
Priority to US18/968,640 priority patent/US20250122301A1/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2896Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against molecules with a "CD"-designation, not provided for elsewhere
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2866Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against receptors for cytokines, lymphokines, interferons
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • A61P35/04Antineoplastic agents specific for metastasis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • A61P37/06Immunosuppressants, e.g. drugs for graft rejection
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/20Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/24Immunoglobulins specific features characterized by taxonomic origin containing regions, domains or residues from different species, e.g. chimeric, humanized or veneered
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/30Immunoglobulins specific features characterized by aspects of specificity or valency
    • C07K2317/33Crossreactivity, e.g. for species or epitope, or lack of said crossreactivity
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/50Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/52Constant or Fc region; Isotype
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/50Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/55Fab or Fab'
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/50Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/50Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • C07K2317/565Complementarity determining region [CDR]
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/70Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/73Inducing cell death, e.g. apoptosis, necrosis or inhibition of cell proliferation
    • C07K2317/732Antibody-dependent cellular cytotoxicity [ADCC]
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/70Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/76Antagonist effect on antigen, e.g. neutralization or inhibition of binding
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/90Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
    • C07K2317/92Affinity (KD), association rate (Ka), dissociation rate (Kd) or EC50 value
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/90Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
    • C07K2317/94Stability, e.g. half-life, pH, temperature or enzyme-resistance

