WO2020092221A1 - Method of treatment of p53 wt tumors - Google Patents
Method of treatment of p53 wt tumors Download PDFInfo
- Publication number
- WO2020092221A1 WO2020092221A1 PCT/US2019/058319 US2019058319W WO2020092221A1 WO 2020092221 A1 WO2020092221 A1 WO 2020092221A1 US 2019058319 W US2019058319 W US 2019058319W WO 2020092221 A1 WO2020092221 A1 WO 2020092221A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- combination
- tumor
- mdm4
- inhibitor
- ckla
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
- A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/40—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
- A61K31/44—Non condensed pyridines; Hydrogenated derivatives thereof
- A61K31/4427—Non condensed pyridines; Hydrogenated derivatives thereof containing further heterocyclic ring systems
- A61K31/4439—Non condensed pyridines; Hydrogenated derivatives thereof containing further heterocyclic ring systems containing a five-membered ring with nitrogen as a ring hetero atom, e.g. omeprazole
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
- A61K31/44—Non condensed pyridines; Hydrogenated derivatives thereof
- A61K31/445—Non condensed piperidines, e.g. piperocaine
- A61K31/4523—Non condensed piperidines, e.g. piperocaine containing further heterocyclic ring systems
- A61K31/454—Non condensed piperidines, e.g. piperocaine containing further heterocyclic ring systems containing a five-membered ring with nitrogen as a ring hetero atom, e.g. pimozide, domperidone
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
- A61K31/496—Non-condensed piperazines containing further heterocyclic rings, e.g. rifampin, thiothixene or sparfloxacin
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
- A61K31/505—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
- A61K31/506—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim not condensed and containing further heterocyclic rings
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
- A61K31/505—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
- A61K31/513—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim having oxo groups directly attached to the heterocyclic ring, e.g. cytosine
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
- A61P35/02—Antineoplastic agents specific for leukemia
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K2300/00—Mixtures or combinations of active ingredients, wherein at least one active ingredient is fully defined in groups A61K31/00 - A61K41/00
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Definitions
- the present invention relates to methods of treating p53 wild type (WT) tumors.
- WT wild type
- the invention provides novel therapies for p53 WT tumors based on the combination of an Mouse Double Minute 2 (MDM2) inhibitor together with a Casein Kinase 1 alpha (CKla) degrading agent and/or an MDM4 inhibitor.
- MDM2 Mouse Double Minute 2
- CKla Casein Kinase 1 alpha
- Merkel cell carcinoma is an aggressive neuroendocrine carcinoma of the skin with an incidence in the United States that has tripled in the last two decades[l, 2] In 2008, Feng et al. discovered Merkel cell polyomavirus (MCV, MCPyV) clonally integrated in 8 of 10 MCC tumors[3] MCV positive MCC contains integrated copies of the MCV genome and expresses small T antigen (ST) and a truncated form of large T antigen (LT)[4] MCC tumor associated truncated LT retains the N-terminal LXCXE, RB-binding motif, but deletes the C-terminal DNA-binding and helicase domains required for viral replication[3] . Expression of MCV ST and truncated LT can promote proliferation and transformation in several cell types, consistent with their oncogenic roles in MCC [5]
- the prototypic polyomavirus Simian vacuolating virus 40 (SV40) LT binds to the
- Retinoblastoma-associated protein RB (RBI) and the cellular tumor antigen p53 (TP53) and inactivates their tumor suppressive functions [6]
- MCV LT binds to RB but not p53[6].
- Next generation sequencing of MCC reveals that virus-negative MCC typically harbors p53 and RB mutations along with a UV damage signature [7, 8]
- virus-positive MCC usually contains wild type RB and p53 and no evidence for UV damage [7, 8] Given the presence of wild type p53 in virus-positive MCC, the present inventors suspected that MCV T antigens could functionally inactivate p53 activity.
- p53 is mutated in a wide variety of cancers.
- wild type p53 can be functionally inactivated by overexpression of MDM2, a ubiquitin ligase targeting p53, or MDM4 (MDMX)[9, 10]
- MDM2 and MDM4 both have similar structures with N-terminal p53 binding and C-terminal RING domains[l 1]
- MDM4 does not directly ubiquitinate p53, its RING domain facilitates recruitment of ubiquitin to MDM2[11]
- MDM4 also has an auto-inhibitory domain that reduces binding to p53[12].
- the MDM4 auto-inhibitory interaction can be relieved by Casein kinase 1 alpha (CK1 a, CSNK1A1)[13]
- the present invention provides novel combinations comprising an MDM2 inhibitor and Casein Kinase 1 alpha (CKla) degrading agent and/or an MDM4 inhibitor for use in treating a p53 WT tumor in a subject.
- CKla Casein Kinase 1 alpha
- the MDM2 inhibitor may be selected from the group consisting of nutlin-3, idasanutlin (RG7388, RO5503781, Roche), RG7775
- HDM201 preferably is HDM201, i.e.
- the Casein Kinase 1 alpha (CKla) degrading agent and/or an MDM4 inhibitor be selected from the group consisting of thalidomide, pomalidomide, lenalidomide and SC-24-UR99 (Novartis), i.e. 4-(3-amino-l-(4-chloro-5-methyl-6- (methylamino)pyridin-3-yl)-5-fluoro-lH-indazol-6-yl)naphthalen-l-ol, preferably is lenalidomide, i.e. (RS)-3-(7-Amino-3-oxo-lH-isoindol-2-yl)piperidin-2,6-dion, also referred to as REVLIMID.
- the present inventions provide such combinations in particular with the MDM2 inhibitor HDM201 and the CKla degrading agent lenalidomide.
- the combinations according to the present invention may comprise further anti-cancer agent(s).
- anti-cancer agents according to the present invention may be selected from:
- FLT3 inhibitors e.g. gilterinib, quizartinib, midostaurin
- BCF2 inhibitors e.g. navitoclax, venetoclax
- MDM2 inhibitors e.g. nutlin-3, idasanutlin, AMG232, DS-3032B,
- hypomethylating agents e.g. Vidaza [azacytidine, 5-azacytidine], Dacogen
- anthracyclines e.g. idarubicin, daunorubicin, doxorubicin, epirubicin
- anti-CD33 antibodies e.g. Mylotarg [gemtuzumab], vadastuximab
- P53 WT tumors which may be treated by the combinations in accordance with the present invention may be solid tumors or hematological tumors.
- Solid tumor may be sarcomas, e.g.
- lymphomas e.g. non-Hodgkin's lymphoma (NHL), in particular, Mantle cell lymphoma (MCL), melanomas, e.g. skin melanoma or uveal melanoma, blastomas (e.g. neuroblastoma), colon tumor, colorectal tumor, kidney tumor, and liver tumor or skin cancer, e.g. Merkel cell carcinoma (MCC), in particular Merkel cell polyomavirus (MCV) positive MCC.
- Hematological tumor may be acute myeloid leukemia (AML), multiple myeloma (MM), myelodysplastic syndrome (MDS), or acute lymphoblastic leukemia (ALL).
- the present invention provides the following embodiments:
- a combination comprising (a) an mouse double minute 2 (MDM2) inhibitor and (b) a Casein Kinase 1 alpha (CKla) degrading agent and/or a mouse double minute 4 (MDM4) inhibitor.
- MDM2 mouse double minute 2
- CKla Casein Kinase 1 alpha
- a combination comprising (a) an MDM2 inhibitor and (b) a CKla degrading agent and/or an MDM4 inhibitor for use in treating a p53 wild type (WT) tumor in a subject.
- a method of treating a p53 WT tumor in a subject comprising administering to the subject a combination of (a) an MDM2 inhibitor and (b) a CKla degrading agent and/or an MDM4 inhibitor.
- MDM2 inhibitor is selected from the group consisting of nutlin-3, idasanutlin (RG7388, RO5503781), RG7775 (R06839921), AMG232, DS3032 (DS3032b), ALRN-6924, ATSP-7041, CGM097, and HDM201, i.e.
