WO2020032379A1 - 사멸화 세포 처리 대식 세포 유래 엑소좀을 포함하는 암 예방 또는 치료용 조성물 - Google Patents

사멸화 세포 처리 대식 세포 유래 엑소좀을 포함하는 암 예방 또는 치료용 조성물 Download PDF

Info

Publication number
WO2020032379A1
WO2020032379A1 PCT/KR2019/007379 KR2019007379W WO2020032379A1 WO 2020032379 A1 WO2020032379 A1 WO 2020032379A1 KR 2019007379 W KR2019007379 W KR 2019007379W WO 2020032379 A1 WO2020032379 A1 WO 2020032379A1
Authority
WO
WIPO (PCT)
Prior art keywords
macrophages
cancer
cells
exosomes
derived
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/KR2019/007379
Other languages
English (en)
French (fr)
Inventor
이지희
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Ewha Womans University
Original Assignee
Ewha Womans University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Ewha Womans University filed Critical Ewha Womans University
Publication of WO2020032379A1 publication Critical patent/WO2020032379A1/ko
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Images

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/14Blood; Artificial blood
    • A61K35/15Cells of the myeloid line, e.g. granulocytes, basophils, eosinophils, neutrophils, leucocytes, monocytes, macrophages or mast cells; Myeloid precursor cells; Antigen-presenting cells, e.g. dendritic cells
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/1703Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • A61K38/1709Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/10Cellular immunotherapy characterised by the cell type used
    • A61K40/17Monocytes; Macrophages
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • A61P35/04Antineoplastic agents specific for metastasis
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06Animal cells or tissues; Human cells or tissues
    • C12N5/0602Vertebrate cells
    • C12N5/0634Cells from the blood or the immune system
    • C12N5/0645Macrophages, e.g. Kuepfer cells in the liver; Monocytes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2509/00Methods for the dissociation of cells, e.g. specific use of enzymes