Definitions

  • CD25 ANTIBODIES CROSS-REFERENCE TO RELATED APPLICATIONS [0001] This application claims the priority benefit of U.S. Provisional Application Serial No. 62/767,405, filed on November 14, 2018, the contents of this application are hereby incorporated by reference herein in their entirety.
  • BACKGROUND [0002] The CD25 protein is the alpha chain of interleukin-2 (IL-2) receptor and is a
  • transmembrane protein present on regulatory T cells and activated T cells.
  • regulatory T cells constitutively express CD25 and act to suppress the expansion of effector cells.
  • Regulatory T cells maintain the healthy state and inhibit effector T cells from reacting against self antigens or over-reacting to foreign antigens.
  • effector T cells multiply after contact with foreign antigen and overcome inhibition by regulatory T cells.
  • cancer cells disable the healthy immune response by increasing the amount of regulatory T cells and thereby limiting the generation of effector T cells against them.
  • CD25 antibodies that specifically bind to CD25 (anti-CD25 antibodies, interchangeably referred to herein as CD25 antibodies).
  • the antibodies may be human, chimeric or humanized.
  • the CD25 antibodies may be used therapeutically to treat cancer, comprising administering to a subject in need thereof an antibody or a pharmaceutical composition thereof.
  • methods of producing the CD25 antibodies described herein are also provided.
  • a monoclonal CD25 antibody which binds to human CD25, and possesses at least one, at least two, at least three, at least four, at least five, or at lease six of the following characteristics: a. the antibody does not disrupt the binding of the IL-2 ligand to the alpha chain of the IL-2 receptor (CD25), and binds to a different epitope than to which 7G7B6 binds; b. the antibody does not disrupt the binding of the IL-2 ligand to the alpha chain of the IL-2 receptor (CD25), but does disrupt the trimerization of the beta, gamma, and alpha (CD25) chains of the IL-2 receptor; c.
  • the antibody disrupts the binding of the IL-2 ligand to the alpha, beta, and/or gamma chains of the IL-2 receptor, and binds to a different epitope than to which daclizumab or baciliximab bind; d. the antibody exhibits a higher affinity of binding to CD25 at pH lower than 7.4, when compared to the affinity of binding to CD25 at a pH of 7.4; e.
  • the antibody comprises the amino acid sequence of any one of the variable heavy chains presented in Tables 1A, 1C, 1E, 1G, 1I, 1K, 2A, 2B, 2C, 4A, and 5A or FIGS.3A, 3B and 5, humanized versions thereof, or an amino acid sequence comprising at least a 80%, at least a 85%, at least a 90%, or at least a 95% sequence identity thereto; f.
  • the antibody comprises the amino acid sequence of any one of the variable light chains presented in Tables 1B, 1D, 1F, 1H, 1J, 1L, 3A, 3B, 3C, 4B, and 5B or FIGS.4A, 4B and 6, humanized versions thereof, or an amino acid sequence comprising at least a 80%, at least a 85%, at least a 90%, or at least a 95% sequence identity thereto; g.
  • the VH of the antibody comprises any one of the amino acid sequence of CDRH1, CDRH2, and CDRH3 as presented in Tables 1A, 1C, 1E, 1G, 1I, 1K, 2A, 2B, 2C, 4A, 5A, and 6 or contained in the sequences presented in FIGS.3A, 3B and 5; h.
  • the VL of the CD25 antibody comprises any one of the amino acid sequence of CDRL1, CDRL2, and CDRL3 as presented in Tables 1B, 1D, 1F, 1H, 1J, 1L, 3A, 3B, 3C, 4B, 5B and 7, or contained in the sequences presented in FIGS.4A, 4B and 6; and i.
  • the antibody comprises the amino acid sequence of CDRH1, CDRH2, and CDRH3 of any one of the combinations presented in Table 6 and the amino acid sequence of CDRL1, CDRL2, and CDRL3 of any one of the combinations presented in Table 7.
  • the VH of the antibody comprises the amino acid sequence of CDRH1, CDRH2, and CDRH3 combinations as presented in Tables 1A, 1C, 1E, 1G, 1I, 1K, 2A, 2B, 2C, 4A, 5A, or 6 or contained in the sequences presented in FIGS.3A, 3B or 5.
  • the VL of the CD25 antibody comprises the amino acid sequence of CDRL1, CDRL2, and CDRL3 combinations as presented in Tables 1B, 1D, 1F, 1H, 1J, 1L, 3A, 3B, 3C, 4B, 5B, or 7 or contained in the sequences presented in FIGS.4A, 4B or 6.
  • the CD25 antibody comprises the amino acid sequence of CDRH1, CDRH2, and CDRH3 of any one of the combinations presented in Table 6.
  • the CD25 antibody comprises the amino acid sequence of CDRL1, CDRL2, and CDRL3 of any one of the combinations presented in Table 7.
  • the antibody is a human antibody.
  • the antibody is a humanized antibody. In some embodiments the antibody is a chimeric antibody. In some embodiments the antibody is an antibody fragment. In some embodiments the antibody also binds cynomologous monkey CD25. [0010] In another aspect, provided herein is a method of treating a subject in need thereof comprising administering to the subject a therapeutically effective amount of any one of the antibodies or pharmaceutical compositions described herein. In some embodiments, provided herein is a method of depleting the number of regulatory T cells in a subject comprising
  • the subject suffers from cancer; in other embodiments, the subject suffers from an autoimmune-related disease or disorder.
  • a method of depleting the number of regulatory T cells in a sample comprising peripheral blood mononuclear cells comprising contacting the sample with any one of the antibodies described herein.
  • pharmaceutical compositions or kits comprising any one or more of the antibodies described herein, nucleic acid sequences encoding any of the antibodies described herein, vectors comprising the nucleic acid and phage expressing any of the antibodies described herein.
  • FIG.1 is an exemplary description of the desired characteristics of one of the class of CD25 antibodies described herein: CD25 antibodies that block the alpha chain of the IL-2 receptor (CD25) only, do not block binding of IL-2, do not disrupt signal transduction mediated by IL-2, and leads to depletion of Tregs.
  • FIG.2 is an exemplary workflow for CD25 antibody discovery, in vitro testing, and in vivo testing.
  • FIG.3A and FIG.3B depict variable heavy chain (VH) amino acid sequences of exemplary CD25 antibodies of the disclosure.
  • FIG.4A and FIG.4B depict variable light chain (VL) amino acid sequences of exemplary CD25 antibodies of the disclosure.
  • FIG.5 depicts VH amino acid sequences of exemplary CD25 antibodies of the disclosure.
  • FIG.6 depicts VL amino acid sequences of exemplary CD25 antibodies of the disclosure.
  • FIG.7 depicts the identification of non IL-2 blockers, using a cross block assay, using a biosensor.
  • FIG.8 depicts phage express Fabs of the disclosure that compete with IL-2 non-blocking antibody, 7G7B6, using a biosensor.
  • FIG.9 shows that pSTAT5 levels are IL-2 dose dependent and inhibited with an IL-2 blocking antibody, Daclizumab.
  • FIG.10 depicts the effect of the D5 Fab of the disclosure on pSTAT5 levels. The data indicate that the D5 Fab is a partial IL-2 blocker.
  • FIG.11 depicts the effect of the D5 Fab at different concentrations on pSTAT5 levels, relative to maximum IL-2 pSTAT5 levels.
  • FIG.12 depicts differences in pSTAT5 levels between several Fab clones at 1, 2 and 5 ug/mL compared to the controls (IL-2 only, Daclizumab (Dac) and 7G7B6.
  • FIGS.13A-13C depict differences in Kd and Koff rates for several Fab clones that were reformatted to human IgG1 antibodies (FIG.13A). Several reformatted clones have better affinity and Koff rates than commercially available antibodies 7G7B6, Daclizumab and Basiliximab (FIG.
  • FIGS.14A-14D show representative data from epitope bining cross competition assays against IL-2 and commercially available antibodies 7G7B6, Daclizumab and Basiliximab, using Fab clones that were reformatted to human IgG1 antibodies. Antibodies had different cross blocking profiles.
  • FIGS.15A-15B depicts specific binding of human IgG1 reformatted Fab on CD25+ cell lines SUDHL-1 and HEK IL-2 reporter cells (FIG.15A) and no binding on CD25- cell line SUDHL-2 (FIG.15B).
  • FIGS.16A-16B show representative dose reponse curves of human IgG1 reformatted Fab clones on CD25+ cell line SUDHL-1 compared to commercially available antibodies 7G7B6, Daclizumab and Basiliximab (FIG.16A). Several clones show better EC50 values than IL-2 non- blocker 7G7B6 (FIG.16B).
  • FIG 17. show representative data of human IgG1 reformatted Fab clones that bind to recombinant cynomolgus monkey CD25 protein (25nM). Majority of clones bind in a dose dependent manner (starting at 25 nM with 3 fold dilutions).
  • FIGS.18A-18B show differences in pSTAT5 levels across several human IgG1 reformatted Fab clones at 5 ug/ml, compared to IL-2 levels at 0.1 ng/mL (FIG.18A).
  • FIG.18B shows pSTAT5 levels with IL-2 dose response curve (starting at 10 ng/mL with 10 fold dilutions) with 5ug/mL of each antibody. Some clones were shown to be better IL-2 blocker and IL-2 nonblockers than commercially available antibodies, 7G7B6, Daclizumab and Basiliximab at 0.1ng/mL.
  • FIGS.19A-19B show differences in pSTAT5 levels across several human IgG1 reformatted Fab clones at 5 ug/ml, compared to IL-2 levels at 0.1 ng/mL (FIG.18A).
  • FIG.18B shows pSTAT5 levels with IL-2 dose response curve (starting at 10 ng
  • FIG.19A show representative data of human IgG1 reformatted Fab clones at 20 ug/mL, that elicited cell killing in an ADCC assay using PBMCs as effector cells and SUHL-1 cells as targets (FIG.19A).
  • Several clones showed higher ADCC than 7G7B6 starting at 10ug/mL with 5 fold dilutions of antibody (FIG.19B).
  • DETAILED DESCRIPTION [0034] Provided herein are antibodies that specifically bind to CD25.
  • the antibodies may be human, chimeric or humanized. Also provided herein are methods of use and methods of making the antibodies described.
  • the CD25 antibodies may be used therapeutically to treat cancer, comprising administering to a subject in need thereof an antibody or a pharmaceutical composition thereof. Also provided are methods of producing the CD25 antibodies described herein. Definitions [0035] Unless defined otherwise herein, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, exemplary methods and materials are described. [0036] The headings provided herein are not limitations of the various aspects or embodiments of the invention. Accordingly, the terms defined immediately below are more fully defined by reference to the specification as a whole. [0037] Numeric ranges are inclusive of the numbers defining the range.
  • antibody includes but is not limited to a monoclonal antibody, polyclonal antibody, human antibody, humanized antibody, non-human antibody, chimeric antibody, monovalent antibody and antigen-binding fragments of the antibody (e.g Fab fragment, a Fab ⁇ 2 fragment, or a scFV). Also provided herein are antibody-drug conjugates, bispecific antibodies, and multispecific antibodies that exhibit specificity for CD25.
  • a non-human antibody e.g. a mouse antibody
  • polynucleotide and“nucleic acid” are used interchangeably herein, and refer to a polymeric form of nucleotides of any length, which may be ribonucleotides or deoxyribonucleotides.
  • the terms include, but are not limited to, single-, double-, or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or a polymer comprising purine and pyrimidine bases or other natural, chemically or biochemically modified, non-natural, or derivatized nucleotide bases.
  • nucleic acids containing known analogues of natural nucleotides and having similar binding properties and are metabolized in a manner similar to naturally-occurring nucleotides, unless specifically limited or stated otherwise.
  • nucleic acid or amino acid sequence is said to have a certain percent“sequence identity” or“identity” or is a certain percent“identical” to another nucleic acid or amino acid sequence, that percentage of bases or amino acids are the same, and in the same relative position, when the sequences are aligned, when comparing the two sequences.
  • the terms“individual,”“subject,” and“patient” are used interchangeably herein and refer to any subject for whom treatment or therapy is desired.
  • the subject may be a mammalian subject.
  • Mammalian subjects include, e. g., humans, non-human primates, rodents, (e.g., rats, mice), lagomorphs (e.g., rabbits), ungulates (e.g., cows, sheep, pigs, horses, goats, and the like), etc.
  • the subject is a human.
  • the subject is a non-human primate.
  • the subject is a companion animal (e.g. cats, dogs).
  • Antibodies Provided herein are antibodies that specifically bind to CD25.
  • the CD25 antibody is a humanized antibody that specifically binds to CD25.
  • the CD25 antibody is a chimeric antibody that for example a mouse-human chimeric antibody, e.g. an antibody that comprises mouse variable domains, and a human constant region.
  • a CD25 antibody of the disclosure can be any of a human IgA, IgD, IgE, IgG, or IgM antibody.
  • the IgA antibody can be an IgA1 or an IgA2 antibody.
  • the IgG antibody can be an IgG1, IgG2, IgG2a, IgG2b, IgG3 or IgG4 antibody. A combination of any of these antibodies can also be made and used.
  • the constant region is of the IgG type, e.g. of the human IgG type.
  • the constant region is of the IgG1 type, e.g. of the human IgG1 type.
  • the CD25 antibody exhibits cross reactivity to more than one species, for example specifically binds to both human CD25 and non-human CD25, for example specifically binds to both human CD25 and cynomolgus monkey CD25.
  • the KD (affinity constant) of the antibodies provided herein range from about 10 ⁇ -5 to about 10 ⁇ -14 nM. In some embodiments the KD of the antibodies provided herein range from about 10 ⁇ -8 to about 10 ⁇ -12 nM. In exemplary embodiments, the KD of a CD25 antibody is at least about 10 ⁇ -5 nM, about 10 ⁇ -6 nM, about 10 ⁇ -7 nM nM, about 10 ⁇ -8 nM, about 10 ⁇ -9 nM, about 10 ⁇ -10 nM, about 10 ⁇ -11 nM, about 10 ⁇ -12 nM, about 10 ⁇ -13 nM, or even about 10 ⁇ -14nM.
  • the Kd (off-rate constant) of the antibodies provided herein range from about 10 ⁇ -2 to about 10 ⁇ -61/s.
  • the CD25 antibody exhibits the same affinity (KD) for the CD25 antigen at both physiological pH (about 7.4) and non-physiological pH.
  • the CD25 antibody exhibits the same off-rate (Kd) for the CD25 antigen at both physiological pH (about 7.4) and non-physiological pH.
  • the CD25 antibody exhibits different affinities (different KD) for the CD25 antigen at physiological pH (about 7.4) and non-physiological pH.
  • the CD25 antibody exhibits different off-rate constants (different Kd) for the CD25 antigen at physiological pH (about 7.4) and non-physiological pH.
  • the CD25 antibody exhibits a lower affinity (higher KD) for the CD25 antigen at physiological pH (about 7.4) than at a pH that is lower than physiological pH, for example when the pH is 7.3, 7.2, 7.1, 7.0, 6.9, 6.8, 6.7, 6.6, 6.5, 6.4, 6.3, 6.2, 6.1, or lower.
  • the antibody exhibits a higher affinity for the CD25 antigen at a pH of about 6.5, when compared to the affinity at a pH of about 7.4.
  • such antibodies are useful for retaining activity, or exhibiting enhanced activity in an acidic environment, a hypoxic environment, for example a tumor microenvironment.
  • the antibody is a non IL-2-blocking antibody (a non IL-2 blocker)– that is, the binding of the antibody to CD25 does not disrupt or prevent binding of the IL-2 ligand to CD25 (the IL-2 alpha chain), and does not affect IL-2 mediated signal transduction, e.g. signaling through the IL-2/JAK3/STAT-5 signaling pathway.
  • the antibody does not disrupt the binding of IL-2 ligand to CD25 (IL-2 alpha chain), and binds to a different epitope than where the 7G7B6 antibody binds. In some embodiments, the antibody does not disrupt the binding of the IL-2 ligand to CD25 (IL-2 alpha chain), but does disrupt the trimerization of the beta, gamma, and alpha (CD25) chains of the IL-2 receptor.
  • the antibody is an IL-2 blocking antibody (IL-2 blocker), e.g., the antibody disrupts or prevents binding of the IL-2 ligand to the alpha, beta, and/or gamma chains of the receptor, and decreases or inhibits IL-2 mediated signal transduction.
  • the antibody disrupts or prevents binding of the IL-2 ligand to CD25.
