WO2020101042A1 - Method for treating muscular dystrophy by targeting utrophin gene - Google Patents
Method for treating muscular dystrophy by targeting utrophin gene Download PDFInfo
- Publication number
- WO2020101042A1 WO2020101042A1 PCT/JP2019/045716 JP2019045716W WO2020101042A1 WO 2020101042 A1 WO2020101042 A1 WO 2020101042A1 JP 2019045716 W JP2019045716 W JP 2019045716W WO 2020101042 A1 WO2020101042 A1 WO 2020101042A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- promoter
- seq
- set forth
- base sequence
- vector
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P21/00—Drugs for disorders of the muscular or neuromuscular system
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
- C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
- C07K14/4702—Regulators; Modulating activity
- C07K14/4705—Regulators; Modulating activity stimulating, promoting or activating activity
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
- C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
- C07K14/4707—Muscular dystrophy
- C07K14/4708—Duchenne dystrophy
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/102—Mutagenizing nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
- C12N9/22—Ribonucleases [RNase]; Deoxyribonucleases [DNase]
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
- C07K2319/09—Fusion polypeptide containing a localisation/targetting motif containing a nuclear localisation signal
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2740/00—Reverse transcribing RNA viruses
- C12N2740/00011—Details
- C12N2740/10011—Retroviridae
- C12N2740/16011—Human Immunodeficiency Virus, HIV
- C12N2740/16041—Use of virus, viral particle or viral elements as a vector
- C12N2740/16043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
- C12N2750/00011—Details
- C12N2750/14011—Parvoviridae
- C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
- C12N2750/14141—Use of virus, viral particle or viral elements as a vector
- C12N2750/14143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/80—Vectors containing sites for inducing double-stranded breaks, e.g. meganuclease restriction sites
Definitions
- the present invention relates to methods for treating muscular dystr'ophy by targeting the human Utrophin (UTRN) gene, and the like. More particularly, the present invention relates to methods and agents for treating or preventing muscular dystrophy by activating expression of human UTRN gene by using a guide RNA targeting a particular sequence of human UTRN gene and a fusion protein of a transcription activator and a CRISPR effector protein, and the like.
- UTRN human Utrophin
- Muscular dystrophy is a generic term for hereditary diseases associated with progressive muscular atrophy and muscle weakness.
- muscular dystrophies those caused by mutation of the dystrophin gene on the X chromosome include DUCHENNE muscular dystrophy (DMD) and its mild type, BECKER muscular dystrophy (BMD) .
- DMD is the most frequent hereditary progressive muscular disease that one in about 3,500 newborn males develops. The clinical symptoms thereof include muscle weakness from around 2 to 5 years of age, progression of muscle weakness thereafter, abasia by about 10 years of age, and death in the twenties due to cardiac failure or respiratory failure (see WO 2009/044383, which is incorporated herein by reference in its entirety) .
- DMD is caused by a mutation in the
- the dystrophin gene is present on the X
- chromosome is a huge gene consisting of about 2.2 million bases of DNA. It is transcribed from DNA. to mRNA precursor, introns are further removed by splicing, and mRNA composed of 79 exons is produced (about 14kb) . This mRNA is translated into 3685 amino acids to generate dystrophin protein. Dystrophin protein is involved in the maintenance of membrane stability of muscle cells. In DMD patients, since the mutation occurs in the dystrophin gene, the dystrophin protein is hardly expressed and the structure of the muscle cell cannot be maintained, thus leading to muscle weakness.
- BMD is also caused by mutation in dystrophin gene; however, the symptoms thereof are generally mild compared to DMD.
- the difference between the clinical symptoms of DMD and BMD is based on that functional dystrophin protein is hardly expressed in DMD whereas incomplete but functional dystrophin protein is produced in BMD.
- the full-length dystrophin cDNA is relatively large with a length of about 14 kb; therefore the size limitation of DNA that can be packaged may be a problem for certain vectors like adeno- associated virus (AAV) vector.
- AAV adeno- associated virus
- a method using a truncated dystrophin gene (mini/microdystrophin gene) which has a minimum functional domain has been proposed (see Sakamoto M. et al., Biochem Biophys Res Commun. 2002 May 17; 293 (4) : 1265-72, which is incorporated herein by reference in its entirety) .
- utrophin sometimes also described as "Utrophin", "UTRN” etc. in the present
- Utrophin is a cytoskeletal protein highly homologous to dystrophin, and is present in normal and DMD muscle, albeit at a low level.
- Utrophin cDNA is very large (over 10 kb) as with dystrophin.
- Utrophin is also known to be able to
- utrophin As a gene therapy targeting utrophin, for example,
- W02015/018503 discloses an invention directed to a recombinant adeno-associated virus (AAV) vector for expression of a gene in skeletal or cardiac muscle tissue, comprising a muscle-specific promoter and a gene encoding a fusion protein, wherein said fusion protein comprises:
- said fusion protein when expressed in said skeletal or cardiac muscle tissue, is capable of increasing utrophin
- zinc finger protein is used as a DNA binding element.
- a system using a combination of Cas9 with deactivated nuclease activity (dCas9) and a transcription activation domain or transcription repression domain has been developed in recent years, in which expression of a target gene is controlled through targeting of the protein to the gene by using guide RNA and without cleaving DNA sequence of the gene (WO2013/176772, which is incorporated herein by reference in its entirety) . Its clinical application is expected (see Dominguez A. et al., Nat Rev Mol Cell Biol. 2016 Jan; 17(1): 5-15, which is incorporated herein by reference in its entirety) .
- Gene ID: 7402 can be strongly activated by using a guide RNA targeting a particular sequence of human UTRN gene and a fusion protein of a transcription activator and a nuclease-deficient CRISPR effector protein.
- the present inventors have found that the expression of human UTRN gene can be
- the present invention provides:
- a polynucleotide comprising the following base
- the base sequence encoding the guide RNA comprises the base sequence set forth in SEQ ID NO: 45, 46, 58, 59, 60, 135, 141, 153, 155, 156, 157, 159, 167, or 172, or the base sequence set forth in SEQ ID NO: 45, 46, 58, 59, 60, 135, 141, 153, 155, 156, 157, 159, 167, or 172 in which 1 to 3 bases are deleted, substituted, inserted, and/or added.
- promoter sequence for the base sequence encoding the fusion protein of the nuclease-deficient CRISPR effector protein and the transcription activator is selected from the group EFS promoter, EF-la promoter, CMV promoter, CK8 promoter, MHC
- the base sequence encoding the guide RNA comprises the base sequence set forth in SEQ ID NO: 45, 46, or 59, or the base sequence set forth in SEQ ID NO: 45, 46, or 59 in which 1 to 3 bases are deleted, substituted, inserted, and/or added,
- the transcription activator comprises an amino acid sequence set forth in SEQ ID NO: 117, or an amino acid sequence which is at least 90% identical to the amino acid sequence set forth in SEQ ID NO: 117,
- nuclease-deficient CRISPR effector protein is dCas9 derived from Staphylococcus aureus
- the promoter sequence for the base sequence encoding the guide RNA is U6 promoter
- the promoter sequence for the base sequence encoding the fusion protein of the nuclease-deficient CRISPR effector protein and the transcription activator is CK8 promoter.
- the base sequence encoding the guide RNA comprises the base sequence set forth in SEQ ID NO: 59, or the base sequence set forth in SEQ ID NO: 59 in which 1 to 3 bases are deleted, substituted, inserted, and/or added.
- a vector comprising a polynucleotide of any of (1) to
- AAV adeno-associated virus
- AAV vector is selected from the group consisting of AAVl, AAV2, AAV6, AAV7, AAV8 , AAV9, AAV 58? MTP, AAVsssMTP, AAV-B1, AAVM41, AAVrh74,
- AAVS1_P1 AAVS1_P1
- AAVS10_P1 AAVS1_P1
- a pharmaceutical composition comprising a
- compositions for the treatment or prevention of DUCHENNE muscular dystrophy or BECKER muscular dystrophy are provided.
- a ribonucleoprotein comprising the following:
- (25) The ribonucleoprotein of (23) or (24), wherein the transcription activator is a peptide comprising VP64 and a transcription activation domain of RTA.
- transcription activator comprises an amino acid sequence set forth in SEQ ID NO: 117, or an amino acid sequence which is at least 90% identical to the amino acid sequence set forth in SEQ
- the transcription activator comprises an amino acid sequence set forth in SEQ ID NO: 117, or an amino acid sequence which is at least 90% identical to the amino acid sequence set forth in SEQ ID NO: 117, and
- nuclease-deficient CRISPR effector protein is dCas9 derived from Staphylococcus aureus
- the ribonucleoprotein of (29) wherein the guide RNA comprises the base sequence set forth in SEQ ID NO: 197, or the base sequence set forth in SEQ ID NO: 197 in which 1 to 3 bases are deleted, substituted, inserted, and/or added.
- composition or kit comprising the following for activation of the expression of the human Utrophin gene:
- composition or kit of (31) wherein the guide RNA comprises the base sequence set forth in SEQ ID NO: 194, 195,
- 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206 or 207 or the base sequence set forth in SEQ ID NO: 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206 or 207 in which 1 to 3 bases are deleted, substituted, inserted, and/or added.
- composition or kit of (31) or (32) comprising at least two different guide RNAs.
- transcription activator comprises an amino acid sequence set forth in SEQ ID NO: 117, or an amino acid sequence which is at least 90% identical to the amino acid sequence set forth in SEQ ID NO: 117.
- composition or kit of any of (31) to (35) wherein the nuclease-deficient CRISPR effector protein is dCas9.
- composition or kit of (36) wherein the dCas9 is derived from Staphylococcus aureus.
- polynucleotide encoding the fusion protein further comprises a promoter sequence for the fusion protein and/or the polynucleotide encoding the guide RNA further
- RNA comprises a promoter sequence for the guide RNA.
- composition or kit of (38), wherein the promoter sequence for the guide RNA is selected from the group U6
- composition or kit of (38) or (39), wherein the promoter sequence for the fusion protein is selected from the group EFS promoter, EF-lc* promoter, CMV promoter, CK8 promoter, MHC promoter, Des promoter, CAG promoter and MYOD promoter.
- the transcription activator comprises an amino acid sequence set forth in SEQ ID NO: 117, or an amino acid sequence which is at least 90% identical to the amino acid sequence set forth in SEQ ID NO: 117,
- nuclease-deficient CRISPR effector protein is dCas9 derived from Staphylococcus aureus
- promoter sequence for the guide RNA is U6 promoter
- promoter sequence for the fusion protein is CK8 promoter.
- composition or kit of (41) wherein the guide RNA comprises the base sequence set forth in SEQ ID NO: 197, or the base sequence set forth in SEQ ID NO: 197 in which 1 to 3 bases are deleted, substituted, inserted, and/or added.
- a method for treating or preventing DUCHENNE muscular dystrophy or BECKER muscular dystrophy comprising administering the following (e) and (f) :
- transcription activator is a peptide comprising VP64 and a transcription activation domain of RTA.
- activator comprises an amino acid sequence set forth in SEQ ID NO: 117, or an amino acid sequence which is at least 90%
- nuclease-deficient CRISPR effector protein is dCas9.
- the method comprises administering a
- polynucleotide encoding the fusion protein further comprises a promoter sequence for the fusion protein and/or the polynucleotide encoding the guide RNA further
- RNA comprises a promoter sequence for the guide RNA.
- the transcription activator comprises an amino acid sequence set forth in SEQ ID NO: 117, or an amino acid sequence which is at least 90% identical to the amino acid sequence set forth in SEQ ID NO: 117,
- nuclease-deficient CRISPR effector protein i dCas9 derived from Staphylococcus aureus
- promoter sequence for the guide RNA is U6 promoter
- promoter sequence for the fusion protein is CK8 promoter.
- the guide RNA comprises th base sequence set forth in SEQ ID NO: 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206 or 207, or the base sequence set forth in SEQ ID NO: 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206 or 207 in which 1 to 3 bases are deleted, substituted, inserted, and/or added.
- transcription activator is a peptide comprising VP64 and a transcription activation domain of RTA.
- the use comprises use of a polynucleotide encoding the fusion protein and use of a polynucleotide encoding the guide RNA and
- polynucleotide encoding the fusion protein further comprises a promoter sequence for the fusion protein and/or the polynucleotide encoding the guide RNA further comprises a promoter sequence for the guide RNA.
- (62) The use of (62), wherein the promoter sequence for the guide RNA is selected from the group U6 promoter, SNR6 promoter, SNR52 promoter, SCR1 promoter, RPR1 promoter, U3 promoter, and HI promoter.
- (64) The use of (62) or (63), wherein the promoter sequence for the fusion protein is selected from the group EFS promoter, EF-la promoter, CMV promoter, CK8 promoter, MHC promoter, Des promoter, CAG promoter, and MYOD promoter.
- guide RNA comprises the base sequence set forth in SEQ ID NO: 194, 195, or 197, or the base sequence set forth in SEQ ID NO: 194, 195, or 197 in which 1 to 3 bases are deleted, substituted, inserted, and/or added,
- the transcription activator comprises an amino acid sequence set forth in SEQ ID NO: 117, or an amino acid sequence which is at least 90% identical to the amino acid sequence set forth in SEQ ID NO: 117,
- nuclease-deficient CRISPR effector protein is dCas9 derived from Staphylococcus aureus
- promoter sequence for the guide RNA . is U6 promoter
- promoter sequence for the fusion protein is CK8 promoter.
- (66) The use of (65), wherein the guide RNA comprises the base sequence set forth in SEQ ID NO: 197, or the base sequence set forth in SEQ ID NO: 197 in which 1 to 3 bases are deleted, substituted, inserted, and/or added.
- the expression of the human Utrophin gene can be activated and, consequently, the present invention is expected to be able to treat DMD and BMD.
- Fig. 1 the upper panel shows the region of promoter A in human UTRN gene, and the middle panel shows the region of promoter B, and the positions of the 24 targeting sequences (Guide # sgED3-l to sgED3-24 (SEQ ID NOs : 129 to 152)) determined in respective regions are shown.
