WO2020047268A1 - Products and methods for inhibition of expression of mutant gars protein - Google Patents

Products and methods for inhibition of expression of mutant gars protein Download PDF

Info

Publication number
WO2020047268A1
WO2020047268A1 PCT/US2019/048832 US2019048832W WO2020047268A1 WO 2020047268 A1 WO2020047268 A1 WO 2020047268A1 US 2019048832 W US2019048832 W US 2019048832W WO 2020047268 A1 WO2020047268 A1 WO 2020047268A1
Authority
WO
WIPO (PCT)
Prior art keywords
aav
gars
gene
composition
nucleic acid
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2019/048832
Other languages
English (en)
French (fr)
Inventor
Scott Quenton HARBOR
Robert W. BURGESS
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Jackson Laboratory
Nationwide Childrens Hospital Inc
Original Assignee
Jackson Laboratory
Nationwide Childrens Hospital Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Jackson Laboratory, Nationwide Childrens Hospital Inc filed Critical Jackson Laboratory
Priority to AU2019328270A priority Critical patent/AU2019328270B2/en
Priority to JP2021510957A priority patent/JP2021534794A/ja
Priority to CA3110665A priority patent/CA3110665A1/en
Priority to US17/271,377 priority patent/US20210324417A1/en
Priority to EP19768951.6A priority patent/EP3844284A1/en
Publication of WO2020047268A1 publication Critical patent/WO2020047268A1/en
Anticipated expiration legal-status Critical
Priority to JP2024107253A priority patent/JP2024133570A/ja
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/0075Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the delivery route, e.g. oral, subcutaneous
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/43Enzymes; Proenzymes; Derivatives thereof
    • A61K38/53Ligases (6)
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1137Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/93Ligases (6)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y601/00Ligases forming carbon-oxygen bonds (6.1)
    • C12Y601/01Ligases forming aminoacyl-tRNA and related compounds (6.1.1)
    • C12Y601/01014Glycine-tRNA ligase (6.1.1.14)
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00Genetically modified animals
    • A01K2217/07Animals genetically altered by homologous recombination
    • A01K2217/075Animals genetically altered by homologous recombination inducing loss of function, i.e. knock out
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2227/00Animals characterised by species
    • A01K2227/10Mammal
    • A01K2227/105Murine
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00Animals characterised by purpose
    • A01K2267/03Animal model, e.g. for test or diseases
    • A01K2267/0306Animal model for genetic diseases
    • A01K2267/0318Animal model for neurodegenerative disease, e.g. non- Alzheimer's
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering nucleic acids [NA]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering nucleic acids [NA]
    • C12N2310/141MicroRNAs, miRNAs
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/30Special therapeutic applications
    • C12N2320/32Special delivery means, e.g. tissue-specific
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14111Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141Use of virus, viral particle or viral elements as a vector
    • C12N2750/14143Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector

