WO2023190935A1

WO2023190935A1 - Method for treating myopathies by targeting titin gene

Info

Publication number: WO2023190935A1
Application number: PCT/JP2023/013303
Authority: WO
Inventors: Daniel Ferguson; Tetsuya Yamagata
Original assignee: Modalis Therapeutics Corporation
Priority date: 2022-03-31
Filing date: 2023-03-30
Publication date: 2023-10-05

Abstract

The present invention aims to provide a novel therapeutic approach to human myopathy (particularly titin-based myopathy). The present invention provides a polynucleotide comprising the following base sequences: (a) a base sequence encoding a fusion protein of a nuclease-deficient CRISPR effector protein and a transcription activator, and (b) a base sequence encoding a guide RNA targeting a continuous region set forth in SEQ ID NO: 36, 37, 38, 39, 46, 47, 51, 52, 56, 65, 66, 67 or 69 in the putative promoter region of human TTN gene.

Description

METHOD FOR TREATING MYOPATHIES BY TARGETING TITIN GENE

The present invention relates to methods for treating myopathy, particularly a titin-based myopathy, more particularly a titin-based cardiomyopathy by targeting the human titin (TTN) gene, and the like. More particularly, the present invention relates to methods and agents for treating or preventing myopathy, particularly a titin-based myopathy, more particularly a titin-based cardiomyopathy by activating expression of human TTN gene by using a guide RNA targeting a particular sequence of human TTN gene and a fusion protein of a transcription activator and a CRISPR effector protein, and the like.

The protein titin is the largest protein in the human body. It functions as the molecular spring of skeletal muscle. The human titin gene is located on chromosome 2q31. The coding region of the titin gene includes 364 exons, 363 of which encode 38,138 amino acid residues (4,200 kD) (GenBank accession number AJ277892). The size of the skeletal-muscle titin protein is 3,700 kD, and its physical length in vivo is 2 μm. Titin has mechanical, developmental, and regulatory roles in striated muscles. Its four regions (the Z-disk, l-band, A-band and Inline) stretch over the length of one-half of the basic building block of muscles, the sarcomere. One of the main functions of titin is to keep the contractile elements of the sarcomere in place, and it is responsible for muscle elasticity.

Titin has several sites for alternative splicing, causing isoforms of different lengths to appear in different muscles (NPL 1). The occurrence of several different titin isoforms may be relevant for the selective involvement of muscles in anatomically restricted myopathies (NPL 2).

The titin gene locus 2q31 has been known to be mutated in both human skeletal muscle and heart disease. TTN gene mutations have been found in patients with dilated cardiomyopathy (DCM), hypertrophic cardiomyopathy (HCM), restrictive cardiomyopathy, arrhythmogenic right ventricular cardiomyopathy, and various types of skeletal myopathies (NPL 3).

[NPL 1] Bang et al., Circ Res 89:1065-1072 (2001)
[NPL 2] Sorimachi et al. J Mol Biol 270:688-695 (1997)
[NPL 3] W. A. Linke & N. Hamdani, Circulation Research 114: 1052-1068 (2014)

The present invention aims to provide a novel therapeutic approach to human myopathy (particularly cardiomyopathy).

The present inventors have conducted intensive studies of the above-mentioned problem and found that the expression of human TTN gene can be upregulated with myocytes by using guide RNA targeting a specific sequence of human TTN gene (Gene ID: AJ277892), and a fusion protein of a transcription activator and a CRISPR effector protein lacking nuclease activity. The present inventors have completed the present invention based on these findings.

The present invention may include the following invention.
[1] A polynucleotide comprising the following base sequences:
(a) a base sequence encoding a fusion protein of a nuclease-deficient CRISPR effector protein and a transcription activator, and
(b) a base sequence encoding a guide RNA targeting a continuous region set forth in SEQ ID NO: 36, 37, 38, 39, 46, 47, 51, 52, 56, 65, 66, 67 or 69 in the putative promoter region of human TTN gene.
[2A] The polynucleotide of the above-mentioned [1], wherein the base sequence encoding the guide RNA comprises the base sequence set forth in SEQ ID NO: 36, 37, 38, 39, 46, 47, 51, 52, 56, 65, 66, 67 or 69, or said base sequence in which 1 to 3 nucleotides are deleted, substituted, inserted, and/or added.
[2B] The polynucleotide of the above-mentioned [1], wherein the base sequence encoding the guide RNA comprises the base sequence set forth in SEQ ID NO: 36, 37, 38, 39, 46, 47, 51, 52, 56, 65, 66, 67 or 69, or said base sequence in which one nucleotide or 2 to 5 continuous nucleotides are deleted from the 5’-terminal thereof.
[2C] The polynucleotide of the above-mentioned [1],
wherein the base sequence encoding the guide RNA comprises the base sequence set forth in SEQ ID NO: 36, 37, 38, 39, 46, 47, 51, 52, 56, 65, 66, 67 or 69, or said base sequence in which one nucleotide or 2 to 5 continuous nucleotides corresponding to the upstream target sequence are added to the 5’-terminal thereof.
[3] The polynucleotide of any of the above-mentioned [1] and [2A] to [2C], wherein the transcription activator is selected from the group consisting of VP64, VP160, VPH, VPR, VP64-miniRTA (miniVR), and microVR, a variant thereof having transcription activation ability.
[4] The polynucleotide of the above-mentioned [3], wherein the transcription activator is miniVR.
[5] The polynucleotide of any of the above-mentioned [1] to [4], wherein the nuclease-deficient CRISPR effector protein is dCas9.
[6] The polynucleotide of the above-mentioned [5], wherein the dCas9 is derived from Staphylococcus aureus.
[7] The polynucleotide of any of the above-mentioned [1] to [6], further comprising a promoter sequence for the base sequence encoding the guide RNA and/or a promoter sequence for the base sequence encoding the fusion protein of the nuclease-deficient CRISPR effector protein and the transcription activator.
[8] The polynucleotide of the above-mentioned [7], wherein the promoter sequence for the base sequence encoding the guide RNA is selected from the group consisting of U6 promoter, SNR6 promoter, SNR52 promoter, SCR1 promoter, RPR1 promoter, U3 promoter, and H1 promoter.
[9] The polynucleotide of the above-mentioned [8], wherein the promoter sequence for the base sequence encoding the guide RNA is U6 promoter.
[10] The polynucleotide of any of the above-mentioned [7] to [9], wherein the promoter sequence for the base sequence encoding the fusion protein of the nuclease-deficient CRISPR effector protein and the transcription activator is ubiquitous promoter or muscle specific promoter.

[11] The polynucleotide of the above-mentioned [10], wherein the ubiquitous promoter is selected from the group consisting of EFS promoter, CMV promoter and CAG promoter.
[12] The polynucleotide of the above-mentioned [10], wherein the muscle specific promoter is selected from the group consisting of CK8 promoter, myosin heavy chain kinase (MHCK) promoter, muscle creatine kinase (MCK) promoter, synthetic C5-12(Syn) promoter and unc45b promoter.
[13] A vector comprising a polynucleotide of any of the above-mentioned [1] to [12].
[14] The vector of the above-mentioned [13], wherein the vector is a plasmid vector or a viral vector.
[15] The vector of the above-mentioned [14], wherein the viral vector is selected from the group consisting of adeno-associated virus (AAV) vector, adenovirus vector, and lentivirus vector.
[16] The vector of the above-mentioned [15], wherein the AAV vector is selected from the group consisting of AAV1, AAV2, AAV6, AAV7, AAV8, AAV9, and a variant thereof.
[17] An agent for treating or preventing myopathy, comprising a polynucleotide of any of the above-mentioned [1] to [12] or a vector of any of the above-mentioned [13] to [16].
[18] A method for treating or preventing myopathy, comprising administering a polynucleotide of any of the above-mentioned [1] to [12] or a vector of any of the above-mentioned [13] to [16] to a subject in need thereof.
[19] Use of a polynucleotide of any of the above-mentioned [1] to [12] or a vector of any of the above-mentioned [13] to [16] for the treatment or prevention of myopathy.
[20] Use of a polynucleotide of any of the above-mentioned [1] to [12] or a vector of any of the above-mentioned [13] to [16] in the manufacture of a pharmaceutical composition for the treatment or prevention of myopathy.