- the 24 targeting sequences (Guide # sgED3-l to sgED3-24 (SEQ ID NOs : 129 to 152)) determined in respective regions are shown.
- sgRNAs that
- region A specifically binds to a region comprising Guide # sgED3-6 and sgED3-7 (SEQ ID NOs: 134 and 135) (region A) and the other region comprising Guide # sgED3-13 (SEQ ID NO: 141) (region B) were used respectively, expression of human UTRN gene was strongly activated as compared to the case in which control sgRNA was used. The activation effect was the strongest when dSaCas9-VPR fusion protein was used out of 3 kinds of dSaCas9- transcription activator fusion proteins.
- the upper panel shows the positions of the targeting sequences (Guide # sgED3-l to sgED3-20 and sgED3-25 to sgED3-48 (SEQ ID NOs: 129 to 148 and 153 to 176)) determined in the regions of promoter A of human UTRN gene.
- the targeting sequences (Guide # sgED3-l to sgED3-20 and sgED3-25 to sgED3-48 (SEQ ID NOs: 129 to 148 and 153 to 176)) determined in the regions of promoter A of human UTRN gene.
- sgRNAs that specifically bind to a region comprising the targeting sequences Guide # sgED3-6, sgED3-13, sgED3-25 to sgED3-32, sgED3-39, sgED3-40, sgED3-44 (SEQ ID NOs: 134, 141,
- human UTRN gene expression was activated not less than two times as compared to the case in which the control sgRNA was used.
- sgRNA comprising crRNA coded by the targeting sequence Guide # sgED3-6, sgED3-13, sgED3-25, sgED3-27, sgED3-30, sgED3- 31, sgED3-39, sgED3-40, or sgED3-44 (SEQ ID NO: 134, 141, 153, 155, 158, 159, 167, 168 or 172) was used, activation of human UTRN gene expression was observed.
- AAV2 produced using pAAV-EFS-dSaCas9 [-25] -miniVR-U6-sgRNA AIO plasmid that expresses sgRNA comprising crRNA coded by the targeting sequence Guide # sgED3-6, sgED3-30, or sgED3-31 (SEQ ID NO: 134, 158 or 159) was transduced into HEK293FT cells.
- sgRNAs comprising crRNA coded by the targeting sequence Guide # sgED3-6, sgED3-30, or sgED3-31 (SEQ ID NO: 134, 158, or 159), activation of human UTRN gene was observed as compared to the control sgRNA.
- Fig. 5 shows a construct of pAAV-EFS-dSaCas9 [-25] -miniVR- U6-sgRNA AIO plasmid.
- Panel A shows H3K4me3 and H3K27Ac pattern of genome in human skeletal muscle cells, and the putative enhancer region, El, E2, and E3, and the putative promoter region, Pi and P2, of the human UTRN gene.
- Panels B to F show the positions of the targeting sequences set forth in each Guide # (sequences set forth in SEQ ID NOs : 4 to 103).
- the upper panel shows homology with cynomolgus monkey (Macaca fascicularis) and located region of the 5
- the lower panel shows combinations of the 5 targeting sequences, their homology with cynomolgus monkey and located region.
- Fig. 10 shows sgRNA comprising crRNA coded by the
- Targets # 145, # 146, or # 208 upregulates UTRN in pED260, pED261, or pED263 plasmid backbones.
- Fig. 11 the left panel shows the lane layout of SDS- PAGE where each AAV9 sample and markers were applied, and the right panel shows the image of SDS-PAGE.
- the values next to lane 11 mean the molecular weight (kDa) .
- Three capsid proteins (VP1, VP2, and VP3, which are 87, 72, and 62 kDa, respectively) were detected from each AAV sample. These results indicated that the genes of interest which were cloned into the plasmids (pED261-145, pED261-146, pED261-208, pED263-145, pED263-146, and pED263-208) can be packaged into AAV9.
- Fig. 13 shows RNA-seq results for target guide normalized against non-targeting guide plotted as log 2 fold change vs mean of normalized counts (Panel A; Guide # 145 vs NTgl, Panel B; Guide # 146 vs NTgl, and Panel C; Guide # 208 vs NTgl) .
- the present invention provides a polynucleotide comprising the following base sequences (hereinafter sometimes to be also referred to as "the polynucleotide of the present invention”) :
- fusion protein and guide RNA form a complex
- ribonucleoprotein RNP
- the expression regulatory region of human Utrophin (UTRN) gene means any region in which the expression of human UTRN gene can be activated by binding RNP to that region. That is, the expression regulatory region of human UTRN gene may exist in any region such as the promoter region, enhancer region, intron, and exon of the human UTRN gene, as long as the expression of the human UTRN gene is activated by the binding of RNP. In the present specification, when the expression regulatory region is shown by the particular sequence, the expression regulatory region includes both the sense strand sequence and the antisense strand sequence conceptually.
- a fusion protein of a nuclease- deficient CRISPR effector protein and a transcription activator is recruited by a guide RNA into a particular region in the expression regulatory region of the human UTRN gene.
- the "guide RNA targeting " means a "guide RNA recruiting a fusion protein into ".
- the "guide RNA (to be also referred to as 'gRNA' ) " is an RNA comprising a genome specific CRISPR-RNA (to be referred to as "crRNA”) .
- crRNA is an RNA that binds to a complementary sequence of a targeting sequence
- the "guide RNA” refers to an RNA comprising an RNA consisting of crRNA and a specific sequence attached to its 5'- terminal (for example, an RNA sequence set forth in SEQ ID NO: 106 in the case of FnCpf 1) .
- the "guide RNA” refers to chimera RNA (to be referred to as "single guide RNA(sgRNA)”) comprising crRNA and trans-activating crRNA attached to its 3' -terminal (to be
- tracrRNA referred to as "tracrRNA" (see, for example, Zhang F. et al., Hum Mol Genet. 2014 Sep 15; 23(Rl):R40-6 and Zetsche B. et al . , Cell. 2015 Oct 22; 163(3): 759-71, which are incorporated herein by reference in their entireties) .
- a sequence complementary to the sequence to which crRNA is bound in the expression regulatory region of the human UTRN gene is referred to as a "targeting sequence". That is, in the present specification, the "targeting sequence” is a DNA sequence present in the expression regulatory region of the human UTRN gene and adjacent to PAM (protospacer adjacent motif). PAM is adjacent to the 5'- side of the targeting sequence when Cpfl is used as the CRISPR effector protein. PAM is adjacent to the 3' -side of the targeting sequence.
- the targeting sequence may be present on either the sense strand sequence side or the antisense strand sequence side of the expression regulatory region of the human UTRN gene (see, for example, the aforementioned Zhang F. et al . , Hum Mol Genet. 2014 Sep 15; 23 (Rl): R40-6 and Zetsche B. et al., Cell. 2015 Oct 22; 163(3): 759-71, which are incorporated herein by reference in their entireties) .
- CRISPR effector protein a transcriptional activator fused thereto is recruited to the expression regulatory region of the human UTRN gene.
- the nuclease-deficient CRISPR effector protein (hereinafter to be simply referred to as "CRISPR effector protein") to be used in the present invention is not
- nuclease-deficient Cas9 (hereinafter sometimes to be also referred to as “dCas9") or nuclease- deficient Cpfl (hereinafter sometimes to be also referred to as “dCpfl”) can be included.
- dCas9 nuclease-deficient Cas9
- dCpfl nuclease- deficient Cpfl
- dCas9 examples include, but are not limited to, a nuclease-deficient variant of Streptococcus pyogenes-derived Cas9 (SpCas9; PAM sequence: NGG (N is A, G, T or C. hereinafter the same)), Streptococcus thermophilus- derived Cas9 (StCas9; PAM sequence: NNAGAAW (W is A or T.
- Neisseria meningitidis-derived Cas9 NmCas9; PAM sequence: NNNNGATT
- Staphylococcus aureus- derived Cas9 SaCas9; PAM sequence: NNGRRT (R is A or G.
- dCas9 a variant obtained by modifying a part of the amino acid sequence of the aforementioned dCas9, which forms a complex with gRNA and is recruited to the expression regulatory region of the human UTRN gene, may also be used.
- examples of such variants include a truncated variant with a partly deleted amino acid sequence.
- dSaCas9 obtained by deleting the 721st to 745th amino acids from dSaCas9 that is a double mutant in which the 10th Asp residue is converted to Ala residue and the 580th Asn residue is converted to Ala residue (SEQ ID NO: 109), or dSaCas9 in which the deleted part is substituted by a peptide linker (e.g.
- dSaCas9 [-25] any of these double mutants is sometimes to be referred to as "dSaCas9 [-25] ") , or dSaCas9 obtained by deleting the 482nd to 648th amino acids from dSaCas9 that is the aforementioned double mutant (SEQ ID NO: 112), or dSaCas9 in which the deleted part is substituted by a peptide linker (one in which the deleted part is substituted by GGSGGS linker is set forth in SEQ ID NO: 113) may also be used.
- dCpfl examples include, but are not limited to, a nuclease-deficient variant of Francisella
- Acidaminococcus sp. -derived Cpfl (AsCpfl; PAM sequence: NTTT)
- LbCpfl Lachnospiraceae bacterium-derived Cpfl
- dCpfl a double mutant in which the 917th Asp residue is converted to Ala residue and the 1006th Glu residue is converted to Ala residue can be used (see, for example, the aforementioned Zetsche B et al., Cell. 2015, which is incorporated herein by reference in its entirety) .
- dCpfl a variant obtained by modifying a part of the amino acid sequence of the aforementioned dCpfl, which forms a complex with gRNA and is recruited to the expression regulatory region of the human UTRN gene, may also be used.
- dCas9 is used as the nuclease-deficient CRISPR effector protein.
- the dCas9 is dSaCas9, and, in a particular
- the dSaCas9 is dSaCas9 [-25] .
- a polynucleotide comprising a base sequence encoding a CRISPR effector protein can be cloned by, for example,
- RNA or mRNA fraction prepared from the cells producing the protein as a template amplifying the polynucleotide by PCR method using total RNA or mRNA fraction prepared from the cells producing the protein as a template.
- polynucleotide comprising a base sequence encoding a nuclease- deficient CRISPR effector protein
- a nucleotide sequence encoding a cloned CRISPR effector protein by a known site-directed mutagenesis method to convert the amino acid residues (e.g., 10th Asp residue, 557th His residue, and 580th Asn residue in the case of SaCas9; 917th Asp residue and 1006th Glu residue in the case of FnCpfl, and the like can be included, but are not limited to these) at a site important for DNA cleavage activity to other amino acids.
- amino acid residues e.g., 10th Asp residue, 557th His residue, and 580th Asn residue in the case of SaCas9; 917th Asp residue and 1006th Glu residue in the case of FnCpfl, and the like can be included, but are not limited to these
- a polynucleotide comprising a base sequence encoding nuclease-deficient CRISPR effector protein can be obtained by chemical synthesis or a combination of chemical synthesis and PCR method or Gibson Assembly method, based on the cDNA sequence information thereof, and can also be further constructed as a base sequence that underwent codon optimization to give codons suitable for expression in human.
- human UTRN gene expression is activated by the action of the transcription activator fused with the nuclease-deficient CRISPR effector protein.
- the "transcription activator” means a protein having the ability to activate gene transcription of human UTRN gene or a peptide fragment retaining the function thereof.
- the transcription activator to be used in the present invention is not particularly limited as long as it can activate the expression of human UTRN gene.
- it includes VP64, VPH, VPR, miniVR, and microVR, a variant thereof having transcription activation ability and the like.
- VP64 is a protein having the ability to activate gene transcription of human UTRN gene.
- VPH is a fusion protein of ' VP64, p65 and HSF1, specifically, a peptide consisting of 376 amino acids set forth in SEQ ID NO:
- VPR is a fusion protein of VP64, p65, and a replication and transcription activator of Epstein-Barr virus (RTA) , for example, a peptide consisting of 523 amino acids set forth in SEQ ID NO: 116, a peptide consisting of 519 amino acids set forth in SEQ ID NO: 216, and the like.
- RTA Epstein-Barr virus
- VP64, VPH, and VPR are known and disclosed in detail in, for example, Chavez A. et al., Nat Methods. 2016 Jul; 13(7): 563-7 and Chavez A. et al., Nat Methods. 2015 Apr; 12 (4) :326—8, which are incorporated herein by reference in their entireties.
- a transcription activator a peptide comprising VP64 and a transcription activation domain of RTA can be used as a transcription activator.
- the transcription activation domain of RTA is known and
- miniVR is a peptide consisting of 167 amino acids set forth in SEQ ID NO: 117
- microVR is a peptide consisting of 140 amino acids set forth in SEQ ID NO:
- the amino acid sequence set forth in SEQ ID NO: 117 is composed of an amino acid sequence in which the 493rd - 605th amino acid residues of RTA, which is a shorter transcription activation domain of RTA, and VP64 are linked with a G-S-G-S linker (SEQ ID NO: 209) .
- the amino acid sequence set forth in SEQ ID NO: 118 is composed of an amino acid sequence in which the 520th - 605th amino acid residues of RTA, which is a much shorter transcription activation domain of RTA, and VP64 are linked with a G-S-G-S linker.
- miniVR and microVR is described in PCT/JP2019/030972, which is incorporated herein by reference in its entirety. Any of the aforementioned
- transcriptional activators may be subjected to any modification and/or alteration as long as it maintains its transcription activation ability.