  • the antibody disrupts or prevents the binding of the IL-2 ligand to CD25, and binds to a different epitope than to which either daclizumab or baciliximab bind.
  • the CD25 antibody is a partially blocking antibody (partial IL-2 blocker), and partially, but not completely, disrupts binding of the IL-2 ligand to the alpha, beta, and/or gamma chains of the IL-2 receptor (CD25), and/or partially, but not completely decreases IL- 2 mediated signal transduction.
  • the CD25 antibody disrupts or prevents heterotrimerization of the alpha, beta, and gamma IL-2 chains.
  • the antibody does not block binding of the IL-2 ligand with CD25, but does disrupt or prevent heterotrimerization of the alpha, beta, and gamma IL-2 chains.
  • the antibody selectively binds to regulatory T cells. In other embodiments, the antibody selectively binds T effector cells. [0056] In some embodiments, binding of the CD25 antibody leads to the depletion of regulatory T cells (Tregs), while allowing for expansion of effector T cells (Teff). [0057] In some embodiments, the antibody binds to CD25 in the trans orientation. In other embodiments the antibody binds to CD25 in the cis orientation. In still further embodiments, the antibody is capable of binding to CD25 in either the cis or the trans configuration.
  • the CD25 antibody exhibits greater binding affinity to CD25, as compared to the binding of 7G7B6 (anti-human CD25 with mouse IgG2a Fc receptor; IL-2 non blocker; BioXcell) to CD25.
  • Tables 1A-1L, 2A-2C, 3A-3C, 4A-4B, 5A-5B, 6, and 7 and FIGS.3A, 3B, 4A, 4B, 5, and 6 provide exemplary sequences for the CD25 antibodies described herein. It is noted that the complementarity determining region (CDR) and framework (FR) sequences shown are based on the IMGT convention for antibody annotation.
  • KATLTADKSSS S ID V-D-J-REGION H-FR1 CDRH1 H-FR2 CDRH2 H-FR3 CDRH3 JUNC- J- T ION REGION H-FR4
  • VTV ASGYAFSSYW AELV PGQG ATLTA VFAY VSA SA ID V-D-J-REGION H-FR1 CDRH1 H-FR2 CDRH2 H-FR3 CDRH3 JUNC- J- T ION REGION H-FR4
  • VDKSSSTAYM ID V-D-J-REGION H-FR1 CDRH1 H-FR2 CDRH2 H-FR3 CDRH3 JUNC- J- T ION REGION H-FR4 QG T
  • VSS ID V-D-J-REGION H-FR1 CDRH1 H-FR2 CDRH2 H-FR3 CDRH3 JUNC- J- T ION REGION H-FR4
  • the CD25 antibody comprises a“V-D-J-region” heavy chain sequence presented in any one of Table 2A, Table 2B, and Table 2C, and a“ V-J-region” light chain sequence presented in any one of Table 3A, Table 3B, and Table 3C, humanized versions thereof, or an amino acid sequence comprising at least a 80%, at least a 85%, at least a 90%, or at least a 95% sequence identity thereto.
  • the antibody comprises the heavy chain variable region sequence from a particular antibody clone so named by its given“ID” (or a humanized version thereof) and the light chain variable region sequence from the same antibody clone (e.g.
  • the antibody clone of origin can be identified by the ID shown in Tables 2A-2C or 3A-3C.
  • the CD25 antibody comprises the heavy chain variable region of antibody clone“AHH03760” as presented in row 1 of Table 2B (or a humanized version thereof) and the light chain variable region of antibody clone“AHH03760” as presented in row 3 of Table 3B (or a humanized version thereof).
  • the CD25 antibody comprises the heavy chain variable region sequence from a particular antibody clone so named by its given“ID” (or a humanized version thereof) and the light chain variable region sequence from a different antibody clone (e.g. the light chain from clone identified by the same“ID”) (or a humanized version thereof).
  • the CD25 antibody comprises a CDRH1, a CDRH2, and a CDRH3 presented in any one of Table 2A, Table 2B, and Table 2C, and a CDRL1, a CDRL2, and a CDRL3 presented in any one of Table 3A, Table 3B, and Table 3C.
  • the CD25 antibody comprises the CDRH1, CDRH2, and CDRH3 from a particular antibody clone and the CDRL1, CDRL2, and CDRL3 from the same antibody clone.
  • the antibody clone of origin can be identified by the ID shown in Tables 2A-2C or 3A-3C.
  • the CD25 antibody comprises a heavy chain variable region presented in Table 4A, humanized versions thereof, or an amino acid sequence comprising at least a 80%, at least a 85%, at least a 90%, or at least a 95% sequence identity thereto.
  • variable region may include the contiguous HFR1, CDRH1, HFR2, CDRH2, HFR3, CDRH3, HRF4 sequences to form a complete variable region, humanized versions thereof, or an amino acid sequence comprising at least a 80%, at least a 85%, at least a 90%, or at least a 95% sequence identity thereto.
  • the CD25 antibody comprises a light chain variable region presented in Table 4B, humanized versions thereof, or an amino acid sequence comprising at least a 80%, at least a 85%, at least a 90%, or at least a 95% sequence identity thereto.
  • the variable region may include the contiguous LFR1, CDRL1, LFR2, CDRL2, LFR3, CDRL3, LRF4 sequences to form a complete variable region, humanized versions thereof, or an amino acid sequence comprising at least a 80%, at least a 85%, at least a 90%, or at least a 95% sequence identity thereto.
  • the CD25 antibody comprises a complete heavy chain variable region as presented in Table 4A and a complete light chain variable region as presented in Table 4B, including humanized versions thereof, and amino acid sequences comprising at least a 80%, at least a 85%, at least a 90%, or at least a 95% sequence identity thereto.
  • the CD25 antibody comprises the heavy chain variable region sequence from a particular antibody clone and the light chain variable region sequence from the same antibody clone, including humanized versions thereof and amino acid sequences comprising at least a 80%, at least a 85%, at least a 90%, or at least a 95% sequence identity thereto. In some embodiments, the CD25 antibody comprises the heavy chain variable region sequence from a particular antibody clone and the light chain variable region sequence from a different antibody clone, including humanized versions thereof and amino acid sequences comprising at least a 80%, at least a 85%, at least a 90%, or at least a 95% sequence identity thereto.
  • the CD25 antibody comprises a CDRH1, a CDRH2, and a CDRH3 presented in Table 4A, and a CDRL1, a CDRL2, and a CDRL3 presented in Table 4B.
  • the CD25 antibody comprises the CDRH1, CDRH2, and CDRH3 from a particular antibody clone and the CDRL1, CDRL2, and CDRL3 from the same antibody clone.
  • the CD25 antibody comprises the CDRH1, CDRH2, and CDRH3 from a particular antibody clone and the CDRL1, CDRL2, and CDRL3 from a different antibody clone.
  • the antibody clone of origin can be identified by the ID shown in Tables 4A and 4B.
  • the CD25 antibody comprises a heavy chain variable region presented in Table 5A, including humanized versions thereof and amino acid sequences comprising at least a 80%, at least a 85%, at least a 90%, or at least a 95% sequence identity thereto.
  • variable region may include the contiguous HFR1, CDRH1, HFR2, CDRH2, HFR3, CDRH3, HRF4 sequences to form a complete variable region, including humanized versions thereof and amino acid sequences comprising at least a 80%, at least a 85%, at least a 90%, or at least a 95% sequence identity thereto.
  • the CD25 antibody comprises a light chain variable region presented in Table 5B, including humanized versions thereof and amino acid sequences comprising at least a 80%, at least a 85%, at least a 90%, or at least a 95% sequence identity thereto.
  • the variable region may include the contiguous LFR1, CDRL1, LFR2, CDRL2, LFR3, CDRL3, LRF4 sequences to form a complete variable region, including humanized versions thereof and amino acid sequences comprising at least a 80%, at least a 85%, at least a 90%, or at least a 95% sequence identity thereto.
  • the CD25 antibody comprises a complete heavy chain variable region as presented in Table 5A and a complete light chain variable region as presented in Table 5B, including humanized versions thereof and amino acid sequences comprising at least a 80%, at least a 85%, at least a 90%, or at least a 95% sequence identity thereto.
  • the CD25 antibody comprises the heavy chain variable region sequence from a particular antibody clone and the light chain variable region sequence from the same antibody clone, including humanized versions thereof and amino acid sequences comprising at least a 80%, at least a 85%, at least a 90%, or at least a 95% sequence identity thereto.
  • the CD25 antibody comprises the heavy chain variable region sequence from a particular antibody clone and the light chain variable region sequence from a different antibody clone, including humanized versions thereof and amino acid sequences comprising at least a 80%, at least a 85%, at least a 90%, or at least a 95% sequence identity thereto.
  • the CD25 antibody comprises a CDRH1, a CDRH2, and a CDRH3 presented in Table 5A, and a CDRL1, a CDRL2, and a CDRL3 presented in Table 5B.
  • the CD25 antibody comprises the CDRH1, CDRH2, and CDRH3 from a particular antibody clone and the CDRL1, CDRL2, and CDRL3 from the same antibody clone.
  • the CD25 antibody comprises the CDRH1, CDRH2, and CDRH3 from a particular antibody clone and the CDRL1, CDRL2, and CDRL3 from a different antibody clone.
  • the antibody clone of origin can be identified by the ID shown in Tables 5A and 5B.
  • the CD25 antibody comprises the amino acid sequence of any one of the variable heavy chains presented in Tables 1A, 1C, 1E, 1G, 1I, 1K, 2A, 2B, 2C, 4A, and 5A or FIGS.3A, 3B and 5, or an amino acid sequence comprising at least a 80%, at least a 85%, at least a 90%, or at least a 95% sequence identity thereto.
  • the CD25 antibody comprises the amino acid sequence of any one of the variable heavy chains presented in Tables 1A, 1C, 1E, 1G, 1I, 1K, 2A, 2B, 2C, 4A, and 5A or FIGS.3A, 3B and 5 that has been further humanized.
  • the CD25 antibody comprises the amino acid sequence of any one of the variable light chains presented in Tables 1B, 1D, 1F, 1H, 1J, 1L, 3A, 3B, 3C, 4B, and 5B or FIGS.4A, 4B and 6, or an amino acid sequence comprising at least a 80%, at least a 85%, at least a 90%, or at least a 95% sequence identity thereto.
  • the CD25 antibody comprises the amino acid sequence of any one of the variable heavy chains presented in Tables 1B, 1D, 1F, 1H, 1J, 1L, 3A, 3B, 3C, 4B, and 5B or FIGS.4A, 4B and 6 that has been further humanized, using conventional techniques [0068]
  • the CD25 antibody comprises the amino acid sequence of any one of the variable heavy chains presented in Tables 1A, 1C, 1E, 1G, 1I, 1K, 2A, 2B, 2C, 4A, and 5A or FIGS.3A, 3B and 5, humanized versions thereof, or an amino acid sequence comprising at least a 80%, at least a 85%, at least a 90%, or at least a 95% sequence identity thereto; and the CD25 antibody comprises the amino acid sequence of any one of the variable light chains presented in Tables 1B, 1D, 1F, 1H, 1J, 1L, 3A, 3B, 3C, 4B, and 5B or FIGS.4A, 4B
  • VH of the CD25 antibody comprises the amino acid sequence of CDRH1, CDRH2, and CDRH3 as presented in Tables 1A, 1C, 1E, 1G, 1I, 1K, 2A, 2B, 2C, 4A, or 5A, or contained in the sequences presented in FIGS.3A, 3B or 5.
  • VH of the CD25 antibody comprises the amino acid sequence of CDRH1, CDRH2, and CDRH3 as presented in Table 6.
  • VL of the CD25 antibody comprises the amino acid sequence of CDRL1, CDRL2, and CDRL3 as presented in Tables 1B, 1D, 1F, 1H, 1J, 1L, 3A, 3B, 3C, 4B, or 5B, or contained in the sequences presented in FIGS.4A, 4B or 6.
  • VL of the CD25 antibody comprises the amino acid sequence of CDRH1, CDRH2, and CDRH3 as presented in Table 7.
  • VH of the CD25 antibody comprises the amino acid sequence of CDRH1, CDRH2, and CDRH3 as presented in Tables 1A, 1C, 1E, 1G, 1I, 1K, 2A, 2B, 2C, 4A, or 5A, or contained in the sequences presented in FIGS.3A, 3B or 5; and the VL of the CD25 antibody comprises the amino acid sequence of CDRL1, CDRL2, and CDRL3 as presented in Tables 1B, 1D, 1F, 1H, 1J, 1L, 3A, 3B, 3C, 4B, or 5B, or contained in the sequences presented in FIGS.4A, 4B or 6.
  • VH of the CD25 antibody comprises the amino acid sequence of CDRH1, CDRH2, and CDRH3 as presented in Table 6 and the VL of the CD25 antibody comprises the amino acid sequence of CDRH1, CDRH2, and CDRH3 as presented in Table 7. [0072] In some embodiments, the VH of the antibody comprises the CDR1, CDR2, and CDR3 amino acid sequences presented in Table 5A. In some embodiments, the VL of the antibody comprises the CDR1, CDR2, and CDR3 amino acid sequences presented in Table 5B.
  • the antibody comprises a VH comprising the CDR1, CDR2, and CDR3 amino acid sequences presented in Table 5A, and a VL comprising the CDR1, CDR2, and CDR3 amino acid sequences presented in Table 5B.
  • the antibody comprises the D5 CDR1, CDR2, and CDR3 amino acid sequences, the D5 VH and D5 VL amino acid sequences presented in Tables 1A and 1B, or humanized versions of the D5 VH and D5 VL amino acid sequences presented in Tables 1A and 1B.
  • the antibody comprises the D11 CDR1, CDR2, and CDR3 amino acid sequences, the D11 VH and D11 VL amino acid sequences presented in Tables 1C and 1D, or humanized versions of the D11 VH and D11 VL amino acid sequences presented in Tables 1C and 1D. [0075] In some embodiments, the antibody comprises the D16 CDR1, CDR2, and CDR3 amino acid sequences, the D16 VH and D16 VL amino acid sequences presented in Tables 1E and 1F, or humanized versions of the D16 VH and D16 VL amino acid sequences presented in Tables 1E and 1F.
  • the antibody comprises the D17 CDR1, CDR2, and CDR3 amino acid sequences, the D17 VH and D17 VL amino acid sequences presented in Tables 1G and 1H, or humanized versions of the D17 VH and D17 VL amino acid sequences presented in Tables 1G and 1H. [0077] In some embodiments, the antibody comprises the D34 CDR1, CDR2, and CDR3 amino acid sequences, the D34 VH and D34 VL amino acid sequences presented in Tables 1I and 1J, or humanized versions of the D34 VH and D34 VL amino acid sequences presented in Tables 1I and 1J.
  • the antibody comprises the D36 CDR1, CDR2, and CDR3 amino acid sequences, the D36 VH and D36 VL amino acid sequences presented in Tables 1K and 1L, or the humanized versions of the D36 VH and D36 VL amino acid sequences presented in Tables 1K and 1L.
  • the CD25 antibody comprises the CDRH1, CDRH2, and CDRH3 amino acid sequences of any one of the AH04507, AH04522, AH04526, AH04527, AH04734, AH04750, AH05214, AH05247, AH05249, AH05251, AH05256, AH05257, AH05258, AH05259, AH05268, AH05271, AH05274, AH05280, AH05285, AH05286, AH4501, AH4502, AH4503, AH4505, AH4509, AH4511, AH4518, AH4523, AH4524, AH4525, D11, D17, D34, D36, D5, BP003-T2P1C4, BP003-T2P1D10, BP003-T2P1D7, BP003-T2P1E3, or BP003
  • the CD25 antibody comprises the CDRL1, CDRL2, and CDRL3 amino acid sequences of any one of the AH04507, AH04522, AH04526, AH04527, AH04734, AH04750, AH05214, AH05247, AH05249, AH05251, AH05256, AH05257, AH05258, AH05259, AH05268, AH05271, AH05274, AH05280, AH05285, AH05286, AH4501, AH4502, AH4503, AH4505, AH4509, AH4511, AH4518, AH4523, AH4524, AH4525, D11, D17, D34, D36, D5, BP003-T2P1C4, BP003-T2P1D10, BP003-T2P1D7, BP003-T2P1E3, or BP003-T2
  • the CD25 antibody comprises the CDRH1, CDRH2, and CDRH3 amino acid sequences of any one of the AH04507, AH04522, AH04526, AH04527, AH04734, AH04750, AH05214, AH05247, AH05249, AH05251, AH05256, AH05257, AH05258, AH05259, AH05268, AH05271, AH05274, AH05280, AH05285, AH05286, AH4501, AH4502, AH4503, AH4505, AH4509, AH4511, AH4518, AH4523, AH4524, AH4525, D11, D17, D34, D36, D5, BP003-T2P1C4, BP003-T2P1D10, BP003-T2P1D7, BP003-T2P1E3, or BP003
  • the CD25 antibody comprises the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, AND CDRL3 amino acid sequences of AH04507 (presented in Tables 5A and 5B respectively); in some embodiments, the CD25 antibody is a humanized antibody. [0083] In some embodiments, the CD25 antibody comprises the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, AND CDRL3 amino acid sequences of AH04522 (presented in Tables 5A and 5B respectively); in some embodiments, the CD25 antibody is a humanized antibody.