Definitions

  • RNA interference-based methods and products for inhibiting the expression of mutant Glycyl-tRNA Synthetase ⁇ GARS are provided. Delivery vehicles such as
  • recombinant adeno-associated viruses deliver DNAs encoding GARS microRNAs, as well as a replacement GARS gene that is resistant to knock down by the microRNAs.
  • the methods have application in the treatment of Charcot-Marie-Tooth Disease Type 2D (CMT2D).
  • CMT2D also known as distal spinal muscular atrophy V (dSMAV)
  • dSMAV distal spinal muscular atrophy V
  • GARS distal spinal muscular atrophy V
  • dSMAV distal spinal muscular atrophy V
  • RNA interference is a mechanism of gene regulation in eukaryotic cells that researchers have worked on adapting for the treatment of various diseases. RNAi refers to post-transcriptional control of gene expression mediated by microRNAs (miRNAs).
  • miRNAs microRNAs
  • the miRNAs are small (21 -25 nucleotides in length), noncoding RNAs that share sequence homology and base-pair with cognate messenger RNAs (mRNAs).
  • mRNAs messenger RNAs
  • the interaction between the miRNAs and mRNAs directs cellular gene silencing machinery to prevent the translation of the mRNAs.
  • the RNAi pathway is summarized in Duan (Ed.), Section 7.3 of Chapter 7 in Muscle Gene Therapy, Springer Science+Business Media, LLC (2010). Section 7.4 mentions GARS RNAi therapy of CMT2D in mice to demonstrate proof-of-principle for RNAi therapy of dominant neuromuscular disorders.
  • RNAi pathways As an understanding of natural RNAi pathways has developed, researchers have designed artificial miRNAs for use in regulating expression of target genes for treating disease. As described in Section 7.4 of Duan, supra, artificial miRNAs can be transcribed from DNA expression cassettes. The miRNA sequence specific for a target gene is transcribed along with sequences required to direct processing of the miRNA in a cell. Viral vectors such as adeno-associated virus have been used to deliver miRNAs to muscle.
  • Adeno-associated virus is a replication-deficient parvovirus, the single-stranded DNA genome of which is about 4.7 kb in length including 145 nucleotide inverted terminal repeat (ITRs).
  • ITRs nucleotide inverted terminal repeat
  • AAV serotypes There are multiple serotypes of AAV.
  • the nucleotide sequences of the genomes of the AAV serotypes are known.
  • the complete genome of AAV-1 is provided in GenBank Accession No. NC_002077
  • the complete genome of AAV-2 is provided in GenBank Accession No. NC_001401 and Srivastava et al., J. Virol., 45: 555-564 (1983)
  • the complete genome of AAV-3 is provided in GenBank Accession No.
  • AAV-4 is provided in GenBank Accession No. NC_001829
  • AAV-5 genome is provided in GenBank Accession No. AF085716
  • the complete genome of AAV-6 is provided in GenBank Accession No. NC_00 1862
  • at least portions of AAV-7 and AAV-8 genomes are provided in GenBank Accession Nos. AX753246 and AX753249, respectively
  • the AAV -9 genome is provided in Gao et al., J. Virol., 78: 6381 -6388 (2004)
  • the AAV-10 genome is provided in Mol.
  • Genbank Accession No. EU285562 Genbank Accession No. EU285562.
  • the sequence of the AAV rh.74 genome is provided in see U.S. Patent 9,434,928, incorporated herein by reference.
  • the sequence of the AAV-B1 genome is provided in Choudhury et al., Mol. Ther., 24(7): 1247-1257 (2016).
  • Cis-acting sequences directing viral DNA replication (rep), encapsidation/packaging and host cell chromosome integration are contained within the AAV ITRs.
  • Three AAV promoters (named p5, p19, and p40 for their relative map locations) drive the expression of the two AAV internal open reading frames encoding rep and cap genes.
  • the two rep promoters (p5 and p19), coupled with the differential splicing of the single AAV intron (at nucleotides 2107 and 2227), result in the production of four rep proteins (rep 78, rep 68, rep 52, and rep 40) from the rep gene.
  • Rep proteins possess multiple enzymatic properties that are ultimately responsible for replicating the viral genome.
  • the cap gene is expressed from the p40 promoter and it encodes the three capsid proteins VP1 , VP2, and VP3.
  • Alternative splicing and non-consensus translational start sites are responsible for the production of the three related capsid proteins.
  • a single consensus polyadenylation site is located at map position 95 of the AAV genome. The life cycle and genetics of AAV are reviewed in Muzyczka, Current Topics in Microbiology and Immunology, 158: 97-129 (1992).
  • AAV possesses unique features that make it attractive as a vector for delivering foreign DNA to cells, for example, in gene therapy.
  • AAV infection of cells in culture is noncytopathic, and natural infection of humans and other animals is silent and
  • AAV infects many mammalian cells allowing the possibility of targeting many different tissues in vivo.
  • AAV transduces slowly dividing and non dividing cells, and can persist essentially for the lifetime of those cells as a transcriptionally active nuclear episome (extrachromosomal element).
  • the AAV proviral genome is infectious as cloned DNA in plasmids which makes construction of recombinant genomes feasible.
  • the signals directing AAV replication, genome encapsidation and integration are contained within the ITRs of the AAV genome, some or all of the internal approximately 4.3 kb of the genome (encoding replication and structural capsid proteins, rep-cap) may be replaced with foreign DNA.
  • the rep and cap proteins may be provided in trans.
  • Another significant feature of AAV is that it is an extremely stable and hearty virus. It easily withstands the conditions used to inactivate adenovirus (56 to 65°C for several hours), making cold preservation of AAV less critical. AAV may even be lyophilized. Finally, AAV- infected cells are not resistant to superinfection.
  • RNAi is described herein as an effective long-term treatment for dominant genetic disorders.
  • methods and products are provided for treating any patient with a dominantly-inherited neuropathy or dominantly-inherited motor neuron disease by knocking down both wild-type and mutant forms of the involved gene(s), while also delivering an RNAi-resistant replacement gene.
  • RNAi RNAi-resistant replacement GARS gene.
  • Use of the methods and products is indicated, for example, in preventing or treating CMT2D.
  • the methods deliver inhibitory RNAs that knock down the expression of both the wild- type and mutant GARS gene.
  • the GARS inhibitory RNAs contemplated include, but are not limited to, antisense RNAs, small inhibitory RNAs (siRNAs), short hairpin RNAs (shRNAs) or artificial microRNAs (GARS miRNAs) that inhibit expression of the wild-type and mutant GARS gene.
  • GARS miRNAs are provided as well as polynucleotides encoding one or more of the GARS miRNAs.
  • the disclosure includes nucleic acids comprising RNA- encoding and guide strand-encoding nucleotide sequences comprising at least about 70%,
  • Exemplary GARS miRNAs comprise a full length miRNA antisense guide strand set out in any one of SEQ ID NOs: 1 -25 or variants thereof comprising at least about 70%, 75%,
  • Corresponding final processed guide strand sequences are respectively set out in SEQ ID NOs: 26-50 or variants thereof comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity to the sequence set forth in any one of SEQ ID NOs: 26-50.
  • the antisense guide strand is the strand of the mature miRNA duplex that becomes the RNA component of the RNA induced silencing complex ultimately responsible for sequence-specific gene silencing. See Section 7.3 of Duan, supra.
  • GARS miRNAs can specifically bind to a segment of a messenger RNA (mRNA) encoded by a human GARS gene (represented by SEQ ID NO: 69 which is a human GARS cDNA), wherein the segment conserved relative to mRNA encoded by the wild-type mouse GARS gene (represented by SEQ ID NO: 70 which is a mouse GARS cDNA), and the segment does not encode sequence comprising an amino acid mutation associated with CMT2D.
  • a GARS miRNA can specifically bind a mRNA segment that is complementary to a sequence within nucleotides 136-323, 327-339, 544-590, 720-785, 996- 1406, 1734-1913 or 1950-2187 of SEQ ID NO: 69. More particularly, a GARS miRNA can specifically bind a mRNA segment that is complementary to a sequence within nucleotides 996-1406 of SEQ ID NO: 69.
  • RNAi-resistant replacement GARS genes are provided.
  • An“RNAi-resistant replacement GARS gene” has a nucleotide sequence the expression of which is not knocked down by the GARS miRNAs described herein but the nucleotide sequence still encodes a GARS protein that has glycl-tRNA synthetase activity.
  • Exemplary RNAi-resistant replacement GARS genes are set out in SEQ ID NOs: 51 -57.
  • RNAi-resistant replacement GARS genes can be achieved using a delivery vehicle that delivers the DNA(s) to a neuronal cell.
  • a delivery vehicle that delivers the DNA(s) to a neuronal cell.
  • rAAV recombinant AAV
  • Other vectors for example, other viral vectors such as lentivirus, adenovirus, retrovirus, equine-associated virus, alphavirus, pox viruses, herpes virus, polio virus, Sindbis virus and vaccinia viruses
  • viral vectors for example, other viral vectors such as lentivirus, adenovirus, retrovirus, equine-associated virus, alphavirus, pox viruses, herpes virus, polio virus, Sindbis virus and vaccinia viruses
  • viral vectors encoding one or more GARS miRNAs and RNAi-resistant replacement GARS genes.
  • the viral vector is a rAAV
  • the rAAV lack AAV rep and cap genes.
  • the rAAV can be self-complementary (sc) AAV.
  • non-viral vectors such as lipid nanoparticles can be used for delivery.
  • rAAV each encoding a GARS miRNA and an RNAi-resistant replacement GARS gene. Also provided are rAAV encoding one or more GARS miRNAs.
  • a rAAV (with a single-stranded genome) encoding one or more GARS miRNAs can encode one, two, three, four, five, six, seven or eight GARS miRNAs, while a separate rAAV encodes an RNAi-resistant replacement GARS gene.
  • a scAAV encoding one or more GARS miRNAs can encode one, two, three or four GARS miRNAs, while a separate rAAV encodes an RNAi-resistant replacement GARS gene.
  • rAAV comprising an RNAi-resistant replacement GARS gene.
  • compositions comprising the nucleic acids or viral vectors described herein.
  • a delivery vehicle such as rAAV
  • expression of the mutant GARS allele is inhibited by at least 10, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 95, at least 98 percent, at least 99 percent, or 100 percent.
  • expression of the wild-type GARS allele is inhibited by at least 10, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 95, at least 98 percent, at least 99 percent, or 100 percent.
  • a delivery vehicle such as rAAV
  • RNAi-resistant replacement GARS gene comprises administering to the animal a delivery vehicle (such as rAAV) comprising DNA encoding one or more GARS miRNA and a delivery vehicle (such as rAAV) comprising an RNAi-resistant replacement GARS gene wherein, if the delivery vehicle is rAAV, the rAAV lacks rep and cap genes.
  • a delivery vehicle such as rAAV
  • rAAV RNAi-resistant replacement GARS gene
  • a delivery vehicle such as rAAV
  • a delivery vehicle comprising DNA encoding a GARS miRNA and an RNAi-resistant replacement GARS gene wherein, if the delivery vehicle is rAAV, the rAAV lacks rep and cap genes.
  • Other methods of preventing or treating CMT2D comprise administering a delivery vehicle (such as rAAV) comprising DNA encoding one or more GARS miRNA and rAAV comprising an RNAi-resistant replacement GARS gene wherein, if the delivery vehicle is rAAV, the rAAV lacks rep and cap genes.
  • the methods result in restoration of GARS glycyl-tRNA synthetase expression to at least 25 percent, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 95, at least 98 percent, at least 99 percent, or 100 percent or more, of normal GARS glycyl-tRNA synthetase expression in an unaffected individual.
  • the disclosure provides a nucleic acid comprising a nucleic acid encoding a GARS miRNA comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the polynucleotide sequence set forth in any one of SEQ ID NOs: 1 -25; a nucleic acid encoding a GARS guide strand comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the polynucleotide sequence set forth in any one of SEQ ID NOs: 26-50; or a nucleic acid encoding a GARS mi
  • the disclosure provides a viral vector comprising the nucleic acids described herein and/or a combination of any one or more thereof.
  • the viral vector is an adeno-associated virus (AAV), adenovirus, lentivirus, retrovirus, poxvirus, baculovirus, herpes simplex virus, vaccinia virus, or a synthetic virus.
  • the viral vector is an AAV.
  • the AAV lacks rep and cap genes.
  • the AAV is a recombinant AAV (rAAV) or a self-complementary recombinant AAV (scAAV).
  • the AAV is AAV-1 , AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV- 10, AAV-1 1 , AAV-12, AAV-13, AAV-anc80, and AAV rh.74.
  • the AAV is AAV-9.
  • the AAV is a pseudotyped AAV.
  • the AAV is AAV2/8 or AAV2/9.
  • expression of the nucleic acid encoding the GARS miRNA is under the control of a U6 promoter.
  • expression of the RNAi- resistant replacement GARS gene is under the control of a chicken b-actin promoter.
  • the disclosure provides a composition comprising the nucleic acids described herein and a pharmaceutically acceptable carrier.
  • the disclosure provides a composition comprising a viral vector comprising the nucleic acids described herein and/or a combination of any one or more thereof and a pharmaceutically acceptable carrier.
  • the disclosure provides a composition
  • a composition comprising a delivery vehicle capable of delivering agents to a neuronal cell and (a) a nucleic acid comprising an RNAi-resistant human GARS gene; (b) a nucleic acid encoding a miRNA, wherein the miRNA binds a segment of a messenger RNA (mRNA) encoded by a human GARS gene, wherein the segment is conserved relative to the wild-type mouse GARS gene, and wherein the segment does not encode sequence comprising a mutation associated with CMT2D; or a combination of the nucleic acids of (a) and (b) and, optionally, a pharmaceutically acceptable carrier.
  • the nucleic acid in the composition comprises the RNAi-resistant human GARS gene comprising a polynucleotide comprising at least about 70%, 75%, 80%, 81%,
  • the human GARS gene comprises the sequence of SEQ ID NO: 69, or a variant thereof comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, identity to the sequence of SEQ ID NO: 69.
  • the mouse GARS gene comprises the sequence of SEQ ID NO: 70, or a variant thereof comprising at least about 70%, 75%, 80%,
  • the mRNA segment is complementary to a sequence within nucleotides 136-323, 327-339, 544-590, 720-785, 996-1406, 1734-1913 or 1950-2187 of a human GARS gene comprising the sequence of SEQ ID NO: 69. In some aspects, the mRNA segment is complementary to a sequence within nucleotides 996-1406 of SEQ ID NO: 69.
  • the delivery vehicle in the composition is a viral vector.
  • the viral vector is an adeno-associated virus (AAV), adenovirus, lentivirus, retrovirus, poxvirus, baculovirus, herpes simplex virus, vaccinia virus, or a synthetic virus.
  • the viral vector is an AAV.
  • the AAV lacks rep and cap genes.
  • the AAV is a recombinant AAV (rAAV) or a self-complementary recombinant AAV (scAAV).
  • the AAV is or has a capsid serotype selected from the group consisting of: AAV-1 , AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV- 9, AAV-10, AAV-1 1 , AAV-12, AAV-13, AAV-anc80, and AAV rh.74.
  • the AAV is or has a capsid serotype of AAV-9.
  • the AAV is a pseudotyped AAV.