- a transcriptional activator in the present ' invention (i) a peptide comprising an amino acid sequence set forth in SEQ ID NO: 117, (ii) a peptide comprising an amino acid sequence set forth in SEQ ID NO: 117 in which 1 or several (e.g., 2, 3, 4, 5 or more) amino acids are deleted, substituted, inserted and/or added, (iii) a peptide comprising an amino acid sequence not less than 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or above) identical with the amino acid sequence set forth in SEQ ID NO: 117, (iv) a peptide consisting of the amino acid sequence set forth in SEQ ID NO:
- peptide consisting of an amino acid sequence not less than 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or above) identical with the amino acid sequence set forth in SEQ ID NO: 117 can also be used, as long as it maintains its
- transcription activation ability For example, as a
- peptide comprising an amino acid sequence set forth in SEQ ID NO: 118
- a peptide comprising an amino acid sequence set forth in SEQ ID NO: 118 in which 1 or several (e.g., 2, 3, 4, 5 or more) amino acids are deleted, substituted, inserted and/or added
- a peptide consisting of an amino acid sequence not less than 90% e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or above
- a peptide consisting of an amino acid sequence not less than 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or above) identical with the amino acid sequence set forth in SEQ ID NO: 118 can also be used, as long as it maintains its transcription activation ability.
- a polynucleotide comprising a base sequence encoding a transcription activator can be constructed by chemical synthesis or a combination of chemical synthesis and PCR method or Gibson Assembly method. Furthermore, a polynucleotide comprising a base sequence encoding a transcription activator can also be constructed as a codon-optimized DNA sequence to be codons suitable for expression in human.
- a polynucleotide comprising a base sequence encoding a fusion protein of a transcription activator and a nuclease- deficient CRISPR effector protein can be prepared by ligating a base sequence encoding a nuclease-deficient CRISPR effector protein to a base sequence encoding a transcription activator directly or after adding a base sequence encoding a linker, NLS (nuclear localization signal), a tag and/or others.
- the transcription activator may be fused with either N-terminal or C-terminal of the CRISPR effector protein.
- linker a linker with an amino acid number of about 2 to 50 can be used, and specific examples thereof include, but are not limited to, a G-S-G-S linker in which glycine (G) and serine (S) are alternately linked and the like.
- a fusion protein of nuclease- deficient CRISPR effector protein and transcription activator can be recruited to the expression regulatory region of the human UTRN gene by guide RNA.
- guide RNA comprises crRNA, and the crRNA binds to a complementary sequence of the targeting sequence.
- crRNA may not be completely complementary to the complementary sequence of the targeting sequence as long as the guide RNA can recruit the fusion protein to the target region, and may comprise a base sequence of the targeting sequence in which at least 1 to 3 bases are deleted, substituted, inserted and/or added.
- the targeting sequence can be determined using a published gRNA design web site (CRISPR Design Tool, CRISPR direct, etc.).
- CRISPR Design Tool CRISPR direct, etc.
- candidate targeting sequences of about 20 nucleotides in length for which PAM (e.g. , NNGRRT in the case of SaCas9) is adjacent to the 3'-side thereof are listed, and one having a small number of off-target sites in human genome from among these candidate targeting sequences can be used as the targeting sequence.
- the base length of the targeting sequence is 18 to 24 nucleotides in length, preferably 20 to 23 nucleotides in length, more preferably 21 to 23
- bioinformatic tools are known and publicly available, and can be used to predict the targeting sequence with the lowest off- target effect. Examples thereof include bioinformatics tools such as Benchling (https://benchling.com), and COSMID (CRISPR Off-target Sites with Mismatches, Insertions, and Deletions) (Available on https://crispr.bme.gatech.edu on the internet). Using these, the similarity to the base sequence targeted by gRNA can be summarized.
- the off-target site can be searched for by subjecting the target genome to Blast search with respect to 8 to 12 nucleotides on the 3' -side of the target genome
- candidate targeting sequence seed sequence with high
- the following five regions can be the expression regulatory regions of the human UTRN gene. These regions are strongly suggested to be expression regulatory regions by histone
- the targeting sequence can be 18 to 24
- nucleotides in length preferably 20 to 23 nucleotides in length, more preferably 21 to 23 nucleotides in length, in at least one region of the following five regions existing in the GRCh38.pl2 position of human chromosome 6 (Chr 6) :
- the targeting sequence can be continuous 18 to 24 nucleotides in length, preferably 20 to 23 nucleotides in length, more preferably 21 to 23 nucleotides in length, in the regions set forth in SEQ ID NO: 104 present in the above-mentioned region (3) or set forth in SEQ ID NO: 105, 135, 141, 153, 167, or 172 present in the above- mentioned region (4).
- targeting sequence can be the base sequence set forth in SEQ ID NO: 45, 46, 58, 59, 60, 135, 141, 153, 155, 156, 157, 159, 167, or 172.
- the base sequences set forth in SEQ ID NOs: 45 and 46 are targeting sequences comprised in the region set forth in the aforementioned SEQ ID NO: 104, and the base sequences set forth in SEQ ID NOs : 58, 59, 60, 155, 156, 157, and 159 are targeting sequences comprised in the region set forth in the
- sequence encoding crRNA may be the same base sequence as the targeting sequence.
- the targeting sequence set forth in SEQ ID NO: 4 AGAAAAGCGGCCCCTAGGGGC
- RNA transcribed from the sequence is AGAAAAGCGGCCCCUAGGGGC (SEQ ID NO: 119) and is bound to GCCCCTAGGGGCCGCTTTTCT (SEQ ID NO: 120), which is a sequence complementary to the base sequence set forth in SEQ ID NO: 4 and is present in the expression regulatory region of the human UTRN gene.
- a base sequence which is a targeting sequence in which at least 1 to 3 bases are deleted, substituted, inserted and/or added can be used as the base sequence encoding crRNA as long as guide RNA can recruit a fusion protein to the target region.
- a base sequence encoding crRNA as a base sequence encoding crRNA, the base sequence set forth in SEQ ID NO: 45, 46, 58, 59, 60, 135, 141, 153, 155, 156, 157, 159, 167, or 172, or the base sequence set forth in SEQ ID NO: 45, 46, 58, 59, 60,
- the base sequence set forth in SEQ ID NO: 45, 46, 58, 59, 60, 135, 141, 153, 155, 156, 157, 159, 167, or 172 can be used as the base sequence encoding crRNA to produce gRNA comprising crRNA set forth in SEQ ID NO: 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, or 207, respectively.
- the gRNA can comprise the base
- a base sequence encoding gRNA can be designed as a DNA sequence encoding crRNA with particular RNA attached to the 5' -terminal.
- RNA attached to the 5' -terminal of crRNA and a DNA sequence encoding said RNA can be appropriately
- dCpfl a base sequence in which SEQ ID NO: 121; AATTTCTACTGTTGTAGAT is
- the sequence to be added to the 5'- terminal may be a sequence generally used for various Cpfl proteins in which at least 1 to 6 bases are deleted, substituted, inserted and/or added, as long as gRNA can recruit a fusion protein to the expression regulatory region after transcription.
- a base sequence encoding gRNA can be designed as a DNA sequence in which a DNA sequence encoding known tracrRNA is linked to the 3' -terminal of a DNA sequence encoding crRNA.
- tracrRNA and a DNA sequence encoding the tracrRNA can be appropriately
- the DNA sequence encoding tracrRNA may be a base sequence encoding tracrRNA generally used for various Cas9 proteins in which at least 1 to 6 bases are deleted, substituted, inserted and/or added, as long as gRNA can recruit a fusion protein to the expression regulatory region after transcription.
- a polynucleotide comprising a base sequence encoding gRNA designed in this way can be chemically synthesized using a known DNA synthesis method.
- polynucleotide of the present invention may comprise at least two different base sequences encoding a gRNA.
- the polynucleotide can comprise at least two different base
- sequences encoding the guide RNA wherein the at least two different base sequences are selected from a base sequence comprising a sequence set forth in SEQ ID NO: 45, 46, 58, 59, 60, 135, 141, 153, 155, 156, 157, 159, 167, or 172.
- the polynucleotide can comprise at least two different base sequences encoding the guide RNA, wherein the at least two different base sequences are selected from a base sequence comprising the sequence set forth in SEQ ID NO: 45, 46, or 59.
- a promoter sequence may be operably linked to the upstream of each of a base sequence encoding fusion protein of nuclease-deficient
- the promoter to be possibly linked is not particularly limited as long as it shows a promoter activity in the target cell.
- Examples of the promoter sequence possibly linked to the upstream of the base sequence encoding the fusion protein include, but are not limited to, EFS promoter, EF-la promoter, CMV (cytomegalovirus) promoter, CK8 promoter,
- MHC promoter MLC promoter, Des promoter, cTnC promoter, MYOD promoter, hTERT promoter, SRa promoter, SV40 promoter, LTR promoter, CAG promoter, RSV (Rous sarcoma virus) promoter and the like.
- Examples of the promoter sequence possibly linked to the upstream of the base sequence encoding gRNA include, but are not limited to, U6 promoter, SNR6 promoter, SNR52 promoter, SCR1 promoter, RPR1 promoter, U3 promoter, HI promoter, and tRNA promoter, which are pol III promoters, and the like.
- a single promoter sequence may be operably linked to the upstream of the two or more base sequences.
- a promoter sequence may be operably linked to the upstream of each of the two or more base sequences, wherein the promoter sequence operably linked to each base sequence may be the same or different.
- a muscle specific promoter can be used as the promoter sequence linked to the upstream of a base sequence encoding the aforementioned fusion protein.
- the muscle specific promoter include, but are not limited to, CK8 promoter, CK6 promoter, CK1 promoter, CK7 promoter, CK9 promoter, cardiac muscle troponin C promoter, a actin promoter, myosin heavy chain kinase (MHCK) promoter, myosin light chain 2A promoter, dystrophin promoter, muscle creatin kinase promoter, dMCK promoter, tMCK promoter, enh348 MCK promoter, synthetic C5-12 (Syn) promoter, Myf5 promoter, MLCl/3f promoter, MYOD promoter, Myog promoter, Pax7 promoter, Des promoter and the like (for the detail of the muscle specific promoter, see, for example, US2011/0212529A, McCarthy JJ et al.
- U6 promoter can be used as the promoter sequence for the base sequence encoding the gRNA
- CK8 promoter can be used as the promoter sequence for the base sequence encoding the fusion protein.
- the following base sequences can be used; (i) the base sequence set forth in SEQ ID NO: 128, (ii) a base sequence set forth in SEQ ID NO: 128 wherein 1 or several (e.g., 2, 3, 4, 5 or more) bases are deleted, substituted, inserted and/or added with a promoter activity in the target cell, or (iii) a base sequence not less than 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or above) identical with the base sequence set forth in SEQ ID NO: 128 showing a promoter activity in the target cell.
- a base sequence not less than 90% e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or above
- the following base sequences can be used; (i) the base sequence set forth in SEQ ID NO: 191, (ii) a base sequence set forth in SEQ ID NO: 191 wherein 1 or several (e.g., 2, 3, 4, 5 or more) bases are deleted, substituted, inserted and/or added with a promoter activity in the target cell, or (iii) a base sequence not less than 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or above) identical with the base sequence set forth in SEQ ID NO: 191 showing a promoter activity in the target cell.
- a base sequence not less than 90% e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or above
- polynucleotide of the present invention may further comprise known sequences such as Polyadenylation (polyA) signal, Kozak consensus sequence and the like besides those mentioned above for the purpose of improving the polynucleotide of the present invention
- Polyadenylation signal in the present invention may include hGH polyA, bGH polyA, 2x sNRP-1 polyA (see US7557197B2, which is incorporated herein by reference in its entirety) , and so on.
- the polynucleotide of the present invention may comprise a base sequence encoding a linker sequence, a base sequence encoding NLS and/or a base sequence encoding a tag. (7) Exemplified embodiments of the present invention In one embodiment of the present invention, a
- polynucleotide comprising:
- a base sequence encoding a fusion protein of a nuclease- deficient CRISPR effector protein and a transcription activator
- a promoter sequence for the base sequence encoding the fusion protein of the nuclease-deficient CRISPR effector protein and the transcription activator
- one or two base sequences encoding a guide RNA wherein the one or two base sequences are selected from a base sequence comprising a sequence set forth in SEQ ID NO: 45, 46, or 59, or the base sequence comprising a sequence set forth in SEQ ID NO: 45, 46, or 59 in which 1 to 3 bases are deleted, substituted, inserted, and/or added, and
- nuclease-deficient CRISPR effector protein is dSaCas9 or dSaCas9 [-25] ,
- transcription activator is selected from the group VP64, VPH, VPR, miniVR, and microVR, and
- the promoter sequence for the base sequence encoding the fusion protein is selected from the group EF-la promoter, EFS promoter, and CK8 promoter.
- the polynucleotide may further comprise hGH polyA, bGH polyA or 2x sNRP-1 polyA.
- polynucleotide comprising:
- CK8 promoter for the base sequence encoding the fusion protein of the nuclease-deficient CRISPR effector protein and the transcription activator
- one or two base sequences encoding a guide RNA wherein the one or two base sequences are selected from a base sequence comprising a sequence set forth in SEQ ID NO: 45, 46, or 59, or a base sequence comprising a sequence set forth in SEQ ID NO: 45, 46, or 59 in which 1 to 3 bases are deleted, substituted,
- nuclease-deficient CRISPR effector protein is dSaCas9 or dSaCas9 [-25] , and
- the polynucleotide may further comprise bGH polyA or 2x sNRP-1 polyA.
- polynucleotide comprising:
- CK8 promoter for the base sequence encoding the fusion protein of the nuclease-deficient CRISPR effector protein and the transcription activator
- one or two base sequences encoding a guide RNA wherein the one or two base sequences are selected from a base sequence comprising a sequence set forth in SEQ ID NO: 45, 46, or 59, or a base sequence comprising a sequence set forth in SEQ ID NO: 45, 46, or 59 in which 1 to 3 bases are deleted, substituted,
- nuclease-deficient CRISPR effector protein is dSaCas9
- transcription activator is miniVR.
- the polynucleotide may further comprise bGH polyA or 2x sNRP-1 polyA.