  • the CD25 antibody comprises the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, AND CDRL3 amino acid sequences of AH04526 (presented in Tables 5A and 5B respectively); in some embodiments, the CD25 antibody is a humanized antibody. [0085] In some embodiments, the CD25 antibody comprises the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, AND CDRL3 amino acid sequences of AH04527 (presented in Tables 5A and 5B respectively); in some embodiments, the CD25 antibody is a humanized antibody.
  • the CD25 antibody comprises the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, AND CDRL3 amino acid sequences of AH04734 (presented in Tables 5A and 5B respectively); in some embodiments, the CD25 antibody is a humanized antibody. [0087] In some embodiments, the CD25 antibody comprises the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, AND CDRL3 amino acid sequences of AH04750 (presented in Tables 5A and 5B respectively); in some embodiments, the CD25 antibody is a humanized antibody.
  • the CD25 antibody comprises the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, AND CDRL3 amino acid sequences of AH05214 (presented in Tables 5A and 5B respectively); in some embodiments, the CD25 antibody is a humanized antibody. [0089] In some embodiments, the CD25 antibody comprises the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, AND CDRL3 amino acid sequences of AH05247 (presented in Tables 5A and 5B respectively); in some embodiments, the CD25 antibody is a humanized antibody.
  • the CD25 antibody comprises the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, AND CDRL3 amino acid sequences of AH05249 (presented in Tables 5A and 5B respectively); in some embodiments, the CD25 antibody is a humanized antibody. [0091] In some embodiments, the CD25 antibody comprises the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, AND CDRL3 amino acid sequences of AH05251 (presented in Tables 5A and 5B respectively); in some embodiments, the CD25 antibody is a humanized antibody.
  • the CD25 antibody comprises the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, AND CDRL3 amino acid sequences of AH05256 (presented in Tables 5A and 5B respectively); in some embodiments, the CD25 antibody is a humanized antibody. [0093] In some embodiments, the CD25 antibody comprises the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, AND CDRL3 amino acid sequences of AH05257 (presented in Tables 5A and 5B respectively); in some embodiments, the CD25 antibody is a humanized antibody.
  • the CD25 antibody comprises the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, AND CDRL3 amino acid sequences of AH05258 (presented in Tables 5A and 5B respectively); in some embodiments, the CD25 antibody is a humanized antibody. [0095] In some embodiments, the CD25 antibody comprises the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, AND CDRL3 amino acid sequences of AH05259 (presented in Tables 5A and 5B respectively); in some embodiments, the CD25 antibody is a humanized antibody.
  • the CD25 antibody comprises the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, AND CDRL3 amino acid sequences of AH05268 (presented in Tables 5A and 5B respectively); in some embodiments, the CD25 antibody is a humanized antibody. [0097] In some embodiments, the CD25 antibody comprises the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, AND CDRL3 amino acid sequences of AH05271 (presented in Tables 5A and 5B respectively); in some embodiments, the CD25 antibody is a humanized antibody.
  • the CD25 antibody comprises the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, AND CDRL3 amino acid sequences of AH05274 (presented in Tables 5A and 5B respectively); in some embodiments, the CD25 antibody is a humanized antibody. [0099] In some embodiments, the CD25 antibody comprises the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, AND CDRL3 amino acid sequences of AH05280 (presented in Tables 5A and 5B respectively); in some embodiments, the CD25 antibody is a humanized antibody.
  • the CD25 antibody comprises the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, AND CDRL3 amino acid sequences of AH05285 (presented in Tables 5A and 5B respectively); in some embodiments, the CD25 antibody is a humanized antibody. [00101] In some embodiments, the CD25 antibody comprises the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, AND CDRL3 amino acid sequences of AH05286 (presented in Tables 5A and 5B respectively); in some embodiments, the CD25 antibody is a humanized antibody.
  • the CD25 antibody comprises the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, AND CDRL3 amino acid sequences of AH4501 (presented in Tables 5A and 5B respectively); in some embodiments, the CD25 antibody is a humanized antibody. [00103] In some embodiments, the CD25 antibody comprises the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, AND CDRL3 amino acid sequences of AH4502 (presented in Tables 5A and 5B respectively); in some embodiments, the CD25 antibody is a humanized antibody.
  • the CD25 antibody comprises the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, AND CDRL3 amino acid sequences of AH4503 (presented in Tables 5A and 5B respectively); in some embodiments, the CD25 antibody is a humanized antibody.
  • the CD25 antibody comprises the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, AND CDRL3 amino acid sequences of AH4505 (presented in Tables 5A and 5B respectively); in some embodiments, the CD25 antibody is a humanized antibody.
  • the CD25 antibody comprises the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, AND CDRL3 amino acid sequences of AH4509 (presented in Tables 5A and 5B respectively); in some embodiments, the CD25 antibody is a humanized antibody. [00107] In some embodiments, the CD25 antibody comprises the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, AND CDRL3 amino acid sequences of AH4511 (presented in Tables 5A and 5B respectively); in some embodiments, the CD25 antibody is a humanized antibody.
  • the CD25 antibody comprises the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, AND CDRL3 amino acid sequences of AH4518 (presented in Tables 5A and 5B respectively); in some embodiments, the CD25 antibody is a humanized antibody. [00109] In some embodiments, the CD25 antibody comprises the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, AND CDRL3 amino acid sequences of AH4523 (presented in Tables 5A and 5B respectively); in some embodiments, the CD25 antibody is a humanized antibody.
  • the CD25 antibody comprises the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, AND CDRL3 amino acid sequences of AH4524 (presented in Tables 5A and 5B respectively); in some embodiments, the CD25 antibody is a humanized antibody.
  • the CD25 antibody comprises the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, AND CDRL3 amino acid sequences of AH4525 (presented in Tables 5A and 5B respectively); in some embodiments, the CD25 antibody is a humanized antibody.
  • the CD25 antibody comprises the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, AND CDRL3 amino acid sequences of D11 (presented in Tables 5A and 5B respectively); in some embodiments, the CD25 antibody is a humanized antibody.
  • the CD25 antibody comprises the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, AND CDRL3 amino acid sequences of D17 (presented in Tables 5A and 5B respectively); in some embodiments, the CD25 antibody is a humanized antibody.
  • the CD25 antibody comprises the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, AND CDRL3 amino acid sequences of D34 (presented in Tables 5A and 5B respectively); in some embodiments, the CD25 antibody is a humanized antibody.
  • the CD25 antibody comprises the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, AND CDRL3 amino acid sequences of D36 (presented in Tables 5A and 5B respectively); in some embodiments, the CD25 antibody is a humanized antibody.
  • the CD25 antibody comprises the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, AND CDRL3 amino acid sequences of D5 (presented in Tables 5A and 5B respectively); in some embodiments, the CD25 antibody is a humanized antibody.
  • the CD25 antibody comprises the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, AND CDRL3 amino acid sequences of BP003-T2P1C4 (presented in Tables 5A and 5B respectively); in some embodiments, the CD25 antibody is a humanized antibody.
  • the CD25 antibody comprises the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, AND CDRL3 amino acid sequences of BP003-T2P1D10 (presented in Tables 5A and 5B respectively); in some embodiments, the CD25 antibody is a humanized antibody.
  • the CD25 antibody comprises the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, AND CDRL3 amino acid sequences of BP003-T2P1D7 (presented in Tables 5A and 5B respectively); in some embodiments, the CD25 antibody is a humanized antibody.
  • the CD25 antibody comprises the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, AND CDRL3 amino acid sequences of BP003-T2P1E3 (presented in Tables 5A and 5B respectively); in some embodiments, the CD25 antibody is a humanized antibody.
  • the CD25 antibody comprises the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, AND CDRL3 amino acid sequences of BP003-T2P1D1 (presented in Tables 5A and 5B respectively); in some embodiments, the CD25 antibody is a humanized antibody.
  • the CD25 antibody is conjugated for a variety of purposes including, but not limited to, for use in therapeutics and detection/diagnostics.
  • nucleic acid sequences encoding any of the CD25 antibodies provided herein. Exemplary nucleic acid sequences encoding the D5, D11, D16, D17, D34, and D36 VH and VL regions are provided in Tables 1A-1L– one can use humanized versions thereof.
  • vectors comprising any of the nucleic acids encoding the antibodies, phage comprising such vectors, and host cells comprising such vectors.
  • FIG.2 is an exemplary non-limiting workflow for CD25 antibody discovery, in vitro testing, and in vivo testing, but one of skill in the art recognizes that there are alternative ways to approach antibody discovery and testing.
  • the CD25 antibodies described herein can be generated by injection of a CD25 complete or partial immunogen into an animal, e.g. a mouse or a rabbit. CD25 immunoge positive B-cells from the animal can be collected, and phage libraries generated therefrom. In some embodiments, the phage express Fab fragments of candidate CD25 antibodies.
  • the phage can undergo multiple rounds of screening (referred to herein as phage panning), for example against successively lower concentrations of a CD25 antigen, to select for those Fab fragments capable of binding CD25 with high affinities.
  • the phage can be screened against CD25 antigen coated beads, or some other substrate, for example.
  • the screening is carried out a physiological pH (e.g. about pH 7.4).
  • the screening is carried out at a lower pH, for example, at a pH of about 6.5 to screen for Fab fragments capable of binding the CD25 antigen at a lower pH, for example, for use in a therapeutic context, e.g. for use in a hypoxic, acidic tumor microenvironment.
  • the CD25 antibodies generated herein may be tested for efficacy using a number of in vitro, in vivo, ex vivo, and/or cell-based assays.
  • the CD25 antibodies herein can be assayed for, and further selected based on their ability to deplete regulatory T cells.
  • the CD25 antibodies herein can be assayed for, and further selected based on their ability to deplete regulatory T cells in an acidic environment, e.g at a pH lower than physiological pH, e.g. at pH 7.3, 7.2, 7.1, 7.0, 6.9, 6.8, 6.7, 6.6, 6.5, 6.4, 6.3, 6.2, 6.1, or lower.
  • the CD25 antibodies herein can be assayed for, and further selected based on a pSTAT5 in vitro assay, to assay for the signaling through the IL-2/IL-2 receptor pathway, the maintenance of which indicates that the antibody is not an IL-2 blocking antibody.
  • the CD25 antibodies herein can be assayed for using biosensor screening to characterize molecular interactions.
  • the CD25 antibodies herein can be assayed for competition for binding against other known CD25 antibodies, with known mechanisms.
  • the CD25 antibodies herein can be assayed for epitope specificity.
  • the CD25 antibodies herein can be assayed for their capacity to be a non IL-2 blocker, an IL-2 blocker, or a partial IL-2 blocker.
  • Therapeutic Uses [00133] Provided herein are CD25 antibodies for therapeutic use, e.g. for use in proliferative diseases or disorders such as cancer or for use in autoimmune diseases.
  • methods of treating a cancer comprising administering to a subject in need thereof a therapeutically effective amount of a therapeutic CD25 antibody.
  • the cancer is a primary cancer.
  • the cancer is a metastatic cancer.
  • the cancer involves a solid tumor; in other embodiments, the cancer involves a liquid tumor, e.g. a blood based cancer.
  • the CD25 antibody is a non IL-2 blocking antibody.
  • the CD25 antibody is an IL-2 blocking antibody.
  • a subject refers to any animal classified as a mammal, including humans, domestic and farm animals, and zoo, sport, or pet animals, such as dogs, horses, rabbits, cattle, pigs, hamsters, gerbils, mice, ferrets, rats, cats, and the like. Subjects may be male or female.
  • the administration of any of the therapeutic CD25 antibodies provided herein may be administered in combination with other known drugs/treatments (e.g. small molecule drugs, or biologics. The administration may be sequential or concurrent.
  • In vivo administration of the therapeutic CD25 antibodies described herein may be carried out intravenously, intratumorally, intracranially, intralesionally (e.g. intralesional injection, direct contact diffusion), intracavitary (intraperitoneal, intralpleural, intrauterine, intrarectal),
  • the route of administration is by intravenous injection.
  • a therapeutically effective amount of the therapeutic antibody will be administered.
  • the appropriate dosage of the therapeutic antibody may be determined based on the severity of the cancer, the clinical condition of the subject, the subject’s clinical history and response to the treatment, and the discretion of the attending physician [00140]
  • the dosage amounts of the CD25 antibodies provided herein may vary from about 1 ng/kg up to about 1000 mg/kg of a subject’s body weight or more per day, depending upon the route of administration.
  • Dosage regimens may be useful, depending on the pattern of pharmacokinetic decay that the physician wishes to achieve. For example, dosing an individual from one to twenty-one times a week is provided herein. In certain embodiments, dosing frequency is three times per day, twice per day, once per day, once every other day, once weekly, once every two weeks, once every four weeks, once every five weeks, once every six weeks, once every seven weeks, once every eight weeks, once every nine weeks, once every ten weeks, or once monthly, once every two months, once every three months, or longer. Progress of the therapy is may be monitored by conventional techniques and assays.
  • the dosing regimen may vary over time independently of the dose used. Diagnostic Uses [00141]
  • the CD25 antibodies provided herein may be used for diagnostic and detection purposes. Depending on the application, the CD25 antibody may be detected and quantified in vivo or in vitro.
  • the CD25 antibodies provided herein are amendable for use in a variety of immunoassays. These immunoassays include, but are not limited to enzyme-linked immunosorbent assay (ELISA), Western blot, radioimmunoassay (RIA), flow cytometry, a radioimmunoassay, an enzyme-linked immunosorbent assay (ELISA), Western blot, radioimmunoassay (RIA), flow cytometry, a radioimmunoassay, an enzyme-linked immunosorbent assay (ELISA), Western blot, radioimmunoassay (RIA), flow cytometry, a radioimmunoassay, an enzyme-linked immunosorbent assay (ELISA), Western blot
  • the CD25 antibodies provided herein may be comprise a detectable label, for example detectable by spectroscopic, photochemical, biochemical, immunochemical, fluorescent, electrical, optical or chemical methods.
  • useful labels in the present disclosure include, but are not limited to fluorescent dyes, radiolabels, enzymes, colorimetric lables, avidin or biotin.