- sarcomas e.g. liposarcoma or soft tissue sarcoma
- lymphomas e.g. non-Hodgkin's lymphoma (NHL), in particular, Mantle cell lymphoma (MCL), melanomas, e.g. skin melanoma or uveal melanoma, blastomas (e.g.
- MCC Merkel cell carcinoma
- hematological tumor is selected from the group consisting of acute myeloid leukemia (AML), multiple myeloma (MM), myelodysplastic syndrome (MDS), and acute lymphoblastic leukemia (ALL).
- AML acute myeloid leukemia
- MM multiple myeloma
- MDS myelodysplastic syndrome
- ALL acute lymphoblastic leukemia
- MM multiple myeloma
- MDS myelodysplastic syndrome
- the combinations described herein can provide a beneficial anti -cancer effect, e.g., an enhanced anti-cancer effect, reduced toxicity, and/or reduced side effects.
- a first therapeutic agent e.g., any of the therapeutic agents disclosed herein
- a second therapeutic agent e.g., the one or more additional therapeutic agents, or all
- compositions and methods for treating proliferative disorders, including cancer, using the aforesaid combination therapies are disclosed.
- a method of treating a subject comprises administration of a combination as part of a therapeutic regimen.
- a therapeutic regimen comprises one or more, e.g., two, three, or four combinations described herein.
- the therapeutic regimen is administered to the subject in at least one phase, and optionally two phases, e.g., a first phase and a second phase.
- the first phase comprises a dose escalation phase.
- the first phase comprises one or more dose escalation phases, e.g., a first, second, or third dose escalation phase.
- the dose escalation phase comprises
- the second phase comprises a dose expansion phase.
- the dose expansion phase comprises administration of a combination comprising two, three, four, or more therapeutic agents, e.g., as described herein.
- the dose expansion phase comprises the same two, three, four, or more therapeutic agents as the dose escalation phase.
- the first dose escalation phase comprises administration of a combination comprising two therapeutic agents, e.g., two therapeutic agents described herein, wherein a maximum tolerated dose (MTD) or recommended dose for expansion (RDE) for one or both of the therapeutic agents of is determined.
- MTD maximum tolerated dose
- RDE recommended dose for expansion
- the second dose escalation phase comprises administration of a combination comprising three therapeutic agents, e.g., three therapeutic agents described herein, wherein a maximum tolerated dose (MTD) or recommended dose for expansion (RDE) for one, two, or all of the therapeutic agents is determined.
- MTD maximum tolerated dose
- RDE recommended dose for expansion
- the second dose escalation phase starts after the first dose escalation phase ends.
- the second dose escalation phase comprises administration of one or more of the therapeutic agents administered in the first dose escalation phase.
- the second dose escalation phase is performed without performing the first dose escalation phase.
- the third dose escalation phase comprises administration of a combination comprising four therapeutic agents, e.g., four therapeutic agents described herein, wherein a maximum tolerated dose (MTD) or recommended dose for expansion (RDE) of one, two, three, or all of the therapeutic agents is determined.
- the third dose escalation phase starts after the first or second dose escalation phase ends.
- the third dose escalation phase comprises administration of one or more ⁇ e.g., all) of therapeutic agents administered in the second dose escalation phase.
- the third dose escalation phase comprises administration of one or more of the therapeutic agents administered in the first dose escalation phase.
- the third dose escalation phase is performed without performing the first, second, or both dose escalation phases.
- the dose expansion phase starts after the first, second or third dose escalation phase ends.
- the dose expansion phase comprises administration of a combination administered in the dose escalation phase, e.g., the first, second, or third dose escalation phase.
- a biopsy is obtained from a subject in the dose expansion phase.
- a therapeutic regimen comprising a dose escalation phase and a dose expansion phase allows for entry of new agents or regiments for combination, rapid generation of combinations, and/or assessment of safety and activity of tolerable combinations.
- the present inventors demonstrate that MCV ST functions as a transcriptional activator to increase levels of MDM2 and CKla that in turn cooperate with MDM4 to inhibit p53 function in MCC.
- the present inventors further demonstrate the synergistic efficacy of targeting both MDM2 and MDM4 in MCC.
- Merkel cell carcinoma is an aggressive skin cancer. While virus-negative (Merkel cell polyomavirus, MCV) MCC contains inactivating mutations in RB and p53, MCV-positive MCC usually contains wild type RB and p53.
- MCV virus-negative
- MCV-positive MCC usually contains wild type RB and p53.
- the present inventors demonstrate that MCV large T antigen binding to RB results in p53 activation, while MCV small T antigen reduces p53 activation by increasing levels of MDM2 and CKla, an activator of MDM4.
- Targeted degradation of CKla by lenalidomide or a specific MDM4 inhibitor acts synergistically with MDM2 inhibitors to activate p53 and induce apoptosis.
- the present inventors’ work uncovers the mechanism behind MCV control of p53 in MCC and demonstrates the utility of targeting MDM2 and MDM4 combinatorically in p53 wild type tumors.
- Merkel cell polyomavirus contributes to approximately 80% of all Merkel cell carcinomas (MCC), a highly aggressive neuroendocrine carcinoma of the skin.
- MCV-positive MCC expresses small T antigen (ST) and a truncated form of large T antigen (LT) and usually contains wild type p53 (TP53) and RB (RB1).
- TP53 wild type p53
- RB RB
- virus-negative MCC contains inactivating mutations in TP53 and RB1.
- the MCV truncated LT can bind and inhibit RB, it does not bind p53.
- the present inventors disclose here that MCV LT binds to RB leading to increased levels of ARF, an inhibitor of MDM2, and activation of p53.
- MCV ST reduced p53 activation.
- MCV ST recruits the MYC homologue MYCL (L-Myc) to the EP400 chromatin remodeler complex and transactivates specific target genes.
- L-Myc MYC homologue MYCL
- the present inventors observed that depletion of EP400 in MCV-positive MCC cell lines led to increased p53 target gene expression.
- the present inventors suspected that the MCV ST-MYCL-EP400 complex could functionally inactivate p53 but the underlying mechanism was not known.
- Integrated ChIP and RNA-seq analysis following EP400 depletion identified MDM2 as well as CKla, an activator of MDM4, as target genes of the ST-MYCL-EP400 complex.
- MCV- positive MCC cells expressed high levels of MDM4.
- MDM2 inhibitors with lenalidomide targeting CKla or an MDM4 inhibitor caused synergistic activation of p53 leading to an apoptotic response in MCV-positive MCC cells and MCC-derived xenografts in mice. These results support dual targeting of MDM2 and MDM4 in virus-positive MCC and other p53 wild type tumors.
- Fig. 1 Merkel cell polyomavirus large T antigen activates and small T antigen dampens the p53 response.
- IMR90 cells were induced to express GFP, ST, LT-L21 or LT-L21 with ST for 40 hours. Lysates were prepared before (-) or after (+) DOX. Activation of p53 response is reflected by increased levels of p53, phospho-Serine 15 p53 (P-p53), acetyl-lysine 382 p53 (Ac-p53), p2l and cleaved PARP (**).
- MDM2 and CKla are transcriptional targets of the ST-MYCL-EP400 complex.
- RT-qPCR was performed with MKL-l cells after shRNA was induced for 8 days. Reads were normalized to RPLP0 and un-induced samples. The experiment was performed three times and averaged. Data are shown as mean ⁇ SD; *student t-test P ⁇ 0.05, **P ⁇ 0.005, ***P ⁇ 0.0005, ****p ⁇ 0.00005.
- MKL-l cells were transduced with specific shRNAs for five days and harvested for western blotting.
- Nutlin-3 treatment does not elicit p53 response, but MCV T antigens increase levels of MDM2, MDM4 and CKla in IMR90 cells expressing p53DD.
- MKL-l and IMR90- p53DD were treated with Nutlin-3(lpM) for 24 hours.