  • the AAV is AAV2/8 or AAV2/9.
  • the expression of the nucleic acid encoding the GARS miRNA is under the control of a U6 promoter.
  • the expression of the RNAi-resistant replacement GARS gene is under the control of a chicken b actin promoter.
  • the disclosure provides methods of delivering to a neuronal cell comprising a mutant GARS gene, the method comprising administering to the neuronal cell: (a) a nucleic acid comprising a nucleic acid encoding a GARS miRNA comprising at least about 70%, 75%,
  • nucleic acid encoding a GARS guide strand comprising at least about 70%, 75%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the polynucleotide sequence set forth in any one of SEQ ID NOs: 26-50; or a nucleic acid encoding a GARS miRNA comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the polynucleotide sequence set forth in any one of SEQ ID NOs: 26-50; or a nucleic acid encoding a GARS miRNA comprising at least about 70%, 75%, 80%
  • the disclosure provides a method of treating a subject suffering from a mutant GARS gene, the method comprising administering to the subject: (a) a nucleic acid comprising a nucleic acid encoding a GARS miRNA comprising at least about 70%, 75%, 80%, 81%,
  • the subject suffers from Charcot-Marie-Tooth Disease Type 2D (CMT2D) or Distal Hereditary Motor Neuropathy.
  • CMT2D Charcot-Marie-Tooth Disease Type 2D
  • the neuronal cell is a human neuronal cell.
  • the subject is a mammalian subject. In some aspects the subject is a human subject.
  • the disclosure also provides uses of at least one nucleic acid as described herein, at least one viral vector as described herein, or a composition as described herein in making a medicament for or in treating a subject suffering from a mutant Glycyl-tRNA Synthetase (GARS) gene.
  • Glycyl-tRNA Synthetase Glycyl-tRNA Synthetase
  • the disclosure also provides uses of at least one nucleic acid as described herein, at least one viral vector as described herein, or a composition as described herein in making a medicament for or in treating Charcot-Marie-Tooth Disease Type 2D (CMT2D) or Distal Hereditary Motor Neuropathy in a subject in need thereof.
  • CMT2D Charcot-Marie-Tooth Disease Type 2D
  • Distal Hereditary Motor Neuropathy in a subject in need thereof.
  • Figure 1 A-B shows the DETAO GARS mutation does not affect gene expression.
  • Figure 1 A demonstrates that RNA and cDNA libraries were generated from patient fibroblasts. Subsequently, RT-PCR products spanning the mutation were subjected to deep sequencing analysis. A cartoon representing the GARS exon7-exon8 junction is shown with the wild-type (blue) and mutant (red) PCR products indicated. Mapped sequence reads were deemed informative if they spanned the nucleotides affected by the mutation. Of the informative reads, 53.7% were from wild-type (WT) transcripts and 46.3% were from DETAO GARS transcripts.
  • Figure 1 B shows Western blot results.
  • Figure 2A-J shows the in vitro and in vivo characterization of a GARS mutation, the DETAO GARS mutation.
  • Figure 2A the position and evolutionary conservation of the DETAO (red) and P234KY (green) GARS mutations are shown, along with flanking amino acid residues.
  • Figure 2B shows that the body weight of GARS &EJA Q/huEx8 mjce anc
  • Figure 2F shows that these changes are evident in images of nerve cross sections.
  • Figure 2H shows that neuromuscular junctions (NMJs) from the plantaris muscle showed partial innervation and denervation, scored based on the overlap between pre- and post-synaptic staining. While 98.0% of control NMJs were fully innervated, only 32.6% were fully innervated in G/4 ?S AETAQ/huEx8 mjce!
  • Figure 3A-B shows mRNA and protein levels in GARS AEJA Q/huEx8 mjce .
  • GAF?S AETAQ/huEx8 are indicated by black arrows.
  • the DETAO mutation (the 12 bps deleted by the DETAO mutation are highlighted in red) is noted by the box in the sequence above and is indicated by double sequence starting at base 13.
  • Figure 3B shows Western blot analysis of brain homogenates for GARS expression in the indicated mouse strains. The blot was re probed with an anti-NeuN antibody to control for variability in protein loading.
  • FIG. 4A-H shows scAAV9.miAETAQ prevents of the onset of neuropathy in GAflS (AETAQ/huEx8) mice.
  • Figure 4A shows that therapeutic miGARS microRNAs utilize naturally occurring RNAi biogenesis and gene silencing pathways in target cells. Each miGARS or control sequence was cloned as a DNA template downstream of a U6 promoter and then delivered to cells via plasmid transfection (in vitro) or within scAAV9 particles in vivo (depicted here). Once in the target cell nucleus, primary microRNA constructs are transcribed and then processed by the RNAses Drosha and Dicer and the nuclear export factor Exportin-5 (Exp5).
  • the mature antisense strand incorporates into the RNA- Induced Silencing Complex (RISC) to elicit sequence-specific degradation of the mutant GARS mRNA.
  • Figure 4B shows that miRNAs were efficacy tested in vitro by co-transfecting HEK293 cells with individual U6-miGARS, or control, plasmids miRNA and a dual-luciferase reporter plasmid containing one of four target genes cloned into the 3’ UTR of Renilla luciferase: wild-type Human GARS, human AETAQ GARS, wild-type mouse GARS, or the mouse GARS gene containing the same ETAQ deletion.
  • Target gene silencing was then determined by measuring the ratio of Renilla to Firefly luciferase. The values are reported as mean ratios ⁇ SEM, and the significance of knockdown efficiency was analyzed using a two- way ANOVA. Also shown is the sequence of the guide strand of the lead miAETAQ and its complementarity to both the wild-type and AETAQ GARS gene. The four amino acid deletion is shown in red. Base pairing between the miRNA and target genes is shown with vertical lines, with red lines indicating wobble G-U bonds present in RNA duplexes.
  • Axon diameter was analyzed using a KS normality test while all other outcomes measures were analyzed using a two-way ANOVA with Tukey’s FISD posthoc comparisons.
  • Figure 5A-E shows all miRNAs targeting DETAO disease allele tested in vitro.
  • Figure 5A shows the five miRNAs hairpins originally tested targeting the DETAO mutation in the human GARS gene.
  • the guide strand is indicated in blue, and the passenger strand is in red. Gray and black arrowheads indicate the Drosha and Dicer cut sites respectively.
  • Figure 5B shows the first set of miRNAs tested in a dual-luciferase assay. FIEK293 cells were cotransfected with a single miRNA and the dual luciferase reporter containing either wild- type or AETAQ human GARS cloned as the 3’UTR of Renilla luciferase.
  • Figure 5D shows the guide strand of the initial lead miRNA and its complementarity to the target regions of both human and mouse DETAO GARS. Base pairing is indicated by vertical lines with G-U bonds shown in red.
  • Figure 5E shows the hairpin structures of six variants of miEx8D12-1 A. Drosha and Dicer cut sites are indicated with grey and black arrowheads. The guide strand is shown in blue, with the changes to the original miR sequence indicated in red. G-U base pairing is shown with a red vertical line. In vitro testing results for these miRNAs is shown in Figure 2A-J. The lead miRNA is marked with an asterisk and was renamed mi.AETAQ for all further testing.
  • Figure 6A-F shows post-onset therapeutic effects of scAAV9.miAETAQ.
  • Figure 6A-B shows the reduction in mutant GARS expression improves grip strength and increases body weight in early- and late- symptomatic GAF?S AETAQ/huEx8 mice.
  • Figure 6A shows that mi.AETAQ-treated early- and late-symptomatic GARS AETAQ/huEx8 mice exhibit enhanced grip strength and significant increases in body weight starting at ⁇ 5 weeks post treatment.
  • Figure 6B shows that when evaluated at 7 weeks post treatment for primary signs of neuropathy, these data correlate with trending increases in MW:BW ratios and significant improvements in nerve conduction velocity in mi.AETAQ-treated late-symptomatic
  • FIG. 6B shows early-symptomatic GARS &EJA Q/huEx8 mjce treated with mi.AETAQ displayed significantly higher MW:BW ratios and faster nerve conduction velocity, most likely resulting from the greater number of motor axons observed in cross-sections of the motor branch of the femoral nerve, although improvement in axon diameter was not observed ( Figures 6C-D).
  • Figures 6E-D Prevention of axon loss was not observed in mi.AETAQ-treated late-symptomatic GAF?S AETAQ/huEx8 mice.
  • B significant difference in partially innervated NMJs
  • & C significant difference in denervated NMJs.
  • Figure 7A-C shows U6.miP278KY microRNAs can specifically knockdown P278KY mouse GARS mRNA in vitro.
  • Figure 7 A shows hairpin structures of all pre-miRNAs targeting P278KY mouse GARS mRNA.
  • the guide strand is shown in blue, while the passenger strand is in red.
  • Drosha and Dicer cut sites are indicated by gray and black arrowheads, respectively.
  • the best performing miRNA in vitro is marked with an asterisk and the name was shortened to miP278KY for further testing.
  • Figure 7B shows the sequence of the guide strand of the best performing miP278KY and its complementarity to both wild-type and mutant mouse GARS. The P278KY mutation is shown in red.
  • FIG. 7C shows miRNAs were tested in vitro by cotransfecting HEK293 cells with a single miRNA and a dual- luciferase reporter containing either wild-type or P278KY mouse GARS cloned as the 3’UTR of Renilla luciferase.
  • Target gene silencing was determined by measuring the ratio of Renilla to Firefly luciferase. Triplicate data were averaged and presented as the mean ratio ⁇ SEM.
  • Figure 8A-H shows reduction of mutant GARS by RNAi prevents neuropathy in GAF?S ⁇ P278KY/+) mice.
  • Figure 8D shows that quantification of axon number within cross sections of the motor branch of the femoral nerve showed that while axon number was reduced by 17% in control- treated P278KY mice, axon counts in scAAV9.miP278KY-treated P278KY mice (589 ⁇ 15 axons) were similar to untreated control littermates (600 ⁇ 1 1 axons).
  • Figure 8E shows that in a cumulative histogram of axon diameters, scAAV9.miP278KY treatment also restored the presence of large diameter axons, with average axon diameter within control-treated
  • NMJ neuromuscular junction
  • Figure 8G Representative images of neuromuscular junction (NMJ) morphology isolated from plantaris muscle are shown (Figure 8G) after labeling with antibodies against neurofilament and synaptic vesicles (green) and alpha-bungarotoxin (red). While over 70% of the NMJs are partially or completely denervated in control-treated GARS (P278KY/+) mice by 4 weeks of age (Figure 8H) less than 30% of NMJs show any degree of denervation scAAV9.miP278KY-treated GARS P278KYI+) mice.
  • Figure 9A-F shows reduction in mutant GARS expression also alleviates neuropathy in post-disease onset GARG P278KY/+) mice.
  • Figure 9A-B mi-P278KY treatment at 5 weeks (early onset) or at 9 weeks (late post onset) yields significant increases in grip strength as determined by the wire hang test starting at 5 weeks post treatment in both early- ( Figure 9A) and late-symptomatic ( Figure 9B) GARS (P278KY/+) mice.
  • Treated P278KY mice also gain weight starting 3 weeks post treatment with early-symptomatic mice (A) and 1 week post treatment with late-symptomatic mice ( Figure 9B).
  • Figure 10A-C shows escalating reductions of mutant GARS expression within dorsal root ganglia when scAAV9.miP278KY was delivered by ICV compared to IV.
  • Figure 10C In contrast, these gains in peripheral nerve function did not correlate with reductions in mutant GARS expression within liver.
  • N 5 for all experimental groups.
  • IV intravenous delivery of
  • Figure 1 1 A-D shows long term therapeutic effects of neonatal scAAV9.mi.P278KY treatment.
  • both bodyweight and grip strength as determined by the wire hang test, were recorded for 1 year from both GAF?S (P278KY/+) mice and littermate controls every 6 weeks after being injected with scAAV9.mi.LacZ or scAAV9.mi.P278KY at P0.
  • scAAV9.miP278KY-treated P278KY displayed significant increases in body weight (Figure 1 1 A) starting at 24 weeks post treatment and grip strength (Figure 1 1 B) throughout the course of 1 year compared to vehicle control-treated P278KY mice.
  • Figure 1 1 B body weight
  • Figure 1 C body weight
  • Figure 1 D NCVs
  • Significance in ( Figure 1 1 A-B) was determined by one-way ANOVA with T ukey’s HSD posthoc comparisons.
  • Significance in ( Figure 1 1 C-D) was determined by two-way ANOVA with Tukey’s HSD posthoc comparisons.
  • Figure 12A-H shows improvements in phenotype negatively correlates with reductions in mutant GARS expression in dorsal root ganglia.
  • Figure 12A-B Scatter plot illustrating the negative correlation between the percentage of the DETAO mutant expression within dorsal root ganglia and nerve conduction velocities quantified from
  • FIG. 12E-F Scatter plot illustrating the negative correlation between the percentage of the P278KY GARS mutant expression within dorsal root ganglia and nerve conduction velocities quantified from scAAV9.mi.P278KY-treated GARS l - P278KY/+) mice within late- ( Figure 12E) and early- ( Figure 12F) symptomatic cohorts.
  • Figure 12G-H Scatter plot displaying the association between the percentage of the P278KY GARS mutant expression within liver and nerve conduction velocities quantified from scAAV9.mi.P278KY-treated GARG P278KYI+) mice within late- ( Figure 12E) and early- (Figure 12F) symptomatic cohorts.
  • Figure 13A-B schematically shows miRNAs (red blocks in panel Figure 13A) designed to target common regions between the mouse and human GARS cDNAs, while avoiding any sequences containing known GARS mutations associated with CMT2D.
  • Figure 14 shows the sequences of GARS miRNAs, each targeting both wild-type and mutant GARS genes.
  • Figure 15 shows the sequences of exemplary RNAi-resistant replacement GARS genes.
  • Figure 16A-E shows the results of experiments in which neonatal mice were treated systemically with scAAV9-RNAi targeting wild-type GARS (miWT).
  • Figure 16A Total GARS expression was reduced to -70% in tissues transduced by AAV9 (dorsal root ganglia and liver) ( Figure 16B).
  • Cross sections of the motor branch of the femoral nerve from control mice or mice treated with miWT Gars at twelve weeks of age are shown ( Figure 16E). There were no overt signs of axon loss, demyelination, or axon atrophy.
  • Figure 17 is an alignment of the human and mouse GARS gene sequences which shows the portion of the sequences which each GARS miRNAs is designed to target.
  • the products and methods described herein are used in the treatment of diseases or conditions associated with a mutant glycyl tRNA-synthetase (GARS) gene.
  • GARS glycyl tRNA-synthetase
  • the disclosure shows the efficacy of allele-specific RNAi as a potential therapeutic for treating mutations associated with GARS, including Charcot-Marie-Tooth type 2D
  • CMT2D caused by dominant mutations in GARS.
  • a de novo mutation in GARS was identified in a patient with a severe peripheral neuropathy, and a mouse model precisely recreating the mutation was produced. These mice developed a neuropathy by 3-4 weeks-of age, validating the pathogenicity of the mutation.
  • RNAi sequences targeting mutant GARS mRNA, but not wild-type GARS were optimized and then packaged into a viral vector for in vivo delivery demonstrating efficacy in preventing neuropathy in a subject treated at birth and improvement in subjects treated after disease onset.