[21] A method for upregulating expression of human TTN gene in a cell, comprising expressing
(c) a fusion protein of a nuclease-deficient CRISPR effector protein and a transcription activator, and
(d) a guide RNA targeting a continuous region set forth in SEQ ID NO: 36, 37, 38, 39, 46, 47, 51, 52, 56, 65, 66, 67 or 69 in the putative promoter region of human TTN,
in the aforementioned cell.
[22] A ribonucleoprotein comprising the following:
(c) a fusion protein of a nuclease-deficient CRISPR effector protein and a transcription activator, and
(d) a guide RNA targeting a continuous region set forth in SEQ ID NO: 36, 37, 38, 39, 46, 47, 51, 52, 56, 65, 66, 67 or 69 in the putative promoter region of human TTN gene.
[23] A kit comprising the following for upregulation of the expression of the human TTN gene:
(e) a fusion protein of a nuclease-deficient CRISPR effector protein and a transcription activator, or a polynucleotide encoding the fusion protein, and
(f) a guide RNA targeting a continuous region set forth in SEQ ID NO: 36, 37, 38, 39, 46, 47, 51, 52, 56, 65, 66, 67 or 69 in the putative promoter region of human TTN gene, or a polynucleotide encoding the guide RNA.
[24] A method for treating or preventing myopathy, comprising administering the following (e) and (f):
(e) a fusion protein of a nuclease-deficient CRISPR effector protein and a transcription activator, or a polynucleotide encoding the fusion protein, and
(f) a guide RNA targeting a continuous region set forth in SEQ ID NO: 36, 37, 38, 39, 46, 47, 51, 52, 56, 65, 66, 67 or 69 in the putative promoter region of human TTN gene, or a polynucleotide encoding the guide RNA.
[25] Use of the following (e) and (f):
(e) a fusion protein of a nuclease-deficient CRISPR effector protein and a transcription activator, or a polynucleotide encoding the fusion protein, and
(f) a guide RNA targeting a continuous region set forth in SEQ ID NO: 36, 37, 38, 39, 46, 47, 51, 52, 56, 65, 66, 67 or 69 in the putative promoter region of human TTN gene, or a polynucleotide encoding the guide RNA,
in the manufacture of a pharmaceutical composition for the treatment or prevention of myopathy.

According to the present invention, the expression of human TTN gene can be upregulated, as a result of which the present invention is expected to be able to treat myopathy.

[Fig. 1] Fig. 1 shows the location of the targeted genomic region in the human TTN gene. UCSC genome browser graphic displaying the promoter and initial exons of the human TTN gene. Histone modifications (H3K4Me3 & H3K27Ac) and regulatory regions in human skeletal muscle cells (HSMM) produced by the ENCODE project are displayed. Highlighted regions (grey) correspond to sequences used in sgRNA guide design.
[Fig. 2] Fig. 2 shows the Fold-change in TTN gene expression in HEK293FT cells following sgRNA construct transfection and puromycin selection. sgRNAs are rank ordered from lowest TTN induction to highest. Data are expressed as fold-change in TTN expression relative to the average of three control sgRNAs. TTN expression was normalized to the internal reference gene HPRT1.
[Fig. 3] Fig. 3 shows Fold-change in TTN gene expression in SkMC following sgRNA construct lentivirus transduction and puromycin selection. sgRNAs are rank ordered from lowest TTN induction to highest. Data are expressed as fold-change in TTN expression from three independent transductions, relative to the average of three control sgRNAs. TTN expression was normalized to the internal reference gene HPRT1.

The embodiments of the present invention are explained in detail below.

1. Polynucleotide
The present invention provides a polynucleotide comprising the following base sequences (hereinafter sometimes to be also referred to as “the polynucleotide of the present invention”):
(a) a base sequence encoding a fusion protein of a nuclease-deficient CRISPR effector protein and a transcription activator, and
(b) a base sequence encoding a guide RNA targeting a continuous region set forth in SEQ ID NO:36, 37, 38, 39, 46, 47, 51, 52, 56, 65, 66, 67 or 69 in the putative promoter region of human TTN gene.
The polynucleotide of the present invention is introduced into a desired cell and transcribed to produce a fusion protein of a nuclease-deficient CRISPR effector protein and a transcription activator, and a guide RNA targeting a particular region of the putative promoter region of the human TTN gene. These fusion protein and guide RNA form a complex (hereinafter the complex is sometimes referred to as “ribonucleoprotein; RNP”) and cooperatively act on the aforementioned particular region, thus activating transcription of the human TTN gene.

(1) Definition
In the present specification, “the putative promoter region of human titine (TTN) gene” means any region in which the expression of human TTN gene can be activated by binding RNP to that region. In the present specification, when the putative promoter region is shown by the particular sequence, the putative promoter region includes both the sense strand sequence and the antisense strand sequence conceptually.

In the present invention, a fusion protein of a nuclease-deficient CRISPR effector protein and a transcription activator is recruited by a guide RNA into a particular region in the putative promoter region of the human TTN gene. In the present specification, the “guide RNA targeting ...” means a “guide RNA recruiting a fusion protein into ...”.

In the present specification, the “guide RNA (to be also referred to as ‘gRNA’)” is an RNA comprising a genome specific CRISPR-RNA (to be referred to as “crRNA”). crRNA is an RNA that binds to a complementary sequence of a targeting sequence (described later). When Cpf1 is used as the CRISPR effector protein, the “guide RNA” refers to an RNA comprising an RNA consisting of crRNA and a specific sequence attached to its 5’-terminal (for example, an RNA sequence set forth in SEQ ID NO: 74 in the case of FnCpf 1). When Cas9 is used as the CRISPR effector protein, the “guide RNA” refers to chimera RNA (to be referred to as “single guide RNA(sgRNA)”) comprising crRNA and trans-activating crRNA attached to its 3’-terminal (to be referred to as “tracrRNA”) (see, for example, Zhang F. et al., Hum Mol Genet. 2014 Sep 15; 23(R1):R40-6 and Zetsche B. et al., Cell. 2015 Oct 22; 163(3): 759-71, which are incorporated herein by reference in their entireties).

In the present specification, a sequence complementary to the sequence to which crRNA is bound in the putative promoter region of the human TTN gene is referred to as a “targeting sequence”. That is, in the present specification, the “targeting sequence” is a DNA sequence present in the putative promoter region of the human TTN gene and adjacent to PAM (protospacer adjacent motif). PAM is adjacent to the 5’-side of the targeting sequence when Cpf1 is used as the CRISPR effector protein. PAM is adjacent to the 3’-side of the targeting sequence when Cas9 is used as the CRISPR effector protein. The targeting sequence may be present on either the sense strand sequence side or the antisense strand sequence side of the putative promoter region of the human TTN gene (see, for example, the aforementioned Zhang F. et al., Hum Mol Genet. 2014 Sep 15; 23(R1):R40-6 and Zetsche B. et al., Cell. 2015 Oct 22; 163(3): 759-71, which are incorporated herein by reference in their entireties).