- RNA from MCC cell lines and human foreskin fibroblasts(HFF) was harvested for RT-qPCR for MDM4 (total), MDM4-FL (full-length variant), and MDM4-S (short splice variant).
- MDM4 levels were normalized with the geomean of RPLP0, 18s rRNA and beta- actin RNA controls. Data are shown as mean ⁇ SD; *student t-test PO.05 for MDM4-FL.
- Lenalidomide enhances p53 activation by nutlin-3 in MKL-l.
- MKL-l cells were treated with nutlin-3 (5mM), lenalidomide (Len, 10mM) or both for 40 hours.
- MKL-l MCV+ MCC
- UISO MCV- MCC
- ImM lenalidomide
- UISO has less MDM2 and MDM4 proteins than MKL-l.
- MKL-l cells were treated with nutlin-3 (5mM), lenalidomide (10mM) or both for 40 hours and harvested for immunoprecipitation with antibodies to MDM4, p53 and CK1 a followed by western blotting.
- MDM4 inhibitor SC-24-UR99 cooperates with MDM2 inhibitors in activating p53.
- MKL-l cells were treated with nutlin-3 (ImM) or HDM201 (0. ImM) with or without lenalidomide (ImM) or UR99 (0.1 mM).
- MKL-l and MS-l cells were treated with MDM2 inhibitors, nutlin-3, RG7388 or AMG232 at several concentrations and XTT assay was performed after 96 hours of treatment. **multiple t-test p-value ⁇ 0.005.
- B. Bliss synergy test displays a strong synergy between nutlin-3 and lenalidomide or SC-24-UR99 but not with thalidomide.
- BH3 profiling was performed with MKL-l cells treated with lenalidomide, nutlin-3 or both drugs for 16 hours. The experiment was performed three times. Data are shown as mean ⁇ SD; *student t-test P ⁇ 0.05.
- HDM201 40 mg/kg
- lenalidomide 50 mg/kg
- both drugs were administered orally daily starting when xenograft tumors were 200mm3.
- Data are shown as mean ⁇ SEM; multiple t-test between HDM201 and combination treatments * P ⁇ 0.05 # -the study was terminated because the tumor volume reached maximum permissible size.
- E. Model Merkel cell polyomavirus T antigens sensitize Merkel cell carcinoma for targeting the p53-MDM2-MDM4 pathway.
- Fig. 6 (herein also referred to as Fig. Sl).
- RT-qPCR shows that LT-L21 induction in IMR90 cells increases levels of known p53 target gene p2l.
- L21-LT either alone or with ST as splice variants, was induced for 4, 8, 12, 16, 20, 24, 36, 48, 60 and 72 hours and RNA was harvested for RT-qPCR.
- the data shown is a representation of three independent experiments. **two-way ANOVA p-value ⁇ 0.005.
- the LXCXE LT mutant can bind to VPS39 but not RB.
- HCT116 cells stably expressing GFP, LT-L21 or LT-L21 E216K mutant were harvested for LT
- Fig. 7 (herein also referred to as Fig. S2).
- RNA-seq fold change of MDM2, CKla (CSNK1A1) and EP400 compared to control shRNA after depleting EP400 using two independent shRNAs displays reduced levels of MDM2 and CKla along with EP400. Adjusted p-values for Bonferroni correction are shown.
- MKL-l cells were induced to express EP400 or control shRNA for 8 days.
- Western blot shows decreased MDM2 and EP400 levels and increased p53 and p2l levels with EP400 shRNA.
- IMR90 cells stably expressing hTERT, p53DD, MYCL (IMR90-p53DD) with (+) or without (-) MCV T antigens (LT-L21 and ST) were blotted with indicated antibodies.
- Fig. 8 (herein also referred to as Fig. S3).
- MDM2 and MDM4 show frequent copy number gains (3-8 copies) and amplifications (>8 copies).
- Fig. 9 (herein also referred to as Fig. S4).
- Lenalidomide reduces CKla protein rapidly in MKL-l.
- MKL-l cells were treated with lenalidomide (Len, IOmM) and/or cycloheximide (CX, 5mM) for 2, 4 or 6 hours with or without the MG132 (IOmM).
- P53 is a positive control for the cycloheximide pulse chase treatment.
- MKL-l, WaGa, Peta, BroLi and MS-l MCV-positive MCC cell lines were treated with nutlin-3 (5mM) with or without lenalidomide (IOmM) for 40 hours.
- D. MKL-l cells were treated with nutlin-3, lenalidomide or both for 16 hours followed by cycloheximide treatment for 2 and 4 hours.
- Western blot bands were quantified using LiCor and normalized to the 0 hour time point for each treatment.
- p53 half-life is estimated to be 1.5 hours for DMSO and lenalidomide-treated samples and 4 hours for nutlin- 3-treated samples.
- Experiment was performed three times with data shown as mean ⁇ SD; **two-way ANOVA ⁇ 0.005.
- E. MKL-l cells were treated with nutlin-3 (5mM), lenalidomide (10mM) or both for 24 or 40 hours and harvested for IP -western blotting with MDM4, p53 and CKla.
- Fig. 10 (herein also referred to as Fig. S5).
- A-C MKL-l cells were treated with nutlin-3 (A), RG7388 (B), or AMG232 (C) with or without lenalidomide (fixed concentration of 5mM).
- XTT was performed at 96 hours treatment.
- Fig. 11 (herein also referred to as Fig. S6).
- LT activates and ST dampens the p53 response.
- a doxycycline inducible vector expressing GFP or tumor derived truncated or full-length forms of LT was introduced into IMR90 diploid lung fibroblasts (Fig. 1A, SI A).
- the truncated forms of LT include L21 (encoding residues 1- 292), 162 (residues 1-320) and 168(residues 1-275) each containing an intact LXCXE motif[6] LT- L21 or LT-162 expression in IMR90 significantly increased levels of ARF and several p53 target genes including GDF15 and p21 (CDKN1A) as assessed by RT-qPCR (Fig. 1A).
- ARF is a potent inhibitor of the major p53 degrading E3 ligase MDM2[14]
- LT expression increased protein levels of p53 as well as phospho-Serine 15 p53 (P-p53) and p21 indicative of p53 activation (S1A).
- Expression of LT-162 also led to increased levels of cleaved PARP (**), indicating an apoptotic response.
- LT and ST are co-expressed as splice variants from the integrated MCPy V viral DNA in MCC tumors.
- the present inventors introduced a genomic version of LT-L21 that co-expresses ST.
- ST was co-expressed with LT-L21
- lower levels of p53 activation p21, p-p53 and acetyl-Lysine 382 or Ac-p53
- Fig. IB, SIB The results indicate that truncated LT can activate p53 while ST can reduce this response when coexpressed.
- L21-E216K LXCXE motif
- S1C LXCXE motif
- MDM2 and CKla are transcriptional targets of the ST-MYCL- EP400 complex.
- RNA-seq was performed after depleting EP400 using three different shRNAs[15] Using the reported RNA-seq results, the present inventors assessed changes in gene expression of known p53 target genes[9] EP400 depletion led to increased levels of many p53 target genes including p21
- MDM2 and MDM4 contain an N-terminal p53-binding domain that binds directly to the transactivation domain of p53 to block p53 activation[l l] MDM4 can regulate its own activity toward p53.
- CKla (CSNK1A) is a serine/threonine kinase that binds and phosphorylates MDM4, which in turn prevents this auto-inhibitory interaction and activates
- MDM4[13] RT-qPCR and western blotting confirmed that p21 levels increased and MDM2 and CKla levels decreased upon EP400 knockdown in MKL-1 cells (Fig. 2B, SIC).
- This result together with the RT-qPCR and ChIP data indicates that MDM2 and CKla are direct transcriptional targets of the ST-MYCL-EP400 complex.
- MDM4 levels decreased upon depletion of ST although the present inventors did not find evidence for direct activation of MDM4 by ST.
- MDM2 is a p53 target gene
- MCV T antigens indirectly increase MDM2 levels by activating p53[9].
