WO2020091235A1 - Fbln5 유전자 결손 동물 모델 및 이를 이용한 신경 또는 근육 질환 치료제 스크리닝 방법 - Google Patents

Fbln5 유전자 결손 동물 모델 및 이를 이용한 신경 또는 근육 질환 치료제 스크리닝 방법 Download PDF

Info

Publication number
WO2020091235A1
WO2020091235A1 PCT/KR2019/012636 KR2019012636W WO2020091235A1 WO 2020091235 A1 WO2020091235 A1 WO 2020091235A1 KR 2019012636 W KR2019012636 W KR 2019012636W WO 2020091235 A1 WO2020091235 A1 WO 2020091235A1
Authority
WO
WIPO (PCT)
Prior art keywords
animal model
fbln5
neurological
zebrafish
transgenic animal
Prior art date
Application number
PCT/KR2019/012636
Other languages
English (en)
French (fr)
Inventor
이지은
장종욱
원소연
Original Assignee
사회복지법인 삼성생명공익재단
성균관대학교산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from KR1020190118315A external-priority patent/KR102360896B1/ko
Application filed by 사회복지법인 삼성생명공익재단, 성균관대학교산학협력단 filed Critical 사회복지법인 삼성생명공익재단
Publication of WO2020091235A1 publication Critical patent/WO2020091235A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
    • A01K67/027—New or modified breeds of vertebrates
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing

Definitions

  • the present invention was made by Task No. 2018R1A2A3074597 under the support of the Ministry of Science and ICT, and the research institute specialized in the above task is "Sungkyunkwan University", the research project name is “Senior Research (Protection / Cultivation)”, and the research project title is "Primary cilia Research on the mechanism of control of senile muscular dystrophy through the investigation of the inflammation control function of “Sungkyunkwan University”, the main organ is from 2018.09.01 ⁇ 2021.08.31.
  • the present invention relates to a Fbln5 (Fibulin-5) gene-deficient animal model, a method for screening a therapeutic agent for neurological or muscle disease using the same, and a pharmaceutical composition comprising a therapeutic agent for neurological or muscular disease screened using the same.
  • Fbln5 Fubulin-5
  • Zebrafish is a type of tropical fish and is widely used as an experimental animal model.
  • the zebrafish has the advantage of shorter incidence and easier observation because the embryo is transparent compared to experimental animals such as rats and rats.
  • genomic information of zebrafish is similar to about 70% of the human genomic information, and the zebrafish body organs are anatomically similar to the human body organ occurrence state.
  • zebrafish which is economically and time-effective, is much more convenient for screening a large-capacity therapeutic material than animals that are expensive and time-consuming to analyze and manage animals.
  • the zebrafish which has good experimental, economic, and temporal utility, is suitable as a disease animal model according to induction of functional simulation in humans, and is much more useful for large-scale screening of therapeutic substances or research of mechanisms.
  • Schwann cells originating from neural crest cells play a role in myelination by wrapping axons.
  • the nerve sheath cells wrap the axons, and the myelin sheath functions as an insulator, so that the action potential generated in the axon hillock of the nerve cells can be rapidly transferred to the nerve terminal. do.
  • Charcot-Marie-Tooth disease is a type of hereditary motor and sensory neuropathy that occurs in the peripheral nervous system.
  • demyelination a damage in myelination, is typically observed, and the demyelination phenomenon interferes with normal neurotransmission and causes various symptoms in sensation, cognition, and behavior. For this reason, it is known that dysfunction of a neuron cell having a role in myelin formation is involved in the pathogenesis process.
  • Guillain-Barr syndrome chronic inflammatory demyelinating polyneuropathy, progressive inflammatory neuropathy, anti-MAG peripheral neuropathy ), And demyelination is found in many neurological diseases, and it is known that dysfunctional neuronal cells are involved in the pathogenesis of diseases.
  • Fbln5 (Fibulin-5) is an extracellularly secreted matrix protein having an Arg-Gly-Asp (RGD) motif, and is not known in relation to neuropathy.
  • Fbln5 mutations have been observed in Asian family groups who have recently suffered adult onset-CMT and found dysplasia in these patients.
  • laminin which is essential for myelination, is also known to be essential for myelination by binding with integrin as an Arg-Gly-Asp (RGD) motif as an extracellular matrix protein.
  • the animal model shows the biological importance of Fbln5 in myelination.
  • the Fbln5 knockdown zephyrfish using morpholino is a sensory, cognitive, and behavioral activity through damage and neurotransmission in myelination during development. It shows various symptoms. This suggests an essential role of FBLN5 in the function of myelination through neuronal cells.
  • Fibulin-5 is important in many neurological diseases by observing the myelination abnormal phenotype in the knockdown zebrafish of the Fbln5 gene.
  • the present inventors developed knock-down zebrafish using morpholino system for Fbln5 , and developed the present invention by developing a pathological and physiological analysis method capable of quickly and effectively screening a targeted therapeutic substance for a disease in the future. Completed.
  • an object of the present invention is to provide a transgenic animal model in which the Fbln5 gene is knocked down.
  • Another object of the present invention is to provide a method for screening a therapeutic agent for a neurological or muscular disorder, comprising contacting a candidate for the therapeutic agent for a neurological or muscular disorder in a transformed animal model in which the Fbln5 gene is knocked down.
  • Another object of the present invention is to provide a pharmaceutical composition for the improvement, prevention or treatment of neurological or muscular diseases comprising Fbln5 protein as an active substance.
  • the present invention relates to a Fbln5 (Fibulin-5) gene-deficient animal model, a method for screening a therapeutic agent for neurological or muscle disease using the same, and a pharmaceutical composition comprising a therapeutic agent for neurological or muscular disease screened using the same.
  • Fbln5 Fubulin-5
  • the present inventors developed an animal model that mimics symptoms of neurological and muscular diseases by inducing the deletion of the Fbln5 gene as a gene related to neurological and muscular diseases, observing the phenotype of neurological and muscular diseases, and treating substances for future related disease targets
  • the present invention was completed by finding out that it is suitable for screening quickly and effectively.
  • One aspect of the present invention relates to a transgenic animal in which the Fbln5 gene is knocked down.
  • knockdown of the present invention means that RNAi, morpholino, etc. are used to induce normal mRNA expression to be reduced than normal.
  • knockdown of the Fbln5 gene can be induced using various methods known in the art, for example, RNAi or morpholino, but is not limited thereto.
  • the transgenic animal is derived by using a morpholino designed to inhibit the expression of a normal functioning mRNA by binding to a position where translation into the Fbln5 protein fails (between Exon 3 and Exon 4). Can be.
  • the Fbln5 gene may exist as it is, but the translation into a protein due to the gene may not be interrupted.
  • the transgenic animal may be a zebrafish, mouse or rat, but is not limited thereto.
  • the transgenic animal may exhibit any one or more defects selected from the group consisting of appearance defects, myelination defects, and reaction defects caused by stimulation, for example, all appearance defects, myelination defects, and reaction defects caused by stimulation May be
  • the transgenic animal may be an animal having a genetic neurological or muscle disease.
  • the neurological or muscle disease may be, but is not limited to, demyelination, nerve conduction, Charco maritus, Guillain-Barre syndrome, chronic inflammatory demyelinating polyneuropathy, progressive inflammatory neuropathy, or anti-MAG peripheral neuropathy. .
  • One aspect of the present invention relates to a transformed zebrafish fertilized egg in which the Fbln5 gene is knocked down.
  • the Fbln5 gene knock-down transgenic animal shows abnormality in myelination, neurological or muscle disease-related diseases based on the myelination mechanism according to demyelinating disease It is available as a model.
  • disease model refers to a model animal that can be used as a research subject to identify etiology and confirm the condition by showing symptoms similar to human diseases.
  • the zebrafish adopted in the present invention as an animal model has the advantage of predicting the same effect as in humans, making it easy, and having high reproducibility.
  • the test substance for inducing demyelination may be metronidazole (hereinafter referred to as MTZ), but is not limited thereto.
  • E. coli (. Escehrichia Coli) knitted Lowry deokte rise derived from (nitroreductase; hereinafter, NTR) is substituted by the MTZ to the cell toxin (cytotoxin) coated only with a specific nerve damage at home cell.
  • Another aspect of the present invention relates to a method for screening a therapeutic agent for a neurological or muscle disease using a transgenic animal model in which the Fbln5 gene is knocked down.
  • the screening method of the present invention comprises contacting a candidate for treatment of a neurological or muscle disease therapeutic agent in a transgenic animal model in which the Fbln5 gene is knocked down.
  • the screening method may include the following steps:
  • the candidates for the treatment of neurological or muscle disorders include various substances, for example, compounds, proteins, peptides, antibodies, nucleic acids, and natural extracts, but are not limited thereto.
  • the candidate for treating a nerve or muscle disease may be a single compound or a mixture of compounds, for example, a natural extract or a cell or tissue culture, but is not limited thereto.
  • the candidates for the treatment of neurological or muscle disease can be obtained from a library of synthetic or natural compounds. Methods for obtaining libraries of such compounds are known in the art.
  • the synthetic compound library is commercially available from Maybridge Chemical Co. (UK), Comgenex (USA), Brandon Associates (USA), Microsource (USA) and Sigma-Aldrich (USA), and a library of natural compounds is available from Pan Laboratories ( US) and MycoSearch (US).
  • Another aspect of the present invention relates to a pharmaceutical composition for improving, preventing or treating a neurological or muscle disease comprising Fbln5 protein as an active ingredient.
  • the Fbln5 protein exhibits an effect of promoting the myelination of Schwann cells as an extracellular matrix component in an animal model of a neurological or muscular disease animal, and thus can be used for the prevention or treatment of a neurological or muscular disease.
  • the pharmaceutical composition for improving, preventing or treating neurological or muscular diseases includes a pharmaceutically effective amount of Fbln5 protein; And a pharmaceutically acceptable carrier.
  • the Fbln5 protein may be composed of the amino acid sequence of SEQ ID NO: 3.
  • the pharmaceutically acceptable carrier is commonly used in the formulation, lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia rubber, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, Polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil, but is not limited thereto.
  • the pharmaceutical composition of the present invention may further include a lubricant, a wetting agent, a sweetener, a flavoring agent, an emulsifying agent, a suspending agent, a preservative, etc. in addition to the above components.
  • a lubricant e.g., a talc, a kaolin, a kaolin, a kaolin, a kaolin, a kaolin, kaolin, kaolin, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, a talct, a talct, a talct, a stevia, glycerin, a stevia, glycerin, glycerin, g
  • the pharmaceutical composition may be administered orally or parenterally, preferably parenterally, and for parenteral administration, intramuscular injection, intravenous injection, subcutaneous injection, intraperitoneal injection, topical administration, transdermal administration, etc. .
  • the dosage of the pharmaceutical composition may be 0.0001 to 1000 ug per day (microgram, 0.001 to 1000 ug, 0.01 to 1000 ug, 0.1 to 1000 ug, or 1.0 to 1000 ug, but is not limited thereto, and formulation It can be variously prescribed by factors such as method, mode of administration, patient's age, weight, sex, morbidity, food, time of administration, route of administration, rate of excretion, and response sensitivity.
  • the pharmaceutical composition is prepared in a unit dose form by formulating using a pharmaceutically acceptable carrier and / or excipient according to a method that can be easily carried out by a person skilled in the art to which the present invention pertains, or It can be manufactured by incorporating into a multi-dose container.
  • the formulation may be in the form of a solution, suspension, or emulsion in an oil or aqueous medium, or may be in the form of ex, powder, granule, tablet, or capsule, and may further include a dispersant or stabilizer.
  • valginal refers to a linear molecule formed by the binding of amino acid residues to each other by peptide bonds.
  • the proteins of the invention are chemical synthesis methods known in the art, in particular solid-phase synthesis techniques (Merrifield, J. Amer. Chem. Soc. 85: 2149-54 (1963); Stewart, et al., Solid Phase Peptide Synthesis, 2nd.ed., Pierce Chem. Co .: Rockford, 111 (1984)) or liquid synthesis technology (US Patent No. 5,516,891).
  • stability means not only in vivo stability, but also storage stability, eg, room temperature storage stability.
  • pharmaceutically effective amount means an amount sufficient to achieve the efficacy or activity of the above-described FBLN5 protein.
  • the present invention relates to a pharmaceutical composition
  • a pharmaceutical composition comprising an Fbln5 (Fibulin-5) gene-deficient zebrafish model, a method for screening a therapeutic agent for a neurological or muscular disease using the same, and a therapeutic agent for a neurological or muscular disease screened using the same.
  • Fbln5 Fubulin-5 gene-deficient zebrafish model
  • a method for screening a therapeutic agent for a neurological or muscular disease using the same and a therapeutic agent for a neurological or muscular disease screened using the same.
  • the zebrafish model of the present invention it is possible to effectively screen a therapeutic agent for demyelinating disease, which is effective even with few side effects, and can easily and quickly test the presence or absence of causing side effects in vivo according to the toxicity of drug candidates.
  • the FBLN5 protein and the material screened with the zebrafish model of the present invention can be usefully used to improve, treat, or prevent neurological or muscle disease.
  • FIG. 1 is a view showing the location and sequence of the morpholino targeting the zebrafish Fbln5 gene according to an embodiment of the present invention.
  • FIG. 2 is a diagram showing results of confirming a zebrafish indicating a defect during occurrence after knocking down the zebrafish Fbln5 gene according to an embodiment of the present invention.
  • A Zebrafish's head
  • P Zebrafish's tail
  • FIG. 3 is a diagram illustrating a site for observing the symptoms of demyelination in the PLL of zebrafish according to an embodiment of the present invention.
  • FIG. 4 is a photograph observing that the formation of aquatic plants is reduced in a Fbln5 knockdown zebrafish according to an embodiment of the present invention compared to a normal zebrafish.
  • FIG. 5 is a graph quantifying the degree of myelin formation reduction in Fbln5 knockdown zebrafish according to an embodiment of the present invention.
  • FIG. 6 is a view showing a change in the moving speed according to the stimulus by observing the behavior type of the normal zebrafish and Fbln5 knockdown zebrafish according to an embodiment of the present invention.
  • FIG. 7 is a photograph showing that the demyelination phenomenon is restored due to demyelination by MTZ (Metronidazole) and Fibulin-5 protein injection to induce demyelination according to an embodiment of the present invention.
  • FIG. 8 is a graph quantifying the degree of demyelination recovery by demyelination and Fibulin-5 protein injection by MTZ according to an embodiment of the present invention.
  • FIG. 9 is a normal zebrafish according to an embodiment of the present invention and the zebrafish demyelination caused by MTZ, the demyelination phenomenon by MTZ observed the behavioral type of zebrafish mitigated by injection of Fibulin-5 protein to stimulate It is a diagram showing the change of the moving speed along.
  • the present invention relates to a transgenic animal model in which the Fbln5 gene is knocked down.
  • Wild type zebrafish were lit from 28.0 to 28.5 ° C from 8 am to 9 pm, turned off at other times, and bred by feeding brine shrimp as prey.
  • the embryos were divided into zebrafish female and male partitions the day before mating, and the next morning, they were brightened the next morning to remove the partitions between the females and males.
  • the eggs of zebrafish obtained through mating were transferred to a mold made of agarose gel.
  • Morpholino was prepared to knock down the zebrafish Fbln5 mRNA ( requested by GEENE TOOLS). As shown in FIG. 1, the produced morpholino was designed to suppress mRNA expression functioning as a normal AUG morpholino that inhibits the translation of Fbln5 .
  • Example 1 10.0 ng of morpholino prepared in Example 1 was microinjected into the zebrafish embryo to knock down the zebrafish Fbln5 mRNA, and the phenotype was observed 5 days after birth .
  • Example 2 10.0 pg of morpholino prepared in Example 1 was injected into a small amount of zebrafish embryos, and a zebrafish embryo with Fbln5 knocked down was used to investigate defects in myelin formation using Claudin K, a myelin-forming protein as a marker. As shown in FIG. 3, a specific region of the trunk was selected to observe myelination, and the expression pattern of Claudin K was observed through a confocal microscope (Carl Zeiss, LSM 700, Germany), and the results are shown in FIGS. 4 to 5 And Table 2.
  • the normal zebrafish showed a form in which the myelin protein Claudin K is normally expressed and the axons are wrapped around the axons, but the zebrafish injected with the FBLN5 morpholino is a marker protein. It was observed that the expression pattern of was decreased and the myelination of axons was reduced compared to normal.
  • morpholino was injected with a small amount of 8.0 pg into zebrafish embryos as in Example 2.
  • the behavioral type survey was conducted using a Diovision (Noldus, Wageningen, The Netherlands) device containing zebrafish for 1 second immediately before the vibration stimulation and 1 second immediately after the stimulation was applied.
  • EthoVision XT software Measured by, and comparing the speed of the Fbln5 deficient zebrafish (cm / s) and the speed of the normal zebrafish, the results are shown in Figure 6 and Table 3.
  • the aim was to determine whether abnormalities in neurotransmission due to demyelination are restored by injection of Fibulin-5.
  • MTZ was used as in Example 5, and the behavioral response to stimulation was analyzed by comparing and analyzing the speed change before and after vibration stimulation as in Example 4. And Table 5.
  • the present invention relates to a Fbln5 (Fibulin-5) gene-deficient animal model, a method for screening a therapeutic agent for neurological or muscle disease using the same, and a pharmaceutical composition comprising a therapeutic agent for neurological or muscular disease screened using the same.
  • Fbln5 Fubulin-5