(2) Nuclease-deficient CRISPR effector protein
In the present invention, using a nuclease-deficient CRISPR effector protein, a transcriptional activator fused thereto is recruited to the putative promoter region of the human TTN gene. The nuclease-deficient CRISPR effector protein (hereinafter to be simply referred to as “CRISPR effector protein”) to be used in the present invention is not particularly limited as long as it forms a complex with gRNA and is recruited to the expression regulatory region of the human TTN gene. For example, nuclease-deficient Cas9 (hereinafter sometimes to be also referred to as “dCas9”) or nuclease-deficient Cpf1 (hereinafter sometimes to be also referred to as “dCpf1”) can be included.

Examples of the above-mentioned dCas9 include, but are not limited to, a nuclease-deficient variant of Streptococcus pyogenes-derived Cas9 (SpCas9; PAM sequence: NGG (N is A, G, T or C. hereinafter the same)), Streptococcus thermophilus-derived Cas9 (StCas9; PAM sequence: NNAGAAW (W is A or T. hereinafter the same)), Neisseria meningitidis-derived Cas9 (NmCas9; PAM sequence: NNNNGATT), or Staphylococcus aureus-derived Cas9 (SaCas9; PAM sequence: NNGRRT (R is A or G. hereinafter the same)) and the like (see, for example, Nishimasu et al., Cell. 2014 Feb 27; 156(5): 935-49, Esvelt KM et al., Nat Methods. 2013 Nov; 10(11):1116-21, Zhang Y. Mol Cell. 2015 Oct 15; 60(2):242-55, and Friedland AE et al., Genome Biol. 2015 Nov 24; 16:257, which are incorporated herein by reference in their entireties). For example, in the case of SpCas9, a double mutant in which the 10th Asp residue is converted to Ala residue and the 840th His residue is converted to Ala residue (sometimes referred to as “dSpCas9”) can be used (see, for example, the aforementioned Nishimasu et al., Cell. 2014). Alternatively, in the case of SaCas9, a double mutant in which the 10th Asp residue is converted to Ala residue and the 580th Asn residue is converted to Ala residue (SEQ ID NO:75), or a double mutant in which the 10th Asp residue is converted to Ala residue and the 557th His residue is converted to Ala residue (SEQ ID NO: 76) (hereinafter any of these double mutants is sometimes to be referred to as “dSaCas9”) can be used (see, for example, the aforementioned Friedland AE et al., Genome Biol. 2015, which is incorporated herein by reference in its entirety).

In addition, in one embodiment of the present invention, as dCas9, a variant obtained by modifying a part of the amino acid of the aforementioned dCas9, which forms a complex with gRNA and is recruited to the putative promoter region of the human TTN gene, may also be used. Examples of such variant include a truncated variant with a partly deleted amino acid sequence or a variant obtained by modification (deletion, addition and/or substitution) of a part of the amino acid of the aforementioned dCas9. In one embodiment of the present invention, as dCas9, variants disclosed in WO219049913A1, WO2019235627A1, and WO2020085441A1, which are incorporated herein by reference in there entireties, can be used. Specifically, dSaCas9 obtained by deleting the 721st to 745th amino acids from dSaCas9 that is a double mutant in which the 10th Asp residue is converted to Ala residue and the 580th Asn residue is converted to Ala residue(SEQ ID NO: 77), or dSaCas9 in which the deleted part is substituted by a peptide linker (e.g., one in which the deleted part is substituted by GGSGGS linker (SEQ ID NO: 78) is set forth in SEQ ID NO: 79), or dSaCas9 obtained by deleting the 482nd - 648th amino acids of dSaCas9 that is the aforementioned double mutant (SEQ ID NO: 80), or dSaCas9 in which the deleted part is substituted by a peptide linker (one in which the deleted part is substituted by GGSGGS linker is set forth in SEQ ID NO: 81) may also be used. In another embodiment, dSaCas9 (dSaCas9-PFv51)) obtained by amino acid substitution (E782K_L800R_T927K_K929N_N968R_N985A_R991A_A1021S_I1017F) of dSaCas9 that is a double mutant in which the 10th Asp residue is converted to Ala residue and the 580th Asn residue is converted to Ala residue. In this specification, the alphabet displayed on the left side of the number indicating the number of amino acid residues up to the substitution site indicates a single letter code of the amino acid before substitution of the amino acid sequence of SaCas9, and the alphabet displayed on the right side indicates a single letter code of the amino acid after substitution.

Examples of the above-mentioned dCpf1 include, but are not limited to, a nuclease-deficient variant of Francisella novicida-derived Cpf1 (FnCpf1; PAM sequence: NTT), Acidaminococcus sp.-derived Cpf1 (AsCpf1; PAM sequence: NTTT), or Lachnospiraceae bacterium-derived Cpf1 (LbCpf1; PAM sequence: NTTT) and the like (see, for example, Zetsche B. et al., Cell. 2015 Oct 22; 163(3):759-71, Yamano T et al., Cell. 2016 May 5; 165(4):949-62, and Yamano T et al., Mol Cell. 2017 Aug 17; 67(4):633-45, which are incorporated herein by reference in their entireties). For example, in the case of FnCpf1, a double mutant in which the 917th Asp residue is converted to Ala residue and the 1006th Glu residue is converted to Ala residue can be used (see, for example, the aforementioned Zetsche B et al., Cell. 2015, which is incorporated herein by reference in its entirety). In one embodiment of the present invention, as dCpf1, a variant obtained by modifying a part of the amino acid of the aforementioned dCpf1, which forms a complex with gRNA and is recruited to the putative promoter region of the human TTN gene, may also be used.

In one embodiment of the present invention, dCas9 is used as the CRISPR effector protein and, in a particular embodiment, dSaCas9 is used.

A polynucleotide comprising a base sequence encoding a CRISPR effector protein can be cloned by, for example, synthesizing an oligoDNA primer covering a region encoding a desired part of the protein based on the cDNA sequence information thereof, and amplifying the polynucleotide by PCR method using total RNA or mRNA fraction prepared from the cells producing the protein as a template. In addition, a polynucleotide comprising a base sequence encoding a CRISPR effector protein can be obtained by introducing a mutation into a nucleotide sequence encoding a cloned CRISPR effector protein by a known site-directed mutagenesis method to convert the amino acid residues (e.g., 10th Asp residue, 557th His residue, and 580th Asn residue in the case of SaCas9; 917th Asp residue and 1006th Glu residue in the case of FnCpf1, and the like can be included, but are not limited to these) at a site important for DNA cleavage activity to other amino acids.

Alternatively, a polynucleotide comprising a base sequence encoding CRISPR effector protein can be obtained by chemical synthesis or a combination of chemical synthesis and PCR method or Gibson Assembly method, based on the cDNA sequence information thereof, and can also be further constructed as a base sequence that underwent codon optimization to give codons suitable for expression in human.