- polynucleotide comprising:
- CK8 promoter for the base sequence encoding the fusion protein of the nuclease-deficient CRISPR effector protein and the transcription activator
- one or two base sequences encoding a guide RNA wherein the one or two base sequences are selected from a base sequence comprising a sequence set forth in SEQ ID NO: 45, 46, or 59, or a base sequence comprising a sequence set forth in SEQ ID NO: 45, 46, or 59 in which 1 to 3 bases are deleted, substituted,
- nuclease-deficient CRISPR effector protein is dSaCas9
- transcription activator is microVR
- the polynucleotide may further comprise bGH polyA or 2x sNRP-1 polyA.
- polynucleotide comprising:
- CK8 promoter for the base sequence encoding the fusion protein of the nuclease-deficient CRISPR effector protein and the transcription activator
- a base sequence encoding a guide RNA comprising the base sequence set forth in SEQ ID NO: 59, or the base sequence set forth in SEQ ID NO: 59 in which 1 to 3 bases are deleted,
- nuclease-deficient CRISPR effector protein is dSaCas9
- transcription activator is miniVR.
- the polynucleotide may further comprise 2x sNRP-1 polyA.
- polynucleotide comprising: a base sequence encoding a fusion protein of a nuclease- deficient CRISPR effector protein and a transcription activator, CK8 promoter for the base sequence encoding the fusion protein of the nuclease-deficient CRISPR effector protein and the transcription activator,
- a base sequence encoding a guide RNA comprising the base sequence set forth in SEQ ID NO: 59, or the base sequence set forth in SEQ ID NO: 59 in which 1 to 3 bases are deleted, substituted, inserted, and/or added, and
- nuclease-deficient CRISPR effector protein is dSaCas9
- transcription activator is microVR
- the polynucleotide may further comprise 2x sNRP-1 polyA.
- the polynucleotide comprises in order from the 5' end (i) the base sequence encoding the fusion protein of the
- the polynucleotide comprises in order from the 5' end (ii) the base sequence encoding the gRNA and (i) the base sequence encoding the fusion protein of the nuclease- deficient CRISPR effector protein and the transcription activator and (ii) the base sequence encoding the gRNA.
- the polynucleotide comprises in order from the 5' end (ii) the base sequence encoding the gRNA and (i) the base sequence encoding the fusion protein of the nuclease- deficient CRISPR effector protein and the transcription
- the present invention provides a vector comprising the polynucleotide of the present invention (hereinafter sometimes referred to as "the vector of the present invention") .
- the vector of the present invention may be a plasmid vector or a viral vector.
- the plasmid vector to be used is not particularly limited and may be any plasmid vector such as cloning plasmid vector and expression plasmid vector.
- the plasmid vector is prepared by inserting the polynucleotide of the present
- the viral vector to be used is not particularly limited and examples thereof include, but are not limited to, adenovirus vector, adeno-associated virus (AAV) vector, lentivirus vector, retrovirus vector, Sendaivirus vector and the like.
- AAV vector adeno-associated virus
- lentivirus vector lentivirus vector
- retrovirus vector Sendaivirus vector
- Sendaivirus vector Sendaivirus vector
- the "virus vector” or “viral vector” also includes derivatives thereof.
- AAV vector is preferably used for the reasons such that it can express transgene for a long time, and it is derived from a non-pathogenic virus and has high safety.
- a viral vector comprising the polynucleotide of the
- present invention can be prepared by a known method.
- the vector is transfected into an appropriate host cell to allow for transient production of a viral vector
- the serotype of the AAV vector is not
- AAVl particularly limited as long as expression of the human UTRN gene in the target can be activated, and any of AAVl, AAV2, AAV3, AAV4 , AAV5, AAV6, AAV7 , AAV8 , AAV9, AAVrh.lO and the like may be used (for the various serotypes of AAV, see, for example, WO 2005/033321 and EP2341068 (Al) , which are incorporated herein by reference in their entireties) .
- variants of AAV include, but are not limited to, new serotype with a modified capsid (e.g. , WO 2012/057363, which is incorporated herein by reference in its entirety) and the like.
- a new serotype with a modified capsid improving infectivity for muscle cells can be used, such as AAV587MTP, AAVsesMTP, AAV-Bl, AAVM41, AAVS1_P1, and AAVS10_P1, and the like (see Yu et al., Gene Ther. 2009
- an AAV vector When an AAV vector is prepared, a known method such as (1) a method using a plasmid, (2) a method using a baculovirus, (3) a method using a herpes simplex virus, (4) a method using an adenovirus, or (5) a method using yeast can be used (e.g. , Appl Microbiol Biotechnol. 2018; 102(3): 1045-1054, etc., which is incorporated herein by reference in its entirety).
- a known method such as (1) a method using a plasmid, (2) a method using a baculovirus, (3) a method using a herpes simplex virus, (4) a method using an adenovirus, or (5) a method using yeast can be used (e.g. , Appl Microbiol Biotechnol. 2018; 102(3): 1045-1054, etc., which is incorporated herein by reference in its entirety).
- an AAV vector is prepared by a method using a plasmid
- a vector plasmid comprising inverted terminal repeat (ITR) at both ends of wild-type AAV genomic sequence and the polynucleotide of the present invention inserted in place of the DNA encoding Rep protein and capsid protein is prepared.
- ITR inverted terminal repeat
- the DNA encoding Rep protein and capsid protein necessary for forming virus particles are inserted into other plasmids.
- a plasmid comprising genes (E1A, E1B,
- adenovirus necessary for proliferation of AAV is prepared as an adenovirus helper plasmid.
- the co-transfection of these three kinds of plasmids into the host cell causes the production of recombinant AAV (i.e., AAV vector) in the cell.
- AAV vector a cell capable of supplying a part of the gene products (proteins) of the genes responsible for the aforementioned helper action ⁇ e.g., 293 cell, etc.) is preferably used. When such cell is used, it is not necessary to carry the gene
- AAV vector encoding a protein that can be supplied from the host cell in the aforementioned adenoviral helper plasmid.
- the produced AAV vector is present in the nucleus.
- a desired AAV vector is prepared by destroying the host cell with freeze-thawing, collecting the virus and then subjecting the virus fraction to separation and purification by density gradient
- AAV vector has great advantages in terms of safety, gene transduction efficiency and the like, and is used for gene therapy.
- the size of a polynucleotide that can be packaged in AAV vector is limited.
- the entire length including the base length of a polynucleotide comprising a base sequence encoding a fusion protein of dSaCas9 and miniVR or microVR, a base sequence encoding gRNA targeting the expression regulatory region of the human UTRN gene, and EFS promoter sequence or CK8 promoter sequence and U6 promoter sequence as the promoter sequences, and ITR parts is about 4.85 kb, and they can be packaged in a single AAV vector.
- the present invention also provides a pharmaceutical composition comprising the polynucleotide of the present invention or the vector of the present invention (hereinafter sometimes referred to as "the pharmaceutical composition of the present invention") .
- the pharmaceutical composition of the present invention can be used for treating or preventing DMD or BMD.
- the pharmaceutical composition of the present invention comprises the polynucleotide of the present invention or the vector of the present invention as an active ingredient, and may be prepared as a formulation comprising such active ingredient (i.e., the polynucleotide of the present invention or the vector of the present invention) and, generally, a pharmaceutically acceptable carrier.
- the pharmaceutical composition of the present invention is administered parenterally, and may be administered topically or systemically .
- the pharmaceutical composition of the present invention can be administered by, but are not limited to, for example, intravenous administration, intraarterial
- administration subcutaneous administration, intraperitoneal administration, or intramuscular administration.
- the dose of the pharmaceutical composition of the present invention to a subject is not particularly limited as long as it is an effective amount for the treatment and/or prevention. It may be appropriately optimized according to the active
- treatment in the present specification also includes remission of disease, in addition to the cure of diseases.
- prevention may also include delaying the onset of disease, in addition to prophylaxis of the onset of disease.
- composition of the present invention can also be referred to as "the agent of the present invention” or the like. 4.
- the present invention also provides a method for treating or preventing DMD or BMD, comprising administering the
- the present invention includes the polynucleotide of the present invention or the vector of the present invention for use in the treatment or prevention of DMD or BMD.
- the present invention includes use of the
- polynucleotide of the present invention or the vector of the present invention in the manufacture of a pharmaceutical
- composition for the treatment or prevention of DMD or BMD comprising
- the method of the present invention can be practiced by administering the aforementioned pharmaceutical composition of the present invention to a subject affected with DMD or BMD, and the dose, administration route, subject and the like are the same as those mentioned above.
- Measurement of the symptoms may be performed before the start of the treatment using the method of the present invention and at any timing after the treatment to determine the response of the subject to the treatment.
- the method of the present invention can improve the functions of the skeletal muscle and/or cardiac muscle of the subject.
- Muscles to be improved in the function thereof are not particularly limited, and any muscles and muscle groups are exemplified.
- the present invention provides a ribonucleoprotein
- RNP of the present invention comprising the following (hereinafter sometimes referred to as "RNP of the present invention") :
- a guide RNA targeting a continuous region of 18 to 24 nucleotides in length in a region set forth in SEQ ID NO: 104, 105, 135, 141, 153, 167, or 172 in the expression regulatory region of human Utrophin gene.
- the nuclease-deficient CRISPR effector protein, transcription activator, and guide RNA comprised in the RNP of the present invention, the nuclease-deficient CRISPR effector protein, transcription activator, and guide RNA explained in detail in the above-mentioned section of "1. Polynucleotide" can be used.
- the fusion protein of nuclease-deficient CRISPR can be used.
- effector protein and transcription activator to be comprised in the RNP of the present invention can be produced by, for example, introducing a polynucleotide encoding the fusion protein into the cell, bacterium, or other organism to allow for the
- guide RNA comprised in the RNP of the present invention can be produced by, for example, chemical synthesis or an in vitro transcription system by using a
- the RNP may be encapsulated in a lipid nanoparticle (LNP) by a known method.
- LNP lipid nanoparticle
- the RNP of the present invention can be introduced into the target cell, tissue and the like by a known method.
- Lee K., et al., Nat Biomed Eng. 2017; 1:889-901, WO 2016/153012, which are incorporated herein by reference in their entireties, and the like can be referred to for encapsulation in LNP and introduction method.
- the guide RNA comprised in RNP of the present invention targets continuous 18 to 24 nucleotides in length, preferably 20 to 23 nucleotides in length, more preferably 21 to 23 nucleotides in length, in at least one region of the following five regions existing in the GRCh38.pl2 position of human chromosome 6 (Chr 6) :
- the guide RNA targets a base sequence of continuous 18 to 24 nucleotides in length, preferably 20 to 23 nucleotides in length, more preferably 21 to 23 nucleotides in length, in the DNA sequence set forth in SEQ ID NO: 104, 105, 135, 141, 153, 167, or 172. In one embodiment, the guide RNA targets a region comprising all or a part of the sequence set forth in SEQ ID NO: 45, 46, 58, 59, 60, 135, 141, 153, 155, 156, 157, 159, 167, or 172. In one embodiment of the present
- the guide RNA comprising crRNA set forth in SEQ ID NO: 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, or 207, or the base sequence set forth in SEQ ID NO: 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, or 207 in which 1 to 3 bases are deleted, substituted, inserted, and/or added respectively can be used. 6. Others
- the present invention also provides a composition or kit comprising the following for activation of the expression of the human Utrophin gene:
- the present invention also provides a method for treating or preventing DUCHENNE muscular dystrophy or BECKER muscular dystrophy, comprising administering the following (e) and (f) :
- the present invention also provides use of the following
- nuclease-deficient CRISPR effector protein transcription activator, guide RNA, as well as polynucleotides encoding them and vectors in which they are carried in these inventions, those explained in detail in the above-mentioned sections of "1. Polynucleotide”, “2. Vector” and “5.
- Ribonucleoprotein can be used.
- the dose, administration route, subject, formulation and the like of the above-mentioned (e) and (f) are the same as those explained in the section of "3.
- Treating or preventing agent for DMD or BMD Treating or preventing agent for DMD or BMD.
- the examples describe the use of a fusion protein of dCas9 with a transcriptional activator to enhance gene expression, in the defined expression regulatory region of human UTRN gene that leads to the selective activation of human UTRN gene expression.
- the goal of the modification of the gene expression is to enhance the expression of wild-type human UTRN gene products that complements the function of a defective dystrophin gene product.
- the example also describes the definition of a specific genomic region that confers selective activation of the human UTRN gene without minimally affecting the expression of other genes.
- the method of the present invention to enhance human UTRN gene expression represents a novel therapeutic or
- Example 1 Screening of gRNAs for human utrophin gene using HEK293FT cells
- the methods leverage the property of a complex of Cas9 and sgRNA to be recruited to a desired locus of the genome by designing an appropriate sgRNA sequence.
- the methods also leverage the nuclease-deficient form of the SaCas9 protein (D10A and N580A mutant (SEQ ID NO: 107), or D10A and H557A mutant (SEQ ID NO: 108); dSaCas9) to leave the genomic sequence intact, but tether various transcriptional/epigenetic functional domains or motifs to dSaCas9 to achieve desired modifications of the intended loci targeted by the sgRNA sequence, as described in Gilbert LA et al., Cell 2013 Jul; 154 (2 ): 442-51, and Gilbert LA et al., Cell 2014 Oct; 159 (3) : 647-61, which are incorporated herein by reference in their entireties.
- sgRNAs were designed to target the expression regulatory region of the UTRN gene that confers selective and effective gene activation.
- Figure 1 shows the human UTRN locus and two
- TSSs predicted transcript start sites (top and middle) .
- the TSSs of UTRN gene were identified by querying FANT0M5 human pfomoterome data base (www. fantom. gsc. riken. jp, Nature 2014 Mar; 507 (7493) : 462-70, which are incorporated herein by reference in their entireties) .
- FANT0M5 human pfomoterome data base www. fantom. gsc. riken. jp, Nature 2014 Mar; 507 (7493) : 462-70, which are incorporated herein by reference in their entireties
- There are two promoter regions reported for UTRN gene Promoter A and B
- Guide RNA sequences were designed to cover the regions above in order to determine the effective and selective therapeutic sequences within these regions.