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Biomedical Technology (AREA)
  • Immunology (AREA)
  • General Health & Medical Sciences (AREA)
  • Hematology (AREA)
  • Medicinal Chemistry (AREA)
  • Urology & Nephrology (AREA)
  • Zoology (AREA)
  • Organic Chemistry (AREA)
  • Environmental Sciences (AREA)
  • Biotechnology (AREA)
  • Analytical Chemistry (AREA)
  • Cell Biology (AREA)
  • Genetics & Genomics (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Food Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Animal Husbandry (AREA)
  • Biodiversity & Conservation Biology (AREA)
  • Toxicology (AREA)
  • Investigating Or Analysing Biological Materials (AREA)

Abstract

본 발명은 Fbln5 (Fibulin-5) 유전자 결손 동물 모델, 이를 이용한 신경 또는 근육 질환 치료제 스크리닝 방법 및 이를 이용해 스크리닝된 신경 또는 근육 질환 치료제를 포함하는 약제학적 조성물에 관한 것이다. 본 발명의 동물 모델을 이용하면, 부작용이 적으면서도 효능이 좋은 탈수초병증 질환 치료제를 효과적으로 스크리닝 할 수 있으며, 약물 후보물질의 독성에 따른 생체 내 부작용 유발 유무를 쉽고 신속하게 테스트할 수 있다. 또한, Fbln5 단백질 및 본 발명의 제브라피쉬 모델로 스크리닝된 물질은 신경 또는 근육 질환 개선, 치료 또는 예방에 유용하게 활용될 수 있다.