  • the CD25 antibody is radiolabeled with an isotope, useful for imaging by nuclear medicine equipment (SPECT, PET, or scintigraphy).
  • compositions comprising therapeutic CD25 antibodies, In some embodiments the composition is sterile.
  • the pharmaceutical compositions generally comprise an effective amount of the therapeutic antibody in a pharmaceutically acceptable excipient.
  • Kits and Articles of Manufacture [00146] The disclosure also provides for kits comprising any of the CD25 antibodies described herein, e.g. for either therapeutic or diagnostic uses. In some embodiments, the kits further contain a component selected from any of secondary antibodies, reagents for immunohistochemistry analysis, pharmaceutically acceptable excipient and instruction manual and any combination thereof. In some embodiments, the kit comprises any one or more of the therapeutic compositions described herein, with one or more pharmaceutically acceptable excipients.
  • the present application also provides articles of manufacture comprising any one of the therapeutic or diagnostic compositions or kits described herein.
  • articles of manufacture include vials (e.g. sealed vials).
  • vials e.g. sealed vials.
  • the description provided herein sets forth numerous exemplary configurations, methods, parameters, and the like. It should be recognized, however, that such description is not intended as a limitation on the scope of the present disclosure, but is instead provided as a description of exemplary embodiments.
  • the following examples are included for illustrative purposes and are not intend to limit the scope of the invention.
  • ENUMERATED EMBODIMENTS [00150] Embodiment 1.
  • a monoclonal CD25 antibody which binds to human CD25, and possesses at least one of the following characteristics: [00151] a. the antibody does not disrupt the binding of the IL-2 ligand to the alpha chain of the IL- 2 receptor (CD25), and binds to a different epitope than to which 7G7B6 binds; [00152] b. the antibody does not disrupt the binding of the IL-2 ligand to the alpha chain of the IL- 2 receptor (CD25), but does disrupt the trimerization of the beta, gamma, and alpha (CD25) chains of the IL-2 receptor; [00153] c.
  • the antibody disrupts the binding of the IL-2 ligand to the alpha (CD25), beta, and/or gamma chains of the IL-2 receptor, and binds to a different epitope than to which daclizumab or baciliximab bind; [00154] d. the antibody exhibits a higher affinity of binding to CD25 at pH lower than 7.4, when compared to the affinity of binding to CD25 at a pH of 7.4; [00155] e.
  • the antibody comprises the amino acid sequence of any one of the variable heavy chains presented in Tables 1A, 1C, 1E, 1G, 1I, 1K, 2A, 2B, 2C, 4A, and 5A or FIGS.3A, 3B and 5, humanized versions thereof, or an amino acid sequence comprising at least a 80%, at least a 85%, at least a 90%, or at least a 95% sequence identity thereto; [00156] f.
  • the antibody comprises the amino acid sequence of any one of the variable light chains presented in Tables 1B, 1D, 1F, 1H, 1J, 1L, 3A, 3B, 3C, 4B, and 5B or FIGS.4A, 4B and 6, humanized versions thereof, or an amino acid sequence comprising at least a 80%, at least a 85%, at least a 90%, or at least a 95% sequence identity thereto; [00157] g.
  • the VH of the antibody comprises any one of the amino acid sequence of CDRH1, CDRH2, and CDRH3 as presented in Tables 1A, 1C, 1E, 1G, 1I, 1K, 2A, 2B, 2C, 4A, 5A, and 6 or contained in the sequences presented in FIGS.3A, 3B and 5; [00158] h. the VL of the CD25 antibody comprises any one of the amino acid sequence of CDRL1, CDRL2, and CDRL3 as presented in Tables 1B, 1D, 1F, 1H, 1J, 1L, 3A, 3B, 3C, 4B, 5B and 7, or contained in the sequences presented in FIGS.4A, 4B and 6; and [00159] i.
  • Embodiment 2 The antibody of embodiment 1, wherein the antibody possesses at least two, at least three, at least four, at least five, or at least six of the characteristics provided therein.
  • Embodiment 3 The antibody of embodiment 1, wherein the antibody does not disrupt the binding of the IL-2 ligand to the alpha chain of the IL-2 receptor (CD25), and binds to a different epitope than to which 7G7B6 binds.
  • Embodiment 5 The antibody of embodiment 1, wherein the antibody disrupts the binding of the IL-2 ligand to the IL-2 receptor, and binds to a different epitope than to which Daclizumab or Baciliximab bind.
  • Embodiment 6 The antibody of embodiment 1, wherein the antibody exhibits a higher affinity of binding to CD25 at a pH lower than 7.4, when compared to the affinity of binding to CD25 at a pH of 7.4.
  • Embodiment 7 The antibody of embodiment 6, wherein the antibody exhibits a higher affinity of binding to CD25 at a pH of about 6.5.
  • Embodiment 8 The antibody of any one of embodiments 1 to 7, wherein the antibody comprises the amino acid sequence of any one of the variable heavy chains presented in Tables 1A, 1C, 1E, 1G, 1I, 1K, 2A, 2B, 2C, 4A, and 5A or FIGS.3A, 3B and 5, humanized versions thereof, or an amino acid sequence comprising at least a 80%, at least a 85%, at least a 90%, or at least a 95% sequence identity thereto.
  • Embodiment 10 Embodiment 10.
  • VH of the antibody comprises the amino acid sequence of CDRH1, CDRH2, and CDRH3 as presented in Tables 1A, 1C, 1E, 1G, 1I, 1K, 2A, 2B, 2C, 4A, or 5A, or contained in the sequences presented in FIGS.3A, 3B or 5.
  • the antibody of any one of embodiments 1 to 7 and embodiment 10, wherein the VL of the CD25 antibody comprises the amino acid sequence of CDRL1, CDRL2, and CDRL3 as presented in Tables 1B, 1D, 1F, 1H, 1J, 1L, 3A, 3B, 3C, 4B, or 5B, or contained in the sequences presented in FIGS.4A, 4B or 6.
  • Embodiment 12 The antibody of any one of embodiments 1 to 10, wherein the CD25 antibody comprises the amino acid sequence of CDRH1, CDRH2, and CDRH3 of any one of the combinations presented in Table 6.
  • Embodiment 14 The antibody of any one of embodiments 1 to 13, wherein the antibody is a human antibody.
  • Embodiment 15 The antibody of any one of embodiments 1 to 13, wherein the antibody is a humanized antibody.
  • Embodiment 16 The antibody of any one of embodiments 1 to 13, wherein the antibody is a chimeric antibody.
  • Embodiment 17. The antibody of embodiment 16, wherein the antibody comprises a mouse variable domain, and a human constant domain.
  • Embodiment 20 A pharmaceutical composition comprising any one of the antibodies of embodiments 1 to 19.
  • Embodiment 21 A nucleic acid sequence encoding any one of the antibodies of embodiments 1 to 19.
  • Embodiment 22 A vector comprising the nucleic acid sequence of embodiment 21.
  • Embodiment 23 A phage expressing any one of the antibodies of embodiments 1 to 19.
  • Embodiment 24 The antibody of any one of embodiments 1 to 15, wherein the antibody is an antibody fragment.
  • Embodiment 19 The antibody of any one of embodiments 1 to 18, wherein the antibody also binds cynomologous monkey CD25.
  • Embodiment 20 A pharmaceutical composition comprising any one of the antibodies of embodiments 1 to 19.
  • Embodiment 21 A nucleic acid sequence encoding any one of the antibodies of embodiments 1 to 19.
  • Embodiment 22 A vector comprising the nucleic acid sequence of embodiment 21.
  • Embodiment 23 A phage expressing any one of the antibodies of embodiments 1 to 19.
  • Embodiment 25 A method of treating a subject in need thereof comprising administering to the subject a therapeutically effective amount of any one of the antibodies of embodiments 1 to 19 or the pharmaceutical composition of embodiment 20.
  • Embodiment 25 A method of depleting the number of regulatory T cells in a subject comprising administering to the subject a therapeutically effective amount of any one of the antibodies of embodiments 1 to 19 or the pharmaceutical composition of embodiment 20.
  • Embodiment 26 The method of embodiment 24 or 25, wherein the subject suffers from cancer.
  • Embodiment 27 The method of embodiment 24 or 25, wherein the subject suffers from an autoimmune-related disease or disorder.
  • Embodiment 28 Embodiment 28.
  • Embodiment 29 A kit comprising any one of the antibodies of embodiments 1 to 19 or the pharmaceutical composition of embodiment 20.
  • the immunization protocol was as follows: ⁇ Day 0: Immunization 1 ⁇ Day 14: Immunization 2 ⁇ Day 28: Immunization 3 ⁇ Day 35: Bleed [00189] Splenocytes and Leukocytes from four of the five mice were used to generate four phage libraries.
  • the phage libraries contained phage, expressing antigen binding (Fab) fragments. More specifically, a M13 phagemid library using materials from the immunized animals was constructed as follows.
  • RNA from leukocytes and splenocytes was extracted;
  • VH and VL genes were amplified with specific primers; and
  • VH and VL fragments were inserted into GenScript’s M13 phagemid vector by two ⁇ step cloning.
  • the library size > 2x10 ⁇ 8; the insert rate was >90%, and the in-frame rate was >80%.
  • the library was a high diversity library, with at >95% of unique sequences.
  • Example 2 Phage Panning for CD25 Binding [00190] 3 rounds of phage panning of the Fab-containing phage libraries were carried out, using an ELISA-based assay. The phage were screened against beads coated with CD25.
  • the VL sequence was obtained with the sequencing primer (AGCGGATAACAATTTCACACAGGA), or
  • FIGS.3A, 3B, 4A, and 4B and Tables 2A, 2B, 3A, and 3B show VH and VL sequences of the Fabs selected after the second round of panning.
  • FIGS.5 and 6, and Tables 2C and 3C show VH and VL sequences of the Fabs selected after the third round of panning.
  • Tables 4A, 4B, 5A, and 5B show additional clones after similar panning protocols.
  • Further pH-based phage panning was carried out.
  • Example 3 Phage Panning for CD25 Binding at pH 6.5
  • Further phage panning was carried out to select for Fab candidates that bind CD25 at lower pH ranges, to select for binders that could bind, for example, in a hypoxic, acidic tumor microenvironment.
  • the four mouse HuCD25 immunized phage libraries (7807, 7808, 7809, 7810) were transformed by electroporation in TG1 and phage propagated with the addition of CM13 using standard Phage Display protocols (Barbas et al., 2001).
  • TG1 cultures secreting phage were PEG precipitated with PEG/NaCl after incubation on ice for one hour.
  • the phage libraries (7807, 7808, 7809, 7810) were used for specific pH selections using standard protocols. To deplete antibodies that bind with high affinity at physiological pH, subtractive panning was first carried out by counter-selection of 3 x 10 ⁇ 11 pfu phage (1000-fold representation of a 3 x 10 ⁇ 8) at pH 7.4 by absorption for 1 hour on ELISA plates coated with 10 ug/ml full-length CD25 (400 nM) in PBST pH 7.4. Resulting phage supernatant was collected and pH was adjusted to pH 6.5 with PBST.
  • phage panning selections were carried out at pH 6.5 [00199] Panning selections were pre-cleared with 25 microliters streptavidin dynabeads with no CD25 antigen after 1 hour incubation. Phage were then added to new pre-blocked Eppendorf LoBind tube. Biotinylated full-length CD25 antigen was added at 100 nM concentration for one hour. Samples were then incubated with 25 microliters streptavidin beads RT for one hour.
  • Phage ELISA protocol and Biosensor/Octet Screening ELISA/Extract Preparation Phage ELISA protocol and Biosensor/Octet Screening ELISA/Extract Preparation
  • Phage ELISA, for assessing CD25 binding to Fab phage, and periplasmic extract preparation for Fab Octet screening were conducted essentially as described, with modifications noted (Schwimmer et al., 2013).
  • the CD25 antigen was diluted in PBS, pH 7.4. 50 microliters of antigen solution were made containing 1 ug of CD25 for each well of a 96-well plate to be coated.50 microliters of antigen solution was added to the ELISA plate wells and incubate overnight at 4°C.
  • HRP-conjugated anti-M13 antibodies were diluted (Abcam, ab50370) 1:5000 with 1xPBST 1.0% BSA pH 6.5. 50 microliters of diluted secondary antibody conjugate was added to each well, and incubated for 1 hour at room
  • ECL Lumo substrate was prepared (e.g. Supersignal ELISA Pico Chemiluminescent Substrate) as described, into a 1:1 mixture. 50 microliters substrate solution was added to each well, incubated at room temperature for 5 to 60 minutes before reading.
  • Colonies were inoculated in 0.03-4 ml 2xYT 0.2% Glucose with 0.1 ml overnight culture (1 ml cultures in 96-well plate or 4 ml cultures in 14-ml falcon tubes). They were incubated at 250- 700 rpm for 1.5-2 hours at 37 ⁇ C until the OD600 ⁇ 0.5-1.0.
  • Cultures were induced with 50--400 ul IPTG 0.025-0.1M. In some cases, the temperature was reduced to 30 ⁇ C with shaking at 250 rpm. They were then incubated overnight. Next day cultures were harvested by pelleting 3400 rcf for 10- 15 minutes. The supernatant was discarded. [00206] Cultures were resuspended with 50-75 ul PPB buffer (30 mM Tris-HCl, pH 8.0, 1 mM EDTA, 20% Sucrose) with 1x Halt Protease Inhibitor and incubated on a rocking platform for 15 minutes at room temperature or 4 ⁇ C for 10 min.
  • PPB buffer 30 mM Tris-HCl, pH 8.0, 1 mM EDTA, 20% Sucrose
  • Ni-NTA resin was added (pre-washed and pelleted) or a Ni- NTA spin column was used for Fab purification. Incubate with cleared lysate for 30 min– 1 hr. This was spun at 1500 rcf. These were washed 5 times with 1 ml PBS, 10 mM Imidazole. Buffer was discarded after each spin.1 ml PBS, 200 mM Imidazole were added and mixed, incubated for 30 minutes and spun at 1500 rcf for 15 minutes. The eluted protein was stored at 4 ⁇ C or 20 ⁇ C after determining protein concentration. Zeba columns were used for desalting/buffer exchange.
  • Octet/Biosensor Screening of Fabs For Octet Koff rate screening in raw supernatants, 50 ul of lysate was used in 384-well Pall ForteBio Octet plates. Data was collected on an Octet RED 384 (MD ForteBio). Briefly, Human CD25 was coupled to AR2G tips (1 ug/ml). For data collection, baseline was assessed in PBST 1% BSA buffer at pH 6.5 for 60 seconds. Tips were then moved to 50 ul lysate pH6.5 adjusted and association measured for 300 seconds. Finally, tips were moved to PBST 1% BSA buffer at pH 6.5.
  • the Fabs selected for reformatting are show in Tables 5A (heavy chains) and Table 5B (light chains).
  • the Koff rates and affinity of the different reformatted IgG1 antibodies were evaluated on a FortéBio® Octet RED384TM bio-layer interferometry instrument. Purified antibodies were covalently immobilized on amine reactive biosensors (Fortebio® AR2G), and excess reactive esters were blocked with ethanolamine. Sensors were then dipped into running buffer as a baseline, transferred to wells containing 300 nM full- length CD25, and then transferred back into running buffer. Association of CD25 and subsequent dissociation was recorded in duplicate.
  • FIG.7 depicts the identification of non IL-2 blockers and IL-2 blockers (Fabs), using a cross block assay at the molecular level.
  • CD25 was coated on the biosensor tip, and brought into contact with the indicated Fab. IL2 was then added. An increase in signaling shows that the Fab and IL2 have different binding sites on CD25. [00213] Table 8 shows that the Fab clones tested exhibited similar binding kinetics at physiological and acidic pH. Table 8
  • FIG.8 depicts phage express Fabs of the disclosure that compete with IL-2 non-blocking antibody, 7G7B6.
  • the biosensor tip was coated with the antibody 7G7B6, and brought into contact first with CD25, and then with the indicated Fab or Basiliximab, a known IL2 blocking antibody.
  • Clones D11, D34, and D36 do not bind when 7G7B6 is bound to CD25.
  • Clones D5, D16, and D17 bind, but rapidly come off, indicating a possible cross-blocking function.
  • FIGS.13A-13C shows kinetic analysis for Koff rates and affinity on the reformatted human IgG1 antibody clones (FIG.13A).
  • KD values of antibodies ranged from 4.4E-10 to 8.4 E-09 with Koff values from 6.4E-05 to 1.9E-03.
  • Several antibodies had higher affinity (FIG.13B) and Koff values (FIG.13C) than commercially available antibodies 7G7B6, Daclizumab and
  • Basilixumab (Kd values 2.6E-09, 4.5E-10, 4.7E-10, respectively and Koff rates of 2.3E-04, 1.1E- 04, 1.9E-04, respectively).