(3) Transcription activator
In the present invention, human TTN gene expression is activated by the action of the transcription activator fused with the CRISPR effector protein. In the present specification, the “transcription activator” means a protein having ability to activate gene transcription of human TTN gene or a peptide fragment retaining the function thereof. The transcription activator to be used in the present invention is not particularly limited as long as it can activate expression of human TTN gene. For example, it includes VP64, VP160, VPH, VPR, miniVR, and microVR, a variant thereof having transcription activation ability and the like. VP64 is exemplified by a peptide consisting of 50 amino acids set forth in SEQ ID NO: 82. VP160 is exemplified by a peptide consisting of 131 amino acids set forth in SEQ ID NO: 83. VPH is a fusion protein of VP64, p65 and HSF1, specifically, exemplified by a peptide consisting of 376 amino acids set forth in SEQ ID NO: 84. VPR is a fusion protein of VP64, p65, and a replication and transcription activator of Epstein-Barr virus (RTA), specifically, exemplified by a peptide consisting of 523 amino acids set forth in SEQ ID NO: 85. VP64, VPH, and VPR are known and disclosed in detail in, for example, Chavez A. et al., Nat Methods. 2016 Jul; 13(7):563-7 and Chavez A. et al., Nat Methods. 2015 Apr; 12(4):326-8, which are incorporated herein by reference in their entireties. MiniVR and microVR are peptides comprising VP64 and a transcription activation domain of RTA. The transcription activation domain of RTA is known and disclosed in, for example, J Virol. 1992 Sep;66(9):5500-8, which is incorporated herein by reference in its entirety and the like. Specifically, miniVR is exemplified by a peptide consisting of 167 amino acids set forth in SEQ ID NO: 86, and microVR is exemplified by a peptide consisting of 140 amino acids set forth in SEQ ID NO: 87. The amino acid sequence set forth in SEQ ID NO: 86 is composed of an amino acid sequence in which the 493rd - 605th amino acid residues of RTA and VP64 are linked with a G-S-G-S linker (SEQ ID NO: 88). The amino acid sequence set forth in SEQ ID NO: 87 is composed of an amino acid sequence in which the 520th - 605th amino acid residues of RTA and VP64 are linked with a G-S-G-S linker. The detail of miniVR and microVR is described in WO2020/032057A1, which is incorporated herein by reference in its entirety. Any of the aforementioned transcriptional activators may be subjected to any modification and/or alteration as long as it maintains its transcription activation ability.

A polynucleotide comprising a base sequence encoding a transcription activator can be constructed by chemical synthesis or a combination of chemical synthesis and PCR method or Gibson Assembly method. Furthermore, a polynucleotide comprising a base sequence encoding a transcription activator can also be constructed as a codon-optimized DNA sequence to be codons suitable for expression in human.

A polynucleotide comprising a base sequence encoding a fusion protein of a transcription activator and a CRISPR effector protein can be prepared by ligating a base sequence encoding a CRISPR effector protein to a base sequence encoding a transcription activator directly or after adding a base sequence encoding a linker, NLS (nuclear localization signal) and/or a tag. In the present invention, the transcription activator may be fused with either N-terminal or C-terminal. As the linker, a linker with an amino acid number of about 2 to 50 can be used, and specific examples thereof include, but are not limited to, a G-S-G-S linker in which glycine (G) and serine (S) are alternately linked and the like.

(4) Guide RNA
In the present invention, a fusion protein of CRISPR effector protein and transcription activator can be recruited to the putative promoter region of the human TTN gene by guide RNA. As described in the aforementioned “(1) Definition”, guide RNA comprises crRNA, and the crRNA binds to a complementary sequence of the targeting sequence. crRNA may not be completely complementary to the complementary sequence of the targeting sequence as long as the guide RNA can recruit the fusion protein to the target region, and may be a sequence in which at least 1 to 3 nucleotides are deleted, substituted, inserted and/or added.

In one embodiment of the present invention, one nucleotide or several continuous nucleotides (e.g., 2, 3, 4, or 5 nucleotides) may be deleted from the 5’-terminal of the gRNA. Also, in another embodiment of the present invention, one nucleotide or several continuous nucleotides complementary to the complementary sequence of the targeting sequence (e.g., 2, 3, 4, or 5 nucleotides) can be added to the 5’-terminal of the gRNA. The deletion or addition has little effect on the activity of the gRNA.

When dCas9 is used as the CRISPR effector protein, for example, the targeting sequence can be determined using a published gRNA design web site (CRISPR Design Tool, CRISPR direct etc.). To be specific, from the sequence of the object gene (i.e., human TTN gene), candidate targeting sequences of about 20 nucleotides in length for which PAM (e.g., NNGRRT in the case of SaCas9) is adjacent to the 3’-side thereof are listed, and one having a small number of off-target sites in human genome from among these candidate targeting sequences can be used as the targeting sequence. The base length of the targeting sequence is 18 to 24 nucleotides in length, preferably 19 to 22 nucleotides in length, more preferably 20 to 21 nucleotides in length. As a primary screening for the prediction of the off-target site number, a number of bioinformatic tools are known and publicly available, and can be used to predict the targeting sequence with the lowest off-target effect. Examples thereof include bioinformatics tools such as Benchling (https://benchling.com), and COSMID (CRISPR Off-target Sites with Mismatches, Insertions and Deletions) (Available on https://crispr.bme.gatech.edu on the internet). Using these, the similarity to the base sequence targeted by gRNA can be summarized. When the gRNA design software to be used does not have a function to search for off-target site of the target genome, for example, the off-target site can be searched for by subjecting the target genome to Blast search with respect to 8 to 12 nucleotides on the 3’-side of the candidate targeting sequence (seed sequence with high discrimination ability of targeted nucleotide sequence).

In one embodiment of the present invention, in the region existing in the GRCh37/hg19 of human chromosome 2 (Chr 2), the region of “179,669,152-179,670,187” and the region of “179,672,954-179,671,159” can be the putative promoter regions of the human TTN gene. Therefore, in one embodiment of the present invention, the targeting sequence can be 18 to 24 nucleotides in length, preferably 19 to 22 nucleotides in length, more preferably 20 to 21 nucleotides in length, in at least one region of the following region existing in the regions of “179,669,152-179,670,187” and “179,672,954-179,671,159” existing in GRCh37/hg19 of human chromosome 2 (Chr 2).
In one embodiment of the present invention, the targeting sequence can be the base sequence set forth in SEQ ID NO: 36, 37, 38, 39, 46, 47, 51, 52, 56, 65, 66, 67 or 69.

For example, when the targeting sequence set forth in SEQ ID NO: 69 (CCCAAACCTGAGGACTGTGCC) is introduced into the cell as a base sequence encoding crRNA, crRNA transcribed from the sequence is CCCAAACCUGAGGACUGUGCC (SEQ ID NO: 89) and is bound to GGCACAGTCCTCAGGTTTGGG (SEQ ID NO: 90), which is a sequence complementary to the base sequence set forth in SEQ ID NO: 90 and is present in the putative promoter region of the human TTN gene. In another embodiment, a base sequence which is a targeting sequence in which at least 1 to 3 nucleotides are deleted, substituted, inserted and/or added can be used as the base sequence encoding crRNA as long as guide RNA can recruit a fusion protein to the target region. Therefore, in one embodiment of the present invention, as a base sequence encoding crRNA, the base sequence set forth in SEQ ID NO: 36, 37, 38, 39, 46, 47, 51, 52, 56, 65, 66, 67 or 69, or such sequence in which 1 to 3 nucleotides are deleted, substituted, inserted and/or added can be used.

When dCpf1 is used as the CRISPR effector protein, a base sequence encoding gRNA can be designed as a DNA sequence encoding crRNA with particular RNA attached to the 5’-terminal. RNA attached to the 5’-terminal of crRNA and a DNA sequence encoding said RNA can be appropriately selected by those of ordinary skill in the art according to the dCpf1 to be used. For example, when dFnCpf1 is used, a base sequence in which SEQ ID NO: 91; AATTTCTACTGTTGTAGAT is attached to the 5’-side of the targeting sequence can be used as a base sequence encoding gRNA (when transcribed to RNA, the sequences of the underlined parts form a base pairs to form a stem-loop structure). The sequence to be added to the 5’-terminal may be a sequence generally used for various Cpf1 proteins in which at least 1 to 6 nucleotides are deleted, substituted, inserted and/or added, as long as gRNA can recruit a fusion protein to the putative promoter region after transcription.