Description

Fbln5 유전자 결손 동물 모델 및 이를 이용한 신경 또는 근육 질환 치료제 스크리닝 방법
본 발명은 과학기술정보통신부의 지원 하에서 과제번호 2018R1A2A3074597에 의해 이루어진 것으로서, 상기 과제의 연구관리 전문기관은 "성균관대학교", 연구사업명은 “중견연구(보호/육성)”, 연구과제명은 “원발성 섬모의 염증 조절 기능 규명을 통한 노인성 근감소증 제어 기전 연구”, 주관기관은 "성균관대학교", 연구기간은 2018.09.01 ~ 2021.08.31이다.
본 특허출원은 2018년 10월 30일에 대한민국 특허청에 제출된 대한민국 특허출원 제 10-2018-0131169호에 대하여 우선권을 주장하며, 상기 특허출원의 개시 사항은 본 명세서에 참조로서 삽입된다.
본 특허출원은 2019년 09월 25일에 대한민국 특허청에 제출된 대한민국 특허출원 제 10-2019-0118315호에 대하여 우선권을 주장하며, 상기 특허출원의 개시 사항은 본 명세서에 참조로서 삽입된다.
본 발명은 Fbln5 (Fibulin-5) 유전자 결손 동물 모델, 이를 이용한 신경 또는 근육 질환 치료제 스크리닝 방법 및 이를 이용해 스크리닝된 신경 또는 근육 질환 치료제를 포함하는 약제학적 조성물에 관한 것이다.
제브라피쉬(zebrafish)는 열대성 어류의 한 종류로 실험 동물모델로 널리 이용되고 있다. 제브라피쉬는 척추동물인 쥐, 렛트와 같은 실험동물에 비해 발생 시간이 짧으며 배아가 투명하여 관찰이 용이하다는 장점이 있다.
또한, 제브라피쉬의 유전체 정보는 인간 유전체 정보의 70% 정도와 유사하며, 제브라피쉬의 신체 기관은 해부학적으로 인간의 신체기관 발생 상태와 유사하다.
특히, 다양한 발병 원인에도 불구하고 유사한 현상을 보여주는 다수의 질환을 위한 치료 물질 개발이나 다양한 질환에서 하나의 후보 물질의 효용성 증명에서도 스크리닝 하는 연구가 절대적으로 필요하다.
이러한 점에서 대용량의 치료 물질을 스크리닝하기 위해서는 동물 사육 및 관리 비용과 분석에 비용 및 시간이 많이 소요되는 동물들 보다, 경제적, 시간적 효용성이 좋은 제브라피쉬가 훨씬 편리하다.
따라서, 실험적, 경제적 및 시간적 효용성이 좋은 제브라피쉬는 인간의 생체 내 기능 모사 유도에 따른 질환 동물 모델로 적합하며, 치료 물질의 대용량 스크리닝이나 기전 연구에 훨씬 유용하다.
발생학적으로 신경능선세포(Neural crest cell)로부터 기원하는 신경집세포(Schwann cell)는 축삭돌기를 감싸 수초형성(Myelination)하는 역할을 한다. 신경집세포가 축삭돌기를 감쌈으로 인해 수초가 절연체로 기능하며, 신경세포의 축삭둔덕(Axon hillock)에서 생성된 활동전위(Action potential)가 신경말단(Nerve terminal)까지 빠른 속도로 전달될 수 있도록 한다.
샤르코-마리-투스병(Charcot-Marie-Tooth disease)은 말초신경계에서 발생하는 유전성 운동 및 감각 신경병증(Hereditary motor and sensory neuropathy)의 일종이다. 이러한 샤르코-마리-투스병에서는 수초형성에서의 손상인 탈수초(Demyelination) 현상이 대표적으로 관찰되며, 탈수초 현상은 정상적인 신경전달을 방해하여 감각, 인지, 행동에 있어 다양한 증상을 유발한다. 이러한 이유로 수초 형성에 역할을 가지는 신경집세포의 기능이상이 발병 과정에 관여하는 것으로 알려져 있다.
뿐만 아니라, 길랭-바레증후군(Guillain-Barrι syndrome), 만성 염증성 탈수초성 다발신경병증 (chronic inflammatory demyelinating polyneuropathy), 진행성 염증성 신경병증 (Progressive inflammatory neuropathy), 항-MAG 말초신경병증(Anti-MAG peripheral neuropathy) 등 다수의 신경질환에서 탈수초현상이 발견되며, 신경집세포의 기능 이상이 질환들의 발병과정에 관여하는 것으로 알려져 있다.
Fbln5(Fibulin-5)은 Arg-Gly-Asp(RGD) 모티프를 가지는 세포 외로 분비되는 기질 단백질의 일종으로 신경병증과 관련하여 알려진 바는 없다. 하지만, 최근 성인 발병-CMT를 겪는 아시아 가족 집단에서 Fbln5 돌연변이가 관찰되었고, 해당 환자들에서 수초형성의 이상을 발견하였다. 또한, 수초형성에 필수적인 laminin 또한 세포 외 기질 단백질로서 Arg-Gly-Asp(RGD) 모티프로 인테그린(integrin)과 결합하여 수초형성에 필수적인 것으로 알려져 있다.
동물 모델을 통해 Fbln5의 수초형성에서의 생물학적 중요성을 알 수 있는데, 먼저 모폴리노(morpholino)를 이용한 Fbln5 넉다운 제프라피쉬는 발생단계에서 수초형성에서의 손상과 신경 전달을 통한 감각, 인지, 행동에 있어 다양한 증상들을 보여주고 있다. 이는 FBLN5의 신경집세포를 통한 수초 형성 기능에서의 필수적 역할을 암시한다.
또한, 탈수초현상을 유도하는 약물로 인해 탈수초화된 제브라피쉬는 Fbln5를 통해 수초현상이 다시 회복되는 것을 보여줌으로써, 다수의 질환에서의 수초 현상 회복에 있어서 Fbln5의 중요한 역할을 제시한다.
최근 본 발명자들은 Fbln5 유전자의 넉다운 제브라피쉬에서 수초 형성 이상 표현형을 관찰함으로써 다수의 신경 질환에서 Fibulin-5의 약물학적 기능이 중요함을 제시하게 되었다.
본 발명자들은 Fbln5를 모폴리노(morpholino) 시스템을 이용하여 넉다운 제브라피쉬를 개발하였고, 이를 이용하여 향후 관련 질환 타겟 치료 물질을 신속하고 효과적으로 스크리닝할 수 있는 병리적, 생리적 분석법을 개발함으로써 본 발명을 완성하였다.
이에, 본 발명의 목적은 Fbln5 유전자가 넉다운(knock-down)된 형질전환 동물 모델을 제공하는 것이다.
본 발명의 다른 목적은 Fbln5 유전자가 넉다운(knock-down)된 형질전환 동물 모델에 신경 또는 근육 질환 치료제 후보물질을 접촉시키는 단계를 포함하는 신경 또는 근육 질환 치료제 스크리닝 방법을 제공하는 것이다.
본 발명의 또 다른 목적은 Fbln5 단백질을 유효물질로 포함하는 신경 또는 근육 질환 개선, 예방 또는 치료용 약학적 조성물을 제공하는 것이다.
본 발명은 Fbln5 (Fibulin-5) 유전자 결손 동물 모델, 이를 이용한 신경 또는 근육 질환 치료제 스크리닝 방법 및 이를 이용해 스크리닝된 신경 또는 근육 질환 치료제를 포함하는 약제학적 조성물에 관한 것이다.
본 발명자들은 신경 및 근육 질환 관련 유전자로 Fbln5 유전자의 결손을 유도하여, 신경 및 근육 질환의 증상을 모사하는 동물 모델을 개발하였고, 신경 및 근육 질환의 표현형을 관찰하고, 향후 관련 질환 타겟의 치료 물질을 신속하고 효과적으로 스크리닝 하기에 적합함을 규명하여 본 발명을 완성하였다.
이하 본 발명을 더욱 자세히 설명하고자 한다.
본 발명의 일 양태는 Fbln5 유전자가 넉다운(knock-down)된 형질전환 동물에 관한 것이다.
본 발명의 용어 "넉다운"은 RNAi, 모폴리노(morpholino) 등을 이용해서 정상의 mRNA 발현량을 정상보다 줄이도록 유도하는 것을 의미한다.
본 발명에 있어서, Fbln5 유전자의 넉다운은 당업계에 알려진 다양한 방법, 예를 들어, RNAi 또는 모폴리노를 이용하여 유도할 수 있으나, 이에 한정되는 것은 아니다.
본 발명에 있어서, 상기 형질전환 동물은 Fbln5 단백질로의 번역 실패되는 위치(Exon 3과 Exon 4 사이)에 결합하여 정상의 기능을 하는 mRNA 발현을 억제하도록 제작된 모폴리노를 이용하여 유도하는 것일 수 있다.
이는 Fbln5 유전자를 목적으로 하는 것은 아니며, 예를 들어, Fbln5 유전자는 그대로 존재할 수 있으나, 유전자로 인한 단백질로의 번역이 방해를 받아 일어나지 않는 것일 수 있다.
상기 형질전환 동물은 제브라피쉬(zebrafish), 마우스(mouse) 또는 래트(rat)인 것일 수 있으나, 이에 한정되는 것은 아니다.
형질전환 동물은 외형 결함, 수초형성 결함 및 자극에 의한 반응 결함으로 이루어진 군으로부터 선택된 어느 하나 이상의 결함을 나타내는 것일 수 있으며, 예를 들어, 외형 결함, 수초형성 결함 및 자극에 의한 반응 결함을 모두 나타내는 것일 수 있다.
상기 형질전환 동물은 유전적 신경 또는 근육 질환을 갖는 동물일 수 있다.
상기 신경 또는 근육 질환은 탈수초병증, 신경 전도, 샤르코 마리 투스, 길랭-바레증후군, 만성 염증성 탈수초성 다발신경병증, 진행성 염증성 신경병증 또는 항-MAG 말초신경병증일 수 있으나, 이에 한정되는 것은 아니다.
본 발명의 일 양태는 Fbln5 유전자가 넉다운(knock-down)된 형질전환 제브라피쉬 수정란에 관한 것이다.
하기 실시 예에서 보는 바와 같이, Fbln5 유전자의 넉다운이 발생학적으로 외형 발달에 미치는 영향을 알아보기 위해 제브라피쉬 배아에 모폴리노를 주사하여 Fbln5 유전자를 넉다운 시킨 후 외형을 관찰한 결과, 정상의 제브라피쉬의 경우 꼬리가 곧고 일자형으로 움직임이 정상적인 반면, Fbln5가 넉다운된 제브라피쉬의 경우 꼬리가 몸통 바깥쪽으로 휘어있는 특성을 나타냈다.