- 144,342,683-144,345,311) were scanned for potential recognition sequences where a complex of dSaCas9 and sgRNA would bind.
- the regions were scanned for protospacer adjacent motifs (PAMs) having the sequence NNGRRT.
- PAMs protospacer adjacent motifs
- Targeting sequences adjacent to the PAMs were identified.
- the length of the targeting sequences (a portion of gRNA which hybridizes to the target DNA) was set to be 21 nucleotides.
- the targeting sequences were selected based on predicted specificity and efficiency generated by Benchling software (https : //benchling . com) , and to be evenly distributed across the selected region.
- Epigenetic information around the UTRN expression regulatory region from ENCODE study (The ENCODE Project Consortium, Nature. 2012 Sep; 489: 57-74, which is incorporated herein by reference in its entirety) was also referenced to select gRNAs with high likelihood of binding to a functional element of the
- the location of the targeting sequences in the UTRN gene is also shown in Figure 1 (top and middle) .
- the selected 24 targeting sequences and a control non- targeting targeting sequence were fused with the DNA sequence coding the tracr RNA (SEQ ID NO: 122)
- sgRNA sequences were cloned into pCRISPR-LvSG03 vector (# pCRISPR-LvSG03) from Genecopoeia.
- the obtained vector denotes pCRISPR-LvSG03 sgRNA expressing vector in this specification.
- the sgRNA expression was driven by the U6 promoter, and the vector expressed mCherry-IRES-Puromycin gene under the SV40 promoter to facilitate the tracking and selection of the sgRNA expressing cells.
- Nuclease-deficient SaCas9 protein (D10A and N580A, or D10A and H557A; dSaCas9) serves as a main scaffold to tether
- dSaCas9 was attached with two nuclear localization signal (NLS) in its N-terminus (amino acid sequence shown by SEQ ID NO: 178, DNA sequence shown by SEQ ID NO: 179) and C-terminus (amino acid sequence shown by SEQ ID NO: 180, DNA sequence shown by SEQ ID NO: 181) to enable efficient localization of the effector molecules to the nucleus.
- NLS nuclear localization signal
- DNA sequence encoding dSaCas9 with D10A and N580A mutations was fused with DNA sequence encoding VP64,
- VPH or VPR which are the synthetic amino acid transcriptional activation moieties (see Chavez A et al., Nat Methods. 2016 Jul; 13(7): 563-67 and Chavez A et al . , Nat Methods. 2015 Apr;
- the obtained fusion protein denotes dSaCas9-VP64 , dSaCas9-VPH, or dSaCas9-VPR fusion protein respectively in this specification.
- the fusion protein is recruited to the expression
- DNA sequence encoding dSaCas9 protein lacking amino acids 721-745 was fused with DNA sequence encoding a synthetic amino acid
- miniVR transcriptional activator, miniVR (see PCT/JP2019/030972, which is incorporated herein by reference in its entirety) , to its C- terminus (SEQ ID NO: 185) .
- the obtained fusion protein denotes dSaCas9 [-25] -miniVR fusion protein (SEQ ID NO: 186) in this specification.
- CP- LvC9NU-09 lentivirus expressing vector Cat. # CP-LvC9NU-09
- the Cas9 coding sequence in the original vector was replaced with the fusion protein coding sequences, resulting in the generation of CP-LvC9NU-09 lentivirus
- expressing vector comprising a DNA fragment encoding the one of the four fusion proteins; dSaCas9-VP64, dSaCas9-VPH, dSaCas9-VPR or dSaCas9 [-25] -miniVR.
- the resulting vectors denote CP-LvdSaCas9-VP64-09, CP-LvdSaCas9-VPH-09, CP- LvdSaCas9-VPR-09, or CP-LvdSaCas9 [-25] -miniVR-09 plasmids, respectively.
- the vector uses EFla promoter for the expression of the effector molecules, and SV40 promoter to express eGFP- IRES-Neomycin gene.
- a DNA fragment encoding the dSaCas9 [-25] -miniVR fusion protein, U6 promoter, and the sgRNA were cloned into pAAV-CMV vector (#6234) from Takara.
- the CMV promoter was replaced with EFS promoter (SEQ ID NO: 187) .
- Beta-globin intron was removed from the original vector and hGH poly-A was replaced with bovine GH polyA (bGH polyA) .
- the obtained vector comprises ITR, EFS promoter, dCas9, miniVR, bGH polyA, U6 promoter, sgRNA, and ITR, in order from its 5' end to its 3' end ( Figure 5), and denotes pAAV-EFS- dSaCas9 [-25] -miniVR-U6-sgRNA AIO plasmid in this specification.
- HEK293FT cells (Thermo Fisher # R70007) were seeded 24 hours prior to transfection in 24-well plates (CORNING # 351147) at a density of 75,000 cells per well and cultured in DMEM media supplemented with 10% FBS and 2 mM fresh L-glutamine, 1 mM sodium pyruvate and non-essential amino acids (Thermo Fisher # 11140050) .
- cells were transfected with 500 ng of CP-LvdSaCas9-VP64-09, CP- LvdSaCas9-VPH-09, CP-LvdSaCas9-VPR-09, or CP-LvdSaCas9 [-25] - miniVR-09 plasmids, and 500 ng of the pCRISPR-LvSG03 sgRNA expressing vector using 1.5 m ⁇ of Lipofectamine 2000 (Life technologies # 11668019), according to manufacturer's
- transfected cells were selected with puromycin (1 pg/ml) .
- puromycin (1 pg/ml)
- cells were transfected with 500 ng of pAAV-EFS-dSaCas9 [-25] - miniVR-U6-sgRNA AIO plasmid using 1.5 m ⁇ of Lipofectamine 2000 (Life technologies # 11668019), according to manufacturer ' s instructions.
- the transfected cells were not selected with puromycin.
- the transfected cells were cultured at 37 °C with 5% CO2 and harvested at 72h after
- RNA-to-cDNA Kit 1.5 pg of total RNA was used to generate cDNA using TaqManTM High-Capacity RNA-to-cDNA Kit
- Taqman primers and probes for the UTRN and HPRT gene were obtained from Applied Biosystems. Taqman
- reaction was run using Taqman gene expression master mix (Thermo Fisher # 4369016) in Roche LightCycler 96 or LightCycler 480 and analyzed using LightCycler 96 analysis software.
- the expression level of UTRN gene was normalized by the expression level of HPRT gene.
- Step 3 60 °C for 30 sec
- AAV Adeno-associated virus
- Adeno-associated virus serotype 2 (AAV2) particles were generated using AAVpro 293T cells (Takara # 632273) seeded at a density of 9,000,000 cells per dish in 150 mm dishes (Corning) and cultured in DMEM media supplemented with 10% FBS, 2 mM fresh L-glutamine, 1 mM sodium pyruvate and non-essential amino acids (Thermo Fisher # 11140050).
- Cells were transfected with 14.85 pg of pRC2-mi342 and pHelper vectors (Takara # 6234) and 14.85 pg of pAAV-EFS-dsaCas9 [-25] -miniVR-U6-sgRNA AIO plasmid with 81 m ⁇ TransIT-VirusGen (Mirus Bio # MIR6703) .
- After 72 h, cells were harvested and crude AAV2 extracted in 550 m ⁇ per 150 mm dish according to the manufacturer' s instructions in the AAV2 Helper Free System protocol (Takara # 6230) .
- Figure 1 shows the activation of UTRN gene expression by the three different dSaCas9-activator fusion proteins (dSaCas9- VP64, dSaCas9-VPH, and dSaCas9-VPR) compared to the control sgRNA.
- the control sgRNA comprises ACGGAGGCUAAGCGUCGCAAG (SEQ ID NO: 215) and the tracrRNA sequence, and was designed as it has no targets on any sequences in the human genome.
- the sgRNAs comprising crRNA encoded by Guide # sgED3-6, sgED3-7, or sgED3- 13 (SEQ ID NOs : 134, 135 or 141) respectively activated UTRN gene expression by recruiting dSaCas9-activator fusion proteins to expression regulatory region of UTRN gene.
- the activation effect was the strongest with dSaCas9-VPR fusion protein.
- the promoter B confers relatively weak activation of UTRN gene compared with crRNA encoded by Guide # sgED3-6, sgED3-7, and sgED3-13 (SEQ ID NOs: 134, 135 and 141) .
- the sgRNAs comprising crRNA encoded by Guide # sgED3-6, sgED3-13, sgED3-25 to sgED3-32, sgED3-39, sgED3-40 and sgED3-44 (SEQ ID NOs: 134, 141, 153 to 160, 167, 168 and 172), respectively, activated UTRN gene expression more than two fold compared to the
- AAV2 carrying EFS-dSaCas9 [-25] -miniVR-U6- sgRNA were produced, and transduced HEK293FT cells.
- sgRNA sgRNAs comprising crRNA encoded by Guide # sgED3-6, sgED3-30, or sgED3-31 (SEQ ID NO: 134, 158, or 159), respectively, were used.
- UTRN gene induction was observed, compared to the aforementioned control sgRNA, regarding all the three sgRNAs.
- Example 2 Screening of gRNAs for human utrophin gene using HSMM cells
- Targeting sequences were specified by the 21-nucleotide segment adjacent to a protospacer adjacent motif (PAM) having the sequence NNGRRT (5'-21nt targeting sequence-NNGRRT-3' ) , and were filtered to include mostly those with a perfect match
- PAM protospacer adjacent motif
- the SpCas9 gRNA scaffold sequence was replaced by SaCas9 gRNA scaffold sequence (SEQ ID NO: 124); SpCas9 was replaced with dSaCas9 fused to codon optimized VP64-miniRTA (also
- miniVR [SEQ ID NO: 125 (DNA) and 126 (Protein) ] .
- MiniVR transcriptional activation domains can activate gene expression by activating transcription.
- MiniVR was tethered to the C-terminus of dSaCas9 (D10A and N580A mutant) , which is referred to as dSaCas9-miniVR hereinafter (SEQ ID NO: 192 (DNA) and 193 (Protein) ) , and targeted to the putative enhancer or promoter regions of the human UTRN gene as directed by gRNA comprising crRNA encoded by each targeting sequence ( Figure 6) .
- the generated backbone plasmid was named pEDl76.
- NEB Stable Competent cells (NEB # C3040I) according to the
- sgRNAs comprising crRNA encoded by individual targeting sequences fused to their 3' end with tracrRNA
- Lentivirus Generation HEK293TA cells (Genecopoeia # LT008) were seeded at 0.75 x 10 6 cells/well in 6 well cell culture dishes (VWR # 10062-892) in 2 ml growth medium (DMEM media supplemented with 10% FBS and 2 mM fresh L-glutamine, 1 mM sodium pyruvate and non-essential amino acids (Thermo Fisher # 11140050) ) and incubated at 37°C/5% CO2 for 24 hours.
- DMEM media supplemented with 10% FBS and 2 mM fresh L-glutamine, 1 mM sodium pyruvate and non-essential amino acids (Thermo Fisher # 11140050)
- TransIT-VirusGEN transfection reactions (Mirus Bio # MIR6700) were set up according to manufacturer's protocol with 1.5 pg packaging plasmid mix [1 pg packaging plasmid (see pCMV delta R8.2; addgene # 12263) and 0.5 pg envelope expression plasmid (see pCMV-VSV-G; addgene # 8454)] and 1 pg of transfer plasmid containing sequence encoding dSaCas9-miniVR and indicated sgRNAs .
- Lentivirus was harvested 48 hours following transfection by passing media supernatant through a 0.45 pm PES filter (VWR # 10218-488). Until ready to use, the purified and aliquoted lentiviruses were stored in - 80°C freezer.
- HSMM Primary skeletal muscle myoblast cells
- the cells were cultured in primary skeletal muscle cell growth medium [SkGMTM-2 Skeletal Muscle Growth BulletKit medium (# CC-3245), which contains Culture system containing SkBMTM-2 Basal Medium (# CC-3246) and SkGMTM-2 SingleQuotsTM supplements (# CC-3244) required for growth of skeletal muscle myoblasts)] from Lonza.
- CC-3246 contains 1 x SkBMTM-2 Basal Medium, 500 mL.
- l x SkGMTM-2 SingleQuotsTM Supplement Pack (# CC-3244) contains:
- CC-3244 Components of CC-3244 were added to the 500 ml culture medium (# CC-3246), according to manufacturer's instructions.
- cells were seeded at 0.125-0.33 x 10 6 cells/well in 6 well cell culture dishes (VWR # 10062-894) containing growth medium and incubated at 37°C/5% CO2 for 24 hours .
- the next day 1.5 ml growth medium supplemented with 8 pg/ml Polybrene (Sigma # TR-1003-G) and 1.0 ml lentivirus supernatant (see above) corresponding to each sgRNA comprising crRNA encoded by individual targeting sequences (Table 3) fused with tracrRNA was added to each well.
- Lentivirus titrers ranged from 10 8 to 10 9 particles/ml, measured by using Lenti-XTM qRT-PCR Titration Kit (Clontech # 631235) .
- Cells were incubated with lentivirus for 6 hours before viral media were removed and replaced with fresh growth media. 72 hours after transduction, cells were fed selection media [growth media supplemented with 0.5 pg/ml puromycin (Sigma # P8833-100MG) ] . Cells were given fresh selection media every 2-3 days. Following 7-10 days of cells being in selection media, cells were harvested and RNA was extracted with RNeasy 96 kit (Qiagen # 74182) as directed by the manufacturer .
- cDNA was generated from about 0.05-0.8 pg of total RNA according to High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems; Thermo Fisher # 4368813) protocol in a 10 m ⁇ volume. cDNA was diluted 10-fold and analyzed using Taqman Fast Advanced Master Mix (Thermo Fisher # 4444557) according to the manufacturer's protocol. Taqman probes (UTRN: Assay Id Hs01125994_ml FAM; HPRT : Assay Id
- Hs99999909_ml VIC_PL were obtained from Life Technologies.