  • GARS is one of the aminoacyl-tRNA synthetases that charge tRNAs with their cognate amino acids. Additional information regarding the GARS gene is found at, for example, HGNC(4162), Entrez Gene(2617), Ensembl(ENSG00000106105), OMIM(600287), or UniProtKB(P41250).
  • the encoded enzyme is an (alpha)2 dimer which belongs to the class II family of tRNA synthetases.
  • GARS has been shown to be a target of autoantibodies in the human autoimmune diseases, polymyositis or dermatomyositis. Diseases associated with GARS include, but are not limited to, CMT2D and Distal Hereditary Motor Neuropathy.
  • the nucleic acid encoding human GARS is set forth in the nucleotide sequence set forth in SEQ ID NO: 69.
  • the products and methods of the disclosure also target isoforms and variants of the nucleotide sequence set forth in SEQ ID NO: 69.
  • the variants comprise 99%, 98%, 97%, 96%,
  • the nucleic acid encoding mouse GARS is set forth in the nucleotide sequence set forth in SEQ ID NO: 70.
  • the products and methods of the disclosure also target isoforms and variants of the nucleotide sequence set forth in SEQ ID NO: 70.
  • the variants comprise 99%, 98%, 97%, 96%,
  • RNA interference is a mechanism of gene regulation in eukaryotic cells that has been considered for the treatment of various diseases. RNAi refers to post-transcriptional control of gene expression mediated by inhibitory RNAs.
  • RNAiRNA short (or small) interfering RNA
  • shRNA short (or small) hairpin RNA
  • miRNA microRNA
  • shRNA and miRNA are expressed in vivo from plasmid- or virus-based vectors and may thus achieve long term gene silencing with a single administration, for as long as the vector is present within target cell nuclei and the driving promoter is active (Davidson et al., Methods Enzymol. 392:145-73, 2005).
  • this vector-expressed approach leverages the decades-long advancements already made in the muscle gene therapy field, but instead of expressing protein coding genes, the vector cargo in RNAi therapy strategies are artificial shRNA or miRNA cassettes targeting disease genes-of- interest.
  • the products and methods of the disclosure comprise short hairpin RNA or small hairpin RNA (shRNA) to affect GARS expression (e.g., knockdown or inhibit expression).
  • a short hairpin RNA (shRNA/Hairpin Vector) is an artificial RNA molecule with a tight hairpin turn that can be used to silence target gene expression via RNA interference (RNAi).
  • shRNA is an advantageous mediator of RNAi in that it has a relatively low rate of degradation and turnover, but it requires use of an expression vector. Once the vector has transduced the host genome, the shRNA is then transcribed in the nucleus by polymerase II or polymerase III, de-pending on the promoter choice.
  • the product mimics pri-microRNA (pri-miRNA) and is processed by Drosha.
  • the resulting pre-shRNA is exported from the nucleus by Exportin 5.
  • This product is then processed by Dicer and loaded into the RNA-induced silencing complex (RISC).
  • RISC RNA-induced silencing complex
  • the sense (passenger) strand is degraded.
  • the antisense (guide) strand directs RISC to mRNA that has a complementary sequence. In the case of perfect complementarity, RISC cleaves the mRNA. In the case of imperfect complementarity, RISC represses translation of the mRNA. In both of these cases, the shRNA leads to target gene silencing.
  • the disclosure includes the production and administration of a viral vector expressing GARS antisense sequences via miRNA or shRNA.
  • shRNAs are regulated by the use of various promoters. The promoter choice is essential to achieve robust shRNA expression.
  • polymerase II promoters such as U6 and H1
  • polymerase III promoters are used.
  • U6 shRNAs are used.
  • the disclosure uses U6 shRNA molecules to inhibit, knockdown, or interfere with gene expression.
  • Traditional small/short hairpin RNA (shRNA) sequences are usually transcribed inside the cell nucleus from a vector containing a Pol III promoter such as U6.
  • the endogenous U6 promoter normally controls expression of the U6 RNA, a small nuclear RNA (snRNA) involved in splicing, and has been well-characterized [Kunkel et al., Nature. 322(6074)73-7 (1986); Kunkel et al., Genes Dev. 2(2):196-204 (1988); Paule et al., Nucleic Ac-ids Res. 28(6):1283-98 (2000)].
  • the U6 promoter is used to control vector-based expression of shRNA molecules in mammalian cells [Paddison et al., Proc. Natl. Acad. Sci. USA 99(3):1443-8 (2002); Paul et al., Nat. Biotechnol. 20(5):505-8 (2002)] because (1 ) the promoter is recognized by RNA polymerase III (poly III) and controls high-level, constitutive expression of shRNA; and (2) the promoter is active in most mammalian cell types.
  • the promoter is a type III Pol III promoter in that all elements required to control expression of the shRNA are located upstream of the transcription start site (Paule et al., Nucleic Acids Res.
  • the disclosure includes both murine and human U6 promoters.
  • the shRNA containing the sense and antisense sequences from a target gene connected by a loop is transported from the nucleus into the cytoplasm where Dicer processes it into small/short interfering RNAs (siRNAs).
  • the disclosure includes sequences encoding inhibitory RNAs to prevent and inhibit the expression of the GARS gene.
  • the inhibitory RNAs comprise antisense sequences, which inhibit the expression of the GARS gene.
  • the disclosure provides nucleic acids encoding GARS miRNAs and guide strands, and RNAi-resistant GARS genes.
  • the disclosure provides a nucleic acid encoding a GARS miRNA comprising at least about 70%,
  • the disclosure provides a nucleic acid encoding a GARS guide strand comprising at least about 70%, 75, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the polynucleotide sequence set forth in any one of SEQ ID NOs: 26-50.
  • the disclosure provides a nucleic acid comprising an RNAi-resistant GARS gene comprising at least about
  • the disclosure provides a nucleic acid encoding a GARS miRNA comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the polynucleotide sequence set forth in any one of SEQ ID NOs: 1 -25 and a nucleic acid comprising an RNAi-resistant GARS gene comprising at least about 70%, 75%, 80%, 81%,
  • Exemplary GARS miRNAs comprise a full length miRNA antisense guide strand comprising the polynucleotide sequence set out in any one or more of SEQ ID NOs: 1 -25, or a variant thereof comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to any one of SEQ ID NOs 1 -25.
  • Corresponding final processed guide strand sequences are respectively set out in the polynucleotide sequence set out in any one or more of SEQ ID NOs: 26-50, or a variant thereof comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to any one of SEQ ID NOs 26-50.
  • Exemplary RNAi-resistant replacement GARS genes are set out in any one of more of SEQ ID NOs: 51 -57, or a variant thereof comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to any one of SEQ ID NOs: 51 -57.
  • the disclosure includes vectors comprising a nucleic acid of the disclosure or a combination of nucleic acids of the disclosure.
  • vectors for example, viral vectors, such as adeno-associated virus (AAV), adenovirus, retrovirus, lentivirus, equine-associated virus, alphavirus, pox virus, herpes virus, herpes simplex virus, polio virus, Sindbis virus, vaccinia virus or a synthetic virus, e.g., a chimeric virus, mosaic virus, or pseudotyped virus, and/or a virus that contains a foreign protein, synthetic polymer, nanoparticle, or small molecule) to deliver the nucleic acids disclosed herein.
  • AAV adeno-associated virus
  • retrovirus retrovirus
  • lentivirus lentivirus
  • equine-associated virus alphavirus
  • pox virus herpes virus
  • herpes simplex virus herpes simplex virus
  • polio virus polio virus
  • Sindbis virus vaccini
  • the viral vector is an AAV.
  • the AAV lacks rep and cap genes.
  • the AAV is a recombinant AAV (rAAV) or a self-complementary recombinant AAV (scAAV).
  • the AAV has a capsid serotype selected from the group consisting of: AAV-1 , AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10, AAV-1 1 , AAV-12, AAV-13, AAV-anc80, AAV rh.74, AAV rh.8, and AAVrh.10.
  • the viral vector is an AAV, such as an AAV1 (i.e., an AAV containing AAV1 inverted terminal repeats (ITRs) and AAV1 capsid proteins), AAV2 (i.e., an AAV containing AAV2 ITRs and AAV2 capsid proteins), AAV3 (i.e., an AAV containing AAV3 ITRs and AAV3 capsid proteins), AAV4 (i.e., an AAV containing AAV4 ITRs and AAV4 capsid proteins), AAV5 (i.e., an AAV containing AAV5 ITRs and AAV5 capsid proteins),
  • AAV1 i.e., an AAV containing AAV1 inverted terminal repeats (ITRs) and AAV1 capsid proteins
  • AAV2 i.e., an AAV containing AAV2 ITRs and AAV2 capsid proteins
  • AAV3 i.e., an AAV containing AAV3 ITRs and A
  • AAV6 i.e., an AAV containing AAV6 ITRs and AAV6 capsid proteins
  • AAV7 i.e., an AAV containing AAV7 ITRs and AAV7 capsid proteins
  • AAV8 i.e., an AAV containing AAV8 ITRs and AAV8 capsid proteins
  • AAV9 i.e., an AAV containing AAV9 ITRs and AAV9 capsid proteins
  • AAVrh74 i.e., an AAV containing AAVrh74 ITRs and AAVrh74 capsid proteins
  • AAVrh.8 i.e., an AAV containing AAVrh.8 ITRs and AAVrh.8 capsid proteins
  • AAVrh.10 i.e., an AAV containing AAVrh.10 ITRs and AAVrh.10 capsid proteins
  • AAV1 1 i.e., an AAV containing AAV1 1 I
  • DNA plasmids of the disclosure comprise rAAV genomes of the disclosure.
  • the DNA plasmids are transferred to cells permissible for infection with a helper virus of AAV (e.g., adenovirus, E1 -deleted adenovirus or herpes virus) for assembly of the rAAV genome into infectious viral particles.
  • helper virus of AAV e.g., adenovirus, E1 -deleted adenovirus or herpes virus
  • rAAV Production of rAAV requires that the following components are present within a single cell (denoted herein as a packaging cell): a rAAV genome, AAV rep and cap genes separate from (i.e., not in) the rAAV genome, and helper virus functions.
  • the AAV rep genes may be from any AAV serotype for which recombinant virus can be derived and may be from a different AAV serotype than the rAAV genome ITRs, including, but not limited to, AAV serotypes AAV-1 , AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV- 10, AAV-1 1 , AAV-12, AAV-13, AAV-anc80, and AAV rh.74.
  • AAV DNA in the rAAV genomes is from any AAV serotype for which a recombinant virus can be derived including, but not limited to, AAV serotypes AAV-1 , AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10, AAV-1 1 , AAV-12, AAV-13, AAV-anc80, and AAV rh.74.
  • Other types of rAAV variants for example rAAV with capsid mutations, are also included in the disclosure. See, for example, Marsic et al., Molecular Therapy 22(1 1 ): 1900- 1909 (2014).
  • nucleotide sequences of the genomes of various AAV serotypes are known in the art. Use of cognate components is specifically contemplated. Production of pseudotyped rAAV is disclosed in, for example, WO 01/83692 which is incorporated by reference herein in its entirety.
  • the viral vector is a pseudotyped AAV, containing ITRs from one AAV serotype and capsid proteins from a different AAV serotype.
  • the pseudo-typed AAV is AAV2/9 (i.e., an AAV containing AAV2 ITRs and AAV9 capsid proteins). In some embodiments, the pseudotyped AAV is AAV2/8 (i.e., an AAV containing AAV2 ITRs and AAV8 capsid proteins). In some embodiments, the pseudotyped AAV is AAV2/1 (i.e., an AAV containing AAV2 ITRs and AAV1 capsid proteins).
  • the AAV contains a recombinant capsid protein, such as a capsid protein containing a chimera of one or more of capsid proteins from AAV1 , AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAVrh74, AAVrh.8, or AAVrh.10, AAV10, AAV1 1 , AAV12, or AAV13.
  • rAAV variants for example rAAV with capsid mutations, are also contemplated. See, for example, Marsic et al., Molecular Therapy,
  • the disclosure utilizes AAV to deliver inhibitory RNAs which target the GARS mRNA to inhibit mutant GARS expression.
  • AAV is a replication-deficient parvovirus, the single-stranded DNA genome of which is about 4.7 kb in length including 145 nucleotide inverted terminal repeat (ITRs).
  • ITRs nucleotide inverted terminal repeat
  • the nucleotide sequences of the genomes of the AAV serotypes are known.
  • the complete genome of AAV-1 is provided in GenBank Accession No. NC_002077; the complete genome of AAV-2 is provided in GenBank Accession No. NC_001401 and
  • AAV-9 genome is provided in Gao et al., J. Virol., 78: 6381 -6388 (2004); the AAV-10 genome is provided in Mol. Ther., 13(1 ): 67-76 (2006); and the AAV-1 1 genome is provided in Virology, 330(2): 375-383 (2004).
  • Cis-acting sequences directing viral DNA replication (rep), encapsidation/packaging and host cell chromo-some integration are contained within the AAV ITRs.
  • AAV promoters Three AAV promoters (named p5, p19, and p40 for their relative map locations) drive the expression of the two AAV internal open reading frames encoding rep and cap genes.
  • the two rep promoters (p5 and p19), coupled with the differential splicing of the single AAV intron (at nucleotides 2107 and 2227), result in the production of four rep proteins (rep 78, rep 68, rep 52, and rep 40) from the rep gene.
  • the cap gene is expressed from the p40 promoter and it encodes the three capsid proteins VP1 , VP2, and VP3.
  • Alternative splicing and non consensus translational start sites are responsible for the production of the three related capsid proteins.
  • a single consensus polyadenylation site is located at map position 95 of the AAV genome. The life cycle and genetics of AAV are reviewed in Muzyczka, Current Topics in Microbiology and Immunology, 158: 97-129 (1992).
  • AAV possesses unique features that make it attractive as a vector for delivering foreign DNA to cells, for example, in gene therapy.
  • AAV infection of cells in culture is noncytopathic, and natural infection of humans and other animals is silent and
  • AAV infects many mammalian cells allowing the possibility of targeting many different tissues in vivo.
  • AAV transduces slowly dividing and non dividing cells, and can persist essentially for the lifetime of those cells as a transcriptionally active nuclear episome (extrachromosomal element).
  • the AAV proviral genome is infectious as cloned DNA in plasmids which makes construction of recombinant genomes feasible.
  • the signals directing AAV replication, genome encapsidation and integration are contained within the ITRs of the AAV genome, some or all of the internal approximately 4.3 kb of the genome (encoding replication and structural capsid proteins, rep-cap) may be replaced with foreign DNA.
  • the rep and cap proteins may be provided in trans.
  • AAV is an extremely stable and hearty virus. It easily withstands the conditions used to inactivate adenovirus, making cold preservation of AAV less critical.
  • AAV may be lyophilized and AAV-infected cells are not resistant to superinfection.
  • AAV is used to deliver shRNA under the control of a U6 promoter.
  • AAV is used to deliver snRNA under the control of a U7 promoter.
  • AAV is used to deliver an RNAi-resistant replacement GARS gene under the control of a chicken D-actin promoter.
  • the AAV lacks rep and cap genes.
  • the AAV is a recombinant linear AAV (rAAV), a single-stranded AAV, or a recombinant self complementary AAV (scAAV).
  • Recombinant AAV genomes of the disclosure comprise one or more AAV ITRs flanking a polynucleotide encoding, for example, one or more GARS inhibitory RNAs or GARS miRNAs.
  • the genomes of the rAAV provided herein either further comprise an RNAi- resistant replacement GARS gene, or the RNAi-resistant replacement GARS gene is present in a separate rAAV.