  • the clones BP003-T2P1D7. AH0580, AH05268, D36, D11, AH05259, BF003-T2P1D1, and D34 have better Kd values than 7G7B6 in this analysis; the clones D17, AH04526, AH04750, AH05285, AH05256, and AH04527 have better Kd values than Daclizumab and Basilixumab in this analysis (FIG.13B).
  • FIGS.14A-14D Epitope binning was carried out to evaluate the binding of the reformatted human IgG1 Fabs to epitopes overlapping commercially available anti-human CD25 antibodies 7G7B6, Daclizumab and Basilixumab, as well as with IL-2.
  • the blocking profiles of the clones are: (FIG.14A) blocked by 7G7B6, but not by IL-2, Daclizumab or Basiliximab; (FIG.14B) blocked by IL-2, Daclizumab, Basiliximab, but not by 7G7B6; (FIG.14C) blocked by 7G7B6 and Daclizumab, but not by Basilixumab; (FIG.14D) blocked by IL-2, Daclizumab and Basilixumab. These blocking profiles indicate binding of the antibodies to different epitopes from different approach angles. [00217] Additional epitope mapping of functional epitopes will be performed by Alanine
  • Mutagensis This method is used as an orthogonal method for binning antibodies as it operates on the functional epitope, rather than the structural epitope defined by competition assays. Various pairs of surface-accessible residues are selected for mutagenesis. Computational modeling is used to confirm that the alanine mutations selected for use in these assays do not impact global or local stability.
  • Example 5 Binding assays Cell binding assays for CD25 specific binding of human IgG antibodies [00218] To validate antibody binding to CD25 on cells and for specificity, three cell lines SUDHL- 1 and SUDHL-2 (human large diffuse histiocytic lymphoma cell lines, ATCC) and HEK IL-2 reporter cells (Invivogen) were used to test for CD25 binding. SUDHL-1 and HEK IL-2 reporter cell lines are CD25+, while SUDHL-2 are CD25- cells. For each cell line, 100,000 cells were plated in a 96 well round bottom plate in cell buffer (PBS+ 2% HI FBS) and centrifuged. Antibody concentrations from 1-10ug/mL were used to test the binding of each antibody.
  • SUDHL- 1 and SUDHL-2 human large diffuse histiocytic lymphoma cell lines, ATCC
  • HEK IL-2 reporter cells Invivogen
  • SUDHL-1 and HEK IL-2 reporter cell lines are CD25
  • Cells were resuspended in 100 uL of antibodies/well and incubated for 20 minutes on ice. After incubation, cells were centrifuged at 300 x g for 5 minutes at room temperature, and resuspended and washed with ice cold cell buffer. Cells were then stained with an anti-human Fc secondary antibody conjugated to AF647 (Biolegend) and incubated on ice for 20 min in the dark. Cells were centrifuged, washed and resuspended in cold cell buffer with DAPI and analyzed using flow cytometry (Cytoflex, Becton Dickinson). DAPI+ cell were excluded from analysis. The mean fluorescence intensity was calculated using the median (FlowJo, TreeStar).
  • Human IgG1 reformatted Fab clones (human IgG1 antibodies) starting 25nM and 3 fold serially were diluted in PBT buffer and added to the plate for incubation at RT for 1 hour. The plate was then washed and then 1:2500 dilution of HRP conjugate anti-Fab antibody was added. The plate was washed 5-10 times with PBS/tween20 to remove non-specific binders. TMB perxidase substrate and peroxidase solution were added and incubated for the time needed to develop with 80uL of ELISA stop solution added at the end. OD measurements were then taken at 450nM using a plate reader (SpectraMax iD3 Plate Reader, Molecular Devices).
  • FIGS.15A-15B shows validation and specific binding of all antibody clones (10 ug/mL) to both CD25+ cells lines, SUDHL-1 and HEK cells, and no binding on CD25- SUDHL-2 cell line. Additionally, the majority of antibodies bound similarily to controls, 7G7B6, Daclizumab,
  • FIGS.16A-16B show dose response curves of clones starting at 10 ug/mL with 5 fold serial dilutions binding on SUDHL-1 CD25+ cell line (FIG.16A).
  • SeveraL Clones in Table 9 have better EC50 values than 7G7B6. Table 9
  • FIG.17 show dose response curves of several clones that bound to recombinant cyno CD25. Daclizumab and Basiliximab were used as positive controls.
  • Example 6 pSTAT5 Assay using primary cells pSTAT5 assay for screening biological activity of Fab clones on highly purified human regulatory T cells [00223]
  • the IL-2/JAK3/STAT-5 signaling pathway is involved in the survival and expansion of Tregs. This pathway initiates and maintains the expression of the transcription factor Foxp3, a factor that is essential for the suppressive activity of Tregs.
  • JAK proteins When IL-2 binds to IL-2R, JAK proteins get activated; they are tyrosine kinases that are bound to the cytoplasmic regions of IL-2 receptors. This initiates trans-phosphorylation on specific tyrosine residues generating docking sites for STAT proteins to be recruited and phosphorylated. Dimerized and phosphorylated STATs are then translocated to the nucleus to bind specific DNA sequences, regulating the transcription of several target genes, such as Foxp3 and CD25 in Tregs. [00224] In this example, the functionality of selected Fabs when bound to CD25 on primary human regulatory T cells was assessed.
  • This assay allowed for determination which are IL-2 blockers, non- blockers and partial blockers, as well as potency, based on pSTAT5 levels.
  • Controls used in the assay include a known IL-2 blocker (Daclizumab) and IL-2 non-blocker (7G7B6).
  • Respective isolation kit protocols were used for magnetic based isolation of cells. Treg isolation was confirmed by staining cells with anti-human CD4, CD25, CD127 antibodies and intracellular Foxp3 staining (BD Biosciences). For the pSTAT5 assay, 100,000 Tregs were plated in a 96 well round bottom plate and centrifuged. Antibody concentrations from 1-5 ug/mL were used. Tregs were resuspended in 50 uL of antibodies/well and incubated for 15 minutes in 37 ⁇ C incubator. Next, dilutions for IL-2 were prepared starting at 100 ng/mL concentration with 10 fold dilutions in cell media.
  • IL-2 dilutions were added to the wells at 50 uL/well for 10 minutes in 37 ⁇ C incubator. After incubation, the plate was centrifuged at 300 x g for 5 minutes at room temperature, and resuspended in 100 uL/well of room temperature fixation buffer (BD Biosciences), for 15 min at room
  • This cell line was generated by Invivogen to monitor the activation of the JAK-STAT pathway with the binding of IL-2.
  • the reporter cell line was created by stably transfecting HEK293 cells with human IL-2Ra, IL-2Rb and IL-2Rg genes, and JAK3 and STAT5 genes.
  • This assay presents a high throughput method for evaluating IL-2 physiology and characterization of IL-2 blockers, non-blockers, partial blockers, with the addition of antibodies and competitors in the presence of IL-2, based on pSTAT5 levels.
  • Controls used in the assay include a known IL-2 blocker (Daclizumab and Basiliximab) and IL-2 non-blocker (7G7B6).
  • IL-2 blocker Daclizumab and Basiliximab
  • IL-2 non-blocker 7G7B6
  • 100,000 cells were plated in a 96 well round bottom plate and centrifuged. Antibody concentrations from 1-5 ug/mL) were used.
  • HEK cells were resuspended in 50 uL of antibodies/well and incubated for 15 minutes in 37 ⁇ C incubator.
  • dilutions for IL-2 were prepared starting at 10 ng/mL concentration with 10 fold dilutions in cell media.
  • IL-2 dilutions were added to the wells at 50 uL/well for 10 minutes in 37 ⁇ C incubator.
  • the plate was centrifuged at 300 x g for 5 minutes at room temperature, and resuspended in 100 uL/well of room temperature fixation buffer (BD Biosciences), for 15 min at room temperature.
  • Cells were spun down and resuspended in cold cell buffer (PBS+2% HI FBS). Cells were then resuspended in 100 uL/well of ice cold permeabilization buffer (BD Biosciences) and incubated on ice for 15 minutes. Cells were washed with cell buffer and resuspended in 50 uL of prepared pSTAT5 antibody for analysis using flow cytometry (Cytoflex, Becton Dickinson).
  • FIG.9 shows that pSTAT5 signal is IL-2 dose dependent and is inhibited with Daclizumab (IL-2 blocker).
  • pSTAT5 levels were correlated with doses of IL-2, with high IL-2 doses increasing pSTAT5 levels, while lower levels of IL-2 yielded lower levels of pSTAT5.
  • Daclizumab an anti-human IL-2 antibody IL-2 blocker was added at fixed concentration of 2 ug/mL, it inhibited JAK/STAT5 signaling pathway, yielding less pSTAT5 levels.
  • FIG.10 and FIG.11 show testing of the D5 Fab in the pSTAT5 assay.
  • the data in FIG. 10 show that the pSTAT5 assay was able to distinguish differences in D5 Fab activity at 1, 2 and 5 ug/mL compared to Daclizumab and IL-2 only.
  • D5 is partially blocking IL-2 binding to IL-2R, even at the lowest concentration of 1 ug/mL.
  • FIG.12 shows preliminary Fab screen data from one donor. This assay from one donor shows differences in pSTAT5 levels between several Fab clones at 1, 2 and 5 ug/mL compared to the controls (IL-2 only, Daclizumab (Dac, an IL-2 blocker) and 7G7B6 (non IL-2 blocker). Some clones seem to be better IL-2 non-blockers than 7G7B6 while others are better IL-2 blockers than Daclizumab.
  • FIGS.18A-18B show functional characterization of reformatted human IgG1clones (at 5ug/mL) as IL-2 blockers, non-blockers and partial blockers by measuring pSTAT5 in HEK IL-2 reporter cell lines starting at IL-2 concentration of 10 ng/ml with 10 fold serial dilutions.
  • clones such as AH04503, AH04750 are better IL-2 blockers than either Daclizumab or Basilixumab, while clones AH05280 and AH02571 may be better IL-2 non-blockers than 7G7B6 at 5ug/mL (A).
  • Clones AH05251, AH05257 are examples of IL-2 partial blockers (FIG.18A).
  • IL-2 dose response curves clearly depict clones that are IL-2 non-blockers from those that are IL-2 blockers, with curves shifting to the left with 7G7B6 and curves shifting to the right with Daclizumab and Basilixumab, respectively (FIG 18B).
  • ADCC Antibody-dependent cell cytotoxicity
  • antibodies with the human Fc subclass, IgG1 is commonly chosen for its effector functions with the ability to bind to the three Fc receptors: FcgRI (CD64), FCgRII (CD32), and FcgRIIIA (CD16), that are expressed on immune cells such as NK cells, monocytes and granulocytes.
  • NK cells predominantly express FcgRIIIA and considered to be the main effector cell in ADCC
  • ADCC was quantified using a Lactate dehydrogenase (LDH) Cytotoxicity plate-based colorimetric assay (Thermo Fisher).
  • LDH Lactate dehydrogenase
  • Thermo Fisher Cytotoxicity plate-based colorimetric assay
  • the release of LDH is proportional to the amount of cell killing.
  • Lactate dehydrogenase (LDH) is a cytosolic enzyme, present in all cells, that is released when the plasma membrane is damaged.
  • Extracellular LDH in the media is quantified by a coupled enzymatic reaction in which LDH catalyzes the conversion of lactate to pyruvate via NAD+ reduction to NADH.
  • Controls for the assay include the use of Rituximab (anti-CD20 antibody) on human Raji lymphoma cell line and Daclizumab on SUDHL-1 cells (both antibodies are known to induce ADCC). Additional controls include: non-glycosylated human IgG1, as a negative control and non-fucosylated human IgG1, as a positive control.
  • a first initial screen reformatted clones were tested in the ADCC assay at one concentration (10ug/mL) using PBMCs from a single donor. Human PBMCs (ASTARTE
  • Biologics were thawed the day before and cultured overnight with X-VIVO 15 or 20 media (Lonza) at 37C in 5% CO2 incubator.
  • X-VIVO 15 Longza, phenol red serum free medium.
  • Antibody dilutions were prepared starting with 10ug/ml with 5 fold serial dilutions.
  • Target cells were then plated in a 96 well 50 mL/well in a 96-well white flat bottom opaque plate (CORNING Ref#3917) and 10 mL/well antibody dilution was added to the target cells and incubated at 37°C and 5% CO2 incubater for 30 min. After the incubation, PBMCs were added to the target cells (50 mL/well). For control target cells for spontaneous and max LDH release calculation, 50 mL/well of assay medium (X-VIVO15, phenol red free) was added.
  • assay medium X-VIVO15, phenol red free
  • the co-incubation was done by incubating the plate for 4h at 37°C and 5% CO2 incubater 45 min before the co-incubation completed, 10% Triton X100 solution (in PBS) was added to the wells to calculate Max LDH release (10 mL/well, 11x dilution factor). After the incubation, 50 ⁇ L/well of the reaction substrate was plated in a 96-well plate (clear flat bottom) and then 50 ⁇ L/well of the supernatant of the assay plate was transferred to the reaction substrate. The plate was developed in the dark at RT for 30 min.
  • ADCP function antibody-dependent cell phagocytosis
  • PBMCs will be isolated from leukocyte reduction system chambers (Stanford Blood Center) for monocyte isolation using CD14 microbeads (Miltenyi Biotec) and for Tregs using Regulatory Human CD4+CD25+ T cell kit (Dynabeads) and Human Treg Cell Differentiation kit (R&D Systems).
  • Monocytes will be cultured for 5-7 days with human serum or M-CSF in media.
  • macrophages will be cocultured with pre-labeled Tregs (labeled with a fixable viability dye (Invitrogen)) for 2-4 hours at 10 to 1 effector to target ratio with addition of anti-CD25 antibodies and controls, and fixed with fixation buffer (BD Bioscienes).
  • FIGS.19A-19B show functional ADCC activity of all reformatted clones.
  • clones bound to CD25+ cells and ADCC was induced with cell killing ranging from 18.2% to 26.7% lysis (Raji cell killing is used as a reference; (FIG.19A)
  • the assay was repeated with a dose response curve for select clones.
  • Readouts for activation will include intracellular granzyme B, proliferation and cytokine release (e.g. IL-2, IFN ⁇ , TNF- ⁇ ).
  • cytokine release e.g. IL-2, IFN ⁇ , TNF- ⁇ .
  • human primary conventional T cells T conv cells from healthy donors and donors with specific antigen responses (e.g. human
  • cytomegalovirus or influenza flu antigens will be labeled with a cell proliferation dye (e.g.
  • ThermoFisher and treated with varying concentrations of CD25 and control antibodies (1-10 ug/mL), followed by activation using CD3/CD28 beads and incubated with and without Tregs for incubation at 37 ⁇ C, 5% CO2 for 48-72 hours.
  • fixable viability dye e.g. Thermofisher
  • surface anti human T cell markers CD3, CD4, CD8, CD45RA, CD25, followed by fixation and permeabilization for staining of intracellular Granzyme B and Foxp3.
  • Cells will be analyzed using flow cytometry for Granzyme B positive and proliferating cells.
  • CD25 antibodies In vivo activity of CD25 antibodies using a mouse xenograft tumor model. These experiments will help to distinguish differences in CD25 antibodies based on CD25+ tumor depletion via ADCC and/or ADCP.
  • Candidate antibodies will be produced as mouse IgG2a isotype antibodies and used in immunodeficient RAG-/- knockout mice (with functional NK and APC cells, but no mature B or T lymphocytes). Animals will be subcutaneously engrafted with CD25+ human cell lines (e.g SUDHL-1, a CD25+ anaplastic large cell lymphoma). Various size tumors (palpable, 100- 500 mm3) may be used to discern the differences between antibodies.
  • CD25 antibodies e.g.1-10 mg/kg, 3X weekly or once daily
  • Drug efficacy and MOA studies in mouse xenograft tumor models in humanized mice.
  • the more effective antibodies for tumor growth inhibition via Treg depletion and increased intratumoral Teff/Treg ratio with increased T effector cell activity will be tested in various human tumor models (e.g. liver, breast, melanoma, gastric, NSCLC and colon cancer) to establish efficacy and mechanism of action.
  • Some studies may include using the triple negative breast cancer cell line MDA-MB-231, a gastric cell line, melanoma cell line A375 and liver cancer cell line Huh- 7 as well as human PDX models that have been well characterized and have either shown correlations between infiltrated Tregs and tumor growth and/or have been treated with PD-1 antibody combinations in humanized mice engrafted with human PBMCs and/or CD34+ cells.
  • tumors will be subcutaneously engrafted until tumors reach a range of sizes from palpable to 100- 500 mm3, and treated with various doses of CD25 antibodies and dosing schedules (e.g.1-10 mg/kg, 3X weekly or once daily).

