WO2020036438A1 - 단일 금속 나노 브릿지 구조의 합성 방법 및 이를 이용한 dna 점돌연변이 검출 센서 제작 방법 - Google Patents

단일 금속 나노 브릿지 구조의 합성 방법 및 이를 이용한 dna 점돌연변이 검출 센서 제작 방법 Download PDF

Info

Publication number
WO2020036438A1
WO2020036438A1 PCT/KR2019/010370 KR2019010370W WO2020036438A1 WO 2020036438 A1 WO2020036438 A1 WO 2020036438A1 KR 2019010370 W KR2019010370 W KR 2019010370W WO 2020036438 A1 WO2020036438 A1 WO 2020036438A1
Authority
WO
WIPO (PCT)
Prior art keywords
dna
metal
biosensor
muts
mutation
Prior art date
Application number
PCT/KR2019/010370
Other languages
English (en)
French (fr)
Inventor
심상준
마흥의
김수현
Original Assignee
고려대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 고려대학교 산학협력단 filed Critical 고려대학교 산학협력단
Priority to EP19849511.1A priority Critical patent/EP3842548A4/en
Priority to US17/266,193 priority patent/US20220364162A1/en
Priority to CN201980053469.2A priority patent/CN112805391A/zh
Priority claimed from KR1020190099454A external-priority patent/KR102300360B1/ko
Publication of WO2020036438A1 publication Critical patent/WO2020036438A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6816—Hybridisation assays characterised by the detection means
    • C12Q1/6825—Nucleic acid detection involving sensors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6827—Hybridisation assays for detection of mutation or polymorphism