When dCas9 is used as the CRISPR effector protein, a base sequence encoding gRNA can be designed as a DNA sequence in which a DNA sequence encoding known tracrRNA is linked to the 3’-terminal of a DNA sequence encoding crRNA. Such tracrRNA and a DNA sequence encoding the tracrRNA can be appropriately selected by those of ordinary skill in the art according to the dCas9 to be used. For example, when dSaCas9 is used, the base sequence set forth in SEQ ID NO: 92 is used as the DNA sequence encoding tracrRNA. The DNA sequence encoding tracrRNA may be a base sequence encoding tracrRNA generally used for various Cas9 proteins in which at least 1 to 6 nucleotides are deleted, substituted, inserted and/or added, as long as gRNA can recruit a fusion protein to the putative promoter region after transcription.

In one embodiment of the present invention, the base sequence of gRNA comprises a DNA sequence encoding crRNA set forth in SEQ ID NO: 36, 37, 38, 39, 46, 47, 51, 52, 56, 65, 66, 67 or 69 and a DNA sequence encoding tracrRNA, or such base sequence in which 1 to 10, 9, 8, 7, 6, 5, 4, or 3 nucleotides are deleted, substituted, inserted and/or added can be used. The deleted, substituted, inserted and/or added nucleotides may or may not be continuous. In one embodiment of the present invention, the deletion or addition of continuous nucleotides is found at the 5’-terminal of the base sequence.

In one embodiment of the present invention, the base sequence encoding the gRNA comprises the base sequence set forth in SEQ ID NO: 36, 37, 38, 39, 46, 47, 51, 52, 56, 65, 66, 67 or 69, or said base sequence in which 1 to 3 nucleotides are deleted, substituted, inserted and/or added.

In another embodiment of the present invention, the base sequence encoding the gRNA comprises the base sequence set forth in SEQ ID NO: 36, 37, 38, 39, 46, 47, 51, 52, 56, 65, 66, 67 or 69, or said base sequence in which one nucleotide or 2 to 5 continuous nucleotides are deleted from the 5’-terminal of the base sequence.

In another embodiment of the present invention, the base sequence encoding the gRNA comprises the base sequence set forth in SEQ ID NO: 36, 37, 38, 39, 46, 47, 51, 52, 56, 65, 66, 67 or 69, or said base sequence in which one nucleotide or 2 to 5 continuous nucleotides corresponding to the target sequence are added to the 5’-terminal of the base sequence.

A polynucleotide comprising a base sequence encoding gRNA designed in this way can be chemically synthesized using a known DNA synthesis method.
In another embodiment of the present invention, the polynucleotide of the present invention may comprise two or more kinds of gRNA with different crRNA.

(5) Promoter sequence
In one embodiment of the present invention, a promoter sequence may be operably linked to the upstream of each of a base sequence encoding fusion protein of CRISPR effector protein and transcription activator and/or a base sequence encoding gRNA. The promoter to be possibly linked is not particularly limited as long as it shows a promoter activity in the target cell. Examples of the promoter sequence possibly linked to the upstream of the base sequence encoding the fusion protein include, but are not limited to, EFS promoter, CMV (cytomegalovirus) promoter, CK8 promoter, MHC promoter, MYOD promoter, hTERT promoter, SRα promoter, SV40 promoter, LTR promoter, CAG promoter, RSV (Rous sarcoma virus) promoter and the like. Examples of the promoter sequence possibly linked to the upstream of the base sequence encoding gRNA include, but are not limited to, U6 promoter, SNR6 promoter, SNR52 promoter, SCR1 promoter, RPR1 promoter, U3 promoter, H1 promoter, and tRNA promoter, which are pol III promoters, and the like. In one embodiment of the present invention, a muscle specific promoter can be used as the promoter sequence linked to the upstream of a base sequence encoding the aforementioned fusion protein. Examples of the muscle specific promoter include, but are not limited to, CK8 promoter, CK6 promoter, CK1 promoter, CK7 promoter, CK9 promoter, cardiac muscle troponin C promoter, α actin promoter, myosin heavy chain kinase (MHCK) promoter, myosin light chain 2A promoter, dystrophin promoter, muscle creatine kinase promoter, dMCK promoter, tMCK promoter, enh348 MCK promoter, synthetic C5-12(Syn) promoter, unc45b promoter, Myf5 promoter, MLC1/3f promoter, MYOD promoter, Myog promoter, Pax7 promoter and the like (for the detail of the muscle specific promoter, see, for example, US2011/0212529A, McCarthy JJ et al., Skeletal Muscle. 2012 May; 2(1):8, Wang B. et al., Gene Ther. 2008 Nov; 15(22):1489-99, which are incorporated herein by reference in their entireties and the like).

(6) Other base sequence
Furthermore, the polynucleotide of the present invention may further comprise known sequences such as Polyadenylation signal, Kozak consensus sequence and the like besides those mentioned above for the purpose of improving the translation efficiency of mRNA produced by transcription of a base sequence encoding a fusion protein of CRISPR effector protein and transcription activator. In addition, the polynucleotide of the present invention may comprise a base sequence encoding a linker sequence, a base sequence encoding NLS and/or a base sequence encoding a tag.

2. Vector
The present invention provides a vector comprising the polynucleotide of the present invention (hereinafter sometimes referred to as “the vector of the present invention”). The vector of the present invention may be a plasmid vector or a viral vector.

When the vector of the present invention is a plasmid vector, the plasmid vector to be used is not particularly limited and may be any plasmid vector such as cloning plasmid vector and expression plasmid vector. The plasmid vector is prepared by inserting the polynucleotide of the present invention into a plasmid vector by a known method.

When the vector of the present invention is a viral vector, the viral vector to be used is not particularly limited and examples thereof include, but are not limited to, adenovirus vector, adeno-associated virus (AAV) vector, lentivirus vector, retrovirus vector, Sendaivirus vector and the like. In the present specification, the “virus vector” or “viral vector” also includes derivatives thereof. Considering the use in gene therapy, AAV vector is preferably used for the reasons such that it can express transgene for a long time, and it is derived from a non-pathogenic virus and has high safety.

A viral vector comprising the polynucleotide of the present invention can be prepared by a known method. In brief, a plasmid vector for virus expression into which the polynucleotide of the present invention has been inserted is prepared, the vector is transfected into an appropriate host cell to allow for transient production of a viral vector comprising the polynucleotide of the present invention, and the viral vector is collected.

In one embodiment of the present invention, when AAV vector is used, the serotype of the AAV vector is not particularly limited as long as expression of the human TTN gene in the target can be activated, and any of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, and variant thereof, and the like may be used (for the various serotypes of AAV, see, for example, WO 2005/033321, which is incorporated herein by reference in its entirety). Examples of the variants of AAV include, but are not limited to, new serotype with a modified capsid (e.g., WO 2012/057363, which is incorporated herein by reference in its entirety) and the like.

In one example of preparing an AAV vector, first, a vector plasmid comprising inverted terminal repeat (ITR) at both ends of wild-type AAV genomic sequence and the polynucleotide of the present invention inserted in place of the DNA encoding Rep protein and capsid protein is prepared. On the other hand, the DNA encoding Rep protein and capsid protein necessary for forming virus particles is inserted into other plasmid. Furthermore, a plasmid comprising genes (E1A, E1B, E2A, VA and E4orf6) responsible for the helper action of adenovirus necessary for proliferation of AAV is prepared as an adenovirus helper plasmid. Co-transfection of these three kinds of plasmids into the host cell causes production of recombinant AAV (i.e., AAV vector) in the cell. As the host cell, a cell capable of supplying a part of the gene products (proteins) of the genes responsible for the aforementioned helper action (e.g., 293 cell etc.) is preferably used. When such cell is used, it is not necessary to carry the gene encoding a protein that can be supplied from the host cell in the aforementioned adenoviral helper plasmid. The produced AAV vector is present in the nucleus. Thus, a desired AAV vector is prepared by destroying the host cell with freeze-thawing, collecting the virus and then subjecting the virus fraction to separation and purification by density gradient ultracentrifugation method using cesium chloride, column method or the like.