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Immunology (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • General Chemical & Material Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Public Health (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Transplantation (AREA)
  • Oncology (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
PCT/US2019/061552 2018-11-14 2019-11-14 Cd25 antibodies Ceased WO2020102591A1 (en)

Priority Applications (7)

Application Number Priority Date Filing Date Title
CA3120096A CA3120096A1 (en) 2018-11-14 2019-11-14 Cd25 antibodies
JP2021526461A JP7619941B2 (ja) 2018-11-14 2019-11-14 Cd25抗体
CN201980088154.1A CN113677359A (zh) 2018-11-14 2019-11-14 Cd25抗体
EP19883467.3A EP3880227A4 (en) 2018-11-14 2019-11-14 ANTI-CD25 ANTIBODIES
US17/320,125 US12215163B2 (en) 2018-11-14 2021-05-13 CD25 antibodies
JP2024158123A JP2024175003A (ja) 2018-11-14 2024-09-12 Cd25抗体
US18/968,640 US20250122301A1 (en) 2018-11-14 2024-12-04 Cd25 antibodies

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201862767405P 2018-11-14 2018-11-14
US62/767,405 2018-11-14

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US17/320,125 Continuation US12215163B2 (en) 2018-11-14 2021-05-13 CD25 antibodies

Publications (1)

Publication Number Publication Date
WO2020102591A1 true WO2020102591A1 (en) 2020-05-22

Family

ID=70730731

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2019/061552 Ceased WO2020102591A1 (en) 2018-11-14 2019-11-14 Cd25 antibodies

Country Status (6)

Country Link
US (2) US12215163B2 (https=)
EP (1) EP3880227A4 (https=)
JP (2) JP7619941B2 (https=)
CN (1) CN113677359A (https=)
CA (1) CA3120096A1 (https=)
WO (1) WO2020102591A1 (https=)