- the present inventors introduced a dominant-negative version of p53 (p53DD) that binds and inactivates the endogenous p53 into IMR90 cells[17].
- the IMR90-p53DD cells were further transduced with MYCL and MCV LT-L21 with ST[17]
- the present inventors detected ST binding to the MDM2 and CKla promoters by ChIP-qPCR and observed that EP400 enrichment to the MDM2 promoter increased in the presence of MCV T antigens (Fig. 2E, S2F).
- MDM2 inhibitor treatment with nutlin-3 did not increase p53, p-p53 and PUMA levels, indicative of p53 activation (Fig 2F, SID).
- the present inventors depleted p53 in MKE-1 with shRNA and performed ChIP-qPCR of EP400 and ST (S2G). The present inventors found that p53 did not affect EP400 and ST enrichment to the MDM2 and CKla promoters. These results indicate that MCV ST transactivates MDM2 and CKla in MCC and IMR90 cells, independently of p53.
- MDM4 is overexpressed in virus-positive MCC.
- MDM4 Overexpression of MDM4 can be found in some cancers with wild type p53[18].
- the present inventors used three sets of MDM4 primers to assess total MDM4 (all splice variants), MDM4-FE (Full length) and MDM4-S (short variant missing the RING domain) levels in MCC cell lines[18].
- Virus-positive (MKF-1, MKF-2, MS-1, WaGa, PeTa, and BroFi) MCC cell lines had significantly higher levels of total MDM4 and MDM4-FF relative to the virus-negative (UISO, MCC13, and MCC26) MCC lines (Fig. 3A).
- the MDM4-FF to MDM4-S ratio was higher in virus positive lines (S3 A).
- the present inventors assessed MDM4-FF protein levels in these MCC cell lines.
- Virus-positive MCC cell lines expressed high levels of MDM4-FF compared to virus-negative MCC cells lines (Fig. 3B).
- the virus-negative UISO cell line had a high MDM4-FF to MDM4-S ratio but did not express abundant levels of MDM4 protein (Fig. 3A, S3A).
- FT’s activation of p53 in virus positive MCC may create dependency on MDM2 and MDM4 expression.
- Targeted next-generation sequencing (Oncopanel) of 101 MCC tumors revealed frequent low copy gains (3-8 copies) of MDM4 regardless of the presence of MCV (S3B)[19]
- the present inventors observed that nutlin-3 MDM2 inhibitor treatment activated p53 as shown by increased levels of total p53, P-p53, Ac-p53, p21 and PUMA in MKF-1, WaGa, PeTa and BroFi MCC cell lines containing wild type p53, but not in MS-1 cells harboring an inactivating p53 mutation (Fig. 2F, Fig. 4 A, S2B)[20]
- CRBN (Cereblon) E3 ligase can specifically target CKla for ubiquitination in the presence of lenalidomide[21, 22]
- the present inventors assessed whether lenalidomide could decrease CKla levels and activate p53 in MCC cells.
- MKL-1 cells were treated with lenalidomide with or without cycloheximide to block protein synthesis. Although CKla levels did not change appreciably with cycloheximide treatment for 6 hours, levels rapidly decreased following addition of lenalidomide (S4A).
- Lenalidomide treatment alone had a modest positive effect on p53 levels. However, when nutlin-3 and lenalidomide were combined, larger increases in p53 and p53 target genes were observed in the cell lines with wild type p53 (Fig. 4A, S4B).
- the present inventors assessed p53 stability in MKL-1 cells treated with nutlin-3, lenalidomide or both in the presence of cycloheximide by quantitative western blotting (S4D). Lenalidomide significantly increased the stability of p53 in the presence of nutlin-3[23]. Depletion of CKla by lenalidomide may decrease MDM4’s activities towards p53.
- CKla enables MDM4 binding to p53
- the present inventors expected that loss of CKla would reduce MDM4 binding to p53 and enhance p53 activation [13]
- the present inventors depleted CKla in MKL-1 by two independent CRISPR sgRNAs and assessed p53 activation following nutlin-3 treatment (Fig. 4E)[24]
- CRISPR knockout of CKla led to increased p53 activity assessed by increased levels of activated MDM2 (phospho-Serine 166, P-MDM2), P-p53, p53 and p21, indicating that a reduction of CKla, either by lenalidomide or sgRNAs, enhances p53 activation[25].
- Lenalidomide synergizes with MDM2 inhibitors to induce apoptosis in MCC cell lines.
- MKL-1 p53 wild type
- MS-1 p53 mutant
- Fig. 5 A MKL-1 but not MS-1 cells were sensitive to all three MDM2 inhibitors
- the present inventors tested the effect of combining lenalidomide with nutlin-3, RG7388 and AMG232 and observed significantly improved cytotoxicity of all three MDM2 inhibitors when used with lenalidomide (S5A-D). Synergy testing using the Compusyn (S6A) and Bliss (Fig.
- the present inventors treated MKL-1 MCC xenografts with HDM201 (suitable for in vivo efficacy studies) with or without lenalidomide (Fig. 5D, Table S3).
- the present inventors found that addition of lenalidomide greatly enhances the efficacy of HDM201, providing a potential for clinical utility of the combinational therapy for p53 wild type tumors expressing MDM2 and MDM4.
- the present inventors propose a model where MCV T antigens increase the dependence on MDM2, MDM4 and CKla to suppress p53 activity with therapeutic potential in virus-positive MCC (Fig. 5E).
- Lenalidomide has been used to treat malignancies, myelodysplastic syndrome (MDS) and multiple myeloma (MM)[21] It was reported that mutant CSNK1A1 predicts for a poor prognosis in lenalidomide-treated MDS[33] Furthermore, MDS with mutant p53 respond less well to lenalidomide and is more likely to progress to acute myeloid leukemia compared to MDS with wild type p53, indicating that lenalidomide’ s effects may be partially dependent on inactivating MDM4[34] The present inventors’ work provides the rationale for the combination of lenalidomide with MDM2 inhibitors in MCC and in other solid tumors and hematologic malignancies containing wild type p53.
- lenalidomide may be administered orally, e.g. in the form of a capsule, in accordance with the prescribing information of REVLIMID, e.g. for MM combination therapy: 25 mg once daily orally on Days 1-21 of repeated 28-day cycles; for MM maintenance therapy following auto-HSCT: 10 mg once daily continuously on Days 1-28 of repeated 28-day cycles; for MDS: 10 mg once daily; for MCL: 25 mg once daily orally on Days 1-21 of repeated 28-day cycles. Dosing is continued or modified based on clinical and laboratory findings in case of renal impairment the starting dose is adjusted based on the creatinine clearance value.
- HDM201 may be administered orally, e.g. in the form of a capsule.
- the oral administration may use a high-dose intermittent regimen [e.g. Regimen A (50 mg - 400 mg HDM201 administered on day 1 of a 3-week cycle or Regimen B (50 mg - 150 mg HDM201 administered on days 1 and 8 of a 4-wk cycle) or regimen C (50 mg - 500 mg HDM201 administered on day 1 of a 4-week cycle], or a low-dose extended regimen [e.g. Regimen D (10 mg - 30 mg HDM201 once daily for the first 2 weeks of a 4-week cycle) or Regimen E (15 mg - 50 mg HDM201 once daily for the first week of a 4-week cycle)].
- Regimen A 50 mg - 400 mg HDM201 administered on day 1 of a 3-week cycle
- Regimen B 50 mg - 150 mg HDM201 administered on days 1 and 8 of a 4-wk cycle
- regimen C 50 mg - 500 mg HDM201 administered on day 1 of a 4-
- idasanutlin may be administered orally, e.g. in the form of a capsule, daily or twice daily on days 1-5 of each 28 days treatment cycle.
- the daily dose may be from 100 mg to 1000 mg.
- SC-24-UR99 may be administered intravenously or orally, e.g. in the form of an solution or capsule.