또한, 모폴리노를 주사하지 않은 정상적인 제브라피쉬의 경우, 수초 단백질인 Claudin K의 발현을 통해 수초화 되어있는 데에 반해, Fbln5를 타겟하는 모폴리노를 주사한 돌연변이 제브라피쉬에서는 수초단백질인 Claudin K의 발현이 감소되어 있는 특성을 나타냈다.
본 발명의 일 구현 예에 따르면 상기 Fbln5 유전자가 넉다운(knock-down)된 형질전환 동물은 수초형성의 이상을 보여줌에 따라, 탈수초병증 질환에 따른 수초 형성 기전에 기반하여 신경 또는 근육 질환 관련 질환 모델로 이용이 가능하다.
본 발명의 용어 "질환 모델(disease model)"은 인간의 질병과 유사한 증상을 보여주어 병인을 규명하고 병태를 확인할 수 있는 연구 대상이 될 수 있는 모델 동물을 의미한다. 동물 모델로서 본 발명에서 채택한 제브라피쉬는 인간에서와 같은 효과를 예측할 수 있으며, 쉽게 만들 수 있고, 재현성이 높다는 장점이 있다.
본 발명에서 탈수초화 현상을 유도하기 위한 시험물질은 메트로니다졸(Metronidazole; 이하, MTZ)인 것일 수 있으나, 이에 한정되는 것은 아니다.
대장균(Escehrichia. Coli)에서 유래된 니트로리덕테이즈(nitroreductase; 이하, NTR)는 MTZ를 세포독소(cytotoxin)으로 치환시켜 신경집세포만 특이적으로 손상을 입힌다.
본 발명의 또 다른 양태는 Fbln5 유전자가 넉다운(knock-down)된 형질전환 동물 모델을 이용한 신경 또는 근육 질환 치료제 스크리닝 방법에 관한 것이다.
본 발명의 스크리닝 방법은 Fbln5 유전자가 넉다운(knock-down)된 형질전환 동물 모델에 신경 또는 근육 질환 치료제 후보물질을 접촉시키는 단계를 포함한다.
발 발명에 있어서, 상기 스크리닝 방법은 하기의 단계를 포함하는 것일 수 있다:
(a) Fbln5 유전자가 넉다운(knock-down)된 형질전환 동물 모델에 신경 또는 근육 질환 치료제 후보물질을 접촉시키는 단계;
(b) 치료제 시험물질이 투여된 동물 모델의 표현형을 확인하는 단계; 및
(c) 치료제 시험물질을 투여하지 않은 대조군 동물 모델의 표현형과 비교하는 단계.
본 발명에서 있어서, 상기 신경 또는 근육 질환 치료제 후보물질은 다양한 물질을 포함하며, 예를 들어, 화합물, 단백질, 펩타이드, 항체, 핵산 및 천연 추출물을 포함하나, 이에 한정되는 것은 아니다.
또한, 상기 신경 또는 근육 질환 치료제 후보물질은 단일 화합물 또는 화합물들의 혼합물, 예를 들어, 천연 추출물 또는 세포 또는 조직 배양물일 수 있으나, 이에 한정되는 것은 아니다.
본 발명에 있어서, 상기 신경 또는 근육 질환 치료제 후보물질은 합성 또는 천연 화합물의 라이브러리로부터 얻을 수 있다. 이러한 화합물의 라이브러리를 얻는 방법은 당업계에 공지되어 있다.
상기 합성 화합물 라이브러리는 Maybridge Chemical Co.(영국), Comgenex(미국), Brandon Associates(미국), Microsource(미국) 및 Sigma-Aldrich(미국)에서 상업적으로 구입 가능하며, 천연 화합물의 라이브러리는 Pan Laboratories(미국) 및 MycoSearch(미국)에서 상업적으로 구입 가능하다.
본 발명의 또 다른 양태는 Fbln5 단백질을 유효성분으로 포함하는 신경 또는 근육 질환 개선, 예방 또는 치료용 약제학적 조성물에 관한 것이다.
상기 Fbln5 단백질은 신경 또는 근육 질환 동물 모델에서 Fbln5가 세포외 기질 성분으로서 신경집세포(Schwann cell)의 수초화 현상을 촉진시키는 효능을 나타내어 신경 또는 근육 질환 예방 또는 치료에 이용될 수 있다.
본 발명의 바람직한 구현예에 따르면 상기 신경 또는 근육 질환 개선, 예방 또는 치료용 약제학적 조성물은 Fbln5 단백질의 약제학적 유효량; 및 약제학적으로 허용되는 담체;를 포함하는 것일 수 있다.
상기 Fbln5 단백질은 서열번호 3의 아미노산 서열로 이루어진 것일 수 있다.
상기 약제학적으로 허용되는 담체는 제제시에 통상적으로 이용되는 것으로서, 락토스, 덱스트로스, 수크로스, 솔비톨, 만니톨, 전분, 아카시아 고무, 인산 칼슘, 알기네이트, 젤라틴, 규산 칼슘, 미세결정성 셀룰로스, 폴리비닐피롤리돈, 셀룰로스, 물, 시럽, 메틸 셀룰로스, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 활석, 스테아르산 마그네슘 및 미네랄 오일 등을 포함하나, 이에 한정되는 것은 아니다.
본 발명의 약제학적 조성물은 상기 성분들 이외에 윤활제, 습윤제, 감미제, 향미제, 유화제, 현탁제, 보존제 등을 추가로 포함할 수 있다. 적합한 약제학적으로 허용되는 담체 및 제제는 Remington's Pharmaceutical Sciences (19th ed., 1995)에 상세히 기재되어 있다.
상기 약제학적 조성물은 경구 또는 비경구, 바람직하게는 비경구로 투여할 수 있고, 비경구 투여인 경우에는 근육 주입, 정맥 내 주입, 피하 주입, 복강 주입, 국소 투여, 경피 투여 등으로 투여할 수 있다.
상기 약제학적 조성물의 투여량은 1일 당 0.0001 내지 1000 ug(마이크로그램, 0.001 내지 1000 ug, 0.01 내지 1000 ug, 0.1 내지 1000 ug, 또는 1.0 내지 1000 ug일 수 있으나, 이에 한정되는 것은 아니며, 제제화 방법, 투여 방식, 환자의 연령, 체중, 성, 병적 상태, 음식, 투여 시간, 투여 경로, 배설 속도 및 반응 감응성과 같은 요인들에 의해 다양하게 처방될 수 있다.
상기 약제학적 조성물은 당해 발명이 속하는 기술분야에서 통상의 지식을 가진 자가 용이하게 실시할 수 있는 방법에 따라, 약제학적으로 허용되는 담체 및/또는 부형제를 이용하여 제제화함으로써 단위 용량 형태로 제조되거나 또는 다용량 용기 내에 내입시켜 제조될 수 있다.
상기 제형은 오일 또는 수성 매질중의 용액, 현탁액 또는 유화액 형태이거나, 엑스제, 분말제, 과립제, 정제 또는 캅셀제 형태일 수도 있으며, 분산제 또는 안정화제를 추가적으로 포함할 수 있다.
본 명세서의 용어 "단밸질"는 펩타이드 결합에 의해 아미노산 잔기들이 서로 결합되어 형성된 선형의 분자를 의미한다.
본 발명의 단백질는 당업계에 공지된 화학적 합성 방법, 특히 고상 합성 기술(solid-phase synthesis techniques; Merrifield, J. Amer. Chem. Soc. 85:2149-54(1963); Stewart, et al., Solid Phase Peptide Synthesis, 2nd. ed., Pierce Chem. Co.: Rockford, 111(1984)) 또는 액상 합성 기술(US 등록특허 제5,516,891호)에 따라 제조될 수 있다.
본 명세서의 용어 "안정성"은 인 비보 안정성뿐만 아니라, 저장 안정성, 예를 들어, 상온 저장 안정성도 의미한다.
본 명세서에서 용어 "약제학적 유효량"은 상술한 FBLN5 단백질의 효능 또는 활성을 달성하는 데 충분한 양을 의미한다.
본 발명은 Fbln5 (Fibulin-5) 유전자 결손 제브라피쉬(zebrafish) 모델, 이를 이용한 신경 또는 근육 질환 치료제 스크리닝 방법 및 이를 이용해 스크리닝된 신경 또는 근육 질환 치료제를 포함하는 약제학적 조성물에 관한 것이다. 본 발명의 제브라피쉬 모델을 이용하면, 부작용이 적으면서도 효능이 좋은 탈수초병증 질환 치료제를 효과적으로 스크리닝 할 수 있으며, 약물 후보물질의 독성에 따른 생체 내 부작용 유발 유무를 쉽고 신속하게 테스트할 수 있다. 또한, FBLN5 단백질 및 본 발명의 제브라피쉬 모델로 스크리닝된 물질은 신경 또는 근육 질환 개선, 치료 또는 예방에 유용하게 활용될 수 있다.
도 1은 본 발명의 일 실시 예에 따른 제브라피쉬 Fbln5 유전자를 표적하는 모폴리노가 결합되는 위치 및 서열을 나타내는 도면이다.
도 2는 본 발명의 일 실시 예에 따라 제브라피쉬 Fbln5 유전자를 넉다운시킨 후, 발생 중 결함을 나타내는 제브라피쉬를 확인한 결과를 나타내는 도면이다. (A: 제브라피쉬의 머리쪽, P: 제브라피쉬의 꼬리쪽)
도 3은 본 발명의 일 실시 예에 따른 제브라피쉬의 PLL에서 탈수초화 증상을 관찰하기 위한 부위를 도식화한 도면이다.
도 4는 본 발명의 일 실시 예에 따른 Fbln5 넉다운 제브라피쉬에서 정상 제브라피쉬에 비해 수초 형성이 감소함을 관찰한 사진이다.
도 5는 본 발명의 일 실시 예에 따른 Fbln5 넉다운 제브라피쉬에서의 수초형성 감소 정도를 수치화한 그래프이다.
도 6은 본 발명의 일 실시 예에 따라 정상 제브라피쉬와 Fbln5 넉다운 제브라피쉬의 행동 유형을 관찰하여 자극에 따른 움직이는 속력 변화를 보여주는 도면이다.
도 7은 본 발명의 일 실시 예에 따른 탈수초 형성을 유도하는 MTZ(Metronidazole)에 의한 탈수초화와 Fibulin-5 단백질 주입으로 인해 탈수초 현상이 복구됨을 나타내는 사진이다.
도 8은 본 발명의 일 실시 예에 따른 MTZ에 의한 탈수초화와 Fibulin-5 단백질 주입으로 탈수초화 복구 정도를 수치화한 그래프이다.
도 9는 본 발명의 일 실시 예에 따라 정상 제브라피쉬와 MTZ에 의해 탈수초화가 일어난 제브라피쉬, MTZ에 의한 탈수초화 현상이 Fibulin-5 단백질 주입으로 완화된 제브라피쉬의 행동 유형을 관찰하여 자극에 따른 움직이는 속력 변화를 보여주는 도면이다.