Definitions

  • the present invention relates to a single nanoparticle biosensor platform including a metal nanobridge structure and a method for manufacturing the same, and specifically, to a single nanoparticle including metal nanoparticles having a biomolecule fixed between two metal nanoseeds.
  • a biosensor platform and a biosensor comprising the same; A method of detecting mutations using the biosensor; And forming a metal nanoparticle in which a biomolecule is immobilized between two metal nanoseeds.
  • the optimal method for obtaining mutation information is ideally capable of revealing identity and presence of variant bases, without prior knowledge of sequences, without concern for artifacts by labeling and in vitro environments, but for most gene mutations. Diagnosis depends on the sequencing method. Inconsistencies after replication in many organisms, by the nanoplasmonic biosensor, the mismatch repair (MMR) initiating protein MutS recognizes mutations in a sequence non-specific manner following the introduction of MutL and other enzymes that repair variant DNA.
  • MMR mismatch repair
  • MMR opposite system of recovery
  • Reliability of nanobiosensing is generally determined by two main factors: biomolecules for target recognition and nanomaterials for a single generation, directly related to detection sensitivity and selectivity for specific physical conditions.
  • biomolecules for target recognition and nanomaterials for a single generation, directly related to detection sensitivity and selectivity for specific physical conditions.
  • plasmon nanoparticles are of interest because of their ability to interact with incident light and exhibit localized surface plasmon resonance (LSPR).
  • LSPR localized surface plasmon resonance
  • the co-vibration of electrons at the resonant frequency in the nanostructure translates the change in local refractive index (RI) into the movement of the plasmon band in the absorption and scattering spectrum.
  • the sensing scale can be reduced to one single nanoparticle, which contributes to single-nanoparticle sensing (sNPS) technology.
  • the sNPS method can report local biological information on the nanometer scale that allows for a limit of detection (LOD) reaching a countable number of molecules using a unique small sensing volume.
  • LOD limit of detection
  • most other techniques consisting of large amounts of solution or planar surfaces have difficulty in positioning and separating sensing elements, suffer from slow molecular diffusion, stochastic coupling, frequent separation of complex biomolecules, and thus out of equilibrium. The response eventually leads to signal fluctuations with a low signal-to-noise (S / N) ratio.
  • S / N signal-to-noise
  • the sNPS sensor is a small probe with high throughput and parallel readout, where the nanoparticle structure and local sensing volume / area are essential for its RI sensitivity.
  • NPs colloidal plasmon NPs having a predetermined structure
  • it is difficult to manipulate atoms temporarily present in solution and currently synthesized NPs are limited to highly symmetrical to the same surface (eg nanospheres).
  • Nanorods, nanocubes, nanodisks, etc. The structural programmability of NP may provide a powerful means to address the limitation of sNPS in sensitivity and repeatability.
  • Two research groups have been cast into DNA molds (Sun, W., et al. Science 346, 1258361 (2014)) or using DNA frameworks (Ma, X., et al. Nat Commun 7, (2016).
  • DNA has led to breakthroughs in synthesis-with-design with sub-5nm precision.
  • sNPS offers a variety of applications that make the most of its unique small sensing size, which can be compared to the size of biomolecules such as nucleic acids or proteins.
  • MutS protein is 125 ⁇ 90 ⁇ 55 ⁇ in size. Therefore, the absorption of MutS on a single NP can significantly change the co-vibration behavior of surface electrons, resulting in wavelength shifts in the NP spectrum. Since single-point mutations are rarely recognized based on PCR and other DNA chip-based assays, the specificity of the biological interactions of MutS, including mismatched DNA, has facilitated the study of nucleotide polymorphism.
  • the present inventors have made efforts to solve the problems of the prior art as described above, by modifying both ends of the DNA to bind the gold nanoseed and implements gold crystallization in two opposite directions, a structure exhibiting excellent RI sensitivity Phosphorous, Au-bridged nanoparticles can be prepared, and a single nanoparticle biosensor platform comprising the prepared Au-bridged nanoparticles can be used to detect targets with high sensitivity and reliability, as well as to target various mutations. According to the relative activity of MutS for Mutant was confirmed that can be directly confirmed, the present invention was completed.
  • Another object of the present invention to provide a method for detecting mutations using the biosensor.
  • Still another object of the present invention is to provide a method for manufacturing a single nanoparticle biosensor platform, which comprises forming metal nanoparticles having biomolecules immobilized therebetween and removing the metal nanobridge structure by using the same. It is.
  • the present invention provides a single nanoparticle biosensor platform and a biosensor comprising the metal nanobridge structure.
  • the present invention also provides a method for detecting a mutation using the biosensor.
  • the present invention also provides a method of manufacturing a single nanoparticle biosensor platform comprising forming metal nanoparticles having biomolecules immobilized therebetween and manufacturing a metal nanobridge structure using the same.
  • the single nanoparticle biosensor platform according to the present invention is not only capable of detecting targets with high sensitivity and reliability, but also enables direct identification of various mutations, and thus enables efficient mutation diagnosis, and thus can be widely used in biomedical diagnostic fields. have.
  • FIG. 1 shows RI sensitivity analysis of a single NP, where the LSPR wavelength shifts in response to RI changes in the surrounding medium.
  • the table on the right is the RI value of the medium.
  • Figure 2 relates to the preparation and characterization of AuNS-dsDNA-AuNS, where a is a photographic image of gel electrophoresis for the separation of different AuNS-ssDNA complexes, each band containing a specific number of ssDNA immobilized on one AuNS Indicates. The leftmost band represents the basic nanoseed without DNA binding. b is a photographic image of gel electrophoresis for isolation and identification of AuNS-dsDNA-AuNS after ssDNA hybridization, and c is a TEM image of AuNS-dsDNA-AuNS.
  • sNPS system shows the specific configuration of the sNPS system based on the RLS and LSPR of a single Au-bridge NP by white light irradiation.
  • b is a schematic diagram of a detection chamber.
  • c is the image of the chamber obtained by the camera. Individual nanoparticles with interparticle spaces that are ⁇ 5 times larger than the diameter of the bright spot were located-marked and analyzed.
  • d is an SEM image of the chamber.
  • e shows the raw spectrum of Au-bridge NP obtained once per minute for 10 minutes.
  • f indicates that Lorentzian fit of ten circle spectra demonstrates peak measurement accuracy of 0.188 nm.
  • a shows the result of a control experiment of MutS using a probe.
  • the RLS spectrum of a single NP is valid ⁇ max No migration (0.356 nm blue-shift) was shown.
  • b shows the result of a control experiment of MutS using homoDNA, which showed 0.343 nm red-shift at ⁇ max .
  • c shows the results of a control experiment of mutant target DNA (mDNA) using nonspecific components in serum. RLS spectrum is valid ⁇ max No migration (0.700 nm red-shift) was shown.
  • d the introduction of MutS into serum markedly produced 14.7-nm red-shift under the same detection conditions as c.
  • 5 is a sequence showing the active site of a restriction enzyme.
  • Genomic DNA was extracted from breast cancer cell lines MCF7 and HCC1937, and ovarian cancer cell line SNU251.
  • a is a schematic of the FOI and available space for MutS loading of Au-Bridge NP.
  • b is the scale black of the CCD image, one pixel is 0.42 ⁇ m in length.
  • c represents the height h of the FOI.
  • a is a schematic illustration of sNPS for identifying single point DNA mutations.
  • b is a representative RLS spectrum and in-situ dark microscope image of Au-bridge NP. Scale bar, 1 ⁇ m.
  • c is LSPR ⁇ max when DNA and MutS are combined Indicates a move. Same line legend for b and c.
  • d represents each step (1, 2 and 3) of molecular bonding.
  • the illustration is a real time image of a single NP obtained with a CCD camera.
  • e is the concentration of MutS for the appropriate signal response.
  • the test curve is ⁇ max And the linear relationship between various concentrations of MutS.
  • f is the LOD of the variant DNA target.
  • the test curve is ⁇ max And the linear relationship between the target DNA at various concentrations.
  • Nanoparticles were modeled as two spheres (grey) bridged by cylinders (yellow); The DNA footprint was assumed to be uniformly distributed in the particles with the highest loading density and the closest distance to each other, thus modeling the circular area of the sphere and the oval of the cylinder.
  • a is an illustration of the designed NP model (top; dimensional unit, nm) and plasmon resonance electric field pattern (bottom) created by numerical simulation
  • b is linear fit versus LSPR wavelength shift versus RI change around NP
  • c is NH Schematic diagram showing the initial stages of direction-specific, contour-following and form-controlled crystallization of Au atoms following reduction of AuCl 4 ⁇ with 3 OH + .
  • the water interface of DNA provides precise controllability under synthetic conditions at pH 5 and 4, which results in NPs with nanobridges and nanogap, respectively, as shown in the TEM image. Scale bar, 20 nm.
  • d is the X-ray diffraction spectrum of AuNS and Au-bridge NP
  • e is the HR-TEM image of the DNA-oriented nanocrystals and the fast Fourier transform pattern (right) of the selected region. Scale bar, 10 nm.
  • a is the result of real-time monitoring of MutS binding to each variant DNA and homoduplex
  • b is the result of the reconstruction of the rate constant of the interaction between MutS and each point mutation.
  • a is the result of real-time monitoring of the binding of various concentrations of MutS to GT-modified DNA
  • b represents the dependence of the rate constant on the MutS concentration.
  • 16 is a BRCA1 using eight sNPS chips developed in the present invention. The diagnostic results of point mutations are shown. Samples derived from the human breast cancer cell line, HCC1937, were detected as analytes and MCF7 derived samples were used as controls. Clinical samples have greater ⁇ max during monitoring Generated waves; However, with the exception of 5382insC, none of the chips produced an effective k reaction , indicating that the analyte contained a single cytosine copy.
  • FIG. 17 shows the results of three detections of BRCA1 of cell line HCC1937 using 5382insC probe.
  • a "+ C” mutation in the target was predicted by entering a k reaction mean value of 0.0573 into the atlas of MutS affinity for the different point mutations.
  • FIG. 19 shows the diagnosis of point mutations in the user-assigned genomic region of an ovarian cancer cell line SNU251 derived DNA sample.
  • Targets located at 43047665 on region 2 band 1 of the long arm of chromosome 17 were analyzed three times.
  • a k reaction of 0.0320 in the atlas of MutS affinity for different point mutations Mean values were entered to predict AC mutations in the target.
  • the illustrations in each figure show the results of a control experiment to detect samples derived from MCF7 cells.
  • the present invention relates to a metal nanobridge structure, specifically, a metal nanobridge structure including a metal nanoparticle having a biomolecule fixed between two metal nanoseeds and a single nanoparticle biosensor platform including the same. will be.
  • a method of forming a metal nanoparticle in which a biomolecule is immobilized between two metal nanoseeds And manufacturing a metal nanobridge structure using the formed metal nanoparticles.
  • the metal is preferably any one selected from the group consisting of gold (Au), copper (Cu), platinum (Pt) and palladium (Pd), more preferably gold (Au) You can do
  • the metal nanoseed may be one selected from the group consisting of nanospheres, nanorods, nanorods, nanoprisms, and nanoplates.
  • the biomolecule may be one selected from the group consisting of single-stranded DNA, double-stranded DNA, DNA oligomer, RNA oligomer, plasmid DNA, polypeptide and protein, preferably double-stranded DNA It may be characterized by.
  • the metal nanoseed may have a diameter of preferably 25 nm or less.
  • the biomolecule may be characterized in that the length is preferably 30 nm or less.
  • the method for manufacturing the single nanoparticle biosensor platform may further include growing metal ions on the surface of the formed metal nanoparticles while being reduced by a reducing agent.
  • the reducing agent may be an amine hydroxide (NH 2 OH), but is not limited thereto.
  • the present invention relates to a biosensor comprising the single nanoparticle biosensor platform in another aspect.
  • the biosensor may be characterized in that it comprises a protein, preferably a mismatch repair initiation protein (MutS).
  • MutS means a protein capable of recognizing a discrepancy in a nucleic acid molecule and binding to the discrepancy site, in which one or more amino acids are substituted, deleted, added, and / or as long as the discrepancy can be recognized. Or a protein consisting of an inserted amino acid sequence.
  • the biosensor may have a higher sensitivity (Refractive index) than the nanorods.
  • RI sensitivity is a comparison of the relative difference in LSPR peak shift relative to the refractive index of the media around the particles. According to one embodiment of the present invention, it is confirmed that the RI sensitivity of the metal nanobridge structure of the present invention is higher than the conventional nanorods known to have the highest RI sensitivity.
  • the biosensor may be used for detecting mutations, in particular point mutations.
  • the biosensor can be used to specify the type of BRCA1 mutation in the sample.
  • the present invention relates to a method for detecting mutations, in particular point mutations, using the biosensor.
  • the detection method of the mutation may be characterized by identifying the mutation by analysis of the binding of the protein, preferably the mismatch repair start protein (MutS) and the mutant nucleic acid molecule.
  • the protein preferably the mismatch repair start protein (MutS) and the mutant nucleic acid molecule.
  • Example 1 single nanoparticle Sensing Preparation of platform and detection method of point mutation using same
  • Gold nanoseed (AuNS; 5 nm) solution (British BioCell International, Crumlin, UK), wash and storage buffer (10 mM PBS with 0.02% NaN 3 , 0.01% Tween 20, 0.1% BSA, pH 7.4; Catalog #: WB- 100, Ocean NanoTech, San Diego, CA, USA), dithiothreitol (DTT, Promega, Madison, WI, USA) and restriction enzyme Sty I (# R648A, Promega, Madison, WI, USA), centrifuge ( Microsep ® and Nanosep ® , Pall Life Sciences, Inc., Ann Arbor, MI, USA), and 2- ⁇ 2- [2- (2- ⁇ 2- [2- (1-mercaptodecks-11-yloxy ) -Ethoxy] -ethoxy ⁇ -ethoxy) -ethoxy] -ethoxy ⁇ -ethylamine hydrochloride (2- ⁇ 2- [2- (2- ⁇ 2- [2- (1-mercaptound
  • Thermus from Thermophilic Bacteria aquaticus MutS protein (Nippon Gene Co., Ltd., Tokyo, Japan) was stored at -20 ° C in 100 mM NaCl, 0.1 mM EDTA, 1 mM DTT and 50% glycerol and 20 mM Tris-HCl buffer (pH 7.5) It was.
  • G-spin TM Total DNA Extraction Kit (# 17046) was supplied from iNtRON Biotechnology (Gyeonggi-do, Korea). Restriction enzymes Mbo I (# R0147) and Alu I (# R0137) were obtained from NEB (Hitchin, Hertfordshire, UK).
  • the perfectly matching sequence corresponding to homoduplex is as follows: ATTGAAAGTTGCAGAATCTGCCCAGAGTCCAGCTGCTGCTCATACTACTGA.
  • ssDNA single stranded DNA
  • Table 2 The sequences of the DNA target and the probe are shown in Table 2 below.
  • Modeling and optical simulation of nanostructures in the form of spheres, rods and dimers were performed and NPs were bridged using software COMSOL.
  • the composition of the NP was gold, the particle size was adjusted equally for comparison, and the final dimensions refer to the fabricated synthesis in the experiment.
  • Optical simulations were performed in a local dielectric environment where various weight ratios of water-glycerol mixtures were set to vary the RI of the surrounding medium from 1.333 to 1.443 (FIG. 1).
  • All 5'-thiol modified oligonucleotides were incubated with DTT for 15 minutes at a ratio of 100: OD to DTT solution of oligonucleotides and purified twice with ethyl acetate. Disulfide bonds of the 5'-thiol were used to degrade into active sulfhydryl form and immediately bind to the gold surface.
  • AuNS was converted to bis (p-sulfonatophenyl) phenylphosphine dihydrate dipotassium (BSPP; 100 mL AuNS solution in 100 mg BSPP And mixed for 10 hours).
  • the AuNS solution was then mixed with NaCl and the color changed from dark red to light purple.
  • the solution was centrifuged at 500 xg for 30 minutes at room temperature and then resuspended in 1 mL of 0.5 mM BSPP.
  • the color of the solution was changed from dark red to light purple again by adding 0.5 mL of methanol, and AuNS was recovered after centrifugation (30 min, 500 ⁇ g) and dissolved in 1 mL of 0.5 X TBE buffer.
  • the concentration of AuNS increased to several ⁇ M; According to the manufacturer's instructions, 1 OD of 5 nm AuNS is equal to 5.00 X 10 13 per micrometer.
  • AuNS was incubated overnight at room temperature with ssDNA-1 at a stoichiometric ratio of 1 in 0.5 X TBE buffer containing 50 mM NaCl. Thereafter, 60% glycerol was added to the solution to make a final mixture containing 10% glycerol, which prevented AuNS-ssDNA from diffusing into the buffer upon gel electrophoresis.
  • the seeds were gently stirred with the gold precursor for 10 minutes at a final concentration of 2 nM; 10 ⁇ l of solution was mixed with 17.54 ⁇ L of reducing agent and a color change from colorless to pale red was observed within 1 minute. After 15 minutes, the synthesized NP was washed off with repeated centrifugation and resuspension in water.
  • TEM and HR-TEM images of NPs were observed with Hitachi HD2300 transmission electron microscopy in z-contrast and SE modes at an acceleration voltage of 300 kV. Samples for TEM were made using an EMS stain plate (Electron Microscopy Sciences) and a 400-mesh copper TEM grid (Ted Pella) with carbon film.
  • the length and diameter of the nanostructures in the plane of the TEM were measured using ImageJ software.
  • TEM images of scale bars of 20 nm and 50 nm showed nanostructures large enough for precise measurements.
  • Particle yield was calculated as the ratio of the total particles of Au-bridge NP. Unwanted particles were easily distinguished as large or small bridge-nanoparticles and as nanospheres grown from AuNS-ssDNA denatured from AuNS-dsDNA-AuNS during the synthesis reaction (Ma, X., et al., Nat Commun 7 , 12873, 2016).
  • the FFT pattern of the HR-TEM image was analyzed by Digital Micrograph software (Gatan, Pleasanton, CA, USA).
  • FIG. 3a The overall configuration of the sNPS system is shown in Figure 3a.
  • First Contact Cleaning Polymer Photonic Cleaning Technologies
  • a microscope glass slide 22 x 40 x 0.1 mm; Warner Instruments
  • the slides were then cleaned overnight with aqua regia solution, rinsed with ultrapure water, slightly immersed in 5% (v / v) 3-aminopropyltriethoxysilane in anhydrous ethanol and sonicated for 5 minutes in ultrapure water (3 times). repeat).
  • 3 ⁇ l of diluted Au-Bridge NP solution (OD ⁇ 0.05) was dropped onto the silane treated slides.
  • Chamber derived images were focused on charge-coupled device (CCD) cameras (PIXIS: 400B, Princeton Instruments, Trenton, NJ, USA) at -70 ° C with 100-ms frame integration.
  • CCD charge-coupled device
  • the beam splitter at the microscope output port and the long pass filter were placed in front of the CCD.
  • the platform allowed the determination of Rayleigh light scattering (RLS) of each NP in the chamber using an RLS spectrometer (Microspec 2300i, Roper Scientific, Montagne Sud-8, rue du Forez, France) in an 18 ° C. dark room. Spectra in the range of 300-900 nm were then recorded with 1 second acquisition time.
  • RLS Rayleigh light scattering
  • Binding of MutS to DNA was performed in binding buffer (pH 7.5; 100 mM NaCl, 1 mM DTT, 0.1 mM EDTA, and 5 mM MgCl 2 ) at a flow rate of 1 ⁇ L / min at 18 ° C.
  • 100 nM target DNA was captured with Probe-GT in the chamber and reacted with 20 nM MutS protein for 2 minutes.
  • Real time imaging of a single NP by CCD and RLS spectra by spectrometer were recorded and processed with the software WinSpec (Roper Scientific). Control experiments were performed under the same detection conditions to investigate MutS interactions with probes (no target binding) and DNA homoduplexes (no mutations).
  • Genomic DNA was extracted using the G-spin TM Total DNA Extraction Kit and treated with 200 ng / ml protease K and 10 ng / ml RNase A at 55 ° C. for 30 minutes before purification and further restriction digestion.
  • restriction enzymes Mbo I Alu I And digestion with Sty I.
  • Mbo I And digestion with Alu I produced fragments of 100-500 bp.
  • BRCA1 to Sty I Because of the site, fragments were further digested by Sty I for ⁇ 50 bp long target samples. Specific sites of the enzyme and calculated fragmentation maps are shown in FIGS. 5 and 6.
  • DNA concentration and purity were evaluated using a Nano-200 Micro-Spectrophotometer DC24V (# AS-11030-00; Allsheng Instrument, Hangzhou, China). 300 ng DNA samples were loaded onto a 0.7% agarose gel at 2.5 V ⁇ cm ⁇ 1, 4 ° C., stained with 0.5% bromide ethidium, and UV-treated using the Davinch-GelTM Gel Imaging System (Film Science, Seoul, Korea) The integrity of the DNA was evaluated by gel electrophoresis, detected by illumination (FIG.
  • the resonance FOI of an individual nanoparticle is defined as the effective space of resonance sensitivity to refractive index change, in order to calculate the molecular concentration directly proportional to the amplitude of the red-shift in ⁇ max , see Equation 1 (1-1 below: data analysis). ) Can be applied.
  • FOI was rectangular (FIG. 8A).
  • the two-dimensional region of the FOI was directly described as 8 pixels in the CCD image by the WinSpec software of the sensing system (FIG. 9D), whose rm length and width were measured at 3.36 ⁇ m based on the scale test (FIG. 8B). The length and width of this two-dimensional region was set before spectral monitoring and maintained for all detections. As shown in FIG.
  • the height h of the FOI is the sum of the diameter D NP and t of the nanostructure, where t is defined as the threshold thickness of the region capable of inducing peak red-shift.
  • the threshold thickness of p / 2 is t .
  • N * was quantitatively predicted (FIG. 10). Specifically, N * was calculated by dividing the surface area of the particles by the area of the effective seizure station of the probe. Footprints are defined as the average area of each probe that occupies the nanoparticle surface. Some estimates were made for the calculation. Nanoparticles were modeled as two perfect spheres bridged by cylinders; The footprints closest to each other were modeled by the circular area of the sphere and the ellipse of the cylinder; The contact-point of the two spheres on the glass was not taken into account; And the probe was assumed to be evenly distributed on the particle surface.
  • the footprint of the sphere ( S sphere ) was indexed by 6 nm 2 depending on the diameter of the sphere (Hill, HD et al., ACS Nano, 3, 418-424, 2009).
  • the two lines on the non-curved surface may have a footprint spacing distance longer than 2.39 nm (4.72 nm; Hill, HD et al., ACS Nano, 3, 418-424, 2009)
  • m is the refractive index sensitivity
  • ⁇ n is a change in the refractive index induced by the absorption quality
  • d is the dielectric thickness
  • L d is to embellish an approximation to the electromagnetic field decay (decay represented by the index; Haes, AJ et al. , J Am Chem Soc, 124, 10596-10604, 2002).
  • ⁇ ⁇ max which is proportional to the concentration of the binding assay, in direct proportion to ⁇ n (Starov, VM, Nanoscience : Colloidal and Interfacial Aspects, CRC Press, Boca Raton, FL, 2010). Based on the measurement of ⁇ max , the concentration change of the analyte was calculated.
  • ⁇ is the standard deviation of the signal and S is the slope of the black line.
  • ⁇ can be estimated as the standard deviation of the y-intercept of the regression line.
  • the detection limit of the sNPS system for the DNA target may be set as the detection limit (LOD) as follows.
  • S / N Signal-to-noise ratio
  • MutS binds to DNA and forms an MSDNA complex. Association is a secondary reaction because two reactants are involved.
  • both binding and separation reactions are straight-bonds.
  • MutS binding and separation is a stochastic process. This is a simple approximation of the binding phenomenon that all DNA strands on Au-bridge NP can bind equally.
  • the length of the DNA strand used indicates binding in MutS with 1: 1 in stoichiometry, and the time-course of binding is shown as a single exponential process.
  • the binding ratio is equal to the release ratio:
  • the rate of change of concentration of the MSDNA complex is equal to the difference between its formation and separation rates as follows:
  • K D equilibrium constant
  • k dissociation is concentration independent and indicates the possibility of complex spontaneous breakdown within unit time (Pollard, TD et al., Mol Biol Cell, 24, 1103-1110, 2013).
  • Example 2 single nanoparticles prepared Sensing Platform Characterization and Point Mutation Detection Results
  • each NP acts as a signal converter in the sNPS platform, the structure and shape of the NP must be uniform and adjustable. Since the formation of such nanocrystals is not empirical but empirical rather than scientific, the use of irregularly shaped nanocrystals (eg, branched nanostars) is prohibited. Moreover, the controllability of polyhedral nanostructures is hindered by the lack of chemicals that can specifically tune the target crystal plane, producing NPs with relatively high morphological results. Therefore, for uniform and scalable synthesis, spherical and rod-shaped nanostructures were selected as substrates for sNPS.
  • RI sensitivity To explore higher RI sensitivity, structures were constructed consisting of nanobridges that induce distinct spectral responses and affect the magnitude, direction of polarization, signal intensity and RI sensitivity of plasmon binding (FIG. 11A).
  • the sensitivity of metal NPs is a major determinant of the usefulness of bio / chemical-sensors. Instead of using complex biomarkers to quantify the RI sensitivity of the particles, optical simulations of a single NP with predesigned structures set up to change the RI of the surrounding medium were performed. Analysis of LSPR wavelength ( ⁇ max ) changes in single gold NPs induced by different RI solutions has proved to be effective and simple in quantifying RI sensitivity (Truong, PL, Ma, X.
  • dsDNA double stranded DNA molecules
  • the reactant pair, AuCl 4 ⁇ and NH 3 OH + are contacted with each other to advance gold crystallization according to DNA. Crystallization proceeds in a specific direction from the AuNS-dsDNA boundary to the middle of the dsDNA strand, with nanoscale controllability defined by the length of the dsDNA. This method is fundamentally distinguished from the conventional approach of metallizing DNA or DNA origami, where sequential necklace forms or continuous protrusion forms are formed with poorly controlled structural precision (> 100 nm).
  • the yield of the preferred form was 87% and the nanostructures were relatively high simple dispersion (FIG. 12).
  • dsDNA is positively charged due to a pI of 4-4.5 (Guo, ZL et al., Soft Matter, 12, 6669-6674, 2016).
  • DNA rejects NH 3 OH + by electrostatic repulsion, and therefore the reaction between NH 3 OH + and AuCl 4 ⁇ usually occurs near AuNS, which further autocatalyzes the crystallization of the Au atoms surrounding its surface. The reaction ends with complete oxidation of the Au ion reactor, leaving a 0.44-nm gap between the two nanospheres (17.01 ⁇ 1.07 nm in diameter).
  • the peak position showed a clear shift after DNA-induced crystallization, indicating that DNA induces significant lattice modification to the Au-bridge nanostructures.
  • the narrower peak line widths indirectly indicate an extension of the particle size.
  • the HR-TEM image for the nanoscale bridge confirmed the crystal plane with a spacing distance of 0.208 ⁇ 0.004 nm, corresponding to the (200) lattice periphery in the ⁇ 100> crystallization direction (Ma, X., et al. Nat Commun 7, (2016)).
  • Resonance RLS reaction of single Au-bridge NP by sNPS as white source was investigated (FIG. 3).
  • Light scattering of the individual NPs was observed on a dark field microscope equipped with a white light source, a dark field condenser, a 100 ⁇ objective and a camera.
  • White light illumination makes it possible to distinguish light scattering from individual NPs of different optical resonances; It also does not induce strong energy and heat to denature target biomolecules or interfere with molecular interactions.
  • dark field placement the light scattering objects appear bright in contrast to the dark background. Stimulation of LSPR by AuNPs strongly enhances light scattering enough to be visually recognized and analyzed photographically.
  • NP is sparsely dispersed on the glass substrate of the designed microfluidic reaction chamber.
  • a high sensitivity charge coupled device (CCD) and a Rayleigh spectrometer were attached to the microscope. Scattered monochromatic light of a single NP was recorded on a CCD and represented as a function of light intensity versus wavelength in the spectrum. In order to remove noise derived from the light of the surrounding environment, the scattering spectrum was fitted to the Lorentian algorithm.
  • CCD charge coupled device
  • Rayleigh spectrometer In order to remove noise derived from the light of the surrounding environment, the scattering spectrum was fitted to the Lorentian algorithm.
  • the MutS protein including the highly positively charged surface sequence, is contacted independently of the negatively charged DNA backbone.
  • the presence of mismatches in DNA messes up the helix and induces specific H-binding of MutS with the conserved Phe-Xaa-Glu motif.
  • the LSPR of metallic NPs is strongly dependent on RI in shape, size and local dielectric environment.
  • the sensitivity of the sNPS sensing method was investigated by two means. The first is the lowest concentration of MutS protein (LOD) that allows for an effective LSPR ⁇ max shift ( ⁇ max ) within a specific detection time; The other is the detection time that can be reached. After the MutS solution reached DNA modified Au-Bridge NP in the microfluidic chamber, the reaction was allowed to continue for 1 minute and then RLS spectra were collected for 10 seconds. DNA targets were used in excess to ensure complete hybridization with the probe. The concentration of MutS protein effective for LSPR translation is 6.17 nm, corresponding to 3.40 nm red shift of ⁇ max in the linear range of 10 nM to 25 nM of MutS (FIG. 9E).
  • LOD MutS protein
  • BRCA1 Gene mutations include the most important genetic susceptibility of breast cancer, the most common cancer in women worldwide. Approximately 12% of women in the general public develop breast cancer during their lifetime, with the greatest risk being caused by BRCA1 , which increases the risk of breast cancer progressing by 59-87%. Except for some common mutations, BRCA1 The spectrum of mutations is heterogeneous in various populations. The polymorphisms of the eight most common BRCA1 genes were selected, including single nucleotide substitutions (GT, GG, AC, TC, AA, GA), insertions (+ C) and deletions (-C). DNA sequences, variant names, genomic locations, functional results, and target populations are summarized in Table 1.
  • MutS binding time more than 10 times longer than homoduplex and clearly leads to a series of ⁇ max .
  • ⁇ max is caused by RI changes on MutS binding to DNA-binding NPs, the time course clearly indicates the different activity of MutS to recognize point mutations.
  • Different nucleotide mutations modify the contact behavior between MutS protein and DNA. For example, mismatched purines form at N7, while mismatched pyrimidines form hydrogen bonds at the N3 position with glutamic acid of MutS.
  • amino acids such as phenylalanine accumulate nonspecifically at bases near mismatches.
  • R act K k reaction
  • K reaction the rate constant of the protein-DNA interaction.
  • DNA on Au-Bridge NP is stochastic and equally available for MutS, so the same detection conditions can be a simple approximation of binding events that maintain K 's consistency. Therefore, R act can be evaluated according to k reaction . Since the length of the DNA probe used indicates binding to MutS in a 1: 1 stoichiometry, the time path of binding and separation can be described as a single exponential process.
  • the k reaction (10 -2 s -1 ) of MutS binding to different DNA targets is 9.95 ⁇ 0.420 for each point mutation of GT, GG, + C, AA, TC, -C, AC, GA. , 6.15 ⁇ 0.208, 5.80 ⁇ 0.189, 4.92 ⁇ 0.214, 3.82 ⁇ 0.212, 3.60 ⁇ 0.243, 3.25 ⁇ 0.184, and 2.82 ⁇ 0.197.
  • Reconstruction of the k reaction value for each target DNA showed that the relative activity of MutS for the different mutations was in the order GT>GG> + C>AA>TC>-C>AC> GA (FIG. 13B).
  • the k binding of 2.97 ⁇ 10 6 M -1 s -1 is similar to the previously reported mass kinetic measurements of 3-6 ⁇ 10 6 M -1 ⁇ s -1 (Qiu, RY , et al. Proc . Natl Acad . Sci . USA 112, 10914-10919 (2015).
  • k reaction Kinetic studies between and k binding revealed the dissociation equilibrium constant of MutS for DNA, ie, K D , which is a fundamental parameter of ligand affinity.
  • K D of MutS was found to be 4.46 nM, which is consistent with the reported smFRET and bulk measurements of 2-10 nM (Jeong, C.
  • Atlas represents the comprehensive information obtained by low-input and high-fidelity sNPS of relative activity and response half-life for each target, mutation type, and diagnostic signal.
  • each circle represents a single point mutation with a diameter and color reflecting the signal response to quantify LSPR peak shift and mutation categories, respectively.
  • target DNA with GT mutations produced a peak shift of 14.2 nm, the value of which is influenced and proportional to the concentration of the target (100 nM).
  • Mutation categories are biologically divided into three types, blue, green and red, of which blue represents a transition mutation (pyrimidine to pyrimidine or vice versa), and green to a mutation mutation (pyrimidine to furin or Vice versa) and red indicates bulging mutations (base insertion or deletion).
  • the y and x coordinates of the center of each circle represent the half-life of the relative activity and response, respectively.
  • the relative activity predicted by the k reaction depends on the concentration of MutS used for detection and the K D of MutS for the target DNA. Therefore, single point mutations can be identified using Muts of the same quality and quantity by this sNPS method.
  • the half-life of the response tells us about the time it takes for the binding of MutS to individual NPs to reach half of the maximum LSPR shift.
  • This information is, for example, as evidenced by the observation that MutS binds more strongly to purine-purine mutations (eg, identifiable GG and AA) than pyrimidine-pyrimidine mutations (eg, highly detectable TC), for example. This may help explain why purine-purine mutations in cells show better recovery than pyrimidine-pyrimidine mutations. These results also indicate that repair of AC and GA mutations is less effective since MutS has lower relative activity than TC.
  • the circle diameter of the target outputs information of its concentration; For example, the 8.25-nm diameter represents a 68.8-nM target according to the circle diameter (12 nm) of + C in the atlas, which is obtained at a standard concentration of 100 nM.
  • this sNPS system was applied to detect potential point mutations in the user-assigned genomic region.
  • Potential BRCA1 based on 43047665 on long arm region 2 band 1 of chromosome 17 Point mutations were assigned to diagnose ovarian cancer cell line, SNU251.
  • the chip was fabricated using the same Au-bridge NP with a new 64-bp probe.
  • a continuous shift of spectral peaks was observed, verifying the effect of sNPS with new probes to monitor specific intervals in the genes (FIG. 19).
  • input to the atlas of diagnostic results indicated that the mutation type was very similar to AC point mutations.
  • the single nanoparticle biosensor platform of the present invention is not only capable of detecting targets with high sensitivity and reliability, but also enables direct identification of various mutations, thereby enabling efficient mutation diagnosis, and thus can be widely used in biomedical diagnostic fields. .