- the administration may use a high-dose intermittent regimen [e.g. Regimen A (10 mg - 1000 mg SC-24-UR99 administered on day 1 of a 3-week cycle or Regimen B (5 mg - 500 mg SC-24-UR99 administered on days 1 and 8 of a 4-wk cycle) or regimen C (100 mg - 1000 mg SC- 24-UR99 administered on day 1 of a 4-week cycle], or a low-dose extended regimen [e.g. Regimen D (1 mg - 100 mg SC-24-UR99 once daily for the first 2 weeks of a 4-week cycle) or Regimen E (1 mg - 200 mg SC-24-UR99 once daily for the first week of a 4-week cycle)].
- Regimen A (10 mg - 1000 mg SC-24-UR99 administered on day 1 of a 3-week cycle
- Regimen B (5 mg - 500 mg SC-24-UR99 administered on days 1 and 8 of a 4-wk cycle) or regimen
- GDF15 TAACCAGGCTGCGGGCCAAC CAGCCGCACTTCTGGCGTGA
- MDM2 CCTACCCAAAGTGATGGGATTA TCTGGTTGGAGAACGAAGATG
- the articles “a” and “an” refer to one or to more than one ( e.g ., to at least one) of the grammatical object of the article.
- “About” and “approximately” shall generally mean an acceptable degree of error for the quantity measured given the nature or precision of the measurements. Exemplary degrees of error are within 20 percent (%), typically, within 10%, and more typically, within 5% of a given value or range of values.
- the articles “a” and “an” refer to one or to more than one (e.g., to at least one) of the grammatical object of the article.
- “About” and “approximately” shall generally mean an acceptable degree of error for the quantity measured given the nature or precision of the measurements. Exemplary degrees of error are within 20 percent (%), typically, within 10%, and more typically, within 5% of a given value or range of values.
- the therapeutic agents in the combination can be administered concurrently with, prior to, or subsequent to, one or more other additional therapies or therapeutic agents.
- the therapeutic agents or therapeutic protocol can be administered in any order. In general, each agent will be administered at a dose and/or on a time schedule determined for that agent. It will further be appreciated that the additional therapeutic agent utilized in this combination may be administered together in a single composition or administered separately in different compositions. In general, it is expected that additional therapeutic agents utilized in combination be utilized at levels that do not exceed the levels at which they are utilized individually. In some embodiments, the levels utilized in combination will be lower than those utilized individually.
- the additional therapeutic agent is administered at a therapeutic or lower- than therapeutic dose.
- the concentration of the second therapeutic agent that is required to achieve inhibition e.g., growth inhibition
- the concentration of the first therapeutic agent that is required to achieve inhibition is lower when the first therapeutic agent is administered in combination with the second therapeutic agent than when the first therapeutic agent is administered individually.
- the concentration of the second therapeutic agent that is required to achieve inhibition is lower than the therapeutic dose of the second therapeutic agent as a monotherapy, e.g., 10-20%, 20-30%, 30-40%, 40-50%, 50-60%, 60-70%, 70-80%, or 80-90% lower.
- the concentration of the first therapeutic agent that is required to achieve inhibition is lower than the therapeutic dose of the first therapeutic agent as a monotherapy, e.g., 10-20%, 20-30%, 30- 40%, 40-50%, 50-60%, 60-70%, 70-80%, or 80-90% lower.
- inhibitortion includes a reduction in a certain parameter, e.g., an activity, of a given molecule, e.g., an immune checkpoint inhibitor.
- a certain parameter e.g., an activity, of a given molecule, e.g., an immune checkpoint inhibitor.
- inhibition of an activity e.g., an activity of a given molecule, e.g., an inhibitory molecule, of at least 5%, 10%, 20%, 30%, 40% or more is included by this term.
- inhibition need not be 100%.
- anti-cancer effect refers to a biological effect which can be manifested by various means, including but not limited to, e.g. , a decrease in tumor volume, a decrease in the number of cancer cells, a decrease in the number of metastases, an increase in life expectancy, decrease in cancer cell proliferation, decrease in cancer cell survival, or amelioration of various physiological symptoms associated with the cancerous condition.
- An“anti-cancer effect” can also be manifested by the ability of the peptides, polynucleotides, cells and antibodies in prevention of the occurrence of cancer in the first place.
- anti-tumor effect refers to a biological effect which can be manifested by various means, including but not limited to, e.g. , a decrease in tumor volume, a decrease in the number of tumor cells, a decrease in tumor cell proliferation, or a decrease in tumor cell survival.
- cancer refers to a disease characterized by the rapid and uncontrolled growth of aberrant cells. Cancer cells can spread locally or through the bloodstream and lymphatic system to other parts of the body. Examples of various cancers are described herein and include but are not limited to, breast cancer, prostate cancer, ovarian cancer, cervical cancer, skin cancer, pancreatic cancer, colorectal cancer, renal cancer, liver cancer, brain cancer, lymphoma, leukemia, lung cancer and the like.
- tumor and“cancer” are used interchangeably herein, e.g., both terms encompass solid and liquid, e.g., diffuse or circulating, tumors.
- cancer includes premalignant, as well as malignant cancers and tumors.
- cancer includes primary malignant cells or tumors ⁇ e.g., those whose cells have not migrated to sites in the subject's body other than the site of the original malignancy or tumor) and secondary malignant cells or tumors ⁇ e.g., those arising from metastasis, the migration of malignant cells or tumor cells to secondary sites that are different from the site of the original tumor).
- the terms“treat,”“treatment” and“treating” refer to the reduction or amelioration of the progression, severity and/or duration of a disorder, e.g., a proliferative disorder, or the amelioration of one or more symptoms (preferably, one or more discernible symptoms) of the disorder resulting from the administration of one or more therapies.
- the terms“treat,”“treatment” and“treating” refer to the amelioration of at least one measurable physical parameter of a proliferative disorder, such as growth of a tumor, not necessarily discernible by the patient.
- the terms“treat”,“treatment” and“treating” refer to the inhibition of the progression of a proliferative disorder, either physically by, e.g., stabilization of a discernible symptom, physiologically by, e.g., stabilization of a physical parameter, or both.
- the terms“treat”,“treatment” and“treating” refer to the reduction or stabilization of tumor size or cancerous cell count.
- the term“subject” refers herein to a human.
- the human may be an adult, an adolescent, a child, or an ieri.
- MDM4 inhibitor herein refers to an inhibitor that preferentially binds MDM-4, disrupting p53-MDM4 binding, thus releasing sequestered p53 protein.
- pl4ARF links the tumour suppressors RB and p53.
- the GFP and T antigen cDNAs were Gateway (Invitrogen) cloned into pLIX ⁇ 02 inducible empty or pLenti CMV Blast empty vector (w263-l), obtained from David Root (Addgene plasmid ]41394) and Eric Campeau (Addgene plasmid 17486), respectively.
- the sgRNA clones for CKla (BRDN0001149315, BRDN0001145680) were obtained from John Doench and David Root (Addgene plasmid 76188, 76189).
- pLKO-p53-shRNA-941 was obtained from Todd Waldman (Addgene plasmid 25637).
- IMR90 human lung fibroblast, HCT116 colon carcinoma or MKL-1 MCC cells were transduced using a three vector lentivirus transduction system (15).
- MCC cell lines were obtained from Masa Shuda (University of Pittsburgh, PA), Jurgen Becker (Medical University Graz, Austria), and Roland Houben (University of Wuerzburg, Germany). 293T, HCT116 and IMR90 cells were obtained from ATCC. Generation of MKL-1 MCC cell lines inducibly expressing shRNAs and IMR90 transformation using p53DD, MYCL and hTERT constructs was described previously (17).
- IMR90 and human primary foreskin fibroblast cells (HFF) were cultured in DMEM supplemented with 15% FBS, antibiotics and non- essential amino acids and MCC cell lines were grown in RPMI supplemented with 10% FBS and antibiotics.