본 발명은 Fbln5 유전자가 넉다운(knock-down)된 형질전환 동물 모델에 관한 것이다.
이하, 본 발명을 하기의 실시예에 의하여 더욱 상세히 설명한다. 그러나 이들 실시예는 본 발명을 예시하기 위한 것일 뿐이며, 본 발명의 범위가 이들 실시예에 의하여 한정되는 것은 아니다.
제조예 1. 제브라피쉬의 사육
일반형(wild type) 제브라피쉬들을 28.0 내지 28.5℃에서 오전 8시 내지 오후 9시까지 점등하고 그 외 시간에는 소등하고, 먹이로 브라인 쉬림프(brine shrimp)를 주어 사육하였다.
제조예 2. 발생배의 준비
발생배는 교미를 시키기 전날 제브라피쉬 암컷과 수컷을 각각 칸막이로 나눠둔 뒤, 다음 날 아침에 밝게 해주면서 암컷과 수컷 사이의 칸막이를 제거해 교미를 시켰다. 교미를 통해 얻은 제브라피쉬의 알을 아가로스 젤(agarose gel)로 만든 틀에 옮겼다.
실시예 1. 제브라피쉬 Fbln5 넉다운(knockdown)을 위한 모폴리노제작
제브라피쉬 Fbln5 mRNA를 넉다운(knockdown)을 시키기 위해 모폴리노(morpholino)를 제작하였다(GENE TOOLS 사에 의뢰). 도 1에서와 같이, 제작된 모폴리노는 Fbln5이 번역(translation)되는 것을 억제하는 AUG 모폴리노로 정상의 기능을 하는 mRNA 발현을 억제하도록 제작되었다.
서열번호 명명 서열목록 비고
1 Morpholino ATGTTTGTTGAACTACGTGGCTTGA
2 Fbln5 mRNA GCTAAGCAAAACCAGGTGCTTGCGCTGAGGGCTCTGCAGTGGCTGGGAGGACCCCGGCGCTCTCCCCGTGTCCTCTCCACGACTCGCTCGGCCCCTCTGGAATAAAACACCCGCGAGCCCCGAGGGCCCAGAGGAGGCCGACGTGCCCGAGCTCCTCCGGGGGTCCCGCCCGCGAGCTTTCTTCTCGCCTTCGCATCTCCTCCTCGCGCGTCTTGGACATGGAGACCAGCCCTTTACCATCTTGTACCGGGACATGGACGTGGTGTCAGGACGCTCCGTTCCCGCTGACATCTTCCAAATGCAAGCCACGACCCGCTACCCTGGGGCCTATTACATTTTCCAGATCAAATCTGGGAATGAGGGCAGAGAATTTTACATGCGGCAAACGGGCCCCATCAGTGCCACCCTGGTGATGACACGCCCCATCAAAGGGCCCCGGGAAATCCAGCTGGACTTGGAAATGATCACTGTCAACACTGTCATCAACTTCAGAGGCAGCTCCGTGATCCGACTGCGGATATATGTGTCGCAGTACCCATTCTGAGCCTCGGGCTGGAGCCTCCGACGCTGCCTCTCATTGGCACCAAGGGACAGGAGAAGAGAGGAAATAACAGAGAGAATGAGAGCGACACAGACGTTAGGCATTTCCTGCTGAA
3 FBLN5 protein MPGIKRILTVTILALCLPSPGNAQAQCTNGFDLDRQSGQCLDIDECRTIPEACRGDMMCVNQNGGYLCIPRTNPVYRGPYSNPYSTPYSGPYPAAAPPLSAPNYPTISRPLICRFGYQMDESNQCVDVDECATDSHQCNPTQICINTEGGYTCSCTDGYWLLEGQCLDIDECRYGYCQQLCANVPGSYSCTCNPGFTLNEDGRSCQDVNECATENPCVQTCVNTYGSFICRCDPGYELEEDGVHCSDMDECSFSEFLCQHECVNQPGTYFCSCPPGYILLDDNRSCQDINECEHRNHTCNLQQTCYNLQGGFKCIDPIRCEEPYLRISDNRCMCPAENPGCRDQPFTILYRDMDVVSGRSVPADIFQMQATTRYPGAYYIFQIKSGNEGREFYMRQTGPISATLVMTRPIKGPREIQLDLEMITVNTVINFRGSSVIRLRIYVSQYPF
실시예 2. Fbln5 넉다운 제브라피쉬의 발생학적 결함 조사
실시예 1에서 제작한 모폴리노 10.0 ng을 제브라피쉬 배아에 미량주사(microinjection)하여 제브라피쉬 Fbln5 mRNA를 넉다운 시킨 후, 태어나지 5일 후에 표현형 (phenotype)을 관찰하였다.
도 2에서 확인할 수 있듯이, 정상 제브라피쉬의 경우 꼬리가 곧고 일자형이었으나, Fbln5가 넉다운된 제브라피쉬의 경우 꼬리가 몸통 바깥 쪽으로 휘는 특징을 확인하였다.
실시예 3. Fbln5 가 넉다운 제브라피쉬의 수초 형성 결함 조사
실시예 1에서 제작한 모폴리노 10.0 pg을 제브라피쉬 배아에 미량주사하여 Fbln5가 넉다운된 제브라피쉬 배아를 이용해, 수초형성 단백질인 Claudin K를 마커로 하여 수초형성의 결함을 조사하였다. 도 3에서와 같이, 수초형성을 관찰하기 위해 몸통의 특정 지역을 선정하였고, 공초점 현미경(Carl Zeiss, LSM 700, Germany) 을 통해 Claudin K의 발현양상을 관찰하여, 그 결과를 도 4 내지 5 및 표 2에 나타내었다.
relative intensity
Control 1
Fbln5 8pg 0.45
Fbln5 10pg 0.37
도 4, 도 5 및 표 2에서 확인할 수 있듯이, 정상 제브라피쉬는 수초단백질인 Claudin K가 정상 발현되어 축삭을 신경집세포가 감싸고 있는 형태를 보였으나, FBLN5 모폴리노가 주사된 제브라피쉬는 마커 단백질의 발현 패턴이 감소되어 있으며, 축삭의 수초화가 정상이 비해 감소되어 있었음을 관찰할 수 있었다.
실시예 4. Fbln5 넉다운된 제브라피쉬의 행동학적 결함 조사
Fbln5의 결핍으로 인한 탈수초화 현상이 신경 전달에 이상을 유도하는지 확인하였다. 구체적으로, 모폴리노를 사용하여 Fbln5이 결핍된 제브라피쉬 모델의 자극에 대한 반응 행동 유형을 관찰하고자 행동 관찰 기기를 이용하여 각 제브라피쉬 배아의 움직임 정도를 녹화 촬영하고, 이들의 행동 유형을 정상 제브라피쉬 대조군과 비교 분석하였다.
구체적으로, 모폴리노는 실시예 2에서와 같이 8.0 pg을 제브라피쉬 배아에 미량 주사되었다. 자극에 대한 반응 행동 유형 조사는 제브라피쉬가 들어있는 디쉬에 다니오비젼(Noldus, Wageningen, The Netherlands)기기를 통해 진동 자극을 주기 직전 1초간의 속력과 자극을 준 직후 1초간의 속력을 EthoVision XT 소프트웨어로 측정하여, Fbln5 결핍 제브라피쉬의 속력(cm/s) 과 정상 제브라피쉬의 속력을 비교하여, 그 결과를 도 6 및 표 3에 나타내었다.
자극 이전 자극 이후
Control 0.0472 cm/s 0.32527 cm/s
Fbln5 kd 0.08024 cm/s 0.09698 cm/s
도 6 및 표 3에서 확인할 수 있듯이, 자극 이전에 있어서 정상 제브라피쉬와 Fbln5 결핍 제브라피쉬의 속력에 있어서는 차이가 없었으나, 진동 자극을 준 직 후에는 정상 제브라피쉬는 빠르게 움직인 반면, Fbln5 결핍 제브라피쉬의 경우 정상에 비해 자극에 대한 반응이 느리게 나타남을 관찰하였다.
실시예 5. Fibulin-5를 통한 수초 형성 결함의 복구 조사
Fibulin-5의 탈수초병증 예방 또는 치료제로서의 효용성을 확인하기 위해였다. 수초 형성 결함의 복구를 조사하였다. 탈수초 증상을 유도하기 위한 시험물질로는 메트로니다졸(Metronidazole; 이하, MTZ)을 사용하였다. MTZ는 태어난 지 4일째되는 배아에 가 들어있는 배양액에 4uM로 48시간 동안 처리하였다. 그 다음, Fibulin-5의 탈수초 예방 혹은 수초 재생 능력을 평가하고자 MTZ 처리 전 관찰 몸통 부위에 Fibulin-5 1.0 pg씩 2 체절(somite) 간격으로 총 4군데에 미량 주입하였다. 그 다음, Claudin K의 발현이 복구됨을 관찰하여, 그 결과를 도 7, 도8 및 표 4에 나타내었다.
Relative intensity
Control 1
MTZ 0.26
MTZ+Fibulin 5 0.69
MTZ+D.W 0.41
도 7, 도 8 및 표 4에서 확인할 수 있듯이, Fibulin-5를 주입한 제브라피쉬에서는 축삭을 따라 Claudin K의 발현이 복구됨을 확인하였다.
실시예 6. Fibulin-5를 통한 제브라피쉬의 행동학적 결함 복구 조사
탈수초화 현상으로 인한 신경 전달에 이상이 Fibulin-5의 주입으로 복구되는지 확인하고자 하였다. 제브라피쉬에서 탈수초증상의 유도는 실시예 5에서와 같이 MTZ를 사용하였으며, 자극에 대한 행동학적 반응 조사는 실시예 4에서와 같이 진동 자극 전후의 속력변화를 비교 분석하여, 그 결과를 도 9 및 표 5에 나타내었다.
자극 이전 자극 이후
Control 0.1063 cm/s 0.5169 cm/s
MTZ 0.0501 cm/s 0.0969 cm/s
MTZ+Fibulin 5 0.0472 cm/s 0.2563 cm/s
MTZ+D.W 0.087 cm/s 0.1787 cm/s
도 9 및 표 5에서 확인할 수 있듯이, MTZ로 탈수초화가 일어난 제브라피쉬는 자극 이후 속력의 변화가 거의 없었으나, Fibulin-5를 미량 주입한 제브라피쉬에서는 다소 자극 이후 속력이 증가함을 관찰하였다. 또한, 대조군으로서 MTZ 처리 후, 증류수를 주입한 제브라피쉬의 경우 속력의 변화가 없음을 통해 복구되지 않음을 관찰하였다.
본 발명은 Fbln5 (Fibulin-5) 유전자 결손 동물 모델, 이를 이용한 신경 또는 근육 질환 치료제 스크리닝 방법 및 이를 이용해 스크리닝된 신경 또는 근육 질환 치료제를 포함하는 약제학적 조성물에 관한 것이다.