Cited By (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20210301000A1 (en) * 2018-08-28 2021-09-30 Guagndong Feipeng Biological Co., Ltd. NS1-Binding Protein and Uses Thereof
WO2022235295A1 (en) * 2021-05-07 2022-11-10 Kiromic BioPharma, Inc. Mesothelin isoform binding molecules and chimeric pd1 receptor molecules, cells containing the same and uses thereof
WO2023016455A1 (zh) * 2021-08-09 2023-02-16 南京诺艾新生物技术有限公司 重组抗人cd25抗体及其应用
WO2023129870A3 (en) * 2021-12-29 2023-08-31 Staidson Biopharma Inc. ANTIBODIES SPECIFICALLY RECOGNIZING C5aR1 AND USES THEREOF
JP2023550048A (ja) * 2020-11-13 2023-11-30 アイバイオ, インク. Cd25抗体
WO2024006961A1 (en) 2022-07-01 2024-01-04 Neoleukin Therapeutics, Inc. Neo-2/15 variants and uses thereof for preferentially stimulating t-regulatory cells
WO2024040195A1 (en) 2022-08-17 2024-02-22 Capstan Therapeutics, Inc. Conditioning for in vivo immune cell engineering
JP2024534053A (ja) * 2021-08-25 2024-09-18 アイバイオ, インク. 抗cd25抗体
WO2024249954A1 (en) 2023-05-31 2024-12-05 Capstan Therapeutics, Inc. Lipid nanoparticle formulations and compositions
WO2025076127A1 (en) 2023-10-05 2025-04-10 Capstan Therapeutics, Inc. Constrained ionizable cationic lipids and lipid nanoparticles
WO2025076113A1 (en) 2023-10-05 2025-04-10 Capstan Therapeutics, Inc. Ionizable cationic lipids with conserved spacing and lipid nanoparticles
WO2025179294A2 (en) 2024-02-22 2025-08-28 Capstan Therapeutics, Inc. Immune engineering amplification
US12441803B2 (en) 2018-11-14 2025-10-14 Ibio, Inc. Engineered CD25 polypeptides and uses thereof
WO2025217454A2 (en) 2024-04-11 2025-10-16 Capstan Therapeutics, Inc. Ionizable cationic lipids and lipid nanoparticles
WO2025217452A1 (en) 2024-04-11 2025-10-16 Capstan Therapeutics, Inc. Constrained ionizable cationic lipids and lipid nanoparticles

Families Citing this family (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
MX2022001065A (es) * 2019-07-30 2022-02-14 Shanghai Hansoh Biomedical Co Ltd Anticuerpo anti-bcma, fragmento de union al antigeno y uso medico del mismo.
WO2021138380A2 (en) * 2019-12-30 2021-07-08 University Of Louisville Research Foundation, Inc. Virus-like particle binding agents, related compositions, and related methods
TW202340250A (zh) * 2022-01-17 2023-10-16 大陸商諾納生物(蘇州)有限公司 標靶cd25的抗體及其製備方法和應用
WO2024213046A1 (en) * 2023-04-11 2024-10-17 Suzhou Transcenta Therapeutics Co., Ltd. Anti-cd25 antibody and uses thereof
CN117050165B (zh) * 2023-08-14 2025-03-25 三优生物医药(上海)有限公司 一种靶向猴痘病毒的抗体、其抗原结合片段及其用途
CN119331099B (zh) * 2024-11-06 2025-12-16 郑州伊美诺生物技术有限公司 抗嗜酸性粒细胞过氧化物酶的单克隆抗体及其应用

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7438907B2 (en) * 2002-11-15 2008-10-21 Genmab A/S Human monoclonal antibodies against CD25
WO2011051327A2 (en) * 2009-10-30 2011-05-05 Novartis Ag Small antibody-like single chain proteins
WO2014028776A1 (en) * 2012-08-15 2014-02-20 Zyngenia, Inc. Monovalent and multivalent multispecific complexes and uses thereof
WO2014145907A1 (en) * 2013-03-15 2014-09-18 Xencor, Inc. Targeting t cells with heterodimeric proteins
US20170342112A1 (en) * 2007-09-25 2017-11-30 Pastoral Greenhouse Gas Research Limited Vaccines and vaccine components for inhibition of microbial cells
US20180141999A1 (en) * 2015-05-05 2018-05-24 Albert Einstein College Of Medicine, Inc. Antibody therapeutics against filovirus infections and uses thereof

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EA201892619A1 (ru) 2011-04-29 2019-04-30 Роше Гликарт Аг Иммуноконъюгаты, содержащие мутантные полипептиды интерлейкина-2
WO2018089829A1 (en) 2016-11-10 2018-05-17 Fortis Therapeutics, Inc. Cd46-specific effector cells and uses thereof
US11879014B2 (en) * 2017-03-17 2024-01-23 Tusk Therapeutics Ltd. Method of treating cancer or depleting regulatory T cells in a subject by administering a human IGG1 anti-CD25 antibody
EP3612565A4 (en) 2017-04-18 2021-06-16 R-Pharm Overseas, Inc. ANTI-PD-L1 ANTIBODIES AND USES THEREOF
EP3880698A4 (en) 2018-11-14 2022-11-30 RubrYc Therapeutics, Inc. MANIPULATED CD25 POLYPEPTIDES AND USES THEREOF

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7438907B2 (en) * 2002-11-15 2008-10-21 Genmab A/S Human monoclonal antibodies against CD25
US20170342112A1 (en) * 2007-09-25 2017-11-30 Pastoral Greenhouse Gas Research Limited Vaccines and vaccine components for inhibition of microbial cells
WO2011051327A2 (en) * 2009-10-30 2011-05-05 Novartis Ag Small antibody-like single chain proteins
WO2014028776A1 (en) * 2012-08-15 2014-02-20 Zyngenia, Inc. Monovalent and multivalent multispecific complexes and uses thereof
WO2014145907A1 (en) * 2013-03-15 2014-09-18 Xencor, Inc. Targeting t cells with heterodimeric proteins
US20180141999A1 (en) * 2015-05-05 2018-05-24 Albert Einstein College Of Medicine, Inc. Antibody therapeutics against filovirus infections and uses thereof

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
See also references of EP3880227A4 *
WILKINSON, DS ET AL.: "Partial CD 25 Antagonism Enables Dominance of Antigen-Inducible CD 25high FOXP3+ Regulatory T Cells As a Basis for a Regulatory T Cell -Based Adoptive Immunotherapy", FRONTIERS IN IMMUNOLOGY, vol. 8, no. 1782, 14 December 2017 (2017-12-14), pages 1 - 21, XP055678640, DOI: 10.3389/fimmu.2017.01782 *

Cited By (21)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20210301000A1 (en) * 2018-08-28 2021-09-30 Guagndong Feipeng Biological Co., Ltd. NS1-Binding Protein and Uses Thereof
US12441803B2 (en) 2018-11-14 2025-10-14 Ibio, Inc. Engineered CD25 polypeptides and uses thereof
JP7621481B2 (ja) 2020-11-13 2025-01-24 アイバイオ, インク. Cd25抗体
JP2023550048A (ja) * 2020-11-13 2023-11-30 アイバイオ, インク. Cd25抗体
US12473368B2 (en) 2020-11-13 2025-11-18 Ibio, Inc. CD25 antibodies
AU2021378308B2 (en) * 2020-11-13 2026-01-08 Ibio, Inc. Cd25 antibodies
EP4243860A4 (en) * 2020-11-13 2024-10-16 iBio, Inc. ANTI-CD25 ANTIBODIES
WO2022235295A1 (en) * 2021-05-07 2022-11-10 Kiromic BioPharma, Inc. Mesothelin isoform binding molecules and chimeric pd1 receptor molecules, cells containing the same and uses thereof
WO2023016455A1 (zh) * 2021-08-09 2023-02-16 南京诺艾新生物技术有限公司 重组抗人cd25抗体及其应用
EP4392455A4 (en) * 2021-08-25 2025-08-20 Ibio Inc ANTI-CD-25 ANTIBODIES
JP2024534053A (ja) * 2021-08-25 2024-09-18 アイバイオ, インク. 抗cd25抗体
WO2023129870A3 (en) * 2021-12-29 2023-08-31 Staidson Biopharma Inc. ANTIBODIES SPECIFICALLY RECOGNIZING C5aR1 AND USES THEREOF
WO2024006961A1 (en) 2022-07-01 2024-01-04 Neoleukin Therapeutics, Inc. Neo-2/15 variants and uses thereof for preferentially stimulating t-regulatory cells
WO2024040194A1 (en) 2022-08-17 2024-02-22 Capstan Therapeutics, Inc. Conditioning for in vivo immune cell engineering
WO2024040195A1 (en) 2022-08-17 2024-02-22 Capstan Therapeutics, Inc. Conditioning for in vivo immune cell engineering
WO2024249954A1 (en) 2023-05-31 2024-12-05 Capstan Therapeutics, Inc. Lipid nanoparticle formulations and compositions
WO2025076113A1 (en) 2023-10-05 2025-04-10 Capstan Therapeutics, Inc. Ionizable cationic lipids with conserved spacing and lipid nanoparticles
WO2025076127A1 (en) 2023-10-05 2025-04-10 Capstan Therapeutics, Inc. Constrained ionizable cationic lipids and lipid nanoparticles
WO2025179294A2 (en) 2024-02-22 2025-08-28 Capstan Therapeutics, Inc. Immune engineering amplification
WO2025217454A2 (en) 2024-04-11 2025-10-16 Capstan Therapeutics, Inc. Ionizable cationic lipids and lipid nanoparticles
WO2025217452A1 (en) 2024-04-11 2025-10-16 Capstan Therapeutics, Inc. Constrained ionizable cationic lipids and lipid nanoparticles

Also Published As

Publication number Publication date
CA3120096A1 (en) 2020-05-22
US20250122301A1 (en) 2025-04-17
CN113677359A (zh) 2021-11-19
US12215163B2 (en) 2025-02-04
US20230220102A1 (en) 2023-07-13
EP3880227A1 (en) 2021-09-22
JP2022507487A (ja) 2022-01-18
EP3880227A4 (en) 2022-11-09
JP2024175003A (ja) 2024-12-17
JP7619941B2 (ja) 2025-01-22

Similar Documents

Publication Publication Date Title
US12215163B2 (en) CD25 antibodies
US12473368B2 (en) CD25 antibodies
JP7317272B2 (ja) Tigit抗体、その抗原結合断片及びその医療用途 本願は、2019年9月29日に出願された出願番号cn201710908565.3に基づいたものであり、その優先権を主張する。その開示は、その全体が参照により本明細書に組み込まれる。
EP3478723B1 (en) Pd-l1-specific antibodies and methods of using the same
US20200181259A1 (en) Anti-cd47 antibodies and uses thereof
US20210363266A1 (en) Anti-4-1bb antibody, antigen-binding fragment thereof and medical use thereof
CN112955548B (zh) 叶酸受体α特异性抗体
TW202124444A (zh) 抗cd39抗體組合物及方法
TWI902681B (zh) 抗cd79b抗體、其抗原結合片段及其醫藥用途
US20230406922A1 (en) Humanized cd19 antibody and use thereof
EP4212549A1 (en) Anti-gitr monoclonal antibody and medical use thereof
CN115038718A (zh) 抗人程序性死亡配体-1(pd-l1)的抗体及其用途
JP2025011259A (ja) 治療用結合分子
CN115335402B (zh) 特异性抗原结合分子,其制备方法及医药用途
CN114616245B (zh) 一种抗cd38的抗体及其用途
WO2023011338A1 (zh) 抗CD79b×CD3双特异性抗体及其用途
CN112409482B (zh) Bcma抗体
US20220378909A1 (en) Methods of Treating Cancer with Anti-PD-1 Antibodies
HK40063825A (en) Cd25 antibodies
TW202602922A (zh) 結合構築體(二)
WO2024077774A1 (zh) 一种多功能重组抗体及其制备方法和应用
CN119552247A (zh) 抗cd25抗体及其医药用途
HK40013319A (en) Anti-cd47 antibody and use thereof

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 19883467

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2021526461

Country of ref document: JP

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 3120096

Country of ref document: CA

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2019883467

Country of ref document: EP

Effective date: 20210614