- Nutlin-3 (Cayman chemical), Lenalidomide (Cayman chemical), Thalidomide (Santa Cruz Biotechnology), Pomalidomide (Selleck chemicals), AMG232 (MedChem Express), RG7388 (from Aileron Therapeutics), HDM201 (Novartis Pharmaceuticals), SC-24-UR99 (Novartis Pharmaceuticals), Cycloheximide (Sigma-Aldrich), and MG132 (Boston Biochem) were reconstituted in DMSO and added directly to culture media. Cell viability assays were performed using Cell Proliferation Kit II (XTT) (Roche) according to the manufacturer’s instructions and BH3 profiling was described in Pallis et al. (36). Synergy testing was performed using Compusyn and Synergyfmder (28, 29).
- the beads were washed with high-salt EBC buffer (50 mM Tris, pH 8.0, 300 mM NaCl, 0.5% NP-40, 0.5 mM EDTA) 5 times and boiled in Laemmli sample buffer prior to SDS polyacrylamide gel electrophoresis. Immunoprecipitation and western blotting were performed with antibodies to MDM4 (17914-1-AP; Proteintech Group), MDM2 (SMP14, Santa Cruz biotechnology), CKla (17125-1-AP; Proteintech Group), phospho-Serl66 MDM2 Q3521, Cell Signaling
- Phopho-Serl5 p53 (]9284; Cell Signaling Technology), acetyl-Lys382 p53 Q2525; Cell Signaling Technology), p21 (]2946; Cell Signaling Technology), PUMA (] 12450; Cell Signaling Technology), VPS39 (abl07570; Abeam), PARP (]9542; Cell Signaling Technology), GFP (]2555; Cell Signaling Technology), MYCL (14584-1-AP; Proteintech Group), p53 (DO-1; Thermo
- the ChIP method was modified from protocols described in Schmidt et al. (37). MKL-1 cells or IMR90 cells were cross-linked using dual cross-linking with disuccinimidyl glutarate (DSG) and formaldehyde. After cross-linking, cells were lysed using SimpleChIP buffer A and B (Cell signaling) and DNA was processed with micrococcal nuclease (New England Biolabs Inc.) for 30 minutes at 37°C followed by sonicating for 20 second pulses 5 times at 4°C. For
- the primer information can be found in Supplementary table 2.
- NSG mice of 7 to 9 weeks old age were injected with 1.00e+007 MKL-1 MCC cells.
- a group of 8 mice were treated daily with vehicle, HDM201 (from Novartis Pharmaceuticals, 40 mg/kg, 0.5% methylcellulose (400 cP) in 50 mM phosphate buffer, pH 6.8, oral), lenalidomide (MedChemExpress, 50 mg/kg, 0.5% CMC + 0.25% Tween 80, oral) or both HDM201 and lenalidomide.
- the study was terminated when the tumor volume reached the maximum permissible size of 2000mm3.
- the following tables provide the data from synergy testing of various combinations of drugs/compounds in reducing viability of MKL-1 MCC cells.
- MKL-1 virus-positive Merkel cell carcinoma cell line with wild type p53
- the XTT assay was performed to determine the relative viability (% response) normalized to untreated cells.
- Separate tables include data for combinations 1. Nutlin-Lenalidomide 2. Nutlin-UR99 3. HDM201-UR99 4. Nutlin-3 +/- lenalidomide; RG7388 +/- Lenalidomide; Lenalidomide alone 5. HDM201 + Lenalidomide.
Landscapes
- Health & Medical Sciences (AREA)
- Veterinary Medicine (AREA)
- Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Life Sciences & Earth Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- General Health & Medical Sciences (AREA)
- Public Health (AREA)
- Epidemiology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Organic Chemistry (AREA)
- Hematology (AREA)
- Oncology (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Priority Applications (10)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP19805046.0A EP3873460B1 (en) | 2018-10-30 | 2019-10-28 | Method of treatment of p53 wt tumors |
| KR1020217015953A KR102879859B1 (ko) | 2018-10-30 | 2019-10-28 | P53 wt 종양의 치료 방법 |
| ES19805046T ES2986421T3 (es) | 2018-10-30 | 2019-10-28 | Método de tratamiento de tumores P53 WT |
| JP2021522967A JP7653907B2 (ja) | 2018-10-30 | 2019-10-28 | p53WT腫瘍の処置の方法 |
| CA3115716A CA3115716A1 (en) | 2018-10-30 | 2019-10-28 | Method of treatment of p53 wt tumors |
| US17/289,122 US12115151B2 (en) | 2018-10-30 | 2019-10-28 | Method of treatment of p53 WT tumors |
| IL282485A IL282485B2 (en) | 2018-10-30 | 2019-10-28 | Compositions containing an mdm2 inhibitor and a cka1 inhibitor and/or an mdm4 inhibitor for use in the treatment of tumors with non-mutant p53 |
| CN201980070367.1A CN112996503A (zh) | 2018-10-30 | 2019-10-28 | P53 wt肿瘤的治疗方法 |
| AU2019369216A AU2019369216B2 (en) | 2018-10-30 | 2019-10-28 | Method of treatment of p53 WT tumors |
| JP2024187067A JP2025026846A (ja) | 2018-10-30 | 2024-10-24 | p53WT腫瘍の処置の方法 |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201862752382P | 2018-10-30 | 2018-10-30 | |
| US62/752,382 | 2018-10-30 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2020092221A1 true WO2020092221A1 (en) | 2020-05-07 |
Family
ID=68582462
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2019/058319 Ceased WO2020092221A1 (en) | 2018-10-30 | 2019-10-28 | Method of treatment of p53 wt tumors |
Country Status (10)
| Country | Link |
|---|---|
| US (1) | US12115151B2 (https=) |
| EP (1) | EP3873460B1 (https=) |
| JP (2) | JP7653907B2 (https=) |
| KR (1) | KR102879859B1 (https=) |
| CN (1) | CN112996503A (https=) |
| AU (1) | AU2019369216B2 (https=) |
| CA (1) | CA3115716A1 (https=) |
| ES (1) | ES2986421T3 (https=) |
| IL (1) | IL282485B2 (https=) |
| WO (1) | WO2020092221A1 (https=) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US11419870B2 (en) | 2014-06-26 | 2022-08-23 | Novartis Ag | Intermittent dosing of MDM2 inhibitor |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115216514B (zh) * | 2022-08-01 | 2026-03-17 | 中国科学技术大学 | Vam6(Vps39)作为靶点在药物筛选、基因编辑以及疾病治疗中的应用 |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| MX388093B (es) * | 2016-11-15 | 2025-03-19 | Novartis Ag | Dosis y regimen para inhibidores de la interaccion hdm2-p53. |
-
2019
- 2019-10-28 WO PCT/US2019/058319 patent/WO2020092221A1/en not_active Ceased
- 2019-10-28 KR KR1020217015953A patent/KR102879859B1/ko active Active
- 2019-10-28 JP JP2021522967A patent/JP7653907B2/ja active Active
- 2019-10-28 IL IL282485A patent/IL282485B2/en unknown
- 2019-10-28 AU AU2019369216A patent/AU2019369216B2/en active Active
- 2019-10-28 US US17/289,122 patent/US12115151B2/en active Active
- 2019-10-28 ES ES19805046T patent/ES2986421T3/es active Active
- 2019-10-28 CA CA3115716A patent/CA3115716A1/en active Pending
- 2019-10-28 CN CN201980070367.1A patent/CN112996503A/zh active Pending
- 2019-10-28 EP EP19805046.0A patent/EP3873460B1/en active Active
-
2024
- 2024-10-24 JP JP2024187067A patent/JP2025026846A/ja active Pending
Non-Patent Citations (43)
| Title |
|---|