  • the miRNA- and replacement GARS-encoding polynucleotides are operatively linked to transcriptional control DNAs, for example promoter DNAs, which are functional in a target cell.
  • Commercial providers such as Ambion Inc. (Austin, TX),
  • RNA molecules are available to produce custom siRNA molecules, such as SILENCERTM siRNA Construction Kit (Ambion Inc., Austin, TX) or psiRNA System (InvivoGen, San Diego, CA).
  • DNA plasmids provided comprise rAAV genomes described herein.
  • the DNA plasmids are transferred to cells permissible for infection with a helper virus of AAV (e.g., adenovirus, E1 -deleted adenovirus or herpesvirus) for assembly of the rAAV genome into infectious viral particles.
  • helper virus of AAV e.g., adenovirus, E1 -deleted adenovirus or herpesvirus
  • rAAV genome a rAAV genome
  • AAV rep and cap genes separate from (i.e., not in) the rAAV genome
  • helper virus functions The AAV rep and cap genes may be from any AAV serotype for which recombinant virus can be derived and may be from a different AAV serotype than the rAAV genome ITRs, including, but not limited to, AAV serotypes AAV-1 , AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7,
  • AAV- 8, AAV-9, AAV-10, AAV-1 1 , AAV-12, AAV-13, AAV-B1 and AAV rh74 Production of pseudotyped rAAV is disclosed in, for example, WO 01/83692 which is incorporated by reference herein in its entirety.
  • Exemplary rAAV comprising AAV-9 capsid proteins and AAV-2 ITRs are provided.
  • a method of generating a packaging cell is to create a cell line that stably expresses all the necessary components for AAV particle production.
  • a plasmid (or multiple plasmids) comprising a rAAV genome lacking AAV rep and cap genes, AAV rep and cap genes separate from the rAAV genome, and a selectable marker, such as a neomycin resistance gene, are integrated into the genome of a cell.
  • AAV genomes have been introduced into bacterial plasmids by procedures such as GC tailing (Samulski et al., 1982, Proc. Natl. Acad. S6.
  • the packaging cell line is then infected with a helper virus such as adenovirus.
  • a helper virus such as adenovirus.
  • Packaging cells that produce infectious rAAV.
  • Packaging cells may be stably transformed cancer cells such as HeLa cells, 293 cells and PerC.6 cells (a cognate 293 line).
  • packaging cells are cells that are not
  • transformed cancer cells such as low passage 293 cells (human fetal kidney cells transformed with E1 of adenovirus), MRC-5 cells (human fetal fibroblasts), WI-38 cells (human fetal fibroblasts), Vero cells (monkey kidney cells) and FRhL-2 cells (rhesus fetal lung cells).
  • Recombinant AAV i.e., infectious encapsidated rAAV particles
  • the genomes of the rAAV lack AAV rep and cap DNA, that is, there is no AAV rep or cap DNA between the ITRs of the genomes of the rAAV.
  • the rAAV may be purified by methods standard in the art such as by column chromatography or cesium chloride gradients. Methods for purifying rAAV vectors from helper virus are known in the art and include methods disclosed in, for example, Clark et al., Hum. Gene Ther., 10(6): 1031 -1039 (1999); Schenpp and Clark, Methods Mol. Med., 69 427-443 (2002); U.S. Patent No. 6,566,1 18 and WO 98/09657.
  • compositions comprising the nucleic acids and viral vectors of the disclosure are provided.
  • Compositions comprising delivery vehicles (such as rAAV) described herein are provided.
  • delivery vehicles such as rAAV
  • compositions also comprise a pharmaceutically acceptable carrier.
  • the compositions may also comprise other ingredients such as diluents and adjuvants.
  • Acceptable carriers, diluents and adjuvants are nontoxic to recipients and are preferably inert at the dosages and concentrations employed, and include buffers such as phosphate, citrate, or other organic acids; antioxidants such as ascorbic acid; low molecular weight polypeptides; proteins, such as serum albumin, gelatin, or
  • immunoglobulins include hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, arginine or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbitol; salt-forming counterions such as sodium; and/or nonionic surfactants such as Tween, pluronics or polyethylene glycol (PEG).
  • hydrophilic polymers such as polyvinylpyrrolidone
  • amino acids such as glycine, glutamine, asparagine, arginine or lysine
  • monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins include chelating agents such as EDTA; sugar alcohols such as mannitol or sorbitol; salt-forming counterions such as sodium; and
  • Titers of rAAV to be administered in methods of the invention will vary depending, for example, on the particular rAAV, the mode of administration, the treatment goal, the individual, and the cell type(s) being targeted, and may be determined by methods standard in the art. Titers of rAAV may range from about 1 x10 6 , about 1 x10 7 , about 1 x10 8 , about
  • DNase resistant particles [or viral genomes (vg)] per ml.
  • Methods of transducing a target cell with a delivery vehicle such as rAAV
  • the in vivo methods comprise the step of administering an effective dose, or effective multiple doses, of a composition comprising a delivery vehicle (such as rAAV) to an animal (including a human patient) in need thereof. If the dose is administered prior to development of a disorder/disease, the administration is prophylactic.
  • An effective dose is a dose that alleviates (eliminates or reduces) at least one symptom associated with the disorder/disease state being treated, that slows or prevents progression to a disorder/disease state, that slows or prevents progression of a
  • CMT2D CMT2D
  • the methods can be carried out in a before the onset of disease. In other patients, the methods are carried out after diagnosis.
  • Outcome measures demonstrate the therapeutic efficacy of the methods. Outcome measures are described, for example, in Chapters 32, 35 and 43 of Dyck and Thomas, Peripheral Neuropathy, Elsevier Saunders, Philadelphia, PA, 4 th Edition, Volume 1 (2005) and in Burgess et al., Methods Mol. Biol., 602: 347-393 (2010). Outcome measures include, but are not limited to, one or more of the reduction or elimination of mutant GARS mRNA or protein in affected tissues, GARS gene knockdown, increased body weight and improved muscle strength.
  • Others include, but are not limited to, nerve histology (axon number, axon size and myelination), neuromuscular junction analysis, and muscle weights and/or muscle histology. Others include, but are not limited to, nerve conduction velocity-ncv, electromyography-emg, and synaptic physiology.
  • expression of the mutant GARS allele is inhibited by at least 10, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 95, at least 98 percent, at least 99 percent, or 100 percent.
  • expression of the wild-type GARS allele is inhibited by at least 10, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 95, at least 98 percent, at least 99 percent, or 100 percent.
  • Combination therapies are also contemplated by the invention.
  • Combination as used herein includes both simultaneous treatment and sequential treatments.
  • Combinations of methods described herein with standard medical treatments and supportive care are specifically contemplated, as are combinations with therapies such as HDAC6 inhibition [Benoy et al., Brain, 141 (3):673-687 (2016)].
  • nucleic acid may be administered by routes standard in the art including, but not limited to,
  • an effective dose is delivered by a combination of routes.
  • an effective dose is delivered intravenously and/or intramuscularly, or intravenously and intracerebroventricularly, and the like.
  • an effective dose is delivered in sequence or sequentially.
  • an effective dose is delivered simultaneously.
  • Route(s) of administration and serotype(s) of AAV components of the rAAV (in particular, the AAV ITRs and capsid protein) of the invention may be chosen and/or matched by those skilled in the art taking into account the infection and/or disease state being treated and the target cells/tissue(s) that are to express the miRNAs.
  • actual administration of delivery vehicle may be accomplished by using any physical method that will transport the delivery vehicle (such as rAAV) into a target cell of an animal.
  • Administration includes, but is not limited to, injection into muscle, the bloodstream and/or directly into the nervous system or liver. Simply resuspending a rAAV in phosphate buffered saline has been demonstrated to be sufficient to provide a vehicle useful for muscle tissue expression, and there are no known restrictions on the carriers or other components that can be co-administered with the rAAV (although compositions that degrade DNA should be avoided in the normal manner with rAAV).
  • Capsid proteins of a rAAV may be modified so that the rAAV is targeted to a particular target tissue of interest such as neurons. See, for example, WO 02/053703, the disclosure of which is incorporated by reference herein.
  • Pharmaceutical compositions can be prepared as injectable formulations or as topical formulations to be delivered to the muscles by transdermal transport. Numerous formulations for both intramuscular injection and transdermal transport have been previously developed and can be used in the practice of the invention.
  • the delivery vehicle (such as rAAV) can be used with any pharmaceutically acceptable carrier for ease of administration and handling.
  • a dispersion of delivery vehicle (such as rAAV) can also be prepared in glycerol, sorbitol, liquid polyethylene glycols and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms.
  • the sterile aqueous media employed are all readily obtainable by standard techniques well-known to those skilled in the art.
  • the pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions.
  • the form must be sterile and must be fluid to the extent that easy syringeability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating actions of microorganisms such as bacteria and fungi.
  • the carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, liquid polyethylene glycol, sorbitol and the like), suitable mixtures thereof, and vegetable oils.
  • the proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of a dispersion and by the use of surfactants.
  • the prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal and the like. In many cases it will be preferable to include isotonic agents, for example, sugars or sodium chloride.
  • Prolonged absorption of the injectable compositions can be brought about by use of agents delaying absorption, for example, aluminum monostearate and gelatin.
  • Sterile injectable solutions are prepared by incorporating rAAV in the required amount in the appropriate solvent with various other ingredients enumerated above, as required, followed by filter sterilization.
  • dispersions are prepared by incorporating the sterilized active ingredient into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above.
  • the preferred methods of preparation are vacuum drying and the freeze drying technique that yield a powder of the active ingredient plus any additional desired ingredient from the previously sterile-filtered solution thereof.
  • Transduction of cells with rAAV of the invention results in sustained expression of GARS miRNAs and RNAi-resistant replacement GARS gene.
  • the present invention thus provides methods of administering/delivering rAAV which express GARS miRNAs and an RNAi-resistant replacement GARS gene to an animal, preferably a human being. These methods include transducing cells and tissues (including, but not limited to, peripheral motor neurons, sensory motor neurons, tissues such as muscle, and organs such as liver and brain) with one or more rAAV described herein. Transduction may be carried out with gene cassettes comprising cell-specific control elements.
  • the term“transduction” is used to refer to, as an example, the administration/delivery of GARS miRNAs and RNAi-resistant replacement GARS genes to a target cell either in vivo or in vitro, via a replication-deficient rAAV described herein resulting in the expression of GARS miRNA and the RNAi-resistant replacement GARS gene by the target cell.
  • Example 1 describes the clinical evaluation and mutation analysis of a CMT2D patient.
  • Example 2 describes GARS expression studies.
  • Example 3 describes CMT2D mouse models.
  • Example 4 describes miRNAs specific for the GARS gene.
  • Example 5 describes the production of scAAV9.mi.AETAQ.
  • Example 6 describes the neonatal delivery of scAAV9.mi.P278KY and scAAV9.mi.AETAQ to mice.
  • Example 7 describes the delivery of gene therapy constructs to post-onset mice.
  • Example 8 describes rAAV9-miGARS/rGARS vector and use.
  • Example 9 describes experiments relating to the level of GARS expression that results in a normal phenotype.
  • Example 10 shows that DETAO GARS affects the primary function of the enzyme.
  • Example 1 1 shows that Example 1 1 shows that DETAO GARS showed slightly aberrant interaction with NRP1 .
  • a patient-specific GARS mutation was chosen to exemplify the methods and products provided herein.
  • the GARS mutation was identified in a now six-year-old female who presented clinically by displaying decreases in muscle tone, head lag, axillary slippage, mild tongue atrophy, ligamentous laxity in the hands and feet, and excessive retraction of the chest wall starting at 13 months of age. Muscle biopsy at 15 months indicated neurogenic changes consistent with neuropathy. This included marked atrophy of type I and II fibers, and no evidence of myofiber necrosis, degeneration, or regeneration; nor of dystrophic or inflammatory myopathy. EMG and nerve conduction studies were also consistent with motor neuron disease.
  • the proband was clinically evaluated at Texas Children’s Hospital (Houston, TX) under Institutional Review Board approved protocols. Clinical data were obtained after written informed consent from the proband’s parents. Diagnostic, whole- exome sequencing (XomeDxPlus) was performed by GeneDx (Gaithersburg, MD). For allele-specific Sanger sequencing, we first isolated DNA from patient-derived primary fibroblasts. Cells were treated with trypsin according to the Wizard Genomic DNA
  • PCR amplification was performed to obtain a 381 bp region including GARS ex on 8 using PCR SuperMix (ThermoFisher Scientific).
  • PCR products were cleaned according to the QiaQuick PCR Purification Kit protocol and cloned into the pCR4-TOPO vector using the TOPO TA Cloning Kit (ThermoFisher Scientific).
  • This mutation resulted in the deletion of four amino acids in the GARS protein (p.Glu299_Gln302del; NP 002038.2) hereafter, referred to as DETAO.
  • DETAO No other potentially pathogenic mutation was identified at another locus that could potentially explain the severity of the neuropathy by a dual molecular diagnosis. Neither parent carries the identified GARS mutation, nor does the patient’s twin brother, indicating a de novo mutation.
  • GARS functions as a dimer to ligate glycine onto cognate tRNA molecules. The substrate glycine is bound within a pocket of each monomer, and one tRNA molecule associates with each half of the dimer.
  • the DETAO GARS mutation results in the deletion of four amino-acid residues that are conserved from human to bacteria and that reside within the glycine binding pocket (Figure 2A) [Qin et al., J. Biol. Chem., 289: 20359-20369 (2014)].
  • RNA-seq was performed to assess the expression of wild-type and mutant alleles in patient primary dermal fibroblasts.
  • the resulting cDNA was used to amplify a 224 base-pair product flanking the region bearing the AETAQ GARS mutation.
  • the reaction was column purified and the product was analyzed for quality via gel
  • Uninformative reads (e.g., those not spanning the mutation) were disregarded.