AAV vector has great advantages in terms of safety, gene transduction efficiency and the like, and is used for gene therapy. However, it is known that the size of polynucleotide that can be packaged is limited. For example, the entire length including the base length of a polynucleotide comprising a base sequence encoding a fusion protein of dSaCas9 and miniVR or microVR, a base sequence encoding gRNA targeting the putative promoter region of the human TTN gene, and EFS promoter sequence and U6 promoter sequence as the promoter sequences, which is one embodiment of the present invention, and ITR parts is about 4.85 kb, and they can be packaged in a single AAV vector.

3. Treating or preventing agent for myopathy
The present invention also provides a treating or preventing agent for myopathy comprising the polynucleotide of the present invention or the vector of the present invention (hereinafter sometimes referred to as “the agent of the present invention”).

The agent of the present invention comprises the polynucleotide of the present invention or the vector of the present invention as an active ingredient, and may be prepared as a formulation comprising such active ingredient (i.e., the polynucleotide of the present invention or the vector of the present invention) and, generally, a pharmaceutically acceptable carrier.

The agent of the present invention is administered parenterally, and may be administered topically or systemically. The agent of the present invention can be administered by, but are not limited to, for example, intravenous administration, intraarterial administration, subcutaneous administration, intraperitoneal administration, or intramuscular administration.

The dose of the agent of the present invention to a subject is not particularly limited as long as it is an effective amount for the treatment and/or prevention. It may be appropriately optimized according to the active ingredient, dosage form, age and body weight of the subject, administration schedule, administration method and the like.

In one embodiment of the present invention, the agent of the present invention can be not only administered to the subject affected with myopathy but also prophylactically administered to subjects who may develop myopathy in the future based on the genetic background analysis and the like. The term “treatment” in the present specification also includes remission of disease, in addition to cure of diseases. In addition, the term “prevention” may also include delaying onset of disease, in addition to prophylaxis of onset of disease. The agent of the present invention can also be referred to as “the pharmaceutical composition of the present invention” or the like.

4. Method for treatment or prevention of myopathy
The present invention also provides a method for treating or preventing myopathy, comprising administering the polynucleotide of the present invention or the vector of the present invention to a subject in need thereof (hereinafter sometimes referred to as “the method of the present invention”). In addition, the present invention includes the polynucleotide of the present invention or the vector of the present invention for use in the treatment or prevention of myopathy. Furthermore, the present invention includes use of the polynucleotide of the present invention or the vector of the present invention in the manufacture of a pharmaceutical composition for the treatment or prevention of myopathy.

The method of the present invention can be practiced by administering the aforementioned agent of the present invention to a subject affected with myopathy, and the dose, administration route, subject and the like are the same as those mentioned above.

Measurement of the symptoms may be performed before the start of the treatment using the method of the present invention and at any timing after the treatment to determine the response of the subject to the treatment.

The method of the present invention can improve the functions of the skeletal muscle and/or cardiac muscle of the subject. Muscles to be improved in the function thereof are not particularly limited, and any muscles and muscle groups are exemplified.

5. Ribonucleoprotein
The present invention provides a ribonucleoprotein comprising the following (hereinafter sometimes referred to as “RNP of the present invention”):
(c) a fusion protein of a nuclease-deficient CRISPR effector protein and a transcription activator, and
(d) a guide RNA targeting a continuous region set forth in SEQ ID NO: 36, 37, 38, 39, 46, 47, 51, 52, 56, 65, 66, 67 or 69 in the putative promoter region of human TTN gene.

As the CRISPR effector protein, transcription activator, and guide RNA comprised in the RNP of the present invention, the CRISPR effector protein, transcription activator, and guide RNA explained in detail in the above-mentioned section of “1. Polynucleotide” can be used. The fusion protein of CRISPR effector protein and transcription activator to be comprised in the RNP of the present invention can be produced by, for example, introducing a polynucleotide encoding the fusion protein into the cell, bacterium, or other organism to allow for expression, or an in vitro translation system by using the polynucleotide. In addition, guide RNA comprised in the RNP of the present invention can be produced by, for example, chemical synthesis or an in vitro transcription system by using a polynucleotide encoding the guide RNA. The thus-prepared CRISPR effector protein and guide RNA are mixed to prepare the RNP of the present invention. Where necessary, other substances such as gold particles may be mixed. To directly deliver the RNP of the present invention to the target cell, tissue and the like, the RNP may be encapsulated in a lipid nanoparticle (LNP) by a known method. The RNP of the present invention can be introduced into the target cell, tissue and the like by a known method. For example, Lee K., et al., Nat Biomed Eng. 2017; 1:889-901, WO 2016/153012, which are incorporated herein by reference in their entireties, and the like can be referred to for encapsulation in LNP and introduction method.

In one embodiment of the present invention, the guide RNA comprised in RNP of the present invention targets continuous 18 to 24 nucleotides in length, preferably 19 to 22 nucleotides in length, more preferably 20 to 21 nucleotides in length, in at least one region of the following region existing in the GRCh37/hg19 of human chromosome 2 (Chr 2):
179,669,152-179,670,187,
179,672,954-179,671,159.
In one embodiment, the guide RNA targets a region comprising all or a part of the sequence set forth in SEQ ID NO: 36, 37, 38, 39, 46, 47, 51, 52, 56, 65, 66, 67 or 69. In one embodiment of the present invention, one nucleotide or several continuous nucleotides (e.g., 2, 3, 4, or 5 nucleotides) may be deleted from the 5’-terminal of the gRNA. Also, in another embodiment of the present invention, one nucleotide or several continuous nucleotides complementary to the complementary sequence of the targeting sequence (e.g., 2, 3, 4, or 5 nucleotides) can be added to the 5’-terminal of the gRNA. The deletion or addition has little effect on the activity of the gRNA.

6. Others
The present invention also provides a composition or kit comprising the following for activation of the expression of the human TTN gene:
(e) a fusion protein of a nuclease-deficient CRISPR effector protein and a transcription activator, or a polynucleotide encoding the fusion protein, and
(f) a guide RNA targeting a continuous region set forth in SEQ ID NO: 36, 37, 38, 39, 46, 47, 51, 52, 56, 65, 66, 67 or 69 in the putative promoter region of human TTN gene, or a polynucleotide encoding the guide RNA.

The present invention also provides a method for treating or preventing myopathy, comprising administering the following (e) and (f):
(e) a fusion protein of a nuclease-deficient CRISPR effector protein and a transcription activator, or a polynucleotide encoding the fusion protein, and
(f) a guide RNA targeting
a continuous region set forth in SEQ ID NO: 36, 37, 38, 39, 46, 47, 51, 52, 56, 65, 66, 67 or 69 in the putative promoter region of human TTN gene, or a polynucleotide encoding the guide RNA.

As the CRISPR effector protein, transcription activator, guide RNA, as well as polynucleotides encoding them and vectors in which they are carried in these inventions, those explained in detail in the above-mentioned sections of “1. Polynucleotide”, “2. Vector” and “5. Ribonucleoprotein” can be used. The dose, administration route, subject, formulation and the like of the above-mentioned (e) and (f) are the same as those explained in the section of “3. Treating or preventing agent for myopathy”.