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Analytical Chemistry (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Apparatus Associated With Microorganisms And Enzymes (AREA)

Abstract

본 발명은 두 개의 금속 나노시드(nanoseed) 사이에 생체분자가 고정된 금속 나노입자를 포함하는 단일 나노입자 바이오센서 플랫폼 및 이를 포함하는 바이오센서; 상기 바이오센서를 이용한 돌연변이의 검출 방법; 및 두 개의 금속 나노시드 사이에 생체분자가 고정된 금속 나노입자를 형성하는 단계를 포함하는 단일 나노입자 바이오센서 플랫폼의 제조 방법에 관한 것으로, 본 발명에 따른 단일 나노입자 바이오센서 플랫폼은 높은 민감도 및 신뢰도로 타겟 검출이 가능할 뿐만 아니라, 다양한 돌연변이의 직접적인 확인이 가능하고, 이에 따라 효율적인 돌연변이 진단이 가능한바, 생의학적 진단 분야 등에서 널리 활용될 수 있다.

Description

단일 금속 나노 브릿지 구조의 합성 방법 및 이를 이용한 DNA 점돌연변이 검출 센서 제작 방법
본 발명은 금속 나노 브릿지 구조를 포함하는 단일 나노입자 바이오센서 플랫폼 및 그 제조 방법에 관한 것으로, 구체적으로 두 개의 금속 나노시드(nanoseed) 사이에 생체분자가 고정된 금속 나노입자를 포함하는 단일 나노입자 바이오센서 플랫폼 및 이를 포함하는 바이오센서; 상기 바이오센서를 이용한 돌연변이의 검출 방법; 및 두 개의 금속 나노시드 사이에 생체분자가 고정된 금속 나노입자를 형성하는 단계를 포함하는 단일 나노입자 바이오센서 플랫폼의 제조 방법에 관한 것이다.
많은 질병들은 유전적 요소를 가지고 있다. 그러므로 생의학적 진단을 위해, 대사에 있어서 돌연변이에 의한 장애에 대하여 분명히 이해할 필요가 있다. 돌연변이 정보를 획득하기 위한 최적의 방법은 이상적으로는 표지 및 시험관내 환경에 의한 인공물에 대한 우려없이, 서열에 대한 사전 지식 없이, 변이체 염기의 존재와 동일성을 밝힐 수 있는 것이나, 대부분의 유전자 돌연변이의 진단은 시퀀싱 방법에 의존적이다. 나노플라즈몬(nanoplasmonic) 바이오센서에 의해, MMR(mismatch repair) 개시 단백질 MutS가 MutL 및 변이체 DNA를 복구하는 다른 효소들의 도입에 따라 서열 비-특이적 방식으로 돌연변이를 인식하는, 많은 생물체 내 복제 후 불일치 복구(MMR)의 정반대 시스템으로 이러한 방법을 발견하고자 노력해왔다(Ma, X., Truong, P. L., Anh, N. H. & Sim, S. J. Biosensors & Bioelectronics 67, 59-65 (2015)).
나노바이오센싱의 신뢰도는 일반적으로 두 가지 주요 요소에 의해 결정된다: 특정한 물리적 조건에 대한 검출 민감도 및 선택도와 직접적으로 관련되는, 단일 세대를 위한 나노물질 및 타겟 인식을 위한 생체분자. 입사광과 상호작용하고, 국소 표면 플라즈몬 공명(LSPR) 현상을 나타내는 능력으로, 나노물질 중에서 플라즈몬 나노입자가 관심을 끌고 있다. 나노구조체 내 공진 주파수에서의 전자의 공동 진동은 국소 굴절률(RI)의 변화를 흡수 및 산란 스펙트럼의 플라즈몬 밴드의 이동으로 변환시킨다. 센싱 규모는 하나의 단일 나노입자로 줄여질 수 있고, 이는 단일-나노입자 센싱(single-nanoparticle sensing, sNPS) 기술에 기여한다. sNPS 방법은 고유한 작은 센싱 부피를 이용하여 셀 수 있는 수의 분자에 도달하는 검출 한계(LOD)를 허용하는 나노미터 규모 상의 국소 생물학적 정보를 보고할 수 있다. 반대로, 많은 양의 용액 또는 평면 표면으로 구성된 대부분의 다른 기술들은 센싱 요소들을 위치화하고 분리하는데 어려움을 겪고, 느린 분자 확산, 확률론적인 결합, 복잡한 생체분자의 빈번한 분리를 겪는데, 따라서 평형을 벗어난 반응은 결국 신호-대-노이즈(signal-to-noise, S/N) 비가 낮은 신호 변동으로 이어진다. sNPS 센서는 나노입자의 구조 및 국소 센싱 부피/면적이 그 RI 민감도에 필수적인, 높은 처리량 및 병렬 판독기능을 갖춘 작은 프로브이다. 다양한 모양의 금 나노입자(NP)의 RI 민감도에 대한 체계적인 연구는 막대-유사 NPs가 RI의 변화에 가장 높은 민감도를 나타낸다는 것을 보여주었다(Truong, P. L., Ma, X. & Sim, S. J. Nanoscale 6, 2307-2315 (2014)). 최근 입자 모양 외에도 나노갭 및 나노브릿지의 구조가 플라즈몬 결합으로부터의 강한 광 신호와 관련되어 생성되며, 더욱이 국소 장 향상과 뚜렷한 스펙트럼 반응을 일으킨다는 것이 확인되었다(Lim, D. K., et al. Nature Nanotech. 6, 452-460 (2011); Nam, J. M., Oh, J. W., Lee, H. & Suh, Y. D. Acc. Chem. Res. 49, 2746-2755 (2016)). 그러나, 미리 정해진 구조를 가지는 콜로이드 플라즈몬 NP의 합성은 용액 내에 일시적으로 존재하는 원자를 조작하는 것이 어렵다는 점에서 매우 도전적인 것이며, 현재 합성된 NP는 동일한 표면으로 고도로 대칭되도록 제한된다(예, 나노구, 나노막대, 나노큐브, 나노디스크, 등). NP의 구조적 프로그램 가능성은 민감도 및 반복성에 있어서 sNPS의 제한을 해결하기 위한 강력한 수단을 제공할 수 있을 것이다. 최근 두 연구단이 DNA 몰드로 캐스팅하거나(Sun, W., et al. Science 346, 1258361 (2014)), 또는 DNA 프레임워크를 이용하여(Ma, X., et al. Nat Commun 7, (2016)), 정교한 나노플라즈몬 입자를 생성하기 위하여, 프로그래밍 가능한 생체분자, DNA를 이용하여, 5nm 이하의 정밀도로 설계 및 합성(synthesis-with-design)에 획기적인 발전을 이루었다.
sNPS는 핵산이나 단백질과 같은 생체분자의 크기와 비교할 수 있는, 고유한 작은 크기의 센싱 크기를 대부분 활용하는 다양한 응용 분야를 제공한다. 예를 들어, MutS 단백질은 크기가 125 Х 90 Х 55 Å이다. 그러므로, 단일 NP 상 MutS의 흡수는 표면 전자의 공동 진동 행동이 크게 달라져, NP의 스펙트럼에서 파장 이동을 일으킬 수 있다. 단일-점 돌연변이는 PCR 및 다른 DNA 칩-기반 분석에 근거해서는 거의 인식되지 않으므로, 불일치 DNA를 포함하는 MutS의 생물학적 상호작용의 특이성이 뉴클레오티드 다형성에 대한 연구를 촉진시켰다. 가장 광범위한 연구는 단일-분자 형광 공명 에너지 전달(smFRET)을 기반으로 한다; 그러나, 이 방법은 MutS 단백질을 표지하거나, DNA에서 방사성 동위원소를 포함하는 프로브를 제조하는 것과 같이, 노동집약적 단계를 필요로 한다. 원자력 현미경에 의한 단일-분자 이미징을 이용한 최근 연구는 매우 복잡하며, 생의학적 진단은 거의 적용이 불가능하다. 겔 이동도 이동 분석, 필터/칩 결합 분석, 뉴클레아제 보호, 표면 플라즈몬 공명(SPR), 전기화학적 분석 및 수정 진동자 저울에 의한 단일-점 돌연변이의 대량 측정은 분자 상호작용에 대한 실시간 정보의 출력도 없이, 효율성이 매우 낮고 시간이 많이 소요된다.
이에, 본 발명자들은 상술한 바와 같은 종래 기술의 문제점을 해결하고자 예의 노력한 결과, 금 나노시드와 결합하도록 DNA의 양 말단을 변형시키고 두 개의 반대 방향으로 금 결정화를 구현하여, 우수한 RI 민감도를 나타내는 구조인, Au-브릿지(bridged) 나노입자를 제조하고, 제조된 Au-브릿지 나노입자를 포함하는 단일 나노입자 바이오센서 플랫폼을 이용하여 높은 민감도 및 신뢰도로 타겟을 검출할 수 있을 뿐만 아니라, 다양한 돌연변이에 대한 MutS의 상대적인 활성에 따라 돌연변이를 직접 확인할 수 있다는 것을 확인하여, 본 발명을 완성하기에 이르렀다.
본 발명의 목적은 금속 나노 브릿지 구조를 포함하는 단일 나노입자 바이오센서 플랫폼 및 이를 포함하는 바이오센서를 제공하는데 있다.
본 발명의 다른 목적은 상기 바이오센서를 이용한 돌연변이의 검출 방법을 제공하는데 있다.
본 발명의 또 다른 목적은 두 개의 금속 나노시드 사이에 생체분자가 고정된 금속 나노입자를 형성하고 이를 이용하여 금속 나노 브릿지 구조를 제적하는 단계를 포함하는 단일 나노입자 바이오센서 플랫폼의 제조 방법을 제공하는데 있다.
상기 과제를 해결하기 위하여, 본 발명은 금속 나노 브릿지 구조를 포함하는 단일 나노입자 바이오센서 플랫폼 및 이를 포함하는 바이오센서를 제공한다.
본 발명은 또한 상기 바이오센서를 이용한 돌연변이의 검출 방법을 제공한다.
본 발명은 또한 두 개의 금속 나노시드 사이에 생체분자가 고정된 금속 나노입자를 형성하고 이를 이용하여 금속 나노 브릿지 구조를 제작하는 단계를 포함하는 단일 나노입자 바이오센서 플랫폼의 제조 방법을 제공한다.
본 발명에 따른 단일 나노입자 바이오센서 플랫폼은 높은 민감도 및 신뢰도로 타겟 검출이 가능할 뿐만 아니라, 다양한 돌연변이의 직접적인 확인이 가능하고, 이에 따라 효율적인 돌연변이 진단이 가능한바, 생의학적 진단 분야 등에서 널리 활용될 수 있다.
도 1은 단일 NP의 RI 민감도 분석을 나타내는 것으로, LSPR 파장은 주위 매질의 RI 변화에 대한 반응으로 이동한다. 오른쪽 표는 매질의 RI 값이다.
도 2는 AuNS-dsDNA-AuNS의 제조 및 특성화에 관한 것으로, a는 상이한 AuNS-ssDNA 복합체의 분리를 위한 겔 전기영동의 사진 이미지로, 각각의 밴드는 하나의 AuNS에 고정된 특정 수의 ssDNA를 나타낸다. 제일 왼쪽의 밴드는 DNA 결합이 없는 기본 나노시드를 나타낸다. b는 ssDNA 혼성화 후 AuNS-dsDNA-AuNS의 분리 및 확인을 위한 겔 전기영동의 사진 이미지이고, c는 AuNS-dsDNA-AuNS의 TEM 이미지이다.
도 3은 sNPS 시스템이다. a는 백색광 조사에 의한 단일 Au-브릿지 NP의 RLS 및 LSPR에 근거한 sNPS 시스템의 구체적인 구성을 나타낸다. b는 검출 챔버의 개략도이다. c는 카메라에 의해 얻은 챔버의 이미지이다. 빛나는 점의 직경 보다 ~5배 더 큰 입자간 공간을 가지는 개별 나노입자를 위치-표시하고 분석하였다. d는 챔버의 SEM 이미지이다. e는 10분 동안 분당 한번 얻은 Au-브릿지 NP의 원(raw) 스펙트럼을 나타낸다. f는 10개의 원 스펙트럼의 로렌치안 맞춤이 0.188nm의 피크 측정 정밀도를 입증함을 나타낸다.
도 4는 센싱 특이성을 나타낸다. a는 프로브를 이용한 MutS의 대조 실험 결과를 나타낸다. 단일 NP의 RLS 스펙트럼은 유효한 λ max 이동(0.356 nm 청색-이동)을 나타내지 않았다. b는 homoDNA를 이용한 MutS의 대조 실험 결과를 나타내며, 이는 λ max에서 0.343 nm 적색-이동을 나타내었다. c는 혈청 내 비특이적 성분을 이용한 변이 타겟 DNA(mDNA)의 대조 실험 결과를 나타낸다. RLS 스펙트럼은 유효한 λ max 이동(0.700 nm 적색-이동)을 나타내지 않았다. d는 MutS의 혈청으로의 도입은 c에서와 동일한 검출 조건 하에서 14.7-nm 적색-이동을 현저히 생성하였다.
도 5는 제한 효소의 활성 부위를 나타내는 서열이다. MboI, 5'-GATC-3'; AluI, 5'-AGCT-3'; StyI, 5'-CCWWGG-3'.
도 6은 효소 MboI, AluI 및 StyI에 의한 제한 소화 후의 상이한 세포주의 BRCA1의 계산된 단편화 지도이다. 분석에 소프트웨어 GENETYX 4.0(Genetyx Coportation, 도쿄, 일본)을 사용하였다.
도 7은 세 가지 제한효소에 의한 상승적 소화 전후의 BRCA1 DNA의 아가로스 겔 전기영동 결과를 나타낸다(제일 오른쪽에 나타낸 DNA 사다리). 게놈 DNA를 유방암 세포주 MCF7 및 HCC1937, 그리고 난소암 세포주 SNU251로부터 추출하였다.
도 8은 개별 나노입자의 공명 관심장(FOI)를 나타낸다. a는 Au-브릿지 NP의 MutS 로딩을 위한 FOI 및 이용가능한 공간의 개략도이다. b는 CCD 이미지의 규모 검정으로, 하나의 픽셀의 길이는 0.42μm이다. c는 FOI의 높이( h)를 나타낸다. d는 LSPR 피크 이동의 주기성을 나타낸 것으로, 녹색으로 표시된 영역은 단거리 굴절률 센싱 영역이며, 여기서 매질 농도 변화의 함수로서 LSPR 파장 이동을 설명하기 위하여, 식 △λ max = m△ n[1 - exp(-2 d)/ L)]을 사용할 수 있다. 이 식은 장거리 LSPR 센싱에 적용하지 않으므로, 도식적 곡선은 장거리 LSPR의 진동 행동(예, 부조화 특성)의 실제 프로파일을 고려하지 않았다.
도 9는 높은 민감도 및 충실도의 단일 NP 바이오센서의 제작을 나타낸다. a는 단일 점 DNA 돌연변이를 식별하기 위한 sNPS의 개략적 삽화이다. b는 Au-브릿지 NP의 대표적인 RLS 스펙트럼 및 원 위치(in-situ) 암장 현미경 이미지이다. 규모 막대, 1 μm. c는 DNA 및 MutS 결합 시 LSPR λ max 이동을 나타낸다. b 및 c에 대해 동일한 선 범례. d는 분자 결합의 각 단계(1, 2 및 3)을 나타낸다. 삽화는 CCD 카메라로 얻은 단일 NP의 실시간 이미지이다. e는 적절한 신호 반응에 대한 MutS의 농도이다. 검정 곡선은 △λ max 및 다양한 농도의 MutS 사이의 선형 관계를 나타낸다. f는 변이 DNA 타겟의 LOD이다. 검정 곡선은 △λ max 및 다양한 농도의 타겟 DNA 사이의 선형 관계를 나타낸다.
도 10은 Au-브릿지 NP 당 프로브의 평균 로딩 수( N *)의 추정을 나타낸다. 나노입자를 실린더(황색)에 의해 브릿지된 두 개의 구(회색)으로 모델링하였다; DNA 발자국이 가장 높은 로딩 밀도 및 서로 가장 가까운 거리의 입자에 균일하게 분포된 것으로 추정하였고, 따라서, 구 상의 원형 면적 및 실린더의 타원형으로 모델링하였다. 전체 면적에 대한 "유효 로딩의 가장자리"의 선 위의 표면 면적의 비율은 (180° - 73°)/180°=59.4%에 가깝다.
도 11은 용액 내 공명 NP의 설계에 의한 합성을 나타낸다. a는 수치 시뮬레이션에 의해 만들어진 설계된 NP 모델(상단; 치수 단위, nm) 및 플라즈몬 공명 전기장 패턴(하단)의 삽화이고, b는 LSPR 파장 이동에 대한 선형 맞춤 대 NP 주변의 RI 변화이고, c는 NH 3OH +로 AuCl 4 -를 환원시킴에 따른 Au 원자의 방향-특이적, 등고선-추종 및 형태-제어된 결정화의 초기 단계를 나타내는 개략도이다. DNA의 물 계면은 pH 5 및 4에서 합성 조건 하 정밀한 제어성을 제공하며, 이는 TEM 이미지에 나타난 바와 같이, 각각 나노브릿지 및 나노갭을 가진 NP를 생성한다. 규모 막대, 20 nm. d는 AuNS 및 Au-브릿지 NP의 X-선 회절 스펙트럼이며, e는 DNA-지향 나노결정의 HR-TEM 이미지 및 선택된 영역의 고속 푸리에 변환 패턴(오른쪽)이다. 규모 막대, 10 nm.
도 12는 Au-브릿지 NP의 크기 분포를 나타낸다. 나노구조물의 길이 및 직경을 ImageJ를 이용하여 측정하였다. 통계적 결과는 좁은-크기 분포를 증명하였다.
도 13은 8개의 단일 점 돌연변이의 식별가능한 검출을 나타낸다. a는 각각의 변이 DNA 및 호모듀플렉스에 대한 MutS 결합의 실시간 모니터링 결과이고, b는 MutS 및 각각의 점 돌연변이 사이의 상호작용의 속도 상수의 재구성 결과이다.
도 14는 센싱의 신뢰도를 나타낸다. a는 다양한 농도의 MutS의 GT-변이 DNA에의 결합의 실시간 모니터링 결과이고, b는 MutS 농도에 대한 속도 상수의 의존도를 나타낸다.
도 15는 상이한 점 돌연변이에 대한 MutS 친화도의 아틀라스이다. MutS 및 8개의 상이한 돌연변이 사이의 여러 결합 사건을 센싱하는 단일 Au-브릿지 NP에 의해 아틀라스를 확립하였다. 인간 유방암 세포 HCC1937 및 난소암 세포 SNU251 유래 BRCA1에서 잠재적인 돌연변이의 존재 및 유형의 정보에 대한 진단 결과를 아틀라스에 입력하여, 각각 +C 및 A-C 돌연변이를 예측하였다.
도 16은 본 발명에서 개발한 8개의 sNPS 칩을 이용한 BRCA1 점 돌연변이의 진단 결과를 나타낸다. 인간 유방암 세포주, HCC1937 유래 샘플을 분석물로서 검출하였고, MCF7 유래 샘플을 대조군으로서 사용하였다. 임상 샘플은 모니터링 동안 더 큰 △λ max 파동을 생성하였다; 그러나, 5382insC를 제외하고, 칩 중 어느 것도 효과적인 k reaction을 산출하지 않았는데, 이는 분석물이 단일 시토신 복제를 포함한다는 것을 나타낸다.
도 17은 5382insC 프로브를 이용한 세포주 HCC1937의 BRCA1의 세 번의 검출 결과를 나타낸다. 상이한 점 돌연변이에 대한 MutS 친화도의 아틀라스에의 0.0573의 k reaction 평균 값을 입력하여 타겟 내 "+C" 돌연변이를 예측하였다.
도 18은 DNA 시퀀싱 결과이다. 세포주 MCF7(점 돌연변이가 없는 음성 대조군)의 BRCA1 서열과 비교하여, HCC1937의 서열은 단일 시토신 삽입을 나타내었다.
도 19는 난소암 세포주 SNU251 유래 DNA 샘플의 사용자-할당 게놈 영역 내 점 돌연변이의 진단을 나타낸 것이다. 염색체 17의 긴 팔의 영역 2 밴드 1 상의 43047665에 위치한 타겟을 세 번 분석하였다. 상이한 점 돌연변이에 대한 MutS 친화도의 아틀라스에 0.0320의 k reaction 평균 값을 입력하여 타겟 내 AC 돌연변이를 예측하였다. 각 그림의 삽화는 MCF7 세포 유래 샘플을 검출하기 위한 대조 실험 결과를 나타낸다.
도 20은 DNA 시퀀싱 결과이다. 세포주 MCF7(점 돌연변이가 없는 음성 대조군)의 BRCA1 서열과 비교하여, SNU251의 서열은 단일 G>A 치환을 나타내었다.
다른 식으로 정의되지 않는 한, 본 명세서에서 사용된 모든 기술적 및 과학적 용어들은 본 발명이 속하는 기술 분야에서 숙련된 전문가에 의해서 통상적으로 이해되는 것과 동일한 의미를 가진다. 일반적으로, 본 명세서에서 사용된 명명법은 본 기술 분야에서 잘 알려져 있고 통상적으로 사용되는 것이다.
본 발명은 일 관점에서 금속 나노 브릿지 구조, 구체적으로 두 개의 금속 나노시드(nanoseed) 사이에 생체분자가 고정된 금속 나노입자를 포함하는 금속 나노 브릿지 구조체 및 이를 포함하는 단일 나노입자 바이오센서 플랫폼에 관한 것이다.
본 발명은 다른 관점에서 두 개의 금속 나노시드 사이에 생체분자가 고정된 금속 나노입자를 형성하는 단계; 및 형성된 금속 나노입자를 이용하여 금속 나노 브릿지 구조를 제작하는 단계를 포함하는 단일 나노입자 바이오센서 플랫폼의 제조 방법에 관한 것이다.
본 발명에 있어서, 상기 금속은 바람직하게는 금(Au), 구리(Cu), 백금(Pt) 및 팔라듐(Pd)으로 구성된 군에서 선택된 어느 하나이고, 더욱 바람직하게는 금(Au)인 것을 특징으로 할 수 있다.
본 발명에 있어서, 상기 금속 나노시드는 나노구(nanosphere), 나노막대(nanorod), 나노프리즘(nanoprism) 및 나노판(nanoplate)으로 구성된 군에서 선택된 하나인 것을 특징으로 할 수 있다.
본 발명에 있어서, 상기 생체분자는 단일가닥 DNA, 이중가닥 DNA, DNA 올리고머, RNA 올리고머, 플라스미드 DNA, 폴리펩티드 및 단백질로 구성된 군에서 선택된 하나인 것을 특징으로 할 수 있고, 바람직하게는 이중가닥 DNA인 것을 특징으로 할 수 있다.
본 발명에 있어서, 상기 금속 나노시드는 직경이 바람직하게는 25 nm 이하인 것을 특징으로 할 수 있다.
본 발명에 있어서, 상기 생체분자는 길이가 바람직하게는 30 nm 이하인 것을 특징으로 할 수 있다.
본 발명에 있어서, 상기 단일 나노입자 바이오센서 플랫폼의 제조방법은 형성된 금속 나노입자 표면에 금속이온이 환원제에 의해 환원되면서 성장하는 단계를 더 포함하는 것을 특징으로 할 수 있다.