Claims (10)

  1. Fbln5 유전자가 넉다운(knock-down)된 형질전환 동물 모델.
  2. 제1항에 있어서, 상기 형질전환 동물은 제브라피쉬, 마우스(mouse) 또는 래트(rat)인 것인, 형질전환 동물 모델.
  3. 제1항에 있어서, 상기 형질전환 동물 모델은 외형 결함, 수초형성 결함 및 자극에 의한 반응 결함으로 이루어진 군으로부터 선택된 어느 하나 이상의 결함을 나타내는 것인, 형질전환 동물 모델.
  4. 제1항에 있어서, 상기 형질전환 동물 모델은 신경 또는 근육 질환 동물 모델인 것인, 형질전환 동물 모델.
  5. 제4항에 있어서, 상기 신경 또는 근육 질환은 탈수초병증, 신경 전도, 샤르코 마리 투스, 길랭-바레증후군, 만성 염증성 탈수초성 다발신경병증, 진행성 염증성 신경병증 또는 항-MAG 말초신경병증인 것인, 형질전환 동물 모델.
  6. Fbln5 유전자가 넉다운(knock-down)된 형질전환 동물 모델에 신경 또는 근육 질환 치료제 후보물질을 접촉시키는 단계를 포함하는 신경 또는 근육 질환 치료제 스크리닝 방법.
  7. 제6항에 있어서, 상기 신경 또는 근육 질환 치료제 스크리닝 방법은 하기의 단계를 포함하는 것인, 신경 또는 근육 질환 치료제 스크리닝 방법:
    (a) Fbln5 유전자가 넉다운(knock-down)된 형질전환 동물 모델에 신경 또는 근육 질환 치료제 후보물질을 접촉시키는 단계;
    (b) 치료제 시험물질이 투여된 동물 모델의 표현형을 확인하는 단계; 및
    (c) 치료제 시험물질을 투여하지 않은 대조군 동물 모델의 표현형과 비교하는 단계.
  8. 제6항에 있어서, 상기 신경 또는 근육 질환은 샤르코 마리 투스, 길랭-바레증후군, 만성 염증성 탈수초성 다발신경병증, 진행성 염증성 신경병증 또는 항-MAG 말초신경병증인 것인, 신경 또는 근육 질환 치료제 스크리닝 방법.
  9. Fbln5 단백질을 유효물질로 포함하는 신경 또는 근육 질환 개선, 예방 또는 치료용 약학적 조성물.
  10. 제7항에 있어서, 상기 신경 또는 근육 질환은 질환은 샤르코 마리 투스, 길랭-바레증후군, 만성 염증성 탈수초성 다발신경병증, 진행성 염증성 신경병증 또는 항-MAG 말초신경병증인 것인, 약학적 조성물.
PCT/KR2019/012636 2018-10-30 2019-09-27 Fbln5 유전자 결손 동물 모델 및 이를 이용한 신경 또는 근육 질환 치료제 스크리닝 방법 WO2020091235A1 (ko)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR20180131169 2018-10-30
KR10-2018-0131169 2018-10-30
KR10-2019-0118315 2019-09-25
KR1020190118315A KR102360896B1 (ko) 2018-10-30 2019-09-25 Fbln5 유전자 결손 동물 모델 및 이를 이용한 신경 또는 근육 질환 치료제 스크리닝 방법