Other features of the invention will become apparent in the course of the following descriptions of exemplary embodiments which are given for illustration of the invention and are not intended to be limiting thereof.

Experimental Methods
Selection of TTN targeting sequences
Based on the H3K4me3 and H3K27Ac pattern of in human skeletal muscle cells, roughly 2.8 kb of sequence (Figure 1) around the putative promoter regions (referred to as Promoter 1 and Promoter 2), together referred to as the gene regulatory regions of the human TTN gene were scanned for sequences that can be targeted by a catalytically-inactive SaCas9 (D10A and N580A mutant; dSaCas9) complexed with gRNA, defined herein as a targeting sequence. The location of the targeted genome regions on chromosome 2 are noted below:
1. Chr2: GRCh37/hg19; 179669152-179670187 -> ~1kb (referred to as Promoter 1)
2. Chr2: GRCh37/hg19; 179672954-179671159 -> ~1.8kb (referred to as Promoter 2)
Targeting sequences were specified by the 21-nucleotide segment adjacent to a protospacer adjacent motif (PAM) having the sequence NNGRRT (5’-21nt targeting sequence-NNGRRT-3’), and were filtered to include mostly those with a perfect match (targeting sequence and PAM sequences) for the corresponding region of the cynomolgus monkey (Macaca fascicularis) genome (listed as “Y” in Table 1).

Table 1 (Table 1-1 to Table 1-4) Targeting sequences used to screen putative promoter region of TTN gene.

Construction of lentiviral transfer plasmid (pED176)
pLentiCRISPRv2 was purchased from Genscript (https://www.genscript.com) and the following modifications were made: the SpCas9 gRNA scaffold sequence was replaced by SaCas9 gRNA scaffold sequence; SpCas9-FLAG was replaced with dSaCas9 fused to codon optimized VP64-miniRTA (also referred to as mini-VR). MiniVR transcriptional activation domains can activate gene expression when localized to promoters by activating transcription. MiniVR was tethered to the C-terminus of dSaCas9 (D10A and N580A mutant), which is referred to as dSaCas9-miniVR hereinafter, and targeted to human TTN gene regulatory regions as directed by gRNA comprising crRNA encoded by each targeting sequence. The generated backbone plasmid was named pED176

gRNA cloning
Three control non-targeting sequences (Table 1, SEQ ID NOs: 1 through 3) and 70 targeting sequences (Table 1, SEQ ID NOs: 4 through 73) were cloned into pED176. Forward and reverse oligos were synthesized by Integrated DNA Technologies in the following format: Forward; 5’ CACC(G)-20 or 21 base pair targeting sequence - 3’, and Reverse: 5’ AAAC - 20 or 21 base pair reverse complement targeting sequence - (C) - 3’, where bases in parenthesis were added if the target did not begin with a G. Oligos were resuspended in Tris-EDTA buffer (pH 8.0) at 100 μM. 1 μl of each complementary oligo were combined in a 10 μl reaction in NEBuffer 3.1 (New England Biolabs (NEB) # B7203S). The reaction was heated to 95°C and allowed to cool to 25°C in a thermocycler, thus annealing oligos with sticky end overhangs compatible with cloning to pED176. Annealed oligos were combined with lentiviral transfer plasmid pED176 which had been digested with BsmBI, gel purified, and ligated with T4 DNA ligase (NEB # M0202S) according to manufacturer’s protocol. A total of 2 μl of the ligation reaction was transformed into 10 μl of NEB Stable Competent cells (NEB # C3040I) according to the manufacturer’s protocol. The resulting construct drives expression of sgRNAs comprising crRNA encoded by individual targeting sequences fused to their 3’ end with tracrRNA (guuuuaguacucuggaaacagaaucuacuaaaacaaggcaaaaugccguguuuaucucgucaacuuguuggcgagauuuuuu (SEQ ID NO: 93)), which is encoded from the SaCas9 gRNA scaffold sequence added with a termination signal of U6 polymerase TTTTTT, by a U6 promoter.

Lentivirus Generation
HEK293TA cells were seeded at 0.75 x 10⁶ cells/well in 6 well cell culture dishes (VWR # 10062-892) in 2 ml growth medium (DMEM media supplemented with 10% FBS and penicillin/streptomycin (Thermo # 15140122)) and incubated at 37°C/5% CO₂ for 24 hours. The next day TransIT-VirusGEN transfection reactions were set up according to manufacturer’s protocol (Mirus # 6700) with 1.5 μg packaging plasmid mix [1μg packaging plasmid (see pCMV delta R8.2; addgene #12263) and 0.5 μg envelope expression plasmid (see pCMV-VSV-G; addgene #8454)] and 1 μg of transfer plasmid containing sequence encoding dSaCas9-VR and indicated sgRNAs. Lentivirus was harvested 48 hours following transfection by passing media supernatant through a 0.45 μm PES filter (VWR #10218-488). Until ready to use, the purified and aliquoted lentiviruses were stored in -80°C freezer.

Transfection of HEK293 cells
HEK293FT cells were seeded at 0.25 x 10⁶ cells/well in 12 well cell culture dishes (VWR # 10062-894) in 1 ml growth medium: DMEM media supplemented with 10% FBS, penicillin/streptomycin and incubated at 37°C/5% CO₂ for 24 hours. The next day Lipofectamine 2000 transfection reactions were set up according to manufacturer’s protocol (Thermo # 11668019) with 1 μg of transfer plasmid containing the sequence encoding dSaCas9-miniVR and indicated sgRNAs. At 24 hours post-transfection, culture media was changed to selection medium (DMEM media supplemented with 10% FBS and antibiotics with the addition of 1 μg/ml puromycin (Sigma Aldrich # P8833)). Cells were then incubated at 37°C/5% CO₂ for 48 hours. RNA was then harvested from cells surviving selection using the Qiagen RNeasy Plus Kit (Qiagen # 74192) following the manufacturers protocol. Isolated RNA was stored in -80°C freezer until use.

Transduction of SkMC cells
Primary human skeletal muscle cells (SkMC) were obtained from PromoCell (#C-12530). The cells were cultured in Skeletal Muscle Cell Growth Medium with supplements (PromoCell #C-23160). For transduction, cells were seeded at 0.10 x 10⁶ cells/well in 12 well cell culture dishes (VWR # 10062-894) containing growth medium and incubated at 37°C/5% CO₂ for 24 hours. The next day, 1 ml growth medium supplemented with 5 μg/ml Polybrene (Sigma # TR-1003-G) and 0.3 ml lentivirus supernatant (see above) corresponding to each sgRNA comprising crRNA encoded by individual targeting sequences (Table 1) and tracrRNA was added to each well. Cells were incubated with lentivirus for 24 hours before viral media was removed and replaced with fresh growth medium. 24 hours after transduction, cells were fed selection medium [growth media supplemented with 1 μg/ml puromycin (Sigma Aldrich # P8833)]. After 48 hours of selection, culture media was replaced with non-selection media and cells were allowed to recover for 24 hours. Cells were harvested and RNA extracted with RNeasy 96 kit (Qiagen # 74182) as directed by manufacturer.

Gene expression analysis
For gene expression analysis, cDNA was generated from 1 μg of total RNA according to High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems; ThermoFisher # 4368813) protocol in a 10 μl volume. cDNA was diluted 10-fold and analyzed using Taqman Fast Advanced Master Mix (Thermo Fisher # 4444557) according to the manufacturer’s protocol. Taqman probes (TTN: Assay Id Hs00399225_m1 FAM; HPRT1: Assay Id Hs02800695_m1 FAM) were obtained from Life Technologies. Taqman probe-based real-time PCR reactions were processed and analyzed by QuantStudio 5 Real-Time PCR system as directed by Taqman Fast Advanced Master Mix protocol.