  • Each protein sample was prepared in 1 X SDS-sample buffer (ThermoFisher Scientific) plus 5 pL 2-me beta-mercaptoethanol (b-ME) and boiled at 99°C for 10 minutes. Samples were electrophoresed on pre-cast 4-20% tris-glycine gels (ThermoFisher Scientific) at 150V for 1 hour. Proteins were transferred onto a polyvinylidene difluoride (PVDF) membrane at 25V for 1.5 hours. The membrane was incubated for 1 hour at room
  • Membranes were rinsed in 1X TBST and exposed using SuperSignal West Dura substrate and enhancer (ThermoFisher Scientific).
  • the two mouse-specific alleles were identified based on their neuromuscular phenotype.
  • the P278KY allele (a.k.a. Nmf249) was found at Jackson Laboratories, and causes a severe neuropathy with -25% loss of myelinated peripheral axons, reduced axon diameter, reduced nerve conduction velocity, reduced grip strength, muscle atrophy, and denervation, partial innervation, and transmission defects at the neuromuscular junction (NMJ).
  • the milder C201 R allele was found in a chemical mutagenesis program in the UK, and has little or no axon loss, but shows reduced axon diameters, reduced conduction velocity, reduced grip strength, muscle atrophy, and similar, but milder, NMJ defects.
  • the human disease-associated variant is a 12-base pair deletion in exon eight of the human GARS gene, removing four amino acids (AETAQ or Ex8D12) at positions 245-8 in the protein.
  • AETAQ or Ex8D12 amino acids
  • ETAQ 245-8 is 1 1 amino acids C-terminal to the mouse P278KY allele - P234 in humans.
  • the sequence of wild type human GARS exon 8 was also introduced into the mouse genome.
  • the mouse exon 8 sequence was replaced with a double-stranded donor vector containing the human exon 8 sequence.
  • the donor vector was synthesized by recombineering a 10 kb sequence containing the mouse exon 8 sequence flanked by a 2.8kb long 5’ arm of homology and a 7 kb 3’ arm of homology isolated from a C57BL/6J BAC library into a retrieval vector containing short arms of homology for this fragment.
  • the mouse exon 8 sequence was then removed from the vector and replaced with the human exon 8 sequence via restriction digest and subsequent ligation with T4 ligase.
  • the donor construct consisted of a ss-oligonucleotide sequence spanning the first 52 bases of mouse exon 8 with short arms of homology (see below for sequence) containing a 12-base deletion (bases 12-23 of exon 8) referred to as AETAQ.
  • sgRNA 144 aaaattccctgtgcagtttc (SEQ ID NO: 61 )
  • sgRNA 1340 tcagaaatgagatctcacct (SEQ ID NO: 62)
  • Transgenic mice were genotyped based on the presence of either the humanized exon 8 or AETAQ constructs. Genomic DNA was prepared from tail biopsy lysed with proteinase K incubation. Primers HuEx8F0_F:CATAACATCACGCGTGGTTCC (SEQ ID NO: 63) and Flu Ex8R0_R :CAAGT GT GGCGGTTT CCAT C (SEQ ID NO: 64) that span the 2.8 kb 5’ arm of homology to the 3’ end of GARS ex on 8 and subsequent Sanger sequencing with HuEx8R0_R was used to identify human single nucleotide polymorphisms in exon 8 of GARS within G/4F?S toExS founders and subsequent generations. Primers delETAQF0_F: GGCCAT AAGCAT AATTTT ACT GT G (SEQ ID NO: 65) and
  • G/4F?S huEx8/huEx8 a control mouse model was engineered that harbors a“humanized” wild- type GARS ex on 8 replacement in the mouse gene.
  • the GARS gene is highly conserved, including intron/exon structure, and the fifty amino acids encoded by exon 8 are 100% identical between mouse and human, although there are some silent single-nucleotide differences between the mouse and human GARS/GARS ex on 8 that could affect allele- specificity of gene silencing, thereby necessitating humanizing the wild-type mouse exon.
  • CTCACTCAGCAGCAGCTCC (SEQ ID NO: 68) were used to amplify a portion of the GARS open reading frame spanning GARS exon 8 from first-strand cDNA generated from sciatic nerve RNA isolated from GARSf +lhuEx8) and GARS I - &EJA Q/huEx8) mice.
  • Humanized exon 8 and AETAQ transcript sequences were identified with Sanger sequencing and primer GARS2F.
  • mice were housed in pressurized individually ventilated (PIV) racks in the research animal facility at The Jackson Laboratory and provided food and water ad libitum. All mouse husbandry and experimental procedures were conducted according to the NIH Guide for Care and Use of Laboratory Animals and were reviewed and approved by The Animal Care and Use Committee of The Jackson Laboratory.
  • GARS CAST ;B6-
  • G/4F?S Nmf249 / Rwb (referred to as G/4F?S P278KY/+ ) are previously described in ( 17).
  • the official strain designations of the newly engineered mouse models are B6;FVB- G/4F?S ⁇ em1 Rwb>/Rwb (referred to as GARS huEx8 ) and B6;FVB-GA/ : ?S ⁇ em2Rwb>/Rwb (referred to as GARG aejaq,+] ).
  • all experimental cohorts used for direct comparisons consisted of littermate animals to match strain and age to the greatest extent possible.
  • Membranes were blocked with 5% skim milk in TBST (1x Tris-buffered saline, 0.1 % Tween-20), and incubated overnight with anti- GARS (rabbit, Abeam, 1 :1000 dilution) and anti-NeuN (mouse monoclonal, Cell Signaling, 1 :1000) diluted in blocking solution at 4 “ C. Following three 10 minute washes in TBST, the blots were incubated with the appropriate horseradish peroxidase- conjugated secondary antibodies (PerkinElimer, Boston MA) diluted in blocking solution. After three 10 minute washes in TBST, the blots were developed using Western Lightening Plus-ECL, Enhanced
  • NCV nerve conduction velocities
  • NMJs neuromuscular junctions
  • mice display primary features of peripheral neuropathy similar to those observed in established mouse models of CMT2D, confirming that the AETAQ GARS mutation is indeed pathogenic and causative of the neuropathy observed in the patient described in Example 1 .
  • the artificial microRNAs included 22 nt mature miRNA length, perfect antisense complementarity to the target mRNA (GARS; GARS), ⁇ 60% GC content of the mature duplex, and guide-strand biasing, such that the last 4 nucleotides of the antisense 5' end were A:U rich, and the last 4 nucleotides of the antisense 3' end were G:C rich.
  • the mutant GARS-targeting microRNA constructs had seed match regions focused on the differing nucleotides present in the mutant P278KY or AETAQ alleles, with intentional mismatches between the mature miRNA guide strand the wild-type GARS/GARS.
  • DNAs encoding the microRNA constructs were ligated to a U6T6 vector (via Xhol and Xbal) overnight.
  • This vector contains a mouse U6 promoter and an RNA polymerase III termination signal (6 thymidine nucleotides).
  • the DNAs were cloned into Xhol + Xbal restriction sites located between the 3’ end of the U6 promoter and the termination signal (Spel on the 3’ end of the DNA template for each miRNA has complementary cohesive ends with the Xbal site).
  • the ligation product was transformed into chemically competent E-coli cells with a 42°C heat shock and incubated at 37°C shaking for 1 hour before being plated on kanamycin selection plates. The colonies were allowed to grow overnight at 37°. The following day they were mini-prepped and sequenced for accuracy
  • HEK293 cells were co-transfected (Lipofectamine-2000, Invitrogen) with the appropriate dual luciferase reporter and an individual U6.miRNA expression plasmid in a 1 :5 molar ratio.
  • GARS silencing was determined by measuring Firefly and Renilla activity 24 hours post transfection, using the Dual-Luciferase Reporter Assay System (Promega). Triplicate data were averaged and knockdown significance was analyzed using two-way ANOVA. Results are presented as the mean ratio of Renilla to firefly ⁇ SEM.
  • miRNAs had one or two point mutations relative to the original sequence, in order to increase complementarity to the mouse AETAQ gene, without losing the ability to target the human AETAQ GARS.
  • miAETAQ-5 was highly effective against both the human and mouse mutant allele, was renamed“mi.AETAQ,” and used in all further in vivo studies ( Figure 4).
  • mi.AETAQ ( Figure 4B) was cloned into a scAAV9 for in vivo delivery.
  • the scAAV9 named“scAAV9.mi.AETAQ” also contained a CMV promoter-driven eGFP reporter gene.
  • the scAAV9.mi.AETAQ comprises a mutant AAV2 inverted terminal repeat (ITR) and a wild type AAV2 ITR that enable packaging of self complementary AAV genomes.
  • the scAAV9 was produced by transient transfection procedures using a double- stranded AAV2-ITR-based vector, with a plasmid encoding Rep2Cap9 sequence as previously described [Gao et ai., J. Virol., 78: 6381-6388 (2004)] along with an adenoviral helper plasmid pHelper (Stratagene, Santa Clara, CA) in 293 cells.
  • Virus was produced in three separate batches for the experiments and purified by two cesium chloride density gradient purification steps, dialyzed against PBS and formulated with 0.001 % Pluronic-F68 to prevent virus aggregation and stored at 4°C.
  • vector preparations were titered by quantitative PCR using Taq-Man technology. Purity of vectors was assessed by 4-12% sodium dodecyl sulfate-acrylamide gel electrophoresis and silver staining (Invitrogen, Carlsbad, CA).
  • mice were evaluated for established signs of neuropathy at 4-weeks-of-age, ⁇ 1 .5 weeks after the initial onset of overt signs of neuropathy.
  • G/4F?S AETAQ/huEx8 mjce treated with scAAV9.mi.AETAQ showed significant improvement in a wire hang test of grip strength, increased muscle to body weight ratios (MW:BW), and improved sciatic nerve conduction velocity (NCV) compared to control-treated AETAQ mice (Figure 4C-E).
  • mice and littermate controls via a single intrathecal (IT) injection into the lumbar spinal cord.
  • IT intrathecal
  • mice were anesthetized with isoflurane and received an injection of the proper vector into the L6 spinous process with the use of a Hamilton syringe with a 32-gauge needle. Each vector was slowly injected and the needle left in place for 5-10 seconds prior to withdrawal.
  • RNA samples were isolated from animals immediately after they were euthanized by cervical dislocation. The tissues were frozen in liquid nitrogen and stored at -80 “ C. Samples were homogenized using a mortar and pestle followed by a Dounce homogenizer and RNA was isolated from liver using Trizol Reagent (ThermoFisher, cat no. 15596018) and dorsal root ganglia using either a RNeasyMini Kit (Qiagen, cat nos. 74104 and 74106) or mirVanaTM miRNA Isolation Kit (ThermoFisher Scientific, cat no. AM1560). All RNA samples were reverse transcribed using Trizol Reagent (ThermoFisher, cat no. 15596018) and dorsal root ganglia using either a RNeasyMini Kit (Qiagen, cat nos. 74104 and 74106) or mirVanaTM miRNA Isolation Kit (ThermoFisher Scientific, cat no. AM1560). All
  • ICV Intracerebroventricular Delivery
  • a rAAV9 (rAAV9-miGARS/rGARS vector) that knocks down mutant and wild-type Gars expression with RNAi, and also restores wild-type Gars expression with an RNAi- resistant cDNA (rGARS) is generated.
  • rGARS RNAi-resistant cDNA
  • the total size of the payload, including the AAV inverted terminal repeats (ITRs) is ⁇ 4.0 kb, thereby necessitating use of ssAAV vectors.
  • the two cassettes will be cloned side-by-side in head-to-tail orientation (where promoter is 5’ end, and terminator or poly A is 3’).
  • RNAi-resistant GARS cDNA (called“rGARS’) will be transcribed from the 800-bp chicken b-actin (CBA) promoter.
  • CBA chicken b-actin
  • a -200-bp SV40 polyA signal will be placed at the 3’ end of the ORF.
  • the total size of the rGARS expression cassette is 3,200-bp.
  • a short, artificial 3’ UTR will be attached to allow specific detection of rGARS, distinguishing it from endogenous mouse or human GARS alleles.
  • the GARS CMT2D AETAQ mouse model is dosed with the rAAV9-miGARS/rGARS vector at the maximally effective dose at two time points, pre-onset (ICV at P0) and post onset (intrathecal).
  • P278KY and C201 R mice can also be dosed. Cohort sizes will be -20 mice per group. Groups will include Gars mutant mice and littermate controls randomly assigned to treatment, negative control (AAV9-LacZ) and positive control (allele-specific knockdown vector for AETAQ) groups. Mice will be monitored longitudinally with behavioral tests (grip strength), noninvasive NCV/EMG, and body weight.
  • mice for each genotype will be analyzed in detail 1 to 2 months after treatment to show short-term efficacy.
  • a second cohort will be allowed to age to determine the endurance of the effects.
  • Terminal outcome measures include nerve histology, neuromuscular junction analysis, and muscle weights and/or muscle histology.
  • CMT2D is an autosomal dominant disease in both human patients and mice.
  • mice die as embryos, heterozygous Gars +Im " mice display a normal phenotype, demonstrating that there is a level of GARS activity less than 100 percent that is sufficient for a normal phenotype.
  • wild-type and mutant GARS proteins were expressed in E. coli with a C-terminal His tag and purified with nickel affinity resins (Novagen).
  • the T7 transcript of human tRNA Gly/ccc (CCC, anticodon) was prepared and purified as previously described (Hou et al., Proc. Natl. Acad. Sci. USA 1993;90(14):6776-80), heat denatured at 85°C for 3 min, and annealed at 37°C for 20 min before use.
  • Yeast complementation assays were carried out using a haploid S. cerevisiae strain with the endogenous GRS1 locus deleted and viability maintained via a pRS316 vector expressing the-wild type GRS1 gene (Antonellis et al., J Neuroscience 2006;26(41 ):10397- 406., Turner et al., J. Biol. Chem. 2000;275(36):27681 -8).
  • the haploid yeast strain was transformed with wild-type or mutant constructs, or a construct bearing no GARS insert.
  • Transformed yeast cells were selected for the presence of both the maintenance and experimental vectors by growth on solid media lacking leucine and uracil. Colonies were grown to saturation in 2 ml. liquid medium lacking leucine and uracil at 30°C, 275 rpm for 48 hours. Undiluted cultures and dilutions of 1 :10 and 1 :100 were spotted on complete solid medium containing 0.1% 5-FOA (Teknova, Hollister CA); 5-FOA selects for cells that have spontaneously lost the maintenance vector (Boeke et al., Mol Gen Genet. 1984;197(2):345- 6). Yeast viability was assessed after 4 days of incubation at 30°C. At least two colonies per transformation were assayed and each transformation was repeated at least twice.
  • NRP1 neuropilin-1
  • the NSC-34 cell line was purchased from ATCC and cultured under standard conditions. Cells were grown to 70% confluency before transfection. A human wild-type, P234KY, or AETAQ GARS cDNA was cloned into the pcDNA6 plasmid to express GARS in frame with a V5 tag. Transfections were performed using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s instruction.
  • NSC-34 cells (36 hours after transfection) were washed twice in phosphate-buffered saline (PBS), scraped into PBS, pelleted, and resuspended in Pierce IP Lysis Buffer (Thermo Scientific) for 30 min and centrifuged for 7 min at 12,000xg; the insoluble fraction was discarded.
  • Protein G beads (Invitrogen) were pre-incubated with anti-NRP1 antibody (Abeam) or rabbit IgG (Cell signaling) for 30 min before mixed with the cell lysates for overnight.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Microbiology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Virology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Epidemiology (AREA)
  • Neurology (AREA)
  • Neurosurgery (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Immunology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
PCT/US2019/048832 2018-08-29 2019-08-29 Products and methods for inhibition of expression of mutant gars protein Ceased WO2020047268A1 (en)