| ALLEN MA ET AL.: "Global analysis of p53-regulated transcription identifies its direct targets and unexpected regulatory mechanisms", ELIFE, vol. 3, 2014 |
| ARORA R ET AL.: "Survivin is a therapeutic target in merkel cell carcinoma", SCI TRANSL MED, vol. 4, no. 133, 2012, pages 133ra56, XP055509660, DOI: 10.1126/scitranslmed.3003713 |
| BATES S ET AL.: "pl4ARF links the tumour suppressors RB and p53", NATURE, vol. 395, no. 6698, 1998, pages 124 - 5 |
| BECKER JCC ET AL.: "Merkel cell carcinoma", NAT REV DIS PRIMERS, vol. 3, 2017, pages 17077 |
| BELIVEAU AYASWEN P: "Soothing the watchman: telomerase reduces the p53-dependent cellular stress response", CELL CYCLE (GEORGETOWN, TEX., vol. 6, no. 11, 2007, pages 1284 - 1287 |
| BERRIOS C ET AL.: "Merkel cell polyomavirus small t antigen promotes pro-glycolytic metabolic perturbations required for transformation", PLOS PATHOGENS, vol. 12, no. 11, 2016 |
| BISTA MPETROVICH MFERSHT AR: "MDMX contains an autoinhibitory sequence element", PROC. NATL. ACAD. SCI. U.S.A., vol. 110, no. 44, 2013, pages 17814 - 9 |
| CHEN L ET AL.: "Autoinhibition of MDMX by intramolecular p53 mimicry", PROC. NATL. ACAD. SCI. U.S.A., vol. 112, no. 15, 2015, pages 4624 - 9 |
| CHENG J ET AL.: "Merkel cell polyomavirus recruits mycl to the ep400 complex to promote oncogenesis", PLOS PATHOGENS, vol. 13, no. 10, 2017, pages 1 - 31 |
| CHENG JROZENBLATT-ROSEN OPAULSON KGNGHIEM PDECAPRIO JA: "Merkel cell polyomavirus large t antigen has growth-promoting and inhibitory activities", JOURNAL OF VIROLOGY, vol. 87, no. 11, 2013, pages 6118 - 6126 |
| CHOU TMOTZER RTONG YBOSL G: "Computerized quantitation of synergism and antagonism of taxol, topotecan, and cisplatin against human teratocarcinoma cell growth: a rational approach to clinical protocol design", J. NATL. CANCER INST., vol. 86, no. 20, 1994, pages 1517 - 24, XP000983664, DOI: 10.1093/jnci/86.20.1517 |
| CRONIN JZHANG XYYREISER J: "Altering the tropism of lentiviral vectors through pseudotyping", CURRENT GENE THERAPY, vol. 5, no. 4, 2005, pages 387 - 398, XP055199682, DOI: 10.2174/1566523054546224 |
| DING Q ET AL.: "Discovery of rg7388, a potent and selective p53-mdm2 inhibitor in clinical development", JOURNAL OF MEDICINAL CHEMISTRY, vol. 56, no. 14, 2013, pages 5979 - 5983, XP055109745, DOI: 10.1021/jm400487c |
| DOENCH JG ET AL.: "Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9", NAT. BIOTECHNOL., vol. 34, no. 2, 2016, pages 184 - 191, XP055551151, DOI: 10.1038/nbt.3437 |
| DONGLIM ESTHER PARK ET AL: "Dual inhibition of MDM2 and MDM4 in virus-positive Merkel cell carcinoma enhances the p53 response", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES, vol. 116, no. 3, 15 January 2019 (2019-01-15), US, pages 1027 - 1032, XP055661334, ISSN: 0027-8424, DOI: 10.1073/pnas.1818798116 * |
| FENG HSHUDA MCHANG YMOORE PS: "Clonal integration of a polyomavirus in human merkel cell carcinoma", SCIENCE (NEW YORK, N.Y., vol. 319, no. 5866, 2008, pages 1096 - 1100 |
| FURET P ET AL.: "Discovery of a novel class of highly potent inhibitors of the p53-MDM2 interaction by structure-based design starting from a conformational argument", BIOORG. MED. CHEM. LETT., vol. 26, no. 19, 2016, pages 4837 - 4841, XP029718498, DOI: 10.1016/j.bmcl.2016.08.010 |
| HARMS PW ET AL.: "The distinctive mutational spectra of polyomavirus-negative Merkel cell carcinoma", CANCER RESEARCH, vol. 75, no. 18, 2015, pages 3720 - 3727 |
| HOUBEN R ET AL.: "Mechanisms of p53 restriction in merkel cell carcinoma cells are independent of the merkel cell polyoma virus t antigens", THE JOURNAL OF INVESTIGATIVE DERMATOLOGY, vol. 133, no. 10, 2013, pages 2453 - 2460, XP055226363, DOI: 10.1038/jid.2013.169 |
| IANEVSKI AHE LAITTOKALLIO TTANG J: "SynergyFinder: a web application for analyzing drug combination dose-response matrix data", BIOINFORMATICS, vol. 33, no. 15, 2017, pages 2413 - 2415, XP055615806, DOI: 10.1093/bioinformatics/btx162 |
| KRONKE J ET AL.: "Lenalidomide induces ubiquitination and degradation of cklalpha in del(5q) mds", NATURE, vol. 523, no. 7559, 2015, pages 183 - 188, XP055336278, DOI: 10.1038/nature14610 |
| LENOS K ET AL.: "Alternate splicing of the p53 inhibitor hdmx offers a superior prognostic biomarker than p53 mutation in human cancer", CANCER RESEARCH, vol. 72, no. 16, 2012, pages 4074 - 4084 |
| LIAO GUOCHAO ET AL: "The development of piperidinones as potent MDM2-P53 protein-protein interaction inhibitors for cancer therapy", EUROPEAN JOURNAL OF MEDICINAL CHEMISTRY, ELSEVIER, AMSTERDAM, NL, vol. 159, 18 September 2018 (2018-09-18), pages 1 - 9, XP085505170, ISSN: 0223-5234, DOI: 10.1016/J.EJMECH.2018.09.044 * |
| LINDNER STEFANIE ET AL: "The molecular mechanism of thalidomide analogs in hematologic malignancies", JOURNAL OF MOLECULAR MEDICINE, SPRINGER VERLAG, DE, vol. 94, no. 12, 5 August 2016 (2016-08-05), pages 1327 - 1334, XP036113710, ISSN: 0946-2716, [retrieved on 20160805], DOI: 10.1007/S00109-016-1450-Z * |
| MAXIMILIAN STAHL ET AL: "Lenalidomide use in myelodysplastic syndromes: Insights into the biologic mechanisms and clinical applications : Use of Lenalidomide in MDS: Biology and Efficacy", CANCER., vol. 123, no. 10, 13 February 2017 (2017-02-13), US, pages 1703 - 1713, XP055661636, ISSN: 0008-543X, DOI: 10.1002/cncr.30585 * |
| MONTERO J ET AL.: "Drug-induced death signaling strategy rapidly predicts cancer response to chemotherapy", CELL, vol. 160, no. 5, 2015, pages 977 - 89, XP055508174, DOI: 10.1016/j.cell.2015.01.042 |
| NOMURA K ET AL.: "Structural analysis of MDM2 RING separates degradation from regulation of p53 transcription activity", NAT. STRUCT. MOL. BIOL., vol. 24, no. 7, 2017, pages 578 - 587 |
| PALLIS M ET AL.: "Complementary dynamic bh3 profiles predict co-operativity between the multi-kinase inhibitor tg02 and the bh3 mimetic abt-199 in acute myeloid leukaemia cells", ONCOTARGET, 2016 |
| PAOLA SECCHIERO ET AL: "Recent Advances in the Therapeutic Perspectives of Nutlin-3", CURRENT PHARMACEUTICAL DESIGN, vol. 17, no. 6, 1 February 2011 (2011-02-01), NL, pages 569 - 577, XP055661521, ISSN: 1381-6128, DOI: 10.2174/138161211795222586 * |
| PAULSON KG ET AL.: "Merkel cell carcinoma: Current US incidence and projected increases based on changing demographics", J. AM. ACAD. DERMATOL., 2017 |
| PETZOLD GFISCHER ESTHOMANH: "Structural basis of lenalidomide-induced CKla degradation by the CRL4(CRBN) ubiquitin ligase", NATURE, vol. 532, no. 7597, 2016, pages 127 - 30 |
| RODIG SJ ET AL.: "Improved detection suggests all Merkel cell carcinomas harbor Merkel polyomavirus", THE JOURNAL OF CLINICAL INVESTIGATION, vol. 122, no. 12, 2012, pages 4645 - 4653 |