Definitions

  • the present invention relates to a composition for preventing or treating cancer, the use thereof, and a method for treating cancer using the same, including apoptosis-derived macrophage-derived exosomes.
  • EMT Epithelial-mesenchymal transition
  • ETM epithelial-mesenchymal transition
  • Cancer is the life-threatening cause of cancer metastasis, and most deaths from cancer are explained by cancer metastasis.
  • the current clinically proven method for treating cancer is surgical surgery, even if the causative cancer is removed, the treatment of the patient becomes difficult by cancer cells that have metastasized to other tissues. Therefore, cancer conquest can be regarded as a fight against cancer metastasis, and much research is currently being conducted on the mechanism of cancer metastasis, but this situation does not lead to the development of a therapeutic agent.
  • exosomes are generically referred to as exosomes produced by fusion of MVB (Multivesicular bodies) with the plasma membrane and microvesicles generated by direct release from the plasma membrane, also called extracellular vesicles (extracellular vesicle).
  • MVB Multivesicular bodies
  • extracellular vesicles extracellular vesicle
  • Exosomes are small vesicles of membrane structure (approximately 30-100 nm in diameter) that are secreted from a variety of cells, and within the cells called multivesicular bodies (MVBs), rather than falling directly off the plasma membrane in an electron microscope study. Originated from specific compartments and released and secreted out of cells was observed. In other words, when fusion occurs between the polycystic body and the plasma membrane, the vesicles are released into the extracellular environment, which is called an exosome.
  • MVBs multivesicular bodies
  • exosomes are made of, but not only red blood cells, but also various immune cells and tumor cells, including B-lymphocytes, T-lymphocytes, dendritic cells, platelets, macrophages, etc. Death cells, stem cells, etc. are also known to produce and secrete exosomes in the living state.
  • exosomes contain a variety of substances having very different characteristics depending on their origin, it is necessary to proceed with research and development on characteristics derived from specific cells.
  • exosomes derived from macrophage exposed to apoptosis cells reach cancer cells, inhibit epithelial-mesenchymal cell conversion in cancer cells, inhibit cancer cell invasion, or prevent or treat cancer.
  • the present invention was completed by confirming the excellent effect.
  • An object of the present invention is to provide a pharmaceutical composition for the prevention or treatment of cancer, including exosomes derived from apoptosis-treated macrophages.
  • the present invention provides a pharmaceutical composition for preventing or treating cancer, including exosomes derived from apoptosis-treated macrophages.
  • the apoptotic cells are preferably epithelial cancer cells, and in accordance with a specific embodiment of the present invention, epithelial cancer cells are most preferred.
  • epithelial cancer cells are most preferred.
  • 344SQ cells, A549 cells, MDA-MB-231 cells, COLO320HSR cells, PC3 cells and the like but is not limited thereto.
  • the killed cells are preferably irradiated with UV light for 5 to 30 minutes at a wavelength of 100 to 400 nm, more preferably at 5 to 20 minutes at a wavelength of 150 to 350 nm, more preferably 200 to 300 It is most preferable to irradiate ultraviolet rays for 10 to 15 minutes at a wavelength of nm, but is not limited thereto.
  • the epithelial cancer cells may be incubated for 1 to 5 hours at 30 to 40 °C temperature under 1 to 10% CO 2 conditions in RPMI 1604 medium added with 10% FBS after UV irradiation.
  • the macrophages can be any of mouse and human origin and can be bone marrow-derived macrophage or monocyte-derived macrophages.
  • microglia histiocytes, Hofbauer cells, mesangial cells, Kupffer cells, peritoneal macrophages, alveolar macrophages macrophage, epidermal or dermal macrophages, marginal zone macrophages, metallophilic macrophages, red pulp macrophages, white pulp macrophages) and osteoclasts (osteoclasts).
  • the treatment may mean culturing apoptosis cells and macrophages together. That is, it may be an exosome isolated from the culture obtained by culturing apoptosis cells and macrophages together.
  • the method may be as follows, for example. Incubate in X-VIVO or serum-free DMEM medium for 20-30 hours before stimulating macrophages with apoptosis. According to a specific embodiment of the present invention, it is most preferable to incubate in X-VIVO medium for 24 hours to make the serum-deficient state. To stimulate, the culture medium can be replaced with X-VIVO or serum-free DMEM medium with killed cells. It is preferable to incubate apoptosis cells and macrophages together for 10 to 30 hours after the medium change, more preferably for 15 to 25 hours, and most preferably for 18 to 24 hours.
  • the exosomes are 40-120 nm nanovesicles secreted from cells, including the main histocompatibility complex (MHC) and heat shock protein, which are immunologically important proteins. It induces a strong anti-tumor immune response and includes anti-inflammatory microRNAs (microRNAs) and microRNAs (microRNAs) that regulate the accumulation of collagen. In addition, it is known to play various roles such as binding to other cells and tissues to deliver membrane components, proteins, RNA.
  • MHC main histocompatibility complex