Priority Applications (6)

Application Number Priority Date Filing Date Title
AU2019328270A AU2019328270B2 (en) 2018-08-29 2019-08-29 Products and methods for inhibition of expression of mutant GARS protein
JP2021510957A JP2021534794A (ja) 2018-08-29 2019-08-29 変異型garsタンパク質の発現を阻害するための生成物および方法
CA3110665A CA3110665A1 (en) 2018-08-29 2019-08-29 Products and methods for inhibition of expression of mutant gars protein
US17/271,377 US20210324417A1 (en) 2018-08-29 2019-08-29 Products and methods for inhibition of expression of mutant gars protein
EP19768951.6A EP3844284A1 (en) 2018-08-29 2019-08-29 Products and methods for inhibition of expression of mutant gars protein
JP2024107253A JP2024133570A (ja) 2018-08-29 2024-07-03 変異型garsタンパク質の発現を阻害するための生成物および方法

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201862724604P 2018-08-29 2018-08-29
US62/724,604 2018-08-29

Publications (1)

Publication Number Publication Date
WO2020047268A1 true WO2020047268A1 (en) 2020-03-05

Family

ID=67953864

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2019/048832 Ceased WO2020047268A1 (en) 2018-08-29 2019-08-29 Products and methods for inhibition of expression of mutant gars protein

Country Status (6)

Country Link
US (1) US20210324417A1 (cg-RX-API-DMAC7.html)
EP (1) EP3844284A1 (cg-RX-API-DMAC7.html)
JP (2) JP2021534794A (cg-RX-API-DMAC7.html)
AU (1) AU2019328270B2 (cg-RX-API-DMAC7.html)
CA (1) CA3110665A1 (cg-RX-API-DMAC7.html)
WO (1) WO2020047268A1 (cg-RX-API-DMAC7.html)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2022015715A1 (en) * 2020-07-13 2022-01-20 The Trustees Of The University Of Pennsylvania Compositions useful for treatment of charcot-marie-tooth disease
IT202200009395A1 (it) * 2022-05-09 2022-08-09 Giam Pharma Int Sarl Attività antitumorale del meso-(p-acetamidophenyl)-calix[4]pirrolo mediante l’Inibizione dell’attività enzimatica della proteina Glicil-tRNA Sintasi 1 (GARS1)
WO2023060215A1 (en) * 2021-10-07 2023-04-13 Research Institute At Nationwide Children's Hospital Products and methods for myelin protein zero silencing and treating cmt1b disease
JP2023553005A (ja) * 2020-12-01 2023-12-20 リサーチ インスティチュート アット ネイションワイド チルドレンズ ホスピタル 末梢ミエリンタンパク質22の発現の阻害のための生成物及び方法

Citations (24)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5173414A (en) 1990-10-30 1992-12-22 Applied Immune Sciences, Inc. Production of recombinant adeno-associated virus vectors
WO1995013392A1 (en) 1993-11-09 1995-05-18 Medical College Of Ohio Stable cell lines capable of expressing the adeno-associated virus replication gene
WO1995013365A1 (en) 1993-11-09 1995-05-18 Targeted Genetics Corporation Generation of high titers of recombinant aav vectors
WO1996017947A1 (en) 1994-12-06 1996-06-13 Targeted Genetics Corporation Packaging cell lines for generation of high titers of recombinant aav vectors
WO1997006243A1 (fr) 1995-08-10 1997-02-20 Pasteur Merieux Serums Et Vaccins Procede de purification de virus par chromatographie
WO1997008298A1 (en) 1995-08-30 1997-03-06 Genzyme Corporation Chromatographic purification of adenovirus and aav
WO1997009441A2 (en) 1995-09-08 1997-03-13 Genzyme Corporation Improved aav vectors for gene therapy
WO1997021825A1 (en) 1995-12-15 1997-06-19 Systemix, Inc. Method for obtaining retroviral packaging cell lines producing high transducing efficiency retroviral supernatant
WO1998009657A2 (en) 1996-09-06 1998-03-12 Trustees Of The University Of Pennsylvania Method for recombinant adeno-associated virus-directed gene therapy
US5786211A (en) 1994-06-06 1998-07-28 Children's Hospital, Inc. Adeno-associated virus materials and methods
US5871982A (en) 1994-10-28 1999-02-16 The Trustees Of The University Of Pennsylvania Hybrid adenovirus-AAV virus and methods of use thereof
WO1999011764A2 (en) 1997-09-05 1999-03-11 Targeted Genetics Corporation Methods for generating high titer helper-free preparations of recombinant aav vectors
US6258595B1 (en) 1999-03-18 2001-07-10 The Trustees Of The University Of Pennsylvania Compositions and methods for helper-free production of recombinant adeno-associated viruses
WO2001083692A2 (en) 2000-04-28 2001-11-08 The Trustees Of The University Of Pennsylvania Recombinant aav vectors with aav5 capsids and aav5 vectors pseudotyped in heterologous capsids
WO2002053703A2 (en) 2001-01-05 2002-07-11 Children's Hospital, Inc. Aav2 vectors and methods
US6566118B1 (en) 1997-09-05 2003-05-20 Targeted Genetics Corporation Methods for generating high titer helper-free preparations of released recombinant AAV vectors
US7282199B2 (en) 2001-12-17 2007-10-16 The Trustees Of The University Of Pennsylvania Adeno-associated virus (AAV) serotype 8 sequences, vectors containing same, and uses therefor
WO2008150897A2 (en) * 2007-05-31 2008-12-11 University Of Iowa Research Foundation Reduction of off-target rna interference toxicity
US9434928B2 (en) 2011-11-23 2016-09-06 Nationwide Children's Hospital, Inc. Recombinant adeno-associated virus delivery of alpha-sarcoglycan polynucleotides
US9614423B2 (en) 2012-04-07 2017-04-04 Traugott Weller Method for producing rotating electrical machines
US9613872B2 (en) 2014-09-29 2017-04-04 Kabushiki Kaisha Toshiba Method of manufacturing semiconductor device
US9620777B2 (en) 2013-09-30 2017-04-11 Tdk Corporation Positive electrode and lithium ion secondary battery using thereof
WO2017153936A1 (en) * 2016-03-10 2017-09-14 Novartis Ag Chemically modified messenger rna's
US9818600B2 (en) 2014-03-21 2017-11-14 Hitachi Kokusai Electric, Inc. Substrate processing apparatus and method of manufacturing semiconductor device

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2152874A2 (en) * 2007-04-26 2010-02-17 University of Iowa Research Foundation Rna interference suppression of neurodegenerative diseases and methods of use thereof
AU2011289831C1 (en) * 2010-07-12 2017-06-15 Pangu Biopharma Limited Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of glycyl-tRNA synthetases

Patent Citations (26)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5173414A (en) 1990-10-30 1992-12-22 Applied Immune Sciences, Inc. Production of recombinant adeno-associated virus vectors
WO1995013392A1 (en) 1993-11-09 1995-05-18 Medical College Of Ohio Stable cell lines capable of expressing the adeno-associated virus replication gene
WO1995013365A1 (en) 1993-11-09 1995-05-18 Targeted Genetics Corporation Generation of high titers of recombinant aav vectors
US5658776A (en) 1993-11-09 1997-08-19 Targeted Genetics Corporation Generation of high titers of recombinant AAV vectors
US5786211A (en) 1994-06-06 1998-07-28 Children's Hospital, Inc. Adeno-associated virus materials and methods
US5871982A (en) 1994-10-28 1999-02-16 The Trustees Of The University Of Pennsylvania Hybrid adenovirus-AAV virus and methods of use thereof
WO1996017947A1 (en) 1994-12-06 1996-06-13 Targeted Genetics Corporation Packaging cell lines for generation of high titers of recombinant aav vectors
WO1997006243A1 (fr) 1995-08-10 1997-02-20 Pasteur Merieux Serums Et Vaccins Procede de purification de virus par chromatographie
WO1997008298A1 (en) 1995-08-30 1997-03-06 Genzyme Corporation Chromatographic purification of adenovirus and aav
WO1997009441A2 (en) 1995-09-08 1997-03-13 Genzyme Corporation Improved aav vectors for gene therapy
WO1997021825A1 (en) 1995-12-15 1997-06-19 Systemix, Inc. Method for obtaining retroviral packaging cell lines producing high transducing efficiency retroviral supernatant
WO1998009657A2 (en) 1996-09-06 1998-03-12 Trustees Of The University Of Pennsylvania Method for recombinant adeno-associated virus-directed gene therapy
WO1999011764A2 (en) 1997-09-05 1999-03-11 Targeted Genetics Corporation Methods for generating high titer helper-free preparations of recombinant aav vectors
US6566118B1 (en) 1997-09-05 2003-05-20 Targeted Genetics Corporation Methods for generating high titer helper-free preparations of released recombinant AAV vectors
US6258595B1 (en) 1999-03-18 2001-07-10 The Trustees Of The University Of Pennsylvania Compositions and methods for helper-free production of recombinant adeno-associated viruses
WO2001083692A2 (en) 2000-04-28 2001-11-08 The Trustees Of The University Of Pennsylvania Recombinant aav vectors with aav5 capsids and aav5 vectors pseudotyped in heterologous capsids
WO2002053703A2 (en) 2001-01-05 2002-07-11 Children's Hospital, Inc. Aav2 vectors and methods
US7790449B2 (en) 2001-12-17 2010-09-07 The Trustees Of The University Of Pennsylvania Adeno-associated virus (AAV) serotype 8 sequences, vectors containing the same, and uses therefor
US7282199B2 (en) 2001-12-17 2007-10-16 The Trustees Of The University Of Pennsylvania Adeno-associated virus (AAV) serotype 8 sequences, vectors containing same, and uses therefor
WO2008150897A2 (en) * 2007-05-31 2008-12-11 University Of Iowa Research Foundation Reduction of off-target rna interference toxicity
US9434928B2 (en) 2011-11-23 2016-09-06 Nationwide Children's Hospital, Inc. Recombinant adeno-associated virus delivery of alpha-sarcoglycan polynucleotides
US9614423B2 (en) 2012-04-07 2017-04-04 Traugott Weller Method for producing rotating electrical machines
US9620777B2 (en) 2013-09-30 2017-04-11 Tdk Corporation Positive electrode and lithium ion secondary battery using thereof
US9818600B2 (en) 2014-03-21 2017-11-14 Hitachi Kokusai Electric, Inc. Substrate processing apparatus and method of manufacturing semiconductor device
US9613872B2 (en) 2014-09-29 2017-04-04 Kabushiki Kaisha Toshiba Method of manufacturing semiconductor device
WO2017153936A1 (en) * 2016-03-10 2017-09-14 Novartis Ag Chemically modified messenger rna's

Non-Patent Citations (55)

* Cited by examiner, † Cited by third party
Title
"GenBank", Database accession no. NC_00 1862
"UniProtKB", Database accession no. P41250
ABEHYASAKA, J. HUM. GENET., vol. 54, 2009, pages 310 - 312
ACHILLI ET AL., DISEASE MODELS & MECHANISMS, vol. 2, 2009, pages 359 - 373
ANTONELLIS ET AL., AM. J. HUM. GENET., vol. 72, 2003, pages 1293 - 1299
ANTONELLIS ET AL., J NEUROSCIENCE, vol. 26, no. 41, 2006, pages 10397 - 406
BENOY ET AL., BRAIN, vol. 141, no. 3, 2018, pages 673 - 687
BOEKE ET AL., MOL GEN GENET., vol. 197, no. 2, 1984, pages 345 - 6
BOUDREAU ET AL.: "RNA Interference Techniques", vol. 1, 2011, HUMAN PRESS, pages: 19 - 37
BURGESS ET AL., METHODS MOL. BIOL., vol. 602, 2010, pages 347 - 393
CARTER, CURRENT OPINIONS IN BIOTECHNOLOGY, 1992, pages 1533 - 539
CHOUDHURY ET AL., MOL. THER., vol. 24, no. 7, 2016, pages 1247 - 1257
CLARK ET AL., GENE THERAPY, vol. 3, 1996, pages 1124 - 1132
CLARK ET AL., HUM. GENE THER., vol. 10, no. 6, 1999, pages 1031 - 1039
DAVIDSON ET AL., METHODS ENZYMOL., vol. 392, 2005, pages 145 - 73
DAVIDSON ET AL., NAT. REV. GENET., vol. 12, 2011, pages 329 - 40
GAO ET AL., J. VIROL., vol. 78, 2004, pages 6381 - 6388
HARPER, ARCH. NEUROL., vol. 66, 2009, pages 933 - 8
HERMONAT ET AL., PROC. NATL. ACAD. SCI. USA, vol. 81, 1984, pages 6466
HOU ET AL., PROC. NATL. ACAD. SCI. USA, vol. 90, no. 14, 1993, pages 6776 - 80
JAMES ET AL., NEUROLOGY, vol. 67, 2006, pages 1710 - 1712
KUNKEL ET AL., GENES DEV., vol. 2, no. 2, 1988, pages 196 - 204
KUNKEL ET AL., NATURE, vol. 322, no. 6074, 1986, pages 73 - 7
LAUGHLIN ET AL., GENE, vol. 23, 1983, pages 65 - 73
LEBKOWSKI ET AL., 1988 MOL. CELL. BIOL., vol. 7, 1988, pages 349
LEE ET AL., J. PERIPHER. NERV. SYST., vol. 17, 2012, pages 418 - 421
MARSIC ET AL., MOLECULAR THERAPY, vol. 22, no. 11, 2014, pages 1900 - 1909
MCCARTY, MOL. THER., vol. 16, no. 10, 2008, pages 1648 - 1656
MCLAUGHLIN ET AL., J. VIROL., vol. 62, 1988, pages 1963
MOL. THER., vol. 13, no. 1, 2006, pages 67 - 76
MORELLI ET AL., CELL. REP., vol. 18, 2017, pages 3178 - 3191
MOTLEY ET AL., PLOS GENET., vol. 7, 2011, pages e1002399
MUZYCZKA, CURR. TOPICS IN MICROBIOL. AND IMMUNOL., vol. 158, 1992, pages 97 - 129
MUZYCZKA, CURRENT TOPICS IN MICROBIOLOGY AND IMMUNOLOGY, vol. 158, 1992, pages 97 - 129
PADDISON ET AL., PROC. NATL. ACAD. SCI. USA, vol. 99, no. 3, 2002, pages 1443 - 8
PAUL ET AL., HUMAN GENE THERAPY, vol. 4, 1993, pages 609 - 615
PAUL ET AL., NAT. BIOTECHNOL., vol. 20, no. 5, 2002, pages 505 - 8
PAULE ET AL., NUCLEIC AC-IDS RES., vol. 28, no. 6, 2000, pages 1283 - 98
PAULE ET AL., NUCLEIC ACIDS RES., vol. 28, no. 6, 2000, pages 1283 - 98
PERRIN ET AL., VACCINE, vol. 13, 1995, pages 1244 - 1250
QIN ET AL., CURR PROTOC MOUSE BIOL., vol. 6, no. 1, 2016, pages 39 - 66
QIN ET AL., J. BIOL. CHEM., vol. 289, 2014, pages 20359 - 20369
RATSCHIN ET AL., MOL. CELL. BIOL., vol. 4, 1984, pages 2072
ROHKAMM ET AL., J. NEUROL. SCI., vol. 263, 2007, pages 100 - 106
SAMULSKI ET AL., J. VIROL., vol. 63, 1989, pages 3822 - 3828
SAMULSKI ET AL., PROC. NATL. ACAD. S6. USA, vol. 79, 1982, pages 2077 - 2081
SCHENPPCLARK, METHODS MOL. MED., vol. 69, 2002, pages 427 - 443
SCHREIER ET AL., BIOCHEMISTRY, vol. 11, no. 9, 1972, pages 1582 - 9
SEBURN ET AL., NEURON, vol. 51, no. 6, 2006, pages 715 - 726
SENAPATHYCARTER, J. BIOL. CHEM., vol. 259, 1984, pages 4661 - 4666
SRIVASTAVA ET AL., J. VIROL., vol. 45, 1983, pages 555 - 564
THOMAS: "Peripheral Neuropathy", vol. 1, 2005, ELSEVIER SAUNDERS
TRATSCHIN ET AL., MO1. CELL. BIOL., vol. 5, 1985, pages 3251
TURNER ET AL., J. BIOL. CHEM., vol. 275, no. 36, 2000, pages 27681 - 8
VIROLOGY, vol. 330, no. 2, 2004, pages 375 - 383

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2022015715A1 (en) * 2020-07-13 2022-01-20 The Trustees Of The University Of Pennsylvania Compositions useful for treatment of charcot-marie-tooth disease
JP2023534037A (ja) * 2020-07-13 2023-08-07 ザ・トラステイーズ・オブ・ザ・ユニバーシテイ・オブ・ペンシルベニア シャルコー・マリー・トゥース病の治療に有用な組成物
JP2023553005A (ja) * 2020-12-01 2023-12-20 リサーチ インスティチュート アット ネイションワイド チルドレンズ ホスピタル 末梢ミエリンタンパク質22の発現の阻害のための生成物及び方法
EP4256069A4 (en) * 2020-12-01 2025-08-06 Res Inst Nationwide Childrens Hospital COMPOSITIONS AND METHODS FOR INHIBITING PERIPHERAL MYELIN PROTEIN 22 EXPRESSION
WO2023060215A1 (en) * 2021-10-07 2023-04-13 Research Institute At Nationwide Children's Hospital Products and methods for myelin protein zero silencing and treating cmt1b disease
IT202200009395A1 (it) * 2022-05-09 2022-08-09 Giam Pharma Int Sarl Attività antitumorale del meso-(p-acetamidophenyl)-calix[4]pirrolo mediante l’Inibizione dell’attività enzimatica della proteina Glicil-tRNA Sintasi 1 (GARS1)
WO2023218306A1 (en) * 2022-05-09 2023-11-16 Giam Pharma International sarl Antitumor activity of meso-(p-acetamidophenyl)-calix[4]pyrrole by inhibition of the enzymatic activity of the protein glycyl-trna synthase 1 (gars1)

Also Published As

Publication number Publication date
JP2021534794A (ja) 2021-12-16
CA3110665A1 (en) 2020-03-05
AU2019328270A1 (en) 2021-03-25
JP2024133570A (ja) 2024-10-02
US20210324417A1 (en) 2021-10-21
AU2019328270B2 (en) 2026-02-26
EP3844284A1 (en) 2021-07-07

Similar Documents

Publication Publication Date Title
US20240318201A1 (en) Recombinant virus products and methods for inhibition of expression of dux4
US12545909B2 (en) DUX4 RNA silencing using RNA targeting CRISPR-CAS13b
US20180256752A1 (en) Selective gene therapy expression system
JP2024133570A (ja) 変異型garsタンパク質の発現を阻害するための生成物および方法
US20240318172A1 (en) Products and methods for inhibition of expression of peripheral myelin protein-22
US20250230443A1 (en) Products and methods for inhibition of expression of dynamin-1 variants
US20230090989A1 (en) AAV-Mediated Targeting of MIRNA in the Treatment of X-Linked Disorders
US20240401046A1 (en) Products and methods for myelin protein zero silencing and treating cmt1b disease
US20250340887A1 (en) Products and methods for treating diseases or conditions associated with mutant or pathogenic kcnq3 expression
HK40119328A (en) Recombinant virus products and methods for inhibition of expresssion of dux4
HK1252157B (en) Recombinant virus products and methods for inhibition of expression of dux4

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 19768951

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 3110665

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2021510957

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2019328270

Country of ref document: AU

Date of ref document: 20190829

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2019768951

Country of ref document: EP

Effective date: 20210329