- Taqman probe-based real-time PCR reactions were processed and analyzed by QuantStudio 5 Real-Time PCR system as directed by Taqman Fast Advanced Master Mix protocol.
- deltaCt values were calculated by subtracting the average Ct values from 3 technical replicates of the UTRN probe from the HPRT probe (Average Ct UTRN - Average Ct HPRT) . Expression values were determined for each sample using the formula 2 ⁇ (deltaCt) .
- Table 3 SEQ ID NOs : 4 through 103 were then normalized to the average of 3 control expression values (Table 3; SEQ ID NOs: 1-3) for each experiment to determine the relative UTRN expression for each sample. Two biological replicates from each screen were analyzed and the average from all the experiments was calculated (Table 3) .
- Lentivirus was produced that deliver expression cassettes for dSaCas9-miniVR and sgRNAs for each targeting sequence to primary HSMM cells from the 5 different donors (Table 2) .
- a majority of the assays were conducted on HSMM cells from donor #3 (Table 2) because of the growth speed of the cells.
- Transduced cells were selected for resistance to puromycin, and UTRN expression was quantitated using the Taqman Assay (Table 3) . Expression values from each sample were normalized to an average of UTRN expression in cells transduced with control sgRNAs
- 5 targeting sequences showed consistent upregulation of UTRN mRNA expression (Guide # 145, 146, 205, 208, and 210 (SEQ ID NOs: 45, 46, 58, 59, and 60)) in HSMM Donor #3 cells. 2 of these sequences namely # 145 (SEQ ID NO: 45) , # 146 (SEQ ID NO: 46) clustered in the enhancer E2 region, whereas the rest 3 namely # 205 (SEQ ID NO: 58), # 208 (SEQ ID NO: 59), and # 210 (SEQ ID NO: 60) clustered in the promoter Pi region.
- Guide # 205, 208, and 210 are same as # sgED3-6, sgED3-30, and sgED3-32 in Example 1 respectively.
- all the tested plasmid backbones pED260 (SEQ ID NO: 210), pED261 (SEQ ID NO: 211), and pED263 (SEQ ID NO: 212) contain same base sequence of full-length dSaCas9, CK8 promoter, and U6 promoter, replacing the sequence between ITRs of the pAAV-CMV vector (Takara # 6234) .
- polyA sequence - pED260, pED261 contain miniVR whereas pED263 contains microVR as activator moiety and pED260 has bGH polyA whereas pED261, pED263 have 2x sNRP-1 polyA sequence (SEQ ID NO: 208) .
- Each oligo for sgRNA comprising crRNA coded by the targeting sequences Guide #145, #146, or #208 was cloned into each of these backbones to create all-in-one (AIO) plasmids for testing.
- Each resulting AIO plasmid denotes pAAV-CK8-dSaCas9- miniVR-bGH polyA-U6-sgRNA#145 (pED260-145) , pAAV-CK8-dSaCas9- miniVR-bGH polyA-U6-sgRNA#146 (pED260-146) , pAAV-CK8-dSaCas9- miniVR-bGH polyA-U6-sgRNA#208 (pED260-208) , pAAV-CK8-dSaCas9- miniVR-2x sNRP-1 polyA-U6-sgRNA#145 (pED261-145) , pAAV-CK8- dSaC
- NTgl SEQ ID NO: 1
- NTg2 SEQ ID NO: 2
- HEK293FT cells (Thermo Fisher # R70007) were seeded at 5 x 10 4 cells/well in 24 well cell culture dishes (CORNING # 351147) in 0.5 ml growth medium (DMEM media supplemented with 10% FBS and 2 mM fresh L-glutamine, 1 mM sodium pyruvate and non- essential amino acids (Thermo Fisher # 11140050) ) and incubated at 37°C/5% CO2 for 24 hours.
- DMEM media fetal bovine serum
- FBS fresh L-glutamine
- 1 mM sodium pyruvate and non- essential amino acids Thermo Fisher # 11140050
- lipofectamine-2000 transfection reactions (Thermo Fisher # 11668019) were set up according to manufacturer's protocol with 0.5 pg plasmid containing sequence encoding dSaCas9-miniVR or dSaCas9-microVR and sgRNA comprising the targeting sequence selected in Example 2, i.e. Guide # 145 (SEQ ID NO: 45), # 146 (SEQ ID NO: 46), or # 208 (SEQ ID NO: 59)) (Table 4).
- cDNA was generated from ⁇ 0.5 pg of total RNA according to High-Capacity cDNA Reverse
- Hs99999909_ml VIC_PL Hs99999909_ml VIC_PL
- delta Ct values for each probe were calculated by subtracting the average Ct values from 3 technical replicates for each sample from the average Ct values from 3 technical replicates of the non-targeting guide controls.
- Delta Ct UTRN Average control Ct UTRN - Average sample Ct UTRN.
- Delta Ct HPRT Average control Ct HPRT - Average sample Ct HPRT.
- Delta delta Ct values were then calculated by subtracting delta Ct values of HPRT from delta Ct values of UTRN for each sample.
- deltadeltaCt delta Ct UTRN - delta Ct HPRT.
- Example 4 Generation of recombinant AAV9 carrying dSaCas9, transcription activator and sgRNA
- Adeno-associated virus serotype 9 (AAV9) particles were generated using 293T cells (ATCC CRL-3216) seeded at a density of 0.96 x 10 7 -1.8 x 10 7 cells per T225 flask (Corning) and cultured in DMEM media supplemented with 10% FBS (Thermo Fisher # 11995-065) .
- the pRC9 plasmid was constructed as follows: AAV9 capsid sequence (see JP5054975B) was subcloned into a pRC2-mi342 plasmid (Takara # 6230) replacing with that of AAV2 capsid sequence.
- Cells were transfected with 20 pg of the pRC9 plasmid and pHelper vector (Takara # 6230) and 20 pg of one of 6 kinds of the AIO plasmid which was used in Example 3, pED261-145, pED261-146, pED261-208, pED263-145, pED263-146, or pED263-208, with 180 pi TransIT-293 Transfection Reagent (Mirus Bio #
- AAV9-ED261-145 AAV9-ED261-146, AAV9-ED261-208, AAV9-ED263-145 , AAV9- ED263-146, or AAV9-ED263-208.
- AAV capsid proteins were checked by SDS-PAGE after AAV sample preparation with NuPAGE Sample Reducing Agent,
- Example 5 In-vitro pharmacological evaluation of recombinant AAV9 carrying dSaCas9, transcription activator and sgRNA on utrophin upregulation
- Adeno-associated virus serotype 9 (AAV9) particles were generated using 293T cells (ATCC # CRL-3216) seeded at a density of 4.77 x 10 7 cell/700 mL/Cell Stack 5 flask (Corning) and cultured in DMEM media supplemented with 10% FBS (Hyclone # SH30070.03), 1% MEM (Sigma # M7145) , 1% penicillin/streptomycin (Thermo Fisher # 15070-063), and 2.5% HEPES (Sigma # H0887).
- polyethyleneimine Max (2 mg/mL) (Polysciences # 24765-2) per flask.
- Triton X-100 final 0.2%) (Roche # 10789704001).
- AAV samples went through centrifugation, filtration, concentration, and purification using chromatography (AKTA york 25, GE Healthcare and POROS CaptureSelect AAV Resins column, Thermo Fisher) and ultracentrifugation (Optima XE-90, Beckman Coulter) with CsCl.
- the target fraction was dialyzed, the titer of AAV was measured using AAVpro Titration Kit (for Real Time PCR) (Takara # 6233) .
- AAV9-ED261-145, AAV9-ED261-208 , and AAV9-ED263-208 were obtained.
- Human skeletal muscle myoblasts (HSMM, Lonza # CC-2580, lot# 18TL211617) were seeded into a collagen I-coated 24 well plate (IWAKI # 4820-010) at a density of 100,000 cells per well and cultured in SkGMTM-2 Skeletal Muscle Cell Growth Medium-2 BulletKitTM (Lonza # CC-3245) supplemented with 500 U/mL
- penicillin/streptomycin (Thermo Fisher # 15070063) for 2 days at 37 °C with 5% CO2.
- the media was replaced with differentiation media (DMEM media (Sigma # D6429) supplemented with 2% FBS (GE Healthcare # SH30070.03) and 500 U/mL penicillin/streptomycin) and the cells were cultured for 3 days at 37 °C with 5% CO2.
- differentiation media DMEM media (Sigma # D6429) supplemented with 2% FBS (GE Healthcare # SH30070.03) and 500 U/mL penicillin/streptomycin
- RNA from cells without AAV infection was set as control and shown as AAV (-) .
- RNA was converted to cDNA using SuperscriptTM VILOTM cDNA Synthesis Kit (Thermo Fisher # 11754250) in 20 pL reaction volume.
- the cDNA was diluted 5 fold with water and 2 pL was used for the qPCR.
- the qPCR was run in 10 pL final volume containing Taqman probes for UTRN (Thermo Fisher # Hs01125994_ml, FAM) , HPRT1 (Thermo Fisher #
- Thermo Fisher # 4324018 with QuantStudioTM 12K Flex Real-Time PCR System (Thermo Fisher) .
- the qPCR cycling condition were as follows: 95°C for 10 min followed by 45 cycles of 95°C for 15 seconds and 60°C for 1 min. The data were analyzed with
- QuantStudioTM 12K Flex software (Thermo Fisher) .
- the expression values were analyzed with the standard curve for each gene and the expression level of UTRN gene was normalized to that of HPRT1 gene.
- AAV9-ED261-145, AAV9-ED261-208 , or AAV9-ED263- 208 By applying AAV9-ED261-145, AAV9-ED261-208 , or AAV9-ED263- 208 into HSMM cells, utrophin mRNA upregulation was found, which suggests AAV9 carrying transgenes of dSaCas9, miniVR or microVR, and sgRNA comprising Guide # 145 or #208 has a pharmacological effect on utrophin upregulation in human muscular cells ( Figure 12) .
- HEK293TA cells (Genecopoeia # LT008) were seeded at 0.75 x 10 6 cells/well in 6 well cell culture dishes (VWR # 10062-892) in 2 ml growth medium (DMEM media supplemented with 10% FBS and 2 mM fresh L-glutamine, 1 itiM sodium pyruvate and non-essential amino acids (Thermo Fisher # 11140050)) and incubated at 37°C/5% CO2 for 24 hours.
- DMEM media supplemented with 10% FBS and 2 mM fresh L-glutamine, 1 itiM sodium pyruvate and non-essential amino acids (Thermo Fisher # 11140050)
- TransIT-VirusGEN transfection reactions were set up according to manufacturer's protocol with 1.5 mg packaging plasmid mix [lpg packaging plasmid (see pCMV delta R8.2; addgene # 12263) and 0.5 pg envelope expression plasmid (see pCMV-VSV-G; addgene #8454)] and 1 pg of transfer plasmid containing base sequence encoding dSaCas9-miniVR and sgRNA comprising the targeting sequence selected in Example 2, i.e.
- NTgl non-targeting guide-1 (SEQ ID NO: 1) .
- Lentivirus was harvested 48-72 hours following transfection by ⁇ passing media supernatant through a 0.45 pm PES filter (VWR # 10218-488) . Until ready to use, the purified and aliquoted lentiviruses were stored in -80°C freezer.
- each sgRNA comprising crRNA encoded by individual targeting sequences (Guide # 145 (SEQ ID NO: 45), # 146 (SEQ ID NO: 46), or # 208 (SEQ ID NO:
- NTgl (non-targeting guide-1) guide used as control is ACGGAGGCTAAGCGTCGCAA (SEQ ID NO: 1) .
- RNA libraries were prepared using the NEBNext Ultra RNA Library Prep Kit (Ipswich, MA, USA, NEB # E7530L) according to the manufacturer's protocol. Sequencing libraries were clustered on three lanes of an Illumina HiSeq flow cell and sequenced using a 2X150 Paired End configuration. Resulting raw sequence data (.bcl files) were converted to fastq files and demultiplexed using Illumina' s bcl2fastq 2.17 software, where one mismatch was allowed for index sequence identification. Fastq files were aligned to the human genome assembly GRCh38.pl2 using the STAR aligner. Differential analysis was conducted using DESeq2 and plots were generated with plotly (https://plot.ly) using custom R scripts.
- Genome-wide fold changes in mRNA levels for each guide normalized against a non-targeting guide 1 (NTgl) Each dot represents one gene.
- X-axis shows mean expression levels of the genes.
- Y-axis shows log-2 fold-changes of gene expression relative to the NTgl sample.
- Gene IDs are shown for the genes that are highly upregulated or down- regulated in the experimental samples than in the NTgl sample.
- Different gRNA induces different gene expression changes (Figure 13A: Guide # 145, 13B: Guide # 146, 13C: Guide # 208) .
- Guide # 208 seems to trigger less other gene expression changes while showing good UTRN gene upregulation.
- AAV9-seronegative cynomolgus monkeys male are used in this study.
- One week after acclimatization 0.75 mg/kg/day of prednisolone sodium phosphate (Abeam # abl42456) is orally administered to the cynomolgus monkeys. Dosing starts at 14 days before AAV administration and continues until sacrifice.
- Fibrous Tissue Mini Kit (Qiagen # 74704) from muscle samples, and converted to cDNA using SuperscriptTM VILOTM cDNA Synthesis - Kit (Thermo Fisher # 11754250) .
- the qPCR is run with Taqman probes for UTRN (Thermo Fisher # Mf01126001_ml, FAM) , HPRT1 (Thermo Fisher, # Hs02800695_ml, FAM) , and TaqManTM Universal PCR Master Mix (Thermo Fisher, # 4324018) with QuantStudioTM 12K Flex Real-Time PCR System (Thermo Fisher) .
- the expression level of UTRN gene is normalized to that of HPRT1 gene.
- whole muscle lysate is prepared with RIPA buffer (Millipore # 20-188) containing protease and phosphatase inhibitor cocktail (Thermo Fisher # 78441) and applied for SDS-PAGE and Western blot.