  • heat shock protein which are immunologically important proteins. It induces a strong anti-tumor immune response and includes anti-inflammatory microRNAs (microRNAs) and microRNAs (microRNAs) that regulate the accumulation of collagen.
  • microRNAs anti-inflammatory microRNAs
  • microRNAs microRNAs
  • microRNAs microRNAs
  • centrifugation for example, in a culture medium, centrifugation, ultrafast centrifugation, filtration by filter, gel filtration chromatography, pre-flow electrophoresis, capillary electrophoresis, using polymer Separation may be carried out using a method such as separation and a combination thereof, preferably centrifugation / supercentrifugation.
  • centrifugation / supercentrifugation centrifugation may be performed sequentially at 100 to 300,000 g, preferably 150 to 150,000 g, to remove cell debris, non-exosome fraction, and dead cells.
  • the pharmaceutical composition of the present invention has an excellent effect on the prevention or treatment of cancer.
  • exosomes are uptake into cancer cells, inhibit EMT action and inhibit Akt / p38 signaling cascade to inhibit cancer cell infiltration and metastasis. Accordingly, it has an excellent effect on the prevention, treatment and suppression of metastasis of cancer. Furthermore, the use of the exosomes according to the present invention has the advantage of being safe for human body and excellent effect even with a small amount of administration compared to the direct administration of apoptosis cells, macrophages or control medium.
  • exosomes according to the present invention while containing a variety of components, in particular, PTEN protein inhibits the EMT action of cancer and shows an excellent effect on cancer metastasis through Akt / p38 signaling cascade inhibition.
  • the present invention is characterized by inhibiting EMT (epithelial-mesenchymal transition), characterized in that the early stage of cancer metastasis, such as cancer cell migration and infiltration due to the EMT inhibitory action.
  • EMT is a phenomenon in which epithelial cells are converted into mesenchymal cells, and cell adhesion substances such as E-cadherin are lost and morphological changes are induced in the process of cancer formation and metastasis, causing EMT to change the epithelial tumor cells. It is known to play various roles in the transition process.
  • TGF- ⁇ 1 was treated to induce EMT of cells and inhibited it through exosomes.
  • the cancer may be selected from various carcinomas that are not limited to a specific carcinoma.
  • it may be any one selected from the group consisting of lung cancer, breast cancer, prostate cancer and colon cancer.
  • the exosomes according to the present invention included in the pharmaceutical composition as an active ingredient, but is not limited thereto, at a concentration of 1 to 200 ⁇ g / ml, or at a concentration of 5 to 150 ⁇ g / ml, or 10 It may be included in the pharmaceutical composition at a concentration of from 100 ⁇ g / ml to the subject.
  • the pharmaceutical composition according to the present invention can be used alone as an anticancer therapy.
  • composition according to the present invention may be used simultaneously, separately or sequentially with radiation or an anticancer agent, if necessary.
  • the pharmaceutical composition may be administered as a separate therapeutic agent, or may be administered in combination with radiation or other therapeutic agents, and may be administered sequentially or simultaneously with conventional radiation or anticancer therapeutic agents.
  • the pharmaceutical composition may include a pharmaceutically effective amount of exosomes alone or may include one or more pharmaceutically acceptable carriers, excipients or diluents.
  • a pharmaceutically effective amount herein means an amount sufficient to prevent, ameliorate and treat the symptoms of cancer.
  • the pharmaceutically effective amount of the exosomes according to the present invention may be appropriately changed depending on the degree of symptoms of cancer, the age, weight, health condition, sex, route of administration and duration of treatment of the patient.
  • a suitable dosage may be 0.0001 to 100 mg / kg body weight.
  • the term "pharmaceutically acceptable” refers to a composition which, when administered physiologically and humanly, does not normally cause an allergic reaction such as gastrointestinal disorders, dizziness or the like.
  • carriers, excipients and diluents include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, Polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil.
  • fillers, anti-coagulants, lubricants, wetting agents, fragrances, emulsifiers and preservatives may be further included.
  • the pharmaceutical composition for preventing or treating cancer of the present invention may be administered in a unit dosage form suitable for administration in the body of a patient according to a conventional method in the pharmaceutical field.
  • Formulations suitable for this purpose include parenteral injectables such as injectable ampoules, injectables such as infusion bags, sprays such as aerosol preparations and the like.
  • the injection ampoule may be mixed with the injection solution immediately before use, and as the injection solution, physiological saline, glucose, mannitol, and Ringer's solution may be used.
  • the infusion bag may also be made of polyvinyl chloride or polyethylene and may be Baxter, Becton-Dickinson, Medcep, National Hospital Products, or Terumo.
  • An injection bag of a cinnamon yarn can be illustrated.
  • the pharmaceutical composition may contain one or more pharmaceutically acceptable inert carriers, for example, preservatives