본 발명에 있어서, 상기 환원제는 수산화아민(NH 2OH)인 것을 특징으로 할 수 있으나, 이에 한정되는 것은 아니다.
본 발명은 또 다른 관점에서 상기 단일 나노입자 바이오센서 플랫폼을 포함하는 바이오센서에 관한 것이다.
본 발명에 있어서, 상기 바이오센서는 단백질, 바람직하게는 불일치 복구 개시 단백질(mismatch repair initiation protein, MutS)을 포함하는 것을 특징으로 할 수 있다. MutS는 핵산 분자에 있어서의 불일치를 인식하고, 그 불일치 부위에 결합하는 것이 가능한 단백질을 의미하는 것으로, 불일치를 인식할 수 있는 한 야생형 단백질의 아미노산 서열에서 하나 이상의 아미노산이 치환, 결실, 부가 및/또는 삽입된 아미노산 서열로 이루어지는 단백질을 포함하는 것이다.
본 발명에 있어서, 상기 바이오센서는 나노막대 보다 높은 RI(Refractive index) 민감도를 갖는 것을 특징으로 할 수 있다. RI 민감도는 입자 주변 매질의 굴절률 대비 LSPR 피크 이동(shift)의 상대적인 차이를 비교한 것이다. 본 발명의 일 실시예에 따르면, 기존에 RI 민감도가 가장 높다고 알려진 나노막대 보다 본 발명의 금속 나노 브릿지 구조체의 RI 민감도가 더 높은 것을 확인할 수 있다.
본 발명에 있어서, 상기 바이오센서는 돌연변이, 특히 점 돌연변이 검출에 사용되는 것을 특징으로 할 수 있다.
본 발명에 있어서, 상기 바이오센서를 이용하여 샘플 내 BRCA1 돌연변이의 종류를 특정할 수 있는 것을 특징으로 할 수 있다.
본 발명은 다른 관점에서 상기 바이오센서를 이용한 돌연변이, 특히 점 돌연변이의 검출 방법에 관한 것이다.
본 발명에 있어서, 상기 돌연변이의 검출 방법은 단백질, 바람직하게는 불일치 복구 개시 단백질(MutS)과 돌연변이 핵산분자의 결합 분석에 의해 돌연변이를 확인하는 것을 특징으로 할 수 있다.
[실시예]
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 예시하기 위한 것으로, 본 발명의 범위가 이들 실시예에 의해 제한되는 것으로 해석되지 않는 것은 당업계에서 통상의 지식을 가진 자에게 있어서 자명할 것이다. 따라서 본 발명의 실질적인 범위는 첨부된 청구항들과 그것들의 등가물에 의하여 정의된다고 할 것이다.
실시예 1: 단일 나노입자 센싱 플랫폼의 제조 및 이를 이용한 점 돌연변이의 검출 방법
1-1: 재료
금 나노시드(AuNS; 5nm) 용액(British BioCell International, Crumlin, UK), 세척 및 저장 버퍼(10 mM PBS with 0.02% NaN 3, 0.01% Tween 20, 0.1 % BSA, pH 7.4; Catalog #: WB-100, Ocean NanoTech, San Diego, CA, USA), 디티오트레이톨(DTT, Promega, Madison, WI, USA) 및 제한 효소 StyI(#R648A, Promega, Madison, WI, USA), 원심분리장치(Microsep ® and Nanosep ®, Pall Life Sciences, Inc., Ann Arbor, MI, USA), 및 2-{2-[2-(2-{2-[2-(1-머캅토운데크-11-일옥시)-에톡시]-에톡시}-에톡시)-에톡시]-에톡시}-에틸아민 하이드로클로라이드(2-{2-[2-(2-{2-[2-(1-mercaptoundec-11-yloxy)-ethoxy]-ethoxy}-ethoxy)-ethoxy]-ethoxy}-ethylamine hydrochloride, OEG; Cos Biotech, 대전, 한국)을 사용하였다. 호열성 박테리아 유래 테르무스 아쿠아티쿠스( Thermus aquaticus) MutS 단백질(Nippon Gene Co., Ltd., Tokyo, Japan)을 -20℃에서 100 mM NaCl, 0.1 mM EDTA, 1 mM DTT 및 50% 글리세롤과 20 mM Tris-HCl 버퍼(pH 7.5)에 보관하였다. G-spin TM Total DNA Extraction Kit(#17046)을 iNtRON Biotechnology(경기도, 한국)로부터 공급받았다. 제한 효소 MboI(#R0147) 및 AluI(#R0137)은 NEB(Hitchin, Hertfordshire, UK)로부터 얻었다. 글리코겐(#901393)은 Roche(Indianapolis, IN, USA)로부터 얻었다. 폴리(에틸렌 글리콜) 메틸 에테르 티올(PEG, Mn = 800), 혼성화 버퍼, 단일-가닥 결합 단백질 포함 혼성화 세척 팩 및 모든 다른 화학 시약들은 Sigma-Aldrich(Saint Louis, MO, USA)에서 구입하여, 추가 정체 없이 사용하였다. 실험에 사용된 모든 유리제품은 사용 전에 왕수(aqua regia) 용액으로 세척하고 초순수(18.2 mΩ·cm - 1)로 헹구어 사용하였다. 사용된 모든 올리고뉴클레오티드는 Integrated DNA Technologies, Inc.(Coralville, IA, USA)에서 구입하였다. 점 돌연변이 8 DNA 타겟의 서열은 하기 표 1에 기재하였다. 아울러, 호모듀플렉스에 상응하는 완벽히 일치하는 서열은 다음과 같다: ATTGAAAGTTGCAGAATCTGCCCAGAGTCCAGCTGCTGCTCATACTACTGA. 단일가닥 DNA(ssDNA)의 지정명(assigned name) 및 정보는 하기 표 2와 같다. DNA 타겟 및 프로브의 서열은 하기 표 2와 같다.
돌연변이 명 a 게놈 위치 b 대립형질 ID 뉴클레오티드 변이체 유형 염기 쌍 기능적 결과 집단 DNA 서열 c
4956A>G GRCh38, 17:43071077..43071077 50266 단일 치환 A>G G*-T 단백질 변화: S1613G, S1634G, S509G 전세계 ATTGAAAGTTGCAGAATCTGCCCA GGGTCCAGCTGCTGCTCATACTACTGA
IVS6-3C>G GRCh38, 17: 43104264..43104264 46057 단일 치환 C>G G*-G 변칙적 스플라이싱 및 조기 번역 및 절단된 단백질 유도 전세계 ACATAATGTTTTCCCTTGTATTTTA GAGATGCAAACAGCTATAATTTTGCA
5075G>A GRCh38, 17:43070958..43070958 50269 단일 치환 G>A A*-C 단백질 변화: M1652I, M1625I, M548I, M1673I 전세계 AAAGGGTCAACAAAAGAATGTCCAT AGTGGTGTCTGGCCTGACCCCAGAAG
IVS18+1G>T GRCh38, 17: 43063873.. 43063873 70090 단일 치환 G>T T*-C 스플라이싱 공여 변이체 전세계 GGAAAATGGGTAGTTAGCTATTTCT TTAAGTATAATACTATTTCTCCCCTC
5632T>A GRCh38, 17: 43045757..43045757 70278 단일 치환 T>A A*-A 단백질 변화: V1838E 전세계 GCACCTGTGGTGACCCGAGAGTGGG AGTTGGACAGTGTAGCACTCTACCAG
300T>G GRCh38, 17: 43106487.. 43106487 32700 단일 치환 T>G G*-A 단백질 변화: C61G 아프리카, 미국 및 유럽 CAACCAGAAGAAAGGGCCTTCACAG GGTCCTTTATGTAAGAATGATATAAC
5382insC GRCh38, 17: 43057065.. 43057065 32716 단일 중복 +C 프레임이동 변이체, nc 전사 변이체 전세계 CAAGGTCCAAAGCGAGCAAGAGAAT [C]CCCAGGACAGAAAGGTAAAGCTCCC
2594delC GRCh38, 17: 43093056.. 43093056 46028 단일 결실 -C 프레임이동 변이체, 인트론 변이체, nc 전사 변이체 중앙 유럽에서 유래, 북유럽에서 가장 일반적 변화 GTTGTTCCAAAGATAATAGAAATGA
Figure PCTKR2019010370-appb-img-000001
ACAGAAGGCTTTAAGTATCCATTGG
aBIC (Breast Cancer Information Core): http://research.nhgri.nih.gov/bic/. Nucleotide number according to GenBank U14680.1. http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nucleotide&val=555931
bhttp://www.ensembl.org
c돌연변이 지점 전후의 가각 25개의 뉴클레오티드(돌연변이 뉴클레오티드는 굵은 글씨로 표시)
지정명 서열(5'-3') 5'-변형
ssDNA-1 GCAGTAACGCTATGTGACCGAGAAGGATTCGCATTTGTAGTCTTGAGCCCGCACGAAACCTGGACACCCCTAAGCAACTCCGTACCAGATGGGAACAGCA 티올
ssDNA-2 TGCTGTTCCCATCTGGTACGGAGTTGCTTAGGGGTGTCCAGGTTTCGTGCGGGCTCAAGACTACAAATGCGAATCCTTCTCGGTCACATAGCGTTACTGC 티올
homoDNA ATTGAAAGTTGCAGAATCTGCCCAGAGTCCAGCTGCTGCTCATACTACTGA 없음
새로운 64-bp probe GAAGCCATTGTCCTCTGTCCAGGCATCTGGCTGCACAACCACAATTGGGTGGACACCCTGGATC 티올
1-2: NP 모델링 및 수치 시뮬레이션
구(sphere), 막대(rod) 및 이합체(dimer) 형태의 나노구조체의 모델링 및 광학 시뮬레이션을 수행하고, 소프트웨어 COMSOL을 사용하여 NP를 브릿지화하였다. NP의 조성은 금이고, 입자 크기는 비교를 위해 동일하게 조정하였고, 최종 크기(dimension)는 실험에서 합성된 제작물을 참조하였다. 광학 시뮬레이션은 다양한 중량비의 물-글리세롤 혼합물이 주변 매질의 RI를 1.333 내지 1.443까지 변화시키도록 설정된 국부 유전 환경에서 수행하였다(도 1).
1-3: AuNS의 ssDNA와의 접합
5'-티올 변형된 올리고뉴클레오티드 모두를 올리고뉴클레오티드의 OD 대 DTT 용액의 비율 1:100으로 15분 동안 DTT로 배양하고 에틸 아세테이트로 2회 정제하였다. 5'-티올의 이황화결합을 활성 설프히드릴 형태로 분해하고 즉시 금 표면과 결합하는데 사용하였다. 용액 내 DNA와 AuNS의 접합 전에, 고이온 환경에의 AuNS의 내성을 향상시키기 위하여, AuNS를 비스(p-설포네이토페닐)페닐포스파인 디하이드레이트 디포타슘(BSPP; 100mL의 AuNS 용액을 100mg BSPP와 10시간 동안 혼합)으로 코팅하였다. 그 후, AuNS 용액을 NaCl과 혼합하자 색이 어두운 적색에서 밝은 보라색으로 변하였다. 용액을 500 x g에서 30분 동안 실온에서 원심분리하고, 이어서 1mL의 0.5mM BSPP에서 침전을 재부유하였다. 0.5mL의 메탄올 첨가에 의해 용액의 색은 다시 어두운 붉은 색에서 밝은 보라색으로 변하였고, AuNS를 원심분리(30분, 500 Хg) 후에 회수하여 1mL의 0.5 X TBE 버퍼에 용해시켰다. 자외선-가시광선-근적외선 분광광도계(UV-3600; Shimadzu, 교토, 일본)로 측정하였을 때, AuNS의 농도가 몇 μM 정도로 증가하였다; 제조자의 지시에 따를 때, 5 nm AuNS의 1 OD는 마이크로미터 당 5.00 X 10 13과 동일하다. AuNS를 50mM NaCl을 함유하는 0.5 X TBE 버퍼에서 1의 화학량비로 ssDNA-1과 밤새 실온에서 배양하였다. 그 후, 10% 글리세롤을 함유하는 최종 혼합물을 만들기 위해 용액에 60%의 글리세롤을 첨가하였는데, 이는 AuNS-ssDNA가 겔 전기영동 시 버퍼에 확산되는 것을 막는다. 0.5 X TBE 버퍼에서 10 V/cm에서 1시간 동안 3% 아가로오스 겔로 수행된, 겔 전기영동은 상이한 ssDNA 결합 수를 가지는 AuNS를 상이한 밴드로 분리하였다(도 2). 1 가닥 ssDNA와 결합된 AuNS(AuNS-1ssDNA-1)의 밴드는 추가 사용을 위해 0.5 X TBE 버퍼에 담가 두었다. 동일한 배양 및 분리 공정을 AuNS-1ssDNA-2를 생산하기 위해, AuNS의 ssDNA-2와의 결합물에도 수행하였다.
1-4: 나노구조체의 방향성 합성(Synthesis-with-direction)
금 전구체(HAuCl 4, 0.03%) 및 환원제(NH 2OH·HCl, 1 mM)를 각각 물에 용해시키고, 각각의 용액의 pH를 질소 환경에서 NaOH를 서서히 첨가하여 5 또는 4(± 0.1)로 조정하였다. DNA-유도 합성을 위한 시드(seed)를 AuNS-1ssDNA-1의 AuNS-1ssDNA-2와의 혼성화로, AuNS-dsDNA-AuNS 형태로 제조하였다. 혼성화 효율을 증가시키기 위하여, 0.5 X TBE에서 두 결합물을 동일한 양으로 혼합하고, 이온강도를 강화하기 위하여 NaCl을 100 mM까지 첨가하였다. 혼합물을 37℃에서 밤새 휘저어, AuNS-dsDNA-AuNS를 겔 전기영동으로 분리하였다(상술한 것과 동일한 공정; 도 2). AuNS-dsDNA-AuNS를 함유하는 겔을 PEG 대 시드의 최종 몰비 100:1로 50mL의 세척/저장 버퍼에 담가 두었다. 용액을 원심분리 튜브(molecular weight cut-off 30K, MWCO 30K, 3000 Хg)로 정제하고 농축하였고, 따라서 시드가 중성 PEG 층에 의해 보호되어 안정성을 향상시키고, 하전된 분자의 AuNS 표면 상의 비-특이적 흡수를 감소시켰다. 시드를 최종 농도 2nM으로 10분 동안 금 전구체와 함께 부드럽게 저어가며 섞었다; 용액 10 μl를 17.54 μL의 환원제와 혼합하고, 무색에서 옅은 적색으로의 색 변화를 1분 내에 관찰하였다. 15분 후, 합성된 NP를 반복된 원심분리 및 수중 재부유로 씻어내었다. NP의 TEM 및 HR-TEM 이미지를 300 kV의 가속 전압에서 z-대비(contrast) 및 SE 모드의 Hitachi HD2300 투과 전자 현미경으로 관찰하였다. TEM용 표본은 EMS 염색 플레이트(Electron Microscopy Sciences) 및 탄소 필름을 구비한 400-메쉬 구리 TEM 그리드(Ted Pella)를 이용하여 제조하였다. TEM의 평면에서 나노구조물의 길이 및 직경을 ImageJ 소프트웨어를 이용하여 측정하였다. 20 nm 및 50 nm의 규모 막대의 TEM 이미지는 정밀한 측정에 충분히 큰 나노구조물을 나타내었다. 입자 수율은 Au-브릿지 NP의 전체 입자에 대한 비율로 계산하였다. 원하지 않는 입자는 대형 또는 소형 브릿지-나노입자로, 그리고 합성 반응 동안 AuNS-dsDNA-AuNS로부터 변성된 AuNS-ssDNA로부터 성장한 나노구로서, 쉽게 구별되었다(Ma,X., et al., Nat Commun 7, 12873, 2016). 결정 구조 및 성장 방향을 확인하기 위하여, HR-TEM 이미지의 FFT 패턴을 Digital Micrograph 소프트웨어(Gatan, Pleasanton, CA, USA)로 분석하였다.
1-5: sNPS 플랫폼의 설정
sNPS 시스템의 전체 구성을 도 3a에 나타내었다. 검출 챔버를 제작하기 위하여, First Contact 클리닝 고분자(Photonic Cleaning Technologies)를 현미경 유리 슬라이드(22 Х 40 Х 0.1 mm; Warner Instruments)에 바르고, 15분 동안의 큐어링 후에 즉시 벗겨내었다. 그 후 슬라이드를 왕수 용액을 이용하여 밤새 깨끗이하고, 초순수로 헹구고, 무수 에탄올 내 5% (v/v) 3-아미노프로필트리에톡시실란에 살짝 담그고, 초순수에서 5분 동안 초음파 처리하였다(3회 반복). 3μl의 희석된 Au-브릿지 NP 용액(OD ~0.05)를 실란 처리된 슬라이드에 떨어뜨렸다. 실온에서 1분 동안 배양한 후, 공기 중의 잔해에 의한 오염을 최소화하기 위하여 생물학적 후드에서 초순수와 물로 씻었고, 마지막으로 질소 가스로 말렸다. 슬라이드를 폐쇄-배스(bath) 이미징 미세유체 챔버(RC-30, Warner Instruments)에 고정시켰다. 챔버를 단계 제어기(stage controller; Marzhauser Sensotech, Wetzlar, Germany)에 조립하고, 급속 난류 용액 혼합을 가능하게 하는 흐름 장치 및 유속 제어 플랫폼(PHD 2000, Harvard Apparatus, Holliston, MA, USA)과 연결하였다. 챔버 내 각각의 NP의 이미지 및 레일리 산란 특성을 센싱 시스템으로 확인하였다(도 3b). 100 W 할로겐 소스(Type 7724, 필립스), 암-시야 콘덴서(건식 콘덴서, NA = 0.80-0.95, 니콘) 및 100 X 대물렌즈(CFI Plan Fluor ELWD, NA = 0.6, 니콘)가 구비된 역현미경(Eclipse TE2000-U, 니콘)의 시야를 컬러 카메라(D50, 니콘, 도쿄, 일본)로 찍었고, 입자간 공명 결합의 영향을 최소화하기 위하여, 빛나는 점의 직경보다 ~5배 큰 입자간 간격을 갖는 개별 나노입자만을 분석하였다(도 3c). 챔버 유래 이미지는 100-ms 프레임 적분시로 -70℃에서, 전하-결합 장치(CCD) 카메라 (PIXIS: 400B, Princeton Instruments, Trenton, NJ, USA)에 초점을 맞추었다. 현미경 출력 포트의 빔 스플리터와 롱 패스 필터를 CCD 앞에 두었다. 플랫폼은 18℃ 암실에서 RLS 분광기(Microspec 2300i, Roper Scientific, Montagne Sud-8, rue du Forez, France)를 이용한 챔버 내 각각의 NP의 레일리 빛 산란(RLS)의 결정을 허용하였다. 300-900 nm의 범위의 스펙트럼을 이어서 1초 획득시간으로 기록하였다. 스펙트럼 데이터는 노이즈를 제거하기 위한 로렌치안(Lorentzian) 알고리즘에 적합하였고, 정확한 λ max를 Origin2018 소프트웨어(OriginLab, Northampton, MA, USA)로 측정하였다. 동일한 나노입자로부터 분당 한번 얻어진 10개의 스펙트럼을 분석하기 위한 이러한 방법의 적용으로 0.188 nm의 피팅-제한 피크 측정 정밀도를 얻었다(도 3e 및 f). 피크 위치의 변동은 분광계 해상도, 챔버 내 물리적 균일성, 액체의 온도 및 유속의 일시적 변화, 및 현미경 초점 제어, 스펙트럼 소스 보정, 노출된 픽셀 선택 및 공간 평균화와 같은 분석적 요인을 포함한, 기기 요인에 기인한다. 0.188nm의 변동 이외에, 168개 나노입자의 임의의 검출 중 전체 실험 피크 불확정성은 0.487 nm인데, 여기서 0.299-nm 차이가 크기, 모양 및 배향의 나노입자 인자로부터 초래된 것이다.
1-6: 점 돌연변이의 검출
sNPS 플랫폼에 유리 슬라이드를 고정시킨 후, 오염원과 결합되지 않은 AuNP를 제거하기 위하여, 5분 동안 75% 에탄올을 주입하고 이어서 세척/저장 버퍼로 20분 동안 씻어, 챔버를 헹구었다. 챔버의 사진을 찍은 후 Au-브릿지 NP의 위치를 표지하고 기록하였다. 하나의 NP가 하나의 배치(batch)의 검출에 책임이 있으며, 그 광학 특성은 분자 결합의 각각의 단계에 대해 검출되었다. 챔버를 실온에서 8시간 동안 100nM의 프로브 DNA(예, 프로브-GT)로 채우고, 5분 동안 세척/저장 버퍼로 씻어내고, 3시간에 걸쳐 혼성화 버퍼에서 특정 농도로 표적 DNA(예, 4956A>G)를 도입하였다. 결합되지 않은 모든 타겟은 타겟 농도로 MutS 용액을 주입하기 전에, 혼성화 세척 팩으로 헹구었다. MutS의 DNA와의 결합을 18℃에서 1 μL/분의 유속으로 결합 버퍼(pH 7.5; 100 mM NaCl, 1 mM DTT, 0.1 mM EDTA, 및 5 mM MgCl 2)에서 수행하였다. 일반적인 검출을 위해, 100 nM 타겟 DNA를 챔버 내 Probe-GT로 포획하였고, 20nM MutS 단백질과 2분 동안 반응시켰다. CCD에 의한 단일 NP의 실시간 이미징 및 분광기에 의한 RLS 스펙트럼을 소프트웨어 WinSpec(Roper Scientific)로 기록하고 처리하였다. 프로브(타겟 결합 없음) 및 DNA 호모듀플렉스(homoDNA; 변이 없음)와의 MutS 상호작용을 조사하기 위하여, 동일한 검출 조건 하에서 대조군 실험을 수행하였다. 비특이적 단백질(MutS 없음)과의 DNA 상호작용에 대한 조사를 위해, GT 변이를 가진 타겟 DNA의 주입 후에 인간 혈청을 도입하였다. 스펙트럼 분석 후에, 단백질을 제거하기 위하여, 30분 동안 95℃에서 챔버를 세척/저장 버퍼로 헹구었다. 20 nM MutS를 포함하는 동일한 혈청 용액을 동일한 타겟 포획 후에 챔버에 주입하였고, 그 후 추가 분석을 위해 스펙트럼을 다시 기록하였다(도 4).