- Utrophin protein is detected using primary antibody for utrophin
- the expression of UTRN gene in human cells can be activated.
- the present invention the expression of UTRN gene in human cells can be activated.
- invention is expected to be extremely useful for the treatment and/or prevention of DMD and BMD.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biomedical Technology (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Medicinal Chemistry (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Gastroenterology & Hepatology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Toxicology (AREA)
- Pharmacology & Pharmacy (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Virology (AREA)
- General Chemical & Material Sciences (AREA)
- Physical Education & Sports Medicine (AREA)
- Orthopedic Medicine & Surgery (AREA)
- Neurology (AREA)
- Epidemiology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Crystallography & Structural Chemistry (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Enzymes And Modification Thereof (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
Priority Applications (14)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| AU2019381460A AU2019381460A1 (en) | 2018-11-16 | 2019-11-15 | Method for treating muscular dystrophy by targeting Utrophin gene |
| IL283123A IL283123B2 (en) | 2018-11-16 | 2019-11-15 | A method for treating muscular dystrophy by targeting the otropin gene |
| KR1020217018333A KR102931423B1 (ko) | 2018-11-16 | 2019-11-15 | 유트로핀 유전자를 표적으로 하는 근이영양증의 치료 방법 |
| CN201980075173.0A CN113271982B (zh) | 2018-11-16 | 2019-11-15 | 通过靶向肌营养相关蛋白基因来治疗肌营养不良的方法 |
| MX2021005720A MX2021005720A (es) | 2018-11-16 | 2019-11-15 | Metodo para tratar la distrofia muscular mediante el direccionamiento del gen de utrofina. |
| BR112021009481-4A BR112021009481A2 (pt) | 2018-11-16 | 2019-11-15 | método para tratamento da distrofia muscular direcionando gene de utrofina. |
| JP2021551108A JP7069426B2 (ja) | 2018-11-16 | 2019-11-15 | ユートロフィン遺伝子を標的とした筋ジストロフィーの治療方法 |
| EP19824401.4A EP3880255A1 (en) | 2018-11-16 | 2019-11-15 | Method for treating muscular dystrophy by targeting utrophin gene |
| SG11202105030VA SG11202105030VA (en) | 2018-11-16 | 2019-11-15 | Method for treating muscular dystrophy by targeting utrophin gene |
| CA3119618A CA3119618A1 (en) | 2018-11-16 | 2019-11-15 | Method for treating muscular dystrophy by targeting utrophin gene |
| PH12021551122A PH12021551122A1 (en) | 2018-11-16 | 2021-05-11 | Method for treating muscular dystrophy by targeting utrophin gene |
| US17/320,643 US11473071B2 (en) | 2018-11-16 | 2021-05-14 | Method for treating muscular dystrophy by targeting utrophin gene |
| CONC2021/0006957A CO2021006957A2 (es) | 2018-11-16 | 2021-05-26 | Método para el tratamiento de la distrofia muscular mediante el gen de utrofina |
| JP2022076261A JP2022115976A (ja) | 2018-11-16 | 2022-05-02 | ユートロフィン遺伝子を標的とした筋ジストロフィーの治療方法 |
Applications Claiming Priority (6)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201862768474P | 2018-11-16 | 2018-11-16 | |
| US62/768,474 | 2018-11-16 | ||
| US201962861039P | 2019-06-13 | 2019-06-13 | |
| US62/861,039 | 2019-06-13 | ||
| US201962931925P | 2019-11-07 | 2019-11-07 | |
| US62/931,925 | 2019-11-07 |
Related Child Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US17/320,643 Continuation US11473071B2 (en) | 2018-11-16 | 2021-05-14 | Method for treating muscular dystrophy by targeting utrophin gene |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2020101042A1 true WO2020101042A1 (en) | 2020-05-22 |
| WO2020101042A8 WO2020101042A8 (en) | 2020-07-30 |
Family
ID=68988228
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/JP2019/045716 Ceased WO2020101042A1 (en) | 2018-11-16 | 2019-11-15 | Method for treating muscular dystrophy by targeting utrophin gene |
Country Status (15)
| Country | Link |
|---|---|
| US (1) | US11473071B2 (https=) |
| EP (1) | EP3880255A1 (https=) |
| JP (2) | JP7069426B2 (https=) |
| KR (1) | KR102931423B1 (https=) |
| CN (1) | CN113271982B (https=) |
| AU (1) | AU2019381460A1 (https=) |
| BR (1) | BR112021009481A2 (https=) |
| CA (1) | CA3119618A1 (https=) |
| CO (1) | CO2021006957A2 (https=) |
| IL (1) | IL283123B2 (https=) |
| MX (1) | MX2021005720A (https=) |
| PH (1) | PH12021551122A1 (https=) |
| SG (1) | SG11202105030VA (https=) |
| TW (1) | TW202033224A (https=) |
| WO (1) | WO2020101042A1 (https=) |
Cited By (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2021230385A1 (en) | 2020-05-15 | 2021-11-18 | Astellas Pharma Inc. | Method for treating muscular dystrophy by targeting utrophin gene |
| EP3805386A4 (en) * | 2018-06-08 | 2022-03-23 | Modalis Therapeutics Corporation | MODIFIED CAS9 PROTEIN AND USE THEREOF |
| WO2022069598A1 (en) | 2020-09-29 | 2022-04-07 | Genethon | Enhancing utrophin expression in cell by inducing mutations within utrophin regulatory elements and therapeutic use thereof |
| EP3833758A4 (en) * | 2018-08-07 | 2022-05-18 | Modalis Therapeutics Corporation | Novel transcription activator |
| US11434491B2 (en) | 2018-04-19 | 2022-09-06 | The Regents Of The University Of California | Compositions and methods for gene editing |
| WO2022267942A1 (zh) * | 2021-06-22 | 2022-12-29 | 呈诺再生医学科技(珠海横琴新区)有限公司 | 特定空间结构多肽及其在制备iPSC中的应用 |
| WO2023190935A1 (en) * | 2022-03-31 | 2023-10-05 | Modalis Therapeutics Corporation | Method for treating myopathies by targeting titin gene |
| EP4331579A4 (en) * | 2021-04-26 | 2025-04-09 | KSB Tugen Inc. | Composition comprising oxiracetam for preventing or treating muscular disease |
| US12428631B2 (en) | 2016-04-13 | 2025-09-30 | Duke University | CRISPR/Cas9-based repressors for silencing gene targets in vivo and methods of use |
| US12509492B2 (en) | 2018-01-19 | 2025-12-30 | Duke University | Genome engineering with CRISPR-Cas systems in eukaryotes |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR102008496B1 (ko) * | 2013-03-25 | 2019-08-07 | 삼성전자주식회사 | 단일 센서를 이용하여 기구물의 이동 방향 및 속도를 검출하는 방법 및 장치. |
| KR102421411B1 (ko) | 2021-10-29 | 2022-07-18 | 주식회사 케이에스비튜젠 | 옥시라세탐을 포함하는 근이영양증 예방 또는 치료용 조성물 |
| CN116218849B (zh) * | 2023-01-18 | 2024-01-23 | 昆明理工大学 | 针对utrophin激活治疗杜氏肌营养不良的sgRNA和应用 |
Citations (16)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2005033321A2 (en) | 2003-09-30 | 2005-04-14 | The Trustees Of The University Of Pennsylvania | Adeno-associated virus (aav) clades, sequences, vectors containing same, and uses therefor |
| WO2009044383A1 (en) | 2007-10-05 | 2009-04-09 | Consiglio Nazionale Delle Ricerche | Nucleic acid codifying for a utrophin transcription specific regulating protein, protein codified thereby and uses thereof |
| US7557197B2 (en) | 2004-01-28 | 2009-07-07 | Oregon Health & Science University | Human soluble neuropilin-1 primary polyadenylation signal and uses thereof |
| EP2341068A1 (en) | 2001-11-13 | 2011-07-06 | The Trustees of The University of Pennsylvania | A method of detecting and/or identifying adeno-associated virus (AAV) sequences and isolating novel sequences identified thereby |
| US20110212529A1 (en) | 2001-05-24 | 2011-09-01 | David Souza | Muscle-specific expression vectors |
| WO2012057363A1 (ja) | 2010-10-27 | 2012-05-03 | 学校法人自治医科大学 | 神経系細胞への遺伝子導入のためのアデノ随伴ウイルスビリオン |
| WO2013176772A1 (en) | 2012-05-25 | 2013-11-28 | The Regents Of The University Of California | Methods and compositions for rna-directed target dna modification and for rna-directed modulation of transcription |
| WO2014197748A2 (en) * | 2013-06-05 | 2014-12-11 | Duke University | Rna-guided gene editing and gene regulation |
| WO2015018503A1 (en) | 2013-08-05 | 2015-02-12 | Consiglio Nazionale Delle Ricerche | Compositions and methods for treatment of muscular dystrophy |
| WO2016153012A1 (ja) | 2015-03-24 | 2016-09-29 | 協和発酵キリン株式会社 | 核酸含有脂質ナノ粒子 |
| WO2017049407A1 (en) * | 2015-09-23 | 2017-03-30 | UNIVERSITé LAVAL | Modification of the dystrophin gene and uses thereof |
| WO2017139505A2 (en) * | 2016-02-11 | 2017-08-17 | The Regents Of The University Of California | Methods and compositions for modifying a mutant dystrophin gene in a cell's genome |
| WO2018148256A1 (en) * | 2017-02-07 | 2018-08-16 | The Regents Of The University Of California | Gene therapy for haploinsufficiency |
| WO2018169983A1 (en) * | 2017-03-13 | 2018-09-20 | President And Fellows Of Harvard College | Methods of modulating expression of target nucleic acid sequences in a cell |
| WO2018204764A1 (en) * | 2017-05-05 | 2018-11-08 | Camp4 Therapeutics Corporation | Identification and targeted modulation of gene signaling networks |
| WO2019207132A1 (en) | 2018-04-27 | 2019-10-31 | Universität Heidelberg | Modified aav capsid polypeptides for treatment of muscular diseases |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| ATE437944T1 (de) * | 2000-04-28 | 2009-08-15 | Asklepios Biopharmaceutical In | Für das dystrophin-minigen kodierende dna- sequenzen und verfahren zu deren verwendung |
| BR112014028634A2 (pt) * | 2012-05-16 | 2017-06-27 | Rana Therapeutics Inc | composições e métodos para modulação da expressão de utrn |
| US11674128B2 (en) * | 2016-12-12 | 2023-06-13 | Tsinghua University | Engineering of a minimal SaCas9 CRISPR/Cas system for gene editing and transcriptional regulation optimized by enhanced guide RNA |
| WO2019236081A1 (en) * | 2018-06-06 | 2019-12-12 | Salk Institute For Biological Studies | Targeted gene activation using modified guide rna |
-
2019
- 2019-11-15 EP EP19824401.4A patent/EP3880255A1/en active Pending
- 2019-11-15 MX MX2021005720A patent/MX2021005720A/es unknown
- 2019-11-15 AU AU2019381460A patent/AU2019381460A1/en not_active Abandoned
- 2019-11-15 IL IL283123A patent/IL283123B2/en unknown
- 2019-11-15 WO PCT/JP2019/045716 patent/WO2020101042A1/en not_active Ceased
- 2019-11-15 BR BR112021009481-4A patent/BR112021009481A2/pt not_active IP Right Cessation
- 2019-11-15 CN CN201980075173.0A patent/CN113271982B/zh active Active
- 2019-11-15 TW TW108141671A patent/TW202033224A/zh unknown
- 2019-11-15 JP JP2021551108A patent/JP7069426B2/ja active Active
- 2019-11-15 SG SG11202105030VA patent/SG11202105030VA/en unknown
- 2019-11-15 CA CA3119618A patent/CA3119618A1/en active Pending
- 2019-11-15 KR KR1020217018333A patent/KR102931423B1/ko active Active
-
2021
- 2021-05-11 PH PH12021551122A patent/PH12021551122A1/en unknown
- 2021-05-14 US US17/320,643 patent/US11473071B2/en active Active
- 2021-05-26 CO CONC2021/0006957A patent/CO2021006957A2/es unknown
-
2022
- 2022-05-02 JP JP2022076261A patent/JP2022115976A/ja active Pending
Patent Citations (17)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20110212529A1 (en) | 2001-05-24 | 2011-09-01 | David Souza | Muscle-specific expression vectors |
| EP2341068A1 (en) | 2001-11-13 | 2011-07-06 | The Trustees of The University of Pennsylvania | A method of detecting and/or identifying adeno-associated virus (AAV) sequences and isolating novel sequences identified thereby |
| WO2005033321A2 (en) | 2003-09-30 | 2005-04-14 | The Trustees Of The University Of Pennsylvania | Adeno-associated virus (aav) clades, sequences, vectors containing same, and uses therefor |
| JP5054975B2 (ja) | 2003-09-30 | 2012-10-24 | ザ・トラステイーズ・オブ・ザ・ユニバーシテイ・オブ・ペンシルベニア | アデノ随伴ウイルス(aav)の同源系統群、配列、それらを含有するベクターおよびそれらの用途 |
| US7557197B2 (en) | 2004-01-28 | 2009-07-07 | Oregon Health & Science University | Human soluble neuropilin-1 primary polyadenylation signal and uses thereof |