Data analysis
For each sample and three controls, deltaCt values were calculated by subtracting the average Ct values from 3 technical replicates of the TTN probe from the HPRT1 probe (Average Ct TTN - Average Ct HPRT1). Expression values were determined for each sample using the formula 2^-(deltaCt). Sample expression values (Table 1; SEQ IDs 4 through 73) were then normalized to the average of 3 control expression values (Table 1; SEQ IDs 1 through 3) for each experiment to determine the relative TTN expression for each sample.

Results
Activation of TTN gene expression by the RNP
Expression cassettes for dSaCas9-miniVR and sgRNA for each targeting sequence were delivered to HEK293FT and primary SkMC cells by transfection and lentivirus transduction, respectively. Cells were selected for resistance to puromycin, and TTN expression was quantified using a target specific Taqman Gene Expression Assay. Expression values from each sample were normalized to an average of TTN expression in cells transduced with control sgRNAs.

As shown in Figure 2, out of 70 tested sequences in Promoter 1 and Promoter 2, 23 sgRNAs produced a >15-fold induction of TTN gene expression in HEK293FT cells following transfection. The top 13 performing sgRNAs (SEQ IDs 36, 37, 38, 39, 46, 47, 51, 52, 56, 65, 66, 67, 69) from the HEK293FT screen were then tested in SkMC using lentivirus transduction which revealed four sgRNAs produced >2-fold induction of TTN gene expression (Figure 3, SEQ IDs 38, 65, 66, 69).

All patents and other references mentioned above are incorporated in full herein by this reference, the same as if set forth at length.

According to the present invention, the expression of TTN gene in muscle cell derived from a myopathy patient can be upregulated. Thus, the present invention is expected to be extremely useful for the treatment and/or prevention of myopathy.
This application is based on US provisional patent application No. 63/325,746 (filing date: March 31, 2022) filed in US, the contents of which is incorporated in full herein.

Claims

A polynucleotide comprising the following base sequences:
(a) a base sequence encoding a fusion protein of a nuclease-deficient CRISPR effector protein and a transcription activator, and
(b) a base sequence encoding a guide RNA targeting a continuous region set forth in SEQ ID NO: 36, 37, 38, 39, 46, 47, 51, 52, 56, 65, 66, 67 or 69 in the putative promoter region of human TTN gene.
The polynucleotide according to claim 1, wherein the base sequence encoding the guide RNA comprises the base sequence set forth in SEQ ID NO: 36, 37, 38, 39, 46, 47, 51, 52, 56, 65, 66, 67 or 69, or said base sequence in which 1 to 3 nucleotides are deleted, substituted, inserted, and/or added.
The polynucleotide according to claim 1, wherein the transcription activator is selected from the group consisting of VP64, VP160, VPH, VPR, VP64-miniRTA (miniVR), and microVR, a variant thereof having transcription activation ability.
The polynucleotide according to claim 3, wherein the transcription activator is miniVR.
The polynucleotide according to claim 1, wherein the nuclease-deficient CRISPR effector protein is dCas9.
The polynucleotide according to claim 5, wherein the dCas9 is derived from Staphylococcus aureus.
The polynucleotide according to claim 1, further comprising a promoter sequence for the base sequence encoding the guide RNA and/or a promoter sequence for the base sequence encoding the fusion protein of the nuclease-deficient CRISPR effector protein and the transcription activator.
The polynucleotide according to claim 7, wherein the promoter sequence for the base sequence encoding the guide RNA is selected from the group consisting of U6 promoter, SNR6 promoter, SNR52 promoter, SCR1 promoter, RPR1 promoter, U3 promoter, and H1 promoter.
The polynucleotide according to claim 8, wherein the promoter sequence for the base sequence encoding the guide RNA is U6 promoter.
The polynucleotide according to claim 7, wherein the promoter sequence for the base sequence encoding the fusion protein of the nuclease-deficient CRISPR effector protein and the transcription activator is ubiquitous promoter or muscle specific promoter.
The polynucleotide according to claim 10, wherein the ubiquitous promoter is selected from the group consisting of EFS promoter, CMV promoter and CAG promoter.
The polynucleotide according to claim 11, wherein the muscle specific promoter is selected from the group consisting of CK8 promoter, myosin heavy chain kinase (MHCK) promoter, muscle creatine kinase (MCK) promoter, synthetic C5-12(Syn) promoter and unc45b promoter.
A vector comprising a polynucleotide of claim 12.
The vector according to claim 13, wherein the vector is a plasmid vector or a viral vector.
The vector according to claim 14, wherein the viral vector is selected from the group consisting of adeno-associated virus (AAV) vector, adenovirus vector, and lentivirus vector.
The vector according to claim 15, wherein the AAV vector is selected from the group consisting of AAV1, AAV2, AAV6, AAV7, AAV8, AAV9, and a variant thereof.
An agent for treating or preventing myopathy, comprising a polynucleotide of claim 1 or a vector of claim 13.
A method for treating or preventing myopathy, comprising administering a polynucleotide of claim 1 or a vector of claim 13 to a subject in need thereof.
Use of a polynucleotide of claim 1 or a vector of claim 13 for the treatment or prevention of myopathy.
Use of a polynucleotide of claim 1 or a vector of claim 13 in the manufacture of a pharmaceutical composition for the treatment or prevention of myopathy.
A method for upregulating expression of human TTN gene in a cell, comprising expressing
(c) a fusion protein of a nuclease-deficient CRISPR effector protein and a transcription activator, and
(d) a guide RNA targeting a continuous region set forth in SEQ ID NO: 36, 37, 38, 39, 46, 47, 51, 52, 56, 65, 66, 67 or 69 in the putative promoter region of human TTN gene,
in the aforementioned cell.
A ribonucleoprotein comprising the following:
(c) a fusion protein of a nuclease-deficient CRISPR effector protein and a transcription activator, and
(d) a guide RNA targeting a continuous region set forth in SEQ ID NO: 36, 37, 38, 39, 46, 47, 51, 52, 56, 65, 66, 67 or 69 in the putative promoter region of human TTN gene.
A kit comprising the following for upregulation of the expression of the human TTN gene:
(e) a fusion protein of a nuclease-deficient CRISPR effector protein and a transcription activator, or a polynucleotide encoding the fusion protein, and
(f) a guide RNA targeting a continuous region set forth in SEQ ID NO: 36, 37, 38, 39, 46, 47, 51, 52, 56, 65, 66, 67 or 69 in the putative promoter region of human TTN gene, or a polynucleotide encoding the guide RNA.
A method for treating or preventing myopathy, comprising administering the following (e) and (f):
(e) a fusion protein of a nuclease-deficient CRISPR effector protein and a transcription activator, or a polynucleotide encoding the fusion protein, and
(f) a guide RNA targeting a continuous region set forth in SEQ ID NO: 36, 37, 38, 39, 46, 47, 51, 52, 56, 65, 66, 67 or 69 in the putative promoter region of human TTN gene, or a polynucleotide encoding the guide RNA.
Use of the following (e) and (f):
(e) a fusion protein of a nuclease-deficient CRISPR effector protein and a transcription activator, or a polynucleotide encoding the fusion protein, and
(f) a guide RNA targeting a continuous region set forth in SEQ ID NO: 36, 37, 38, 39, 46, 47, 51, 52, 56, 65, 66, 67 or 69 in the putative promoter region of human TTN gene, or a polynucleotide encoding the guide RNA,
in the manufacture of a pharmaceutical composition for the treatment or prevention of myopathy.