1-7: 세포주 유래 샘플의 제조 및 검출
게놈 DNA를 G-spin TM Total DNA Extraction Kit를 이용하여 추출하고, 정제 및 추가 제한 소화 전 30분 동안 55℃에서 200 ng/ml 단백질분해효소 K 및 10 ng/ml RNase A를 처리하였다. 50-60 bp 뉴클레오티드를 생성시키기 위하여, 제한효소 Mbo I, Alu I 및 Sty I로 소화를 수행하였다. 구체적으로, Mbo I 및 Alu I에 의한 소화는 100-500 bp의 단편을 생성시켰다. BRCA1에 Sty I 부위가 있으므로, ~50 bp 길이의 타겟 샘플에 대하여, 단편을 추가로 Sty I에 의해 소화시켰다. 효소의 특이적 부위 및 계산된 단편화 지도는 도 5 및 6에 나타내었다. 효과적으로 DNA를 수집하기 위하여, 글리코겐을 에탄올 침전 동안 첨가한 후, 13000 rpm에서 15분 동안 원심분리하였다. DNA의 농도 및 순도를 Nano-200 Micro-Spectrophotometer DC24V(#AS-11030-00; Allsheng Instrument, 항저우, 중국)을 이용하여 평가하였다. 300ng DNA 샘플이 2.5 V·cm-1, 4℃에서 0.7% 아가로오스 겔에 로딩되고, 0.5% 브롬화 에티디움으로 염색되고, Davinch-GelTM Gel Imaging System(영화과학, 서울, 한국)을 이용한 UV 조명으로 검출한, 겔 전기영동에 의해, DNA의 완전성을 평가하였다(도 7); 30μl의 뉴클레오티드를 90℃에서 1분 동안 단일-가닥 타겟에 녹이고, 70℃에서 5분 동안 혼성화 버퍼가 채워진 sNPS 챔버에 주입하였다. 이어서, 18℃에서 1μl/분의 유속에서 결합 버퍼 내 20 nM MutS 용액을 도입하기 전에, 팸버를 혼성화 세척 팩으로 헹구었다. SNU251 세포주 유래 샘플의 진단을 위해, 새로운 64-bp 프로브를 설계하였다(1-1: 재료 참조). 실시간 RLS 스펙트럼을 기록하고, 피크 위치를 상술한 바와 같이 500-650 nm의 파장 범위에서 분석하였다.
1-8: 개별 NP의 공명 관심 장(field of interest, FOI)의 설명
개별 나노입자의 공명 FOI는 굴절률 변화에 대한 공명 민감도의 유효 공간으로 정의되는데, 여기서 λ max 내 적색-이동의 진폭에 정비례하는 분자 농도를 계산하기 위하여, 식 1(하기 1-10: 데이터 분석 참조)을 적용할 수 있다. FOI는 장방형이었다(도 8a). FOI의 이차원 영역은, rm 길이 및 넓이가 규모 검정을 근거로 3.36μm로 측정된(도 8b), 센싱 시스템(도 9d)의 WinSpec 소프트웨어에 의한 CCD 이미지에서 8 픽셀로 직접적으로 설명되었다. 이러한 이차원 영역의 길이 및 넓이는 스펙트럼 모니터링 전에 세팅되었고, 모든 검출에 있어서 유지되었다. 도 8c에 나타난 바와 같이, FOI의 높이( h)는 직경( D NP) 및 나노구조물의 t의 합이며, 여기서 t는 피크 적색-이동을 유도할 수 있는 영역의 역치 두께로 정의된다. 구체적으로, LSPR 피크 이동은 p = λ max/2 n에 가까운 주기를 가진 진동 작용(oscillatory behavior)을 나타내는데, 여기서 n은 표면 상의 코팅 층의 굴절률이다(도 8d) (Rindzevicius, T., et al., J Phys Chem C, 111, 11806-11810, 2007). 주기의 첫번째 절반에서, 스펙트럼은 p/2 보다 적은 두께가 증가함에 따라 적색-이동을 나타낸다. 그러므로, p/2의 역치 두께가 t이다. 역치 두께를 넘어, LSPR 스펙트럼은 청색-이동이기 시작하고, 그 다음 주기적 진동을 나타내었다. 이전 연구들은 DNA 층( n DNA)의 굴절률이 2이고, 단백질 및 DNA가 그들이 유도한 굴절률 변화와 관련하여 유사하게 행동한다는 것을 증명하였다(Thacker, V. V. et al., Nat Commun, 5, 3448, 2014; Liu, G. L. et al., Nature Nanotech, 1, 47-52, 2006; Di Primo, C. et al., Anal Biochem, 368, 148-155, 2007). 그러므로, 561 nm의 λ max인 Au-브릿지 NP의 t는 70.1 nm로 계산되었다. 최종적으로, FOI의 부피( l x w x h = V FOI)는 3.36μm x 3.36μm x 0.0844 μm = 0.953 μm 3으로 밝혀졌다.
1-9: NP 당 프로브의 평균 로딩 수(N *)의 평가
나노입자 및 DNA 발자국(footprint)의 모델링에 근거하여, N *을 정량적으로 예측하였다(도 10). 구체적으로, 입자의 표면 면적을 프로브의 유효 발작국의 면적으로 나누어 N *을 계산하였다. 발자국은 나노입자 표면을 차지하는 각 프로브의 평균 면적으로 정의된다. 계산을 위해 몇몇 추정이 이루어졌다. 나노입자를 실린더에 의해 브릿지된 두 개의 완벽한 구로 모델링하였다; 서로 가장 가까운 거리의 발자국을 구의 원형 면적 및 실린더의 타원으로 모델링하였다; 유리 상 두 개의 구의 접촉-점은 고려하지 않았다; 그리고 프로브는 입자 표면에 고르게 분포된 것으로 추정하였다.
구의 발자국 면적( S sphere)은 구의 직경에 따라 6 nm 2로 색인을 달았다(Hill, H. D. et al., ACS Nano, 3, 418-424, 2009). 두 개의 구의 면적( A sphere)은 A sphere = A' sphere - A contact로 계산되었는데, 여기서 A' sphere는 두 개의 분리된 구의 면적이고, A contact는 구와 실린더 사이의 접촉 면적이다; 결과적으로, A sphere = 2 x 4π( D sphere/2) 2 - 2 x π( D bridge/2) 2 = 1178 nm 2이며, 따라서, 구에 싸여질 수 있는 프로브의 수는 N * sphere = A sphere/ S sphere = 196이었다.
실린더의 외벽의 발자국 면적을 식: N * cylinder = n * short-axis x n * long-axis으로 계산하였는데, 여기서 n * short-axis는 원주 주변의 발자국의 수이고, n * long-axis는 실린더의 축 아래 수이다. 그러나, 비-곡선 표면 상의 두 개의 줄이 2.39 nm 보다 더 긴 발자국 공간 거리(4.72 nm; Hill, H. D. et al., ACS Nano, 3, 418-424, 2009)를 가질 수 있으므로, 브릿지의 길이( D bridge = 2.39 nm)는 실린더의 축을 따라 로딩하는 프로브의 하나의 줄 보다 더 많이 허용하지 않는다. 그러므로, N * cylinder = n * short-axis x 1 = π D bridge/ l short - axis이고, 여기서, D bridge는 원주 길이이며, l short -axis는 l short -axis = 2 x √[(3.3618 ln( D bridge/2) + 0.1616)/π]에 의해 주어진 발자국의 단축 길이이다. N * cylinder는 11인 것으로 확인되었고, 최종적으로, N * = N * sphere + N * cylinder = 207이었다.
평면 기질 상의 입자의 부동화로 인해, 오로지 "유효 로딩의 가장자리"의 선 위의 표면만이 DNA와 효과적으로 결합할 수 있고, 이는 입자의 전체 표면 면적의 59.4%를 아우르는 것이라고 가정하였다(도 10). 포화 조건에서, 모든 프로브는 타겟을 포획하였다. N DNA = [DNA] V FOI N A의 확립된 식을 이용하여, 타겟 DNA의 포화 농도([DNA] saturation)을 [DNA] saturation = 59.4% N * / V FOI/ N A = 215 nM로 예측할 수 있다.
1-10: 데이터 분석
NP 표면 상의 각각의 분자 결합 단계에 상응하는 RI의 변화를 관찰하고, LSPR λ max 이동(△λ max)으로 나타냈다:
△λ max = m(△ n)[1 - exp(-2 d/ L d)] (1)
여기서, m은 굴절률 민감도이고, △ n은 흡수질에 의해 유도된 굴절률의 변화이고, d는 유전체 두께이며, L d는 전자기장 붕괴(지수로 나타낸 붕괴로 근사치를 낸 것; Haes, A. J. et al., J Am Chem Soc, 124, 10596-10604, 2002)이다. m, L d 및 d는 동일한 나노입자 및 동일한 길이의 프로브 및 단백질에 대한 sNPS 시스템의 변수이다; 그러므로, △λ max는 △ n에 정비례하는데, 이는 결합 분석물의 농도에 비례한다(Starov, V. M., Nanoscience: Colloidal and Interfacial Aspects, CRC Press, Boca Raton, FL, 2010). △λ max의 측정에 근거하여, 분석물의 농도 변화를 계산하였다.
MutS 단백질의 농도가 가장 낮으면 λ max를 신뢰할 수 있게 하는 것은 sNPS 절차의 정량 한계(Limit of quantification, LOQ)에 의해 주어지는데, 이는 다음과 같이 표현될 수 있다.
LOQ = 10σ/S (2)
여기서 σ는 신호의 표준 편차이고, S는 검정선의 기울기이다. σ는 회귀선의 y-절편의 표준 편차로 추정될 수 있다.
DNA 타겟에 대한 sNPS 시스템의 검출 한계는 검출 한계(LOD)로 다음과 같이 설정될 수 있다.
LOD = 3.3σ/S (3)
신호-대-노이즈(signal-to-noise) 비(S/N)은 △λ max의 표준 편차에 대한, 평균(μ)의 비로 정의하였다. 5의 S/N은 100% 확실성에서 신호를 구별하기 위한 역치 값이다(Bushberg, J. T. et al., Lippincott Williams & Wilkins, Philadelphia, PA, 2012).
S/N = μ/σ (4)
단백질-핵산 결합 반응에서, MutS는 DNA에 결합하고, MSDNA 복합체를 형성한다. 결합(association)은 2가지 반응물이 관련되어 있으므로, 이는 2차 반응이다.
Figure PCTKR2019010370-appb-img-000002
(5)
개념적으로 결합 및 분리 반응 모두 정(straight)-결합이다. 단일 DNA 가닥의 수준에서, MutS 결합 및 분리는 확률적인 과정이다. 이는 Au-브릿지 NP 상의 모든 DNA 가닥이 결합에 동등하게 결합할 수 있다는 결합 현상의 간단한 근사이다. 사용된 DNA 가닥의 길이는 MutS와 1:1의 화학량론에서의 결합을 나타내고, 결합의 시간-과정은 단일 지수 과정으로 나타낸다. 정상 상태에서, 결합비는 방출비와 동일하다:
Figure PCTKR2019010370-appb-img-000003
(6)
여기서 [MutS] 및 [DNA]는 MutS 및 DNA의 자유 몰 농도를 나타내고, k binding 및 k dissociation는 결합(association) 및 분리(dissociation) 속도 상수이다.
정상 상태 전, MSDNA 복합체의 농도 변화 속도는 다음과 같이 그 형성 및 분리 속도 사이의 차이와 같다:
Figure PCTKR2019010370-appb-img-000004
(7)
반응물이 소비되지 않았으므로 결합은 최대 속도에서 시작되고, 그 후 반응물이 소비됨에 따라 감소된다. 시간에 따른 반응 규모는 다음과 같이 나타낼 수 있다:
Figure PCTKR2019010370-appb-img-000005
(8)
SDNA의 초기 농도,
Figure PCTKR2019010370-appb-img-000006
는 0이고, 상기 식은 다음과 같이 변형될 수 있다:
Figure PCTKR2019010370-appb-img-000007
(9)
여기서,
Figure PCTKR2019010370-appb-img-000008
는 관찰된 반응 속도 상수이다. k dissociation (얼마나 빠르게 MutS가 DNA로부터 분리되는지 측정) 및 k binding (얼마나 빠르게 MutS가 DNA에 결합하는지 측정)의 비는 MutS 단백질의 평형 상수( K D)를 산출하는데, 이는 이분자 상호작용의 강도를 평가하는데 사용된다. K D 의 단위는 nM이다.
Figure PCTKR2019010370-appb-img-000009
(10)
식 (9) 및 (10)의 추가 변형으로, 다음 식을 얻을 수 있다:
Figure PCTKR2019010370-appb-img-000010
(11)
여기서, k dissociation은 농도에 무관하며, 복합체가 단위 시간 안에 자발적으로 부서질 가능성을 나타낸다(Pollard, T. D. et al., Mol Biol Cell, 24, 1103-1110, 2013).
λ max 변화의 시간 코스를 근거로, 최대 △λ max 의 절반에 도달하기 위한 결합 시간을 반응의 하프 타임으로 평가하였다(τ 1 /2):
τ 1 /2 = ln 2/ k reaction (12)
실시예 2: 제조된 단일 나노입자 센싱 플랫폼의 특성 확인 및 점 돌연변이 검출 결과
2-1: 수치 시뮬레이션에 의한 나노입자 설계
각각의 NP는 sNPS 플랫폼에서 신호 변환기의 역할을 하므로, NP의 구조 및 모양은 균일하고 조절가능해야한다. 이러한 나노결정의 형성이 원칙에 따르는 것이 아니라, 과학적이라기 보다는 실증적인 것이므로, 불규칙한 모양의 나노결정(예, 분지형 나노별)의 사용은 금지된다. 게다가, 다면체 나노구조체의 제어 가능성은 타겟 결정 면을 특이적으로 조율하여, 상대적으로 높은 형태학적 결과를 나타내는 NP를 생산할 수 있는 화학물질의 부족으로 방해받는다. 그러므로, 균일하고 확장가능한 합성을 위해, sNPS를 위한 기질로서, 구 및 막대 모양의 나노구조체를 선택하였다. 더 높은 RI 민감도를 탐구하기 위해, 뚜렷한 스펙트럼 반응을 유도하고 플라즈몬 결합의 규모, 분극화 방향, 신호 강도 및 RI 민감도에 영향을 미치는 나노브릿지로 구성된 구조체를 도입하였다(도 11a). 금속 NP의 민감도는 바이오/화학-센서의 유용성을 결정짓는 주요 인자이다. 입자의 RI 민감도의 정량화를 위해 복잡한 바이오마커를 이용하는 대신, 주위의 매질의 RI가 변화하도록 설정된 미리 설계된 구조를 가진 단일 NP의 광학 시뮬레이션을 수행하였다. 상이한 RI 용액에 의해 유도된 단일 금 NP의 LSPR 파장 (λ max) 변화의 분석은 RI 민감도의 정량화에 있어서 효과적이고 간단한 것이라는 점이 증명되었다(Truong, P. L., Ma, X. & Sim, S. J. Nanoscale 6, 2307-2315 (2014)). RI 변화의 각 단계에 상응하는 λ max의 변화는 선형으로 관찰되고 나타났다(도 11b). 선의 기울기는 NP의 RI 민감도이다. 금 나노막대(AuNR)는 나노구(AuNSph) 보다 더 높은 민감도를 나타내었다(Truong, P. L., Ma, X. & Sim, S. J. Nanoscale 6, 2307-2315 (2014)). 나노브릿지(Au-브릿지 NP) 구조는 이전에 최적의 구조로 증명된 나노막대 보다 더 좋은 성과를 나타내었다. 특히, Au-브릿지 NP는 AuNR 보다 2배 이상 높은 민감도를 나타냈는데, 이는 sNPS 제작을 위한 초민감성 후보가 되었다. 이는 나노갭 및 나노브릿지 구조가 제공하는 높은 장 농도의 직접적인 결과이다. 게다가, 플라즈몬 민감도는 구조적 형상비(AR)에 따라 비례적으로 증가한다. 그러나, 더 큰 AR이 RLS 분광기의 파장 범위 밖의, 생물학적 물질의 결합 후 800 nm 보다 더 큰 λ max를 유발할 수 있으므로, Au-브릿지 NP의 AR은 2로 설정되었다.
2-2: NP의 설계에 의한 합성(Synthesis-by-design)
이중 가닥 DNA 분자(dsDNA)를 이용한 금 NP의 "방향 특이적" 합성의 실행가능성을 탐구하였는데, 이 공정에서 두 개의 금 나노시드(AuNS; 직경 ~5nm) 사이에 고정된 하나의 dsDNA(길이 ~30nm)가 금 원자의 결정화에 방향 특이적 가이드를 제공한다(도 2). 흥미롭게도, pH 조절에 의한 dsDNA의 표면 전하의 변경이 1 nm 보다 더 작은 나노갭을 생성시켰다(도 11c). pH 5에서, dsDNA는 약간 음성적으로 대전되고, 정전기적으로 NH 3OH +를 농축시킨다. 반응물 쌍, AuCl 4 - 및 NH 3OH +은 서로 접촉하여, DNA에 따라 금 결정화를 진행시킨다. 결정화는 dsDNA의 길이에 의해 정의된 나노규모의 제어 가능성으로, AuNS-dsDNA 경계로부터 dsDNA 가닥의 중간으로의 특이적인 방향으로 진행된다. 이러한 방법은 순차적인 목걸이 형태 또는 연속적인 돌출 형태가 제대로 제어되지 않은 구조적 정밀도로 형성되는(>100 nm), DNA 또는 DNA 종이접기를 금속화하는 종래의 접근법과는 근본적으로 구별되는 것이다. 결과적으로, 31.15±1.00 nm의 길이, 14.38±0.58 nm의 두 개의 구 말단의 직경 및 8.79±0.96 nm의 브릿지 직경의 크기의 Au-브릿지 NP를 얻었다(표 3).
Au-브릿지나노입자 길이 (nm) 직경 (nm)
입자 나노브릿지 구 말단 나노브릿지
평균 31.15 2.39 14.38 8.79
표준 편차 1.00 0.87 0.58 0.96
치수 편차 [a] 3.20% 36.5% 4.03% 10.9%
p-값 [b] 0.9912 0.9786 0.9522 0.9897
[a]치수 편차는 평균 크기에 대한 표준 편차의 비율이다. [b]나노입자는 8 배치의 합성으로 얻었고, TEM 이미지의 평면 내 194 입자들을 분석하였다.
바람직한 형태의 수율은 87%이었고, 나노구조체는 상대적으로 높은 단순분산이었다(도 12). 반대로, pH 4에서, dsDNA는 4-4.5의 pI로 인해 양성으로 하전된다(Guo, Z. L. et al., Soft Matter, 12, 6669-6674, 2016). DNA는 정전기 반발력에 의해 NH 3OH +를 배척하고, 그러므로, NH 3OH + 및 AuCl 4 - 사이의 반응은 대개 AuNS 근처에서 발생되며, 이는 나아가 그 표면을 둘러싼 Au 원자의 결정화를 자가촉매한다. 반응은 Au 이온의 원자로의 완전 산화로 끝나고, 두 개의 나노구 사이에 0.44-nm의 갭을 남긴다(직경 17.01±1.07 nm).
결정화는 AuNS-dsDNA 경계로부터 dsDNA 가닥의 중간점까지의 특정한 방향으로, dsDNA의 길이에 의해 정의된 나노규모 제어성으로 일어났다. 이러한 방법은 DNA 또는 DNA 오리가미를 금속화하는데 관련된 종래의 접근법과 근본적으로 상이한데, 여기서 연속적인 목걸이 또는 연속적 불룩한 것(bulge) 중 하나가 겨우 제어된 구조적 정밀도로 형성된다(> 100nm). Au-브릿지 NP의 합성에 있어서 DNA의 방향적 효과는 X-선 회절 및 고해상도 투과 전자 현미경(HR-TEM)으로 체계적으로 조사하였다(도 11d 및 e). AuNS는 38°(111) 및 44°(200)에서 금의 fcc 구조의 피크를 나타내었다(JCPDS No. 03-0921). 피크 위치는 DNA-유도 결정화 후 분명한 이동을 나타내었는데, 이는 DNA가 Au-브릿지 나노구조체에 상당한 격자 변형을 유도한다는 것을 나타낸다. 더 좁은 피크의 선폭은 간접적으로 입자 크기의 확장을 나타낸다. 게다가, 나노규모 브릿지에 대한 HR-TEM 이미지로 <100> 결정화 방향의 (200) 격자 주변부에 상응하는, 0.208±0.004 nm의 간격 거리의 결정면을 확인하였다(Ma, X., et al. Nat Commun 7, (2016)). 종합하면, DNA가 민감한 나노플라즈몬 센싱 및 이미징에 사용될 수 있는, 나노규모의 브릿지 및 갭의 방향 특이적 합성을 현실화시킨다는 것을 알 수 있었다.