| WO2009044383A1 (en) | 2007-10-05 | 2009-04-09 | Consiglio Nazionale Delle Ricerche | Nucleic acid codifying for a utrophin transcription specific regulating protein, protein codified thereby and uses thereof |
| WO2012057363A1 (ja) | 2010-10-27 | 2012-05-03 | 学校法人自治医科大学 | 神経系細胞への遺伝子導入のためのアデノ随伴ウイルスビリオン |
| WO2013176772A1 (en) | 2012-05-25 | 2013-11-28 | The Regents Of The University Of California | Methods and compositions for rna-directed target dna modification and for rna-directed modulation of transcription |
| WO2014197748A2 (en) * | 2013-06-05 | 2014-12-11 | Duke University | Rna-guided gene editing and gene regulation |
| WO2015018503A1 (en) | 2013-08-05 | 2015-02-12 | Consiglio Nazionale Delle Ricerche | Compositions and methods for treatment of muscular dystrophy |
| WO2016153012A1 (ja) | 2015-03-24 | 2016-09-29 | 協和発酵キリン株式会社 | 核酸含有脂質ナノ粒子 |
| WO2017049407A1 (en) * | 2015-09-23 | 2017-03-30 | UNIVERSITé LAVAL | Modification of the dystrophin gene and uses thereof |
| WO2017139505A2 (en) * | 2016-02-11 | 2017-08-17 | The Regents Of The University Of California | Methods and compositions for modifying a mutant dystrophin gene in a cell's genome |
| WO2018148256A1 (en) * | 2017-02-07 | 2018-08-16 | The Regents Of The University Of California | Gene therapy for haploinsufficiency |
| WO2018169983A1 (en) * | 2017-03-13 | 2018-09-20 | President And Fellows Of Harvard College | Methods of modulating expression of target nucleic acid sequences in a cell |
| WO2018204764A1 (en) * | 2017-05-05 | 2018-11-08 | Camp4 Therapeutics Corporation | Identification and targeted modulation of gene signaling networks |
| WO2019207132A1 (en) | 2018-04-27 | 2019-10-31 | Universität Heidelberg | Modified aav capsid polypeptides for treatment of muscular diseases |
Non-Patent Citations (34)
| Title |
|---|
| "The ENCODE Project Consortium", NATURE, vol. 489, September 2012 (2012-09-01), pages 57 - 74 |
| APPL MICROBIOL BIOTECHNOL., vol. 102, no. 3, 2018, pages 1045 - 1054 |
| CHAVEZ A. ET AL., NAT METHODS, vol. 12, no. 4, April 2015 (2015-04-01), pages 326 - 8 |
| CHAVEZ A. ET AL., NAT METHODS, vol. 13, no. 7, July 2016 (2016-07-01), pages 563 - 67 |
| CHOUDHURY ET AL., MOL THER., vol. 24, no. 7, August 2016 (2016-08-01), pages 1247 - 57 |
| DOMINGUEZ A. ET AL., NAT REV MOL CELL BIOL., vol. 17, no. 1, January 2016 (2016-01-01), pages 5 - 15 |
| ESVELT KM ET AL., NAT METHODS, vol. 10, no. 11, November 2013 (2013-11-01), pages 1116 - 21 |
| FRIEDLAND AE ET AL., GENOME BIOL., 2015 |
| FRIEDLAND AE ET AL., GENOME BIOL., vol. 16, 24 November 2015 (2015-11-24), pages 257 |
| GILBERT LA ET AL., CELL, vol. 154, no. 2, July 2013 (2013-07-01), pages 442 - 51 |
| GILBERT LA ET AL., CELL, vol. 159, no. 3, October 2014 (2014-10-01), pages 647 - 61 |
| GILBERT R. ET AL., HUM GENE THER., vol. 10, no. 8, 20 May 1999 (1999-05-20), pages 1299 - 310 |
| J VIROL., vol. 66, no. 9, September 1992 (1992-09-01), pages 5500 - 8 |
| KENJI LIM ET AL: "Applications of CRISPR/Cas9 for the Treatment of Duchenne Muscular Dystrophy", JOURNAL OF PERSONALIZED MEDICINE, vol. 8, no. 4, 24 November 2018 (2018-11-24), pages 38, XP055661985, DOI: 10.3390/jpm8040038 * |
| LEE K. ET AL., NAT BIOMED ENG., vol. 1, 2017, pages 889 - 901 |
| LIAO H. ET AL., CELL, vol. 171, no. 7, 14 December 2017 (2017-12-14), pages 1495 - 507 |
| MCCARTHY JJ ET AL., SKELETAL MUSCLE, vol. 2, no. 1, May 2012 (2012-05-01), pages 8 |
| NATURE, vol. 507, no. 7493, March 2014 (2014-03-01), pages 462 - 70 |
| NISHIMASU ET AL., CELL, 2014 |
| NISHIMASU ET AL., CELL, vol. 156, no. 5, 27 February 2014 (2014-02-27), pages 935 - 49 |
| SAKAMOTO M. ET AL., BIOCHEM BIOPHYS RES COMMUN., vol. 293, no. 4, 17 May 2002 (2002-05-17), pages 1265 - 72 |
| SUHANI VORA ET AL: "Rational design of a compact CRISPR-Cas9 activator for AAV-mediated delivery", BIORXIV, 15 April 2018 (2018-04-15), XP055657794, Retrieved from the Internet <URL:https://www.biorxiv.org/content/10.1101/298620v1.full.pdf> [retrieved on 20200114], DOI: 10.1101/298620 * |
| WANG B ET AL., GENE THER., vol. 15, no. 22, November 2008 (2008-11-01), pages 1489 - 99 |
| WOJTAL DARIA ET AL: "Spell Checking Nature: Versatility of CRISPR/Cas9 for Developing Treatments for Inherited Disorders", AMERICAN JOURNAL OF HUMAN GENETICS, AMERICAN SOCIETY OF HUMAN GENETICS, CHICAGO, IL, US, vol. 98, no. 1, 10 December 2015 (2015-12-10), pages 90 - 101, XP029381495, ISSN: 0002-9297, DOI: 10.1016/J.AJHG.2015.11.012 * |
| YAMANO T ET AL., CELL, vol. 165, no. 4, 5 May 2016 (2016-05-05), pages 949 - 62 |
| YAMANO T ET AL., MOL CELL, vol. 67, no. 4, 17 August 2017 (2017-08-17), pages 633 - 45 |
| YANG ET AL., PROC NATL ACAD SCI U S A, vol. 106, no. 10, 10 March 2009 (2009-03-10), pages 3946 - 51 |
| YI-LI MIN ET AL: "CRISPR Correction of Duchenne Muscular Dystrophy", ANNUAL REVIEW OF MEDICINE : SELECTED TOPICS IN THE CLINICALSCIENCES, vol. 70, no. 1, 27 January 2019 (2019-01-27), US, pages 239 - 255, XP055661993, ISSN: 0066-4219, DOI: 10.1146/annurev-med-081117-010451 * |
| YI-LI MIN ET AL: "CRISPR Correction of Duchenne Muscular Dystrophy", ANNUAL REVIEW OF MEDICINE, 31 October 2018 (2018-10-31), pages 239 - 55, XP055662016, Retrieved from the Internet <URL:https://www.annualreviews.org/doi/pdf/10.1146/annurev-med-081117-010451> [retrieved on 20200127], DOI: 10.1146/annurev-med-081117- * |
| YU ET AL., GENE THER., vol. 16, no. 8, August 2009 (2009-08-01), pages 953 - 62 |
| ZETSCHE B ET AL., CELL, 2015 |
| ZETSCHE B. ET AL., CELL, vol. 163, no. 3, 22 October 2015 (2015-10-22), pages 759 - 71 |
| ZHANG F. ET AL., HUM MOL GENET., vol. 23, no. R1, 15 September 2014 (2014-09-15), pages 40 - 6 |
| ZHANG Y, MOL CELL, vol. 60, no. 2, 15 October 2015 (2015-10-15), pages 242 - 55 |
Cited By (12)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US12428631B2 (en) | 2016-04-13 | 2025-09-30 | Duke University | CRISPR/Cas9-based repressors for silencing gene targets in vivo and methods of use |
| US12509492B2 (en) | 2018-01-19 | 2025-12-30 | Duke University | Genome engineering with CRISPR-Cas systems in eukaryotes |
| US11434491B2 (en) | 2018-04-19 | 2022-09-06 | The Regents Of The University Of California | Compositions and methods for gene editing |
| EP3805386A4 (en) * | 2018-06-08 | 2022-03-23 | Modalis Therapeutics Corporation | MODIFIED CAS9 PROTEIN AND USE THEREOF |
| EP3833758A4 (en) * | 2018-08-07 | 2022-05-18 | Modalis Therapeutics Corporation | Novel transcription activator |
| WO2021230385A1 (en) | 2020-05-15 | 2021-11-18 | Astellas Pharma Inc. | Method for treating muscular dystrophy by targeting utrophin gene |
| WO2022069598A1 (en) | 2020-09-29 | 2022-04-07 | Genethon | Enhancing utrophin expression in cell by inducing mutations within utrophin regulatory elements and therapeutic use thereof |
| US20230272433A1 (en) * | 2020-09-29 | 2023-08-31 | Genethon | Enhancing Utrophin Expression in Cell by Inducing Mutations Within Utrophin Regulatory Elements and Therapeutic Use Thereof |
| JP2023542728A (ja) * | 2020-09-29 | 2023-10-11 | ジェネトン | ユートロフィン調節エレメント内に変異を誘導することによる細胞におけるユートロフィン発現の増強、及びその治療的使用 |
| EP4331579A4 (en) * | 2021-04-26 | 2025-04-09 | KSB Tugen Inc. | Composition comprising oxiracetam for preventing or treating muscular disease |
| WO2022267942A1 (zh) * | 2021-06-22 | 2022-12-29 | 呈诺再生医学科技(珠海横琴新区)有限公司 | 特定空间结构多肽及其在制备iPSC中的应用 |
| WO2023190935A1 (en) * | 2022-03-31 | 2023-10-05 | Modalis Therapeutics Corporation | Method for treating myopathies by targeting titin gene |
Also Published As
| Publication number | Publication date |
|---|---|
| JP2022115976A (ja) | 2022-08-09 |
| CN113271982B (zh) | 2024-07-30 |
| US11473071B2 (en) | 2022-10-18 |
| MX2021005720A (es) | 2021-07-21 |
| EP3880255A1 (en) | 2021-09-22 |
| KR102931423B1 (ko) | 2026-02-26 |
| IL283123A (en) | 2021-06-30 |
| JP2022509560A (ja) | 2022-01-20 |
| IL283123B2 (en) | 2026-03-01 |
| US20210355464A1 (en) | 2021-11-18 |
| WO2020101042A8 (en) | 2020-07-30 |
| PH12021551122A1 (en) | 2021-11-22 |
| TW202033224A (zh) | 2020-09-16 |
| CO2021006957A2 (es) | 2021-06-10 |
| AU2019381460A1 (en) | 2021-06-17 |
| CA3119618A1 (en) | 2020-05-22 |
| BR112021009481A2 (pt) | 2021-08-17 |
| SG11202105030VA (en) | 2021-06-29 |
| CN113271982A (zh) | 2021-08-17 |
| IL283123B1 (en) | 2025-11-01 |
| JP7069426B2 (ja) | 2022-05-17 |
| KR20210093954A (ko) | 2021-07-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11473071B2 (en) | Method for treating muscular dystrophy by targeting utrophin gene | |
| CN114174520B (zh) | 用于选择性基因调节的组合物和方法 | |
| EP3494997B1 (en) | Inducible dna binding proteins and genome perturbation tools and applications thereof | |
| KR20220155981A (ko) | 미성숙 종결 코돈-매개 장애를 치료하기 위한 방법 및 조성물 | |
| US20260053950A1 (en) | Epigenetic modulation of genomic targets to control expression of pws-associated genes | |
| CN113330115A (zh) | 肝特异性的病毒启动子及使用其的方法 | |
| KR20240025507A (ko) | 미성숙 종결 코돈-매개 장애를 치료하기 위한 방법 및 조성물 | |
| US12502418B2 (en) | Method for treating muscular dystrophy by targeting LAMA1 gene | |
| US20220233721A1 (en) | Method for treating muscular dystrophy by targeting dmpk gene | |
| EP4204556A1 (en) | Method for treating facioscapulohumeral muscular dystrophy (fshd) by targeting dux4 gene | |
| WO2021230385A1 (en) | Method for treating muscular dystrophy by targeting utrophin gene | |
| WO2022145495A1 (en) | Method for treating spinocerebellar ataxias (sca) by targeting atxn7 gene | |
| WO2023147558A2 (en) | Crispr methods for correcting bag3 gene mutations in vivo | |
| WO2022176859A1 (en) | Method for treating muscular dystrophy by targeting lama1 gene | |
| WO2022114243A1 (en) | Method for treating muscular dystrophy by targeting dmpk gene | |
| WO2023190935A1 (en) | Method for treating myopathies by targeting titin gene | |
| WO2025187834A1 (en) | Method for treating muscular dystrophy by targeting lama1 gene | |
| JP7749244B2 (ja) | Mapt遺伝子を標的としたアルツハイマー病の治療方法 | |
| WO2022234051A1 (en) | Split prime editing enzyme | |
| HK40072820A (en) | Method for treating muscular dystrophy by targeting lama1 gene | |
| HK40009207A (en) | Inducible dna binding proteins and genome perturbation tools and applications thereof | |
| HK40009207B (en) | Inducible dna binding proteins and genome perturbation tools and applications thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 19824401 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 3119618 Country of ref document: CA |
|
| ENP | Entry into the national phase |
Ref document number: 2021551108 Country of ref document: JP Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112021009481 Country of ref document: BR |
|
| WWE | Wipo information: entry into national phase |
Ref document number: NC2021/0006957 Country of ref document: CO |
|
| WWP | Wipo information: published in national office |
Ref document number: NC2021/0006957 Country of ref document: CO |
|
| ENP | Entry into the national phase |
Ref document number: 20217018333 Country of ref document: KR Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 2019381460 Country of ref document: AU Date of ref document: 20191115 Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 2019824401 Country of ref document: EP Effective date: 20210616 |
|
| ENP | Entry into the national phase |
Ref document number: 112021009481 Country of ref document: BR Kind code of ref document: A2 Effective date: 20210514 |
|
| WWR | Wipo information: refused in national office |
Ref document number: NC2021/0006957 Country of ref document: CO |
|
| WWG | Wipo information: grant in national office |
Ref document number: 283123 Country of ref document: IL |