| SAFT L ET AL.: "p53 protein expression independently predicts outcome in patients with lower-risk myelodysplastic syndromes with del(5q", HAEMATOLOGICA, vol. 99, no. 6, 2014, pages 1041 - 9 |
| SCHMIDT D ET AL.: "Chip-seq: Using high-throughput sequencing to discover protein-dna interactions", METHODS, vol. 48, no. 3, 2009, pages 240 - 248, XP026284845, DOI: 10.1016/j.ymeth.2009.03.001 |
| SCUDIERO D ET AL.: "Evaluation of a soluble tetrazolium/formazan assay for cell growth and drug sensitivity in culture using human and other tumor cell lines", CANCER RES., vol. 48, no. 17, 1988, pages 4827 - 33, XP001055448 |
| SHOLL LM ET AL.: "Institutional implementation of clinical tumor profiling on an unselected cancer population", JCI INSIGHT, vol. 1, no. 19, 2016, pages e87062 |
| SHUDA MKWUN HJFENG HCHANG YMOORE PS: "Human Merkel cell polyomavirus small t antigen is an oncoprotein targeting the 4e-bpl translation regulator", THE JOURNAL OF CLINICAL INVESTIGATION, vol. 121, no. 9, 2011, pages 3623 - 3634 |
| SMITH AE ET AL.: "CSNK1A1 mutations and isolated del(5q) abnormality in myelodysplastic syndrome: a retrospective mutational analysis", LANCET HAEMATOL, vol. 2, no. 5, 2015, pages e212 - 21 |
| SPIOTTO MT ET AL.: "Imaging the unfolded protein response in primary tumors reveals microenvironments with metabolic variations that predict tumor growth", CANCER RES., vol. 70, no. 1, 2010, pages 78 - 88 |
| STARRETT GJ ET AL.: "Merkel cell polyomavirus exhibits dominant control of the tumor genome and transcriptome in virus-associated Merkel cell carcinoma", MBIO, vol. 8, no. 1, 2017 |
| SUN D ET AL.: "Discovery of amg 232, a potent, selective, and orally bioavailable mdm2-p53 inhibitor in clinical development", JOURNAL OF MEDICINAL CHEMISTRY, vol. 57, no. 4, 2014, pages 1454 - 1472, XP055116592, DOI: 10.1021/jm401753e |
| TOLEDO ET AL: "MDM2 and MDM4: p53 regulators as targets in anticancer therapy", INTERNATIONAL JOURNAL OF BIOCHEMISTRY AND CELL BIOLOGY, PERGAMON, GB, vol. 39, no. 7-8, 10 July 2007 (2007-07-10), pages 1476 - 1482, XP022145785, ISSN: 1357-2725, DOI: 10.1016/J.BIOCEL.2007.03.022 * |
| ZHOU B ET AL.: "HER-2/neu induces p53 ubiquitination via akt-mediated MDM2 phosphorylation", NAT. CELL BIOL., vol. 3, no. 11, 2001, pages 973 - 82 |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US11419870B2 (en) | 2014-06-26 | 2022-08-23 | Novartis Ag | Intermittent dosing of MDM2 inhibitor |
Also Published As
| Publication number | Publication date |
|---|---|
| US12115151B2 (en) | 2024-10-15 |
| JP7653907B2 (ja) | 2025-03-31 |
| IL282485B1 (en) | 2025-05-01 |
| US20210379039A1 (en) | 2021-12-09 |
| EP3873460A1 (en) | 2021-09-08 |
| AU2019369216A1 (en) | 2021-05-20 |
| JP2022505884A (ja) | 2022-01-14 |
| AU2019369216B2 (en) | 2022-05-19 |
| JP2025026846A (ja) | 2025-02-26 |
| KR20210087958A (ko) | 2021-07-13 |
| IL282485B2 (en) | 2025-09-01 |
| ES2986421T3 (es) | 2024-11-11 |
| EP3873460B1 (en) | 2024-06-12 |
| KR102879859B1 (ko) | 2025-11-04 |
| CN112996503A (zh) | 2021-06-18 |
| CA3115716A1 (en) | 2020-05-07 |
| IL282485A (en) | 2021-06-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Brock et al. | MIF family members cooperatively inhibit p53 expression and activity | |
| JP2025026846A (ja) | p53WT腫瘍の処置の方法 | |
| WO2019246430A1 (en) | Methods of treating disorders | |
| WO2019246423A1 (en) | Methods of treating disorders | |
| Hu et al. | Broad RTK-targeted therapy overcomes molecular heterogeneity-driven resistance to cetuximab via vectored immunoprophylaxis in colorectal cancer | |
| Morimoto et al. | MUC1-C is necessary for SHP2 activation and BRAF inhibitor resistance in BRAF (V600E) mutant colorectal cancer | |
| Xu et al. | Overexpression of nucleotide metabolic enzyme DUT in hepatocellular carcinoma potentiates a therapeutic opportunity through targeting its dUTPase activity | |
| Shah et al. | Sustained aurora kinase B expression confers resistance to PI3K inhibition in head and neck squamous cell carcinoma | |
| Vega-Rubin-de-Celis et al. | Autophagy suppression via SRC induction represents a therapeutic vulnerability for BAP1-mutant cancers | |
| Wang et al. | AKT is critically involved in the antagonism of BRAF inhibitor sorafenib against dabrafenib in colorectal cancer cells harboring both wild-type and mutant (V600E) BRAF genes | |
| Tokumoto et al. | Neurotensin receptor 1 is a new therapeutic target for human undifferentiated pleomorphic sarcoma growth | |
| HK40048199A (en) | Method of treatment of p53 wt tumors | |
| HK40048199B (en) | Method of treatment of p53 wt tumors | |
| US20250277215A1 (en) | Long Non-Coding RNA 122 (Lnc122) for Treatment Cancer | |
| Yang et al. | Hematopoietic progenitor kinase 1 inhibitor BGB-15025 induces apoptosis in acute myeloid leukemia cells through the cell cycle pathway and mitogen-activated protein kinase/extracellular signal-regulated kinase pathway signaling axis | |
| Brunet et al. | Prolonging lung cancer response to EGFR inhibition by targeting the selective advantage of resistant cells | |
| Li et al. | Nintedanib enhances tumor cell radiosensitivity by promoting ferroptosis and modulating the ATF4/SLC7A11/GSH axis | |
| JP2016529202A (ja) | グリアジンペプチドを用いた癌の治療のためのキットおよび方法 | |
| Prince et al. | Women in molecular and cellular oncology, volume II: 2022 | |
| Schneeweis | The Role of FRA1 and SUMOylation in Pancreatic Cancer | |
| Urbach | Misp53 mutation-specific oncogenic transcription factor complexes in PDAC progression | |
| WO2025188779A1 (en) | Cdk2 inhibitors for treatment of cancer | |
| Xinyu | Addiction of Soft-Tissue Sarcoma Cells to MNK and eIF4E | |
| Abou-Hamad | The Roles of SOX9 and SOX10 in Therapy Resistance in BRAFV600E-Induced Melanoma | |
| Lines et al. | The integrated stress response in cancer progression: plasticity and resistance |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 19805046 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 3115716 Country of ref document: CA |
|
| ENP | Entry into the national phase |
Ref document number: 2021522967 Country of ref document: JP Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2019369216 Country of ref document: AU Date of ref document: 20191028 Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 20217015953 Country of ref document: KR Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2021111781 Country of ref document: RU |
|
| ENP | Entry into the national phase |
Ref document number: 2019805046 Country of ref document: EP Effective date: 20210531 |