2-3: Au-브릿지 NP를 포함한 sNPS
백색원으로 sNPS에 의한 단일 Au-브릿지 NP의 공명 RLS 반응을 조사하였다(도 3). 개개의 NP의 광 산란을 백색광원, 암시야 콘덴서, 100X 대물렌즈 및 사진기가 구비된 암시야 현미경 상에서 관찰하였다. 백색광 조명은 상이한 광학 공명의 개개의 NP로부터 광 산란을 구별할 수 있게 한다; 또한 타겟 생체분자를 변성시키는 강한 에너지 및 열을 유도하거나, 분자 상호작용을 방해하지 않는다. 암시야 배치를 이용하여, 광 산란 물체는 어두운 배경에 대조적으로 밝게 보인다. AuNP에 의한 LSPR의 자극은 육안으로 인식되고 사진으로 분석되기에 충분하도록 광 산란을 강하게 향상시킨다. NP는 설계된 미세유체 반응 챔버의 유리 기판 상에 드문드문 분산된다. 단일 NP의 RLS 스펙트럼을 측정하기 위하여, 고감도 전하 결합 소자(CCD) 및 레일리 분광기를 현미경에 부착하였다. 단일 NP의 산란된 단색광을 CCD로 기록하고, 스펙트럼에서의 광 강도 대 파장의 함수로 나타내었다. 주위 환경의 빛으로부터 유래된 노이즈를 제거하기 위하여, 산란 스펙트럼을 로렌찌안 알고리즘에 맞추었다.
빛은 개별 NP의 직접적인 관찰을 허용하는 광 산란을 충분히 향상시키는 NPs와 함께 LSPR을 생성시켰다; 반면, 백색광 조명은 타겟 생분자를 변성시키거나 미세유체 반응 챔버에서 분자 상호작용을 차단할 수 있는 높은 에너지 및 열을 피하였다(도 9a). 단일 Au-브릿지 NP의 RLS 스펙트럼은 두 개의 표면 플라즈몬 피크를 나타내었다(도 9b). 하나는 수평 방향에 따른 전자 진동에 관련된 것으로, 500 nm 주위의 상대적으로 약한 공명 밴드를 나타내고(AuNSph와 유사), 다른 하나는 560 nm 주위의 수직 방향에 따른 전자 진동에 관련된 것이다(AuNR 유사). 수직 방향 모드가 수평 방향 밴드 보다 매질의 유전율 변화에 더 민감하므로, 수직 표면 플라즈몬 피크에 중점을 두었다(Truong, P. L., Ma, X. & Sim, S. J. Nanoscale 6, 2307-2315 (2014)). 매질의 흡착물질은 ssDNA 및 MutS 단백질이었다. 프로브 ssDNA는 티올 변형에 의해 Au-브릿지 NP 상에 고정되고 그 후 수소 결합(H-결합) 및 π-π 적층을 통해, λ max가 561.1±0.5 nm에서 570.7±0.5 nm까지 적색-이동하는 과정동안에, 타겟 ssDNA로 혼성화되었다(도 9c의 단계 1에서 단계 2). DNA 이중 나선 형성 후, λ max에서 9nm 주위의 적색 이동이 관찰되었다. 그 후, 크게 양성적으로 대전된 표면 서열을 포함하는 MutS 단백질은 음성적으로 대전된 DNA 중추와 독립적으로 접촉한다. DNA 내 불일치(mismatch)의 존재는 나선을 난잡하게 하고, MutS의 보존된 Phe-Xaa-Glu 모티프와의 특이한 H-결합을 유도하여. 585.3±0.5 nm로의 기본 NP의 λ max에 비례하여, 24 nm까지의 적색-이동을 야기한다(도 9c의 단계 2에서 3). 미(Mie) 이론에 따르면, 금속성 NP의 LSPR은 모양, 크기 및 국소 유전체 환경의 RI에 강하게 의존적이다. 개개의 NP의 사용은 모양 및 크기의 차이에 대한 우려를 불식시키므로, LSPR λ max 이동은 확실히 국소 유전체 환경의 변화, 즉, DNA 혼성화 및 뒤이은 MutS 결합에 대한 NP 인터페이스의 변화에 기여할 수 있다(도 9d). MutS 돌연변이의 인식에 따라 피크 이동이 발생한 특이성을 증명하기 위하여, MutS 없이 인간 혈청 내 DNA 타겟을 시험하기 위한 유사한 분석 및 어떠한 돌연변이도 없는 DNA(즉, 완벽히 일치된 DNA 타겟)를 시험하기 위한 분석을 수행하였다. 예상한 바와 같이, 두 가지 분석에서 매우 적은 스펙트럼 변화만이 있었다(도 4). 미세유체 챔버의 이동 없이, MutS를 함유하는 혈청 용액의 도입에 이어 95℃에서 세척 버퍼와 함께 열 처리한 후에 검출을 반복하였다. 그 결과는 동일하게 또 다른 하나의 유효한 적색 이동을 나타내었다. 이를 통해 제조된 sNPS가 DNA 돌연변이에 대한 MutS의 특이성을 유지한다는 것을 알 수 있었다.
2-4: 센싱의 민감도 확인
sNPS 센싱 방법의 민감도를 두 가지 수단으로 조사하였다. 첫 번째는 특정한 검출 시간 내에 효과적인 LSPR λ max 이동(Δλ max)을 가능하게 하는 MutS 단백질의 가장 낮은 농도(LOD)이고; 다른 하나는 도달할 수 있는 검출 시간이다. MutS 용액이 미세유체 챔버 내 DNA 변형 Au-브릿지 NP에 도달한 후, 반응을 1분 동안 계속되도록 하고 그 후 10초 동안 RLS 스펙트럼을 수집하였다. 프로브와의 완전한 혼성화를 보장하기 위하여 DNA 타겟을 과량으로 사용하였다. LSPR 해독에 효과적인 MutS 단백질의 농도는 MutS의 10 nM 내지 25 nM의 선형 범위 내 λ max의 3.40 nm 적색 이동에 상응하는, 6.17 nm이다(도 9e). 그 후 LOD의 분석을 위해 공시료 및 상이한 농도의 일련의 DNA 타겟을 검출하였다(도 9f). 농도 대 반응의 그래프가 0.9954의 R 2로 선형으로 가는, 5-150 nM의 분석 범위가 선형성이 일정하지 않은 곳을 넘어서, 관찰되었다. 5-nM 타겟을 모니터링하는 동안 S/N은 9.86이었다. LOD는 8.63 nM로 계산되었다. 이러한 LOD는 무표지 QCM 방법에 의해 얻어진 것에 필적하는 것이며(Su, X. D., Robelek, R., Wu, Y. J., Wang, G. Y. & Knoll, W. Anal. Chem. 76, 489-494 (2004)), 무표지 SPR 대량 검출의 결과 보다 10배는 낮은 것이다(Gotoh, M., et al. Genet Anal-Biomol E 14, 47-50 (1997)). 이러한 민감한 성과는 1 μL/분의 유속에서 달성되었고, 각각의 검출에 요구되는 전체 시료 부피는 미량 수준에서 샘플링 농도로 30 μL이었다. 과량의 비특이적 물질은 센싱 입자에의 물리화학적 간섭 없이 미세유체 챔버 밖으로 손쉽게 씻어내었다. 반대로, 형광 센싱 방법은 매우 많은 시약 및 처리 단계를 필요로 한다(예를 들어, MutS는 55% 미만의 표지 효율에 도달하는, 버퍼 세트에서 3 μM 이상의 전농도에서 오래 계속되는 형광단 변형을 필요로 한다). 겔 이동성 이동 분석은 작은 로딩 부피를 필요로 하지만, 시료들은 시각화를 위해 크게 농축되어야 한다. 단백질과 DNA 사이의 상호작용이 큰 표면 영역(1,250 Å 2, ~50 bp)에 걸쳐 기여하는 반면, MutS의 풋프린트는 24 bp이다. 그에 따라 사용된 51 bp ssDNA 프로브는 점 돌연변이-유도 신호 변화와 비특이적 결합 유도 변화의 분명한 구별을 보장하여, 특이적 타겟 결합-기반 신호 손실을 최소화한다.
2-5: 단일-점 돌연변이 인식
BRCA1 내 8개의 상이한 점 돌연변이를 확인하기 위한 설계를 하였다. BRCA1 유전자 돌연변이는 세계적으로 여성에게 가장 빈번히 나타나는 암인, 유방암의 가장 중요한 유전적 민감성을 포함하는 것이다. 일반 대중의 여성 중 대략 12%가 일생 중 유방암에 걸리는데, 가장 큰 위험은 유방암 진행 위험률을 59 내지 87 %까지 상승시키는 BRCA1에 의한 것이다. 몇몇 일반적인 돌연변이를 제외하고, BRCA1 돌연변이의 스펙트럼은 다양한 집단에서 불균일하다. 단일 뉴클레오티드 치환(GT, GG, AC, TC, AA, GA), 삽입(+C) 및 결실(-C)을 포함하는, 8개의 세계적으로 가장 흔한 BRCA1 유전자의 다형을 선택하였다. DNA 서열, 변이체 명, 게놈 위치, 기능적 결과 및 타겟 집단을 표 1에 요약하였다. 점 돌연변이 상의 MutS의 서열 특이적 결합이 뚜렷한 LSPR 신호 변화를 나타낼 것이라고 가설을 세웠다. 또한, 상이한 뉴클레오티드 변이체에 대한 MutS의 상대적인 활성을 확인하고자 하였다. sNPS 플랫폼의 센싱 챔버로의 주입으로, MutS가 150초 동안 DNA 결합 Au-브릿지 NP에 결합되도록 하였고, 단일 NP의 광학 반응의 변화를 매 1초 마다 모니터하였다(도 13a). MutS는 또한 실시간 신호 반응에 따라 ~15초 동안 호모듀플렉스(완벽히 일치) 상에 로딩될 수 있다. 이는 MutS가 일차원적 확산 슬라이딩에 의해 일시적인 클램프를 형성하고 호모듀플렉스 DNA로 이동한다는 이전의 연구와 일직선 상에 있는 것이다(Jeong, C., et al. Nat. Struct. Mol. Biol. 18, 379-U174 (2011)). 불일치 확인은 MutS 결합 시간을 호모듀플렉스 보다 10배 이상 더 길게 만들고, 명확히 일련의 Δλ max를 유도한다. Δλ max는 DNA-결합 NP에 대한 MutS 결합 상의 RI 변화에 의해 유발되므로, 시간 경로는 명백히 점 돌연변이를 인식하는 MutS의 상이한 활성을 나타내는 것이다. 상이한 뉴클레오티드 돌연변이는 MutS 단백질 및 DNA 사이의 접촉 행동을 변형시킨다. 예를 들어, 불일치 퓨린은 N7에서 형성하는 반면, 불일치 피리미딘은 MutS의 글루탐산과 N3 위치에서 수소결합을 형성한다. MutS에서 페닐알라닌과 같은 아미노산은 불일치 부근 염기에 비특이적으로 축적된다. 돌연변이 유형에 따라 다양한, 이러한 특이적 및 비특이적 상호작용은 MutS-DNA 상호작용의 동역학 분석에 의해 밝혀질 수 있는, 상이한 반응 상수를 유도한다.
MutS가 변이체 DNA를 인식할 때 얼마나 효율적으로 결합하는지에 따른, 변이체 DNA에 대한 MutS의 상대적인 활성, R act을 정의하고, R act = K · k reaction로 나타내었는데, 여기서 K는 점유 상수(occupancy constant)이고, k reaction는 단백질-DNA 상호작용의 속도 상수이다. Au-브릿지 NP 상의 DNA가 MutS에 대하여 확률론적이고 동등하게 이용가능하며, 따라서 동일한 검출 조건이 K의 일관성을 유지하는 결합 사건의 간단한 근사일 수 있다. 그러므로, R act는 k reaction에 따라 평가될 수 있다. 사용된 DNA 프로브의 길이는 MutS와 1:1의 화학량론으로의 결합을 나타내므로, 결합 및 분리의 시간 경로는 단일 지수 과정으로 설명될 수 있다. 지수 방정식에 맞추어, 상이한 DNA 타겟에 대한 MutS 결합의 k reaction(10 -2s -1)은 GT, GG, +C, AA, TC, -C, AC, GA의 점 돌연변이 각각에 대하여 9.95 ± 0.420, 6.15 ± 0.208, 5.80 ± 0.189, 4.92 ± 0.214, 3.82 ± 0.212, 3.60 ± 0.243, 3.25 ± 0.184, 및 2.82 ± 0.197이었다. 각각의 타겟 DNA에 대한 k reaction 값의 재구성으로 상이한 돌연변이에 대한 MutS의 상대적인 활성이 GT > GG > +C > AA > TC > -C > AC > GA의 순서라는 것을 알 수 있었다(도 13b). 이러한 순서는 겔 이동성 이동 분석의 결과와 일치하는 것이다(DeRocco, V. C., Sass, L. E., Qiu, R. Y., Weninger, K. R. & Erie, D. A. Biochemistry-Us 53, 2043-2052 (2014)). 점 돌연변이는 4개의 유형으로 구분되는데, GT는 식별가능성이 높은(high-identifiable) 돌연변이이고(>0.07의 k reaction 값), GG, +C 및 AA는 식별가능한(identifiable) 것이고(0.05-0.07의 k reaction 값), TC, -C 및 AC는 검출가능성이 높은(high-detectable) 것이고(0.03-0.05의 k reaction 값), GA는 검출가능성이 있는(detectable) 것이다(<0.03 의 k reaction 값).
2-6: 센싱의 신뢰도 확인
결정 구조 및 GT 불일치에 대한 MutS 결합의 상호작용이 가장 분명하게 밝혀졌으므로(Groothuizen, F. S., et al. Elife 4, (2015)), MutS가 GT-변이체 DNA에 결합하여, "MSDNA"로 명명된 복합체를 형성하는, 상호작용의 k reaction의 추가 해석을 바탕으로 sNPS의 신뢰도를 확인하였다. 반응은 두 개의 반응물에 관련되어 있고, 따라서 2차 반응이다: MutS + DNA ⇔ MSDNA. MutS의 DNA에의 결합 및 분리의 동역학은 k reaction = k binding [MutS] + k dissociation로 설정하였는데, 여기서 k binding 및 k dissociation은 결합 및 분리 속도 상수이며, [MutS]는 자유 MutS 단백질의 몰 농도를 나타낸다(도 14a). 명백히, [MutS]는 에서의 변화의 진폭에 상응하는 반응 동역학에 영향을 미친다. 더 높은 [MutS]는 복합체가 평형에 도달하기 전에 더 큰 λ max 증가를 유도하고, 최종적으로 상호작용의 끝에 더 긴 이동을 유도하였다. MutS가 하나도 소비되지 않았으므로, 상호작용은 최대 속도에서 시작되고, 그 후 MutS의 평형 확산으로의 예측된 방식으로 감소된다. 속도 상수 k reaction는 지수 맞춤에 의해 정량적으로 설정되었다. [MutS]의 함수로의 k reaction의 재구성은 선형 선을 나타내었는데(도 14b), 여기서 y-절편은 k dissociation를 의미하고, 기울기는 k binding이다. 2.97 Х 10 6 M -1s -1의 k binding은 3-6 Х 10 6 M -1·s -1의 이전에 보고된 대량 동역학 측정값과 유사하다(Qiu, R. Y. , et al. Proc . Natl Acad . Sci . USA 112, 10914-10919 (2015)). k reaction 및 k binding 사이의 동역학적 연구는 DNA에 대한 MutS의 해리 평형 상수, 즉, 리간드 친화도의 기본 파라미터인 K D를 밝혀내었다. MutS의 K D는 4.46 nM인 것으로 밝혀졌는데, 이는 보고된 2-10 nM의 smFRET 및 벌크 측정에 일치한다(Jeong, C. et al., Nat Struct Mol Biol, 18, 379-385, 2011; Yang, Y. et al., Nucleic Acids Res, 33, 4322-4334, 2005). 이는 단일 NP 주위의 정확한 규모에서 MutS의 평형 상수의 동역학적 연구의 최초의 검증이며, 이는 진단 응용을 위한 sNPS 분석의 유용성을 지지하는 것이다.
2-7: 임상 진단을 위한 점 돌연변이에 대한 MutS 친화도의 아틀라스
나아가 4 가지 유형의 점 돌연변이에 대한 단백질 결합 친화도의 아틀라스를 확립하였다(도 15): 매우 식별가능( k reaction>0.07), 식별가능( k reaction=0.05-0.07), 매우 검출가능( k reaction=0.03-0.05) 및 검출가능( k reaction<0.03). 아틀라스는 각 타겟, 돌연변이 타입 및 진단 신호에 대한 상대적인 활성 및 반응 반감기의 저-입력 및 고-충실도 sNPS에 의해 얻은 포괄적인 정보를 나타낸다. 구체적으로, 각 원은각각 LSPR 피크 이동 및 돌연변이 카테고리를 정량화하기 위한 신호 반응을 반영하는 직경 및 색으로, 단일 점 돌연변이를 나타낸다. 예를 들어, GT 돌연변이를 갖는 타겟 DNA는 14.2 nm의 피크 이동을 생성하였으며, 그 값은 타겟의 농도(100 nM)에 영향을 받고 비례한다. 돌연변이 카테고리는 생물학적으로 세 가지 유형, 청색, 녹색 및 적색으로 나뉘며, 그 중 청색은 전이 돌연변이(피리미딘을 피리미딘으로 교체하거나 그 반대)를 나타내며, 녹색은 전환 돌연변이(피리미딘을 퓨린으로 교체하거나 그 반대)를 나타내고, 적색은 불룩한 돌연변이(염기 삽입 또는 결실)을 나타낸다. 각 원의 중심의 y 및 x 좌표는 각각 상대적인 활성 및 반응의 반감기를 나타낸다. k reaction에 의해 예측된 상대적인 활성은 검출에 사용된 MutS의 농도 및 표적 DNA에 대한 MutS의 K D에 의존한다. 그러므로, 단일 점 돌연변이는 이러한 sNPS 방법에 의해 동일한 질과 양의 MutS를 이용하여 식별될 수 있다. 반응의 반감기는 개별 NP에 대한 MutS의 결합이 최대 LSPR 이동의 절반에 도달하는데 걸리는 시간에 대한 정보를 알려준다. 이러한 정보는, MutS가 피리미딘-피리미딘 돌연변이(예, 매우 검출가능한 TC) 보다 퓨린-퓨린 돌연변이(예, 식별가능한 GG 및 AA)에 더 강하게 결합한다는 관찰에 의해 입증되는 바와 같이, 예를 들어, 왜 세포에서 퓨린-퓨린 돌연변이가 피리미딘-피리미딘 돌연변이 보다 더 나은 복구율을 나타내는지를 설명하는데 도움이 될 수 있다. 이러한 결과는 또한 MutS가 TC 보다 더 낮은 상대적 활성을 가지므로, AC 및 GA 돌연변이의 복구가 덜 효과적임을 나타낸다.
아틀라스의 임상적 적용의 원리 증명(proof-of-principle) 입증으로서, 각각 분석물 및 대조군으로서, 인간 유방암 세포주, HCC1937 및 MCF7로부터 생물학적 DNA 샘플을 제조하고(Elstrodt, F. et al., Cancer Res, 66, 41-45, 2006), 아틀라스에 나타낸 8개의 돌연변이 중 잠재적인 점-돌연변이의 존재 및 유형을 검출하였다(도 5 내지 7). 현저히, 5382inC의 검출을 위해 설계된 유리 칩(표 1)은 일련의 피크 이동을 나타낸 반면, 다른 칩은 유효한 신호 변화를 나타내지 않았다(도 15). 검출 시간에 대한 피크 이동의 동역학적 연구는 5.73±0.071(10 -2s -1)의 값을 나타내었고, 이는 아틀라스에서 +C의 위치에 매우 근접한 것으로(도 15 및 도 17), 이는 HCC1937의 BRCA1이 단일의 시토신 복제를 포함한다는 것을 입증한다. 이러한 결과는 DNA 시퀀싱으로 확인하였다(도 18). 또한, 타겟의 원 직경은 그 농도의 정보를 출력하였다; 예를 들어, 8.25-nm 직경은 아틀라스에서 +C의 원 직경(12 nm)에 따를 때 68.8-nM 타겟을 나타내는데, 이는 100 nM의 표준 농도로 얻은 것이다.
최종적으로, 이러한 sNPS 시스템을 사용자-할당 게놈 영역에서 잠재적인 점 돌연변이를 검출하기 위하여 적용하였다. 염색체 17의 긴 팔의 영역 2 밴드 1 상의 43047665에 의치한 잠재적인 BRCA1 점 돌연변이를 난소암 세포주, SNU251를 진단하기 위해 할당하였다. 새로운 64-bp 프로브와 함께 동일한 Au-브릿지 NP를 이용하여 칩을 제작하였다. 흥미롭게도, 스펙트럼 피크의 연속적인 이동이 관찰되었는데, 이는 유전자에서의 특정한 간격을 모니터링하기 위한 새로운 프로브를 가진 sNPS의 효과를 검증하는 것이다(도 19). 아울러, 진단 결과의 아틀라스에의 입력은 돌연변이 유형이 AC 점 돌연변이와 매우 유사하다는 것을 나타내었다. 비록 새롭게 설계된 프로브 및 이전에 사용한 AC-프로브의 측면 순서는 상이하였으나, k reaction(10 -2s -1)은 유사한 값(검출에서 3.20 대 아틀라스에서 3.24)을 산출하였다. 보라색 원의 작은 직경은 진단시 타겟의 낮은 농도를 나타내었다. AC 돌연변이의 예측은 DNA 시퀀싱에 의해 정확히 확인되었다(도 20).
이상으로 본 발명 내용의 특정한 부분을 상세히 기술하였는바, 당업계의 통상의 지식을 가진 자에게 있어서 이러한 구체적 기술은 단지 바람직한 실시태양일 뿐이며, 이에 의해 본 발명의 범위가 제한되는 것이 아닌 점은 명백할 것이다. 따라서, 본 발명의 실질적인 범위는 첨부된 청구항들과 그것들의 등가물에 의하여 정의된다고 할 것이다.
본 발명의 단일 나노입자 바이오센서 플랫폼은 높은 민감도 및 신뢰도로 타겟 검출이 가능할 뿐만 아니라, 다양한 돌연변이의 직접적인 확인이 가능하고, 이에 따라 효율적인 돌연변이 진단이 가능한바, 생의학적 진단 분야 등에서 널리 활용될 수 있다.

Claims (19)

  1. 두 개의 금속 나노시드(nanoseed) 사이에 생체분자가 고정된 금속 나노입자를 포함하는 금속 나노 브릿지 구조체.
  2. 제1항에 있어서, 상기 금속은 금(Au), 구리(Cu), 백금(Pt) 및 팔라듐(Pd)으로 구성된 군에서 선택된 어느 하나인 것을 특징으로 하는 금속 나노 브릿지 구조체.
  3. 제1항에 있어서, 상기 금속 나노시드는 나노구(nanosphere), 나노막대(nanorod), 나노프리즘(nanoprism) 및 나노판(nanoplate)으로 구성된 군에서 선택된 하나인 것을 특징으로 하는 금속 나노 브릿지 구조체.
  4. 제1항에 있어서, 상기 생체분자는 단일가닥 DNA, 이중가닥 DNA, DNA 올리고머, RNA 올리고머, 플라스미드 DNA, 폴리펩티드 및 단백질로 구성된 군에서 선택된 하나인 것을 특징으로 하는 금속 나노 브릿지 구조체.
  5. 제1항에 따른 금속 나노 브릿지 구조체를 포함하는 단일 나노입자 바이오센서 플랫폼.
  6. 제5항의 단일 나노입자 바이오센서 플랫폼을 포함하는 바이오센서.
  7. 제6항에 있어서, 돌연변이 검출에 사용되는 것을 특징으로 하는 바이오센서.
  8. 제7항에 있어서, 상기 돌연변이는 점 돌연변이인 것을 특징으로 하는 바이오센서.
  9. 제6항에 있어서, 상기 바이오센서를 이용하여 샘플 내 BRCA1 돌연변이의 종류를 특정할 수 있는 것을 특징으로 하는 바이오센서.
  10. 제6항에 있어서, 나노막대 보다 높은 RI(Refractive index) 민감도를 갖는 것을 특징으로 하는 바이오센서.
  11. 제6항의 바이오센서를 이용한 돌연변이의 검출 방법.
  12. 제11항에 있어서, 상기 돌연변이는 점 돌연변이인 것을 특징으로 하는 돌연변이의 검출 방법.
  13. 제11항에 있어서, 단백질과 돌연변이 핵산분자의 결합 분석에 의해 돌연변이를 확인하는 것을 특징으로 하는 돌연변이의 검출 방법.
  14. 두 개의 금속 나노시드 사이에 생체분자가 고정된 금속 나노입자를 형성하는 단계; 및 형성된 금속 나노입자를 이용하여 금속 나노 브릿지 구조를 제작하는 단계를 포함하는 단일 나노입자 바이오센서 플랫폼의 제조 방법.
  15. 제14항에 있어서, 상기 금속은 금(Au), 구리(Cu), 백금(Pt) 및 팔라듐(Pd)으로 구성된 군에서 선택된 어느 하나인 것을 특징으로 하는 단일 나노입자 바이오센서 플랫폼의 제조 방법.
  16. 제14에 있어서, 상기 금속 나노시드는 나노구(nanosphere), 나노막대(nanorod), 나노프리즘(nanoprism) 및 나노판(nanoplate)으로 구성된 군에서 선택된 하나인 것을 특징으로 하는 단일 나노입자 바이오센서 플랫폼의 제조 방법.
  17. 제14항에 있어서, 상기 생체분자는 단일가닥 DNA, 이중가닥 DNA, DNA 올리고머, RNA 올리고머, 플라스미드 DNA, 폴리펩티드 및 단백질로 구성된 군에서 선택된 하나인 것을 특징으로 하는 단일 나노입자 바이오센서 플랫폼의 제조 방법.
  18. 제14항에 있어서, 형성된 금속 나노입자 표면에 금속이온이 환원제에 의해 환원되면서 성장하는 단계를 더 포함하는 것을 특징으로 하는 단일 나노입자 바이오센서 플랫폼의 제조 방법.
  19. 제18항에 있어서, 상기 환원제는 수산화아민(NH 2OH)인 것을 특징으로 하는 단일 나노입자 바이오센서 플랫폼의 제조 방법.
PCT/KR2019/010370 2018-08-14 2019-08-14 단일 금속 나노 브릿지 구조의 합성 방법 및 이를 이용한 dna 점돌연변이 검출 센서 제작 방법 WO2020036438A1 (ko)

Priority Applications (3)

Application Number Priority Date Filing Date Title
EP19849511.1A EP3842548A4 (en) 2018-08-14 2019-08-14 METHOD OF MANUFACTURING A SINGLE METAL NANOBRIDGE STRUCTURE AND METHOD OF MANUFACTURING A DNA POINT MUTATION DETECTION SENSOR USING THE SAME
US17/266,193 US20220364162A1 (en) 2018-08-14 2019-08-14 Method for synthesizing single metal nanobridged structure and method for manufacturing dna point mutation detection sensor by using same
CN201980053469.2A CN112805391A (zh) 2018-08-14 2019-08-14 用于合成单金属纳米桥结构的方法以及通过使用其制造dna点突变检测传感器的方法

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR10-2018-0095140 2018-08-14
KR20180095140 2018-08-14
KR10-2019-0099454 2019-08-14
KR1020190099454A KR102300360B1 (ko) 2018-08-14 2019-08-14 단일 금속 나노 브릿지 구조의 합성 방법 및 이를 이용한 dna 점돌연변이 검출 센서 제작 방법

Publications (1)

Publication Number Publication Date
WO2020036438A1 true WO2020036438A1 (ko) 2020-02-20

Family

ID=69525706

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2019/010370 WO2020036438A1 (ko) 2018-08-14 2019-08-14 단일 금속 나노 브릿지 구조의 합성 방법 및 이를 이용한 dna 점돌연변이 검출 센서 제작 방법

Country Status (2)

Country Link
US (1) US20220364162A1 (ko)
WO (1) WO2020036438A1 (ko)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113267477A (zh) * 2021-05-14 2021-08-17 云南大学 一种使用水溶性溴碘铯铅钙钛矿可视化检测以及定量检测水溶液中汞离子的方法

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2008524602A (ja) * 2004-12-17 2008-07-10 インテル・コーポレーション 表面増強ラマン分光法（ｓｅｒｓ）による増強された多重信号の検出
KR20110066881A (ko) * 2009-12-11 2011-06-17 한국화학연구원 라만 활성분자가 나노입자 이합체의 접합부에 위치한 이합체 코어쉘 나노 입자, 이의 용도 및 이의 제조방법
KR20120056024A (ko) * 2010-11-24 2012-06-01 한국화학연구원 코어 물질과 쉘 물질 사이에 나노갭이 형성된 단일 나노입자 및 이의 제조방법
KR20140141880A (ko) * 2013-05-31 2014-12-11 삼성전자주식회사 핵산 구조체를 포함하는 입자간 스페이싱 물질, 및 그의 용도
KR101484743B1 (ko) * 2013-08-13 2015-01-26 고려대학교 산학협력단 생체분자를 기반으로 하는 금속 나노구조물의 제조방법

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004099307A2 (en) * 2003-02-07 2004-11-18 Wisconsin Alumni Research Foundation Nanocylinder-modified surfaces

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2008524602A (ja) * 2004-12-17 2008-07-10 インテル・コーポレーション 表面増強ラマン分光法（ｓｅｒｓ）による増強された多重信号の検出
KR20110066881A (ko) * 2009-12-11 2011-06-17 한국화학연구원 라만 활성분자가 나노입자 이합체의 접합부에 위치한 이합체 코어쉘 나노 입자, 이의 용도 및 이의 제조방법
KR20120056024A (ko) * 2010-11-24 2012-06-01 한국화학연구원 코어 물질과 쉘 물질 사이에 나노갭이 형성된 단일 나노입자 및 이의 제조방법
KR20140141880A (ko) * 2013-05-31 2014-12-11 삼성전자주식회사 핵산 구조체를 포함하는 입자간 스페이싱 물질, 및 그의 용도
KR101484743B1 (ko) * 2013-08-13 2015-01-26 고려대학교 산학협력단 생체분자를 기반으로 하는 금속 나노구조물의 제조방법

Non-Patent Citations (26)

* Cited by examiner, † Cited by third party
Title
CHO, M. ET AL.: "Detection of mismatched DNAs via the binding affinity of MutS using a gold nanopaiticle-based competitive colorimetric method", CHEMICAL COMMUNICATIONS, vol. 14, no. 38, 2008, pages 4573 - 4575, XP055686712 *
DEROCCO, V. C.SASS, L. E.QIU, R. Y.WENINGER, K. R.ERIE, D. A., BIOCHEMISTRY-US, vol. 53, 2014, pages 2043 - 2052
DI PRIMO, C. ET AL., ANAL BIOCHEM, vol. 368, 2007, pages 148 - 155
ELSTRODT, F. ET AL., CANCER RES, vol. 66, 2006, pages 41 - 45
GOTOH, M. ET AL., GENET ANAL-BIOMOL E, vol. 14, 1997, pages 47 - 50
GROOTHUIZEN, F. S. ET AL., ELIFE, vol. 4, 2015
GUO, Z. L. ET AL., SOFT MATTER, vol. 12, 2016, pages 6669 - 6674
HAES, A. J. ET AL., J AM CHEM SOC, vol. 124, 2002, pages 10596 - 10604
HILL, H. D. ET AL., ACS NANO, vol. 3, 2009, pages 418 - 424
HU , J. ET AL.: "Oligonucleotide-linked gold nanoparticle aggregates for enhanced sensitivity in lateral flow assays", LAB ON A CHIP, vol. 13, 2013, pages 4352 - 4357, XP055686713, DOI: 10.1039/c3lc50672j *
JEONG, C. ET AL., NAT STRUCT MOL BIOL, vol. 18, 2011, pages 379 - 385
JEONG, C. ET AL., NAT. STRUCT. MOL. BIOL., vol. 18, 2011, pages 379 - U174
LIM, D. K. ET AL., NATURE NANOTECH, vol. 6, 2011, pages 452 - 460
LIU, G. L. ET AL., NATURE NANOTECH, vol. 1, 2006, pages 47 - 52
MA, X. ET AL., NAT COMMUN, vol. 7, 2016, pages 12873
MA, X.TRUONG, PLANH, N. H.SIM, S. J., BIOSENSORS & BIOELECTRONICS, vol. 67, 2015, pages 59 - 65
NAM, J. M.OH, J. W.LEE, H.SUH, Y. D., ACC. CHEM. RES., vol. 49, 2016, pages 2746 - 2755
POLLARD, T. D. ET AL., MOL BIOL CELL, vol. 24, 2013, pages 1103 - 1110
QIU, R. Y ET AL., PROC. NATL ACAD. SCI. USA, vol. 112, 2015, pages 10914 - 10919
RINDZEVICIUS, T. ET AL., J PHYS CHEM C, vol. 111, 2007, pages 11806 - 11810
See also references of EP3842548A4
SU, X. D.ROBELEK, R.WU, Y. J.WANG, G. Y.KNOLL, W., ANAL. CHEM., vol. 76, 2004, pages 489 - 494
SUN, W. ET AL., SCIENCE, vol. 346, 2014, pages 1258361
THACKER, V. V. ET AL., NAT COMMUN, vol. 5, 2014, pages 3448
TRUONG, P. L.MA, X.SIM, S. J., NANOSCALE, vol. 6, 2014, pages 2307 - 2315
YANG, Y. ET AL., NUCLEICACIDS RES, vol. 33, 2005, pages 4322 - 4334

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113267477A (zh) * 2021-05-14 2021-08-17 云南大学 一种使用水溶性溴碘铯铅钙钛矿可视化检测以及定量检测水溶液中汞离子的方法
CN113267477B (zh) * 2021-05-14 2022-06-17 云南大学 一种使用水溶性溴碘铯铅钙钛矿可视化检测以及定量检测水溶液中汞离子的方法

Also Published As

Publication number Publication date
US20220364162A1 (en) 2022-11-17

Similar Documents

Publication Publication Date Title
Ma et al. Single gold-bridged nanoprobes for identification of single point DNA mutations
WO2017099313A1 (ko) 표면증강라만산란(sers) 나노입자, 이의 제조 방법 및 이의 응용
Guo et al. Facile fabrication of distance-tunable Au-nanorod chips for single-nanoparticle plasmonic biosensors
Zhang et al. Highly sensitive and reversible silicon nanowire biosensor to study nuclear hormone receptor protein and response element DNA interactions
Xu et al. Automatic enumeration of gold nanomaterials at the single-particle level
Liang et al. SERS-based cascade amplification bioassay protocol of miRNA-21 by using sandwich structure with biotin–streptavidin system
Shi et al. Gold nanoparticle aggregation: Colorimetric detection of the interactions between avidin and biotin
Chen et al. Sensitive colorimetric detection of protein by gold nanoparticles and rolling circle amplification
Guo et al. Single plasmonic nanoparticles for ultrasensitive DNA sensing: From invisible to visible
WO2019139383A1 (ko) 탈합금화 기반의 플라즈모닉 내부 나노갭 나노입자, 이의 제조방법 및 이의 용도
Lebedev et al. A virus-based nanoplasmonic structure as a surface-enhanced Raman biosensor
WO2020036438A1 (ko) 단일 금속 나노 브릿지 구조의 합성 방법 및 이를 이용한 dna 점돌연변이 검출 센서 제작 방법
KR101591475B1 (ko) 레일리 산란을 이용한 순환 종양 DNA(ctDNA)의 종양 특이적 돌연변이와 후성유전학적 변이의 동시 검출방법
Wang et al. Cu 2+ modulated DNA-templated silver nanoclusters as a turn-on fluorescence probe for the detection of quinolones
Li et al. Label-free DNA hybridization detection and single base-mismatch discrimination using CE-ICP-MS assay
Zhou et al. Ag-coated 3D Cu (OH) 2 nanowires on the woven copper mesh as a cost-effective surface-enhanced Raman scattering substrate
CN113293197A (zh) 一种检测疾病核酸标志物的spr-sers双模传感器、其制备方法及其应用
Park et al. On-chip plasmonic detection of microRNA-106a in gastric cancer using hybridized gold nanoparticles
US20190064139A1 (en) Integrated dielectrophoretic and surface plasmonic apparatus and methods for improvement in the detection of biological molecules
Lo et al. Monitoring of DNA–protein interaction with single gold nanoparticles by localized scattering plasmon resonance spectroscopy
WO2015178688A1 (ko) 금속증강형광용 코어-쉘 나노 복합체
KR102300360B1 (ko) 단일 금속 나노 브릿지 구조의 합성 방법 및 이를 이용한 dna 점돌연변이 검출 센서 제작 방법
WO2018151542A1 (ko) 구리 결정 과성장에 의한, 금 나노프로브를 이용한 표적 분석물질의 검출방법
Grueso et al. Reversible cationic gemini surfactant-induced aggregation of anionic gold nanoparticles for sensing biomolecules
Xie et al. Metal-mediated gold nanospheres assembled for dark-field microscopy imaging scatterometry

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 19849511

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2019849511

Country of ref document: EP

Effective date: 20210215