Publications (1)

Publication Number Publication Date
WO2020091235A1 true WO2020091235A1 (ko) 2020-05-07

Family

ID=70462640

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2019/012636 WO2020091235A1 (ko) 2018-10-30 2019-09-27 Fbln5 유전자 결손 동물 모델 및 이를 이용한 신경 또는 근육 질환 치료제 스크리닝 방법

Country Status (1)

Country Link
WO (1) WO2020091235A1 (ko)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2006204110A (ja) * 2005-01-25 2006-08-10 Institute Of Physical & Chemical Research カルパスタチン遺伝子改変非ヒト動物およびその利用
US20170071972A1 (en) * 2014-04-18 2017-03-16 Genethon Method of treating peripheral neuropathies and motor neuron diseases

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2006204110A (ja) * 2005-01-25 2006-08-10 Institute Of Physical & Chemical Research カルパスタチン遺伝子改変非ヒト動物およびその利用
US20170071972A1 (en) * 2014-04-18 2017-03-16 Genethon Method of treating peripheral neuropathies and motor neuron diseases

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
AUER-GRUMBACH, M.: "Fibulin-5 mutations link inherited neuropathies, age-related macular degeneration and hyperelastic skin", BRAIN, vol. 18, June 2011 (2011-06-01), pages 39 - 1852, XP55704427 *
NAKAMURA, T.: "Fibulin-5/DANCE is essential for elastogenesis in vivo", NATURE, 10 January 2002 (2002-01-10), XP002998232 *
YANAGISAWA, H. ET AL.: "Fibulin-5 is an elastin-binding protein essential for elastic fibre development in vivo", NATURE, 10 January 2002 (2002-01-10), pages 168 - 171, XP002998230, DOI: 10.1038/415168a *

Similar Documents

Publication Publication Date Title
Seyfried et al. A review of mouse mutants as genetic models of epilepsy
DE69737816T2 (de) Darmprotein mit dreiblättriger struktur
US20100178277A1 (en) Methods and compositions for stimulating cells
Joshi et al. Inhibition of Rho-kinase differentially affects axon regeneration of peripheral motor and sensory nerves
Di Nardo et al. The physiology of homeoprotein transduction
EP3024463B1 (en) Neuroprotective bicyclic compounds and methods for their use in treating autism spectrum disorders and neurodevelopmental disorders
PT2667715T (pt) Tratamento de perturbações do espetro do autismo utilizando o ácido glicil-l-2-metilpropil-l-glutâmico
EA021303B1 (ru) Способы лечения или профилактики рвоты с помощью агентов, усиливающих секрецию гормона роста
WO2016195224A1 (ko) Zc4h2 유전자를 녹아웃시킨 형질전환 동물모델 및 이의 용도
Linden et al. Control of programmed cell death by neurotransmitters and neuropeptides in the developing mammalian retina
Campos-Torres et al. The differential response of astrocytes within the vestibular and cochlear nuclei following unilateral labyrinthectomy or vestibular afferent activity blockade by transtympanic tetrodotoxin injection in the rat
Halasz et al. Substance P neurotransmission and violent aggression: the role of tachykinin NK1 receptors in the hypothalamic attack area
WO2020091235A1 (ko) Fbln5 유전자 결손 동물 모델 및 이를 이용한 신경 또는 근육 질환 치료제 스크리닝 방법
JP2010046062A (ja) 脳損傷の予後改善薬のスクリーニング方法
WO2016043354A1 (ko) 새로운 알츠하이머 질환 치료용 약학적 조성물
Epstein et al. Appearance of somatostatin and vasoactive intestinal peptide along the developing chicken gut
WO2021261965A1 (ko) Prox1 억제제를 유효성분으로 포함하는, 망막신경 퇴행성 질환의 예방 또는 치료용 약학적 조성물
US20230149355A1 (en) Compositions and methods for modulating trp channel activity
KR102360896B1 (ko) Fbln5 유전자 결손 동물 모델 및 이를 이용한 신경 또는 근육 질환 치료제 스크리닝 방법
Bellintani-Guardia et al. Displaced retinal ganglion cells project to the accessory optic system in the chameleon (Chamaeleo calyptratus)
Hagl et al. Temporal and regional morphological differences as a consequence of FGF-2 deficiency are mirrored in the myenteric proteome
Niewiadomska-Cimicka et al. SCA7 mice recapitulate CNS, PNS and retina pathologies and show a transcriptional signature of Purkinje cell dysfunction prevailing in SCA1 and SCA2 mice
Kiyozumi et al. Human disease-associated extracellular matrix orthologs ECM3 and QBRICK regulate primary mesenchymal cell migration in sea urchin embryos
WO2020085547A1 (ko) 알츠하이머병 예방 또는 치료용 재조합 단백질 및 이를 포함하는 알츠하이머병 예방 또는 치료용 조성물
KR102200606B1 (ko) 기분 장애 예방 또는 치료를 위한 iqsec3 유전자 및 이를 이용한 스크리닝 방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 19878157

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 19878157

Country of ref document: EP

Kind code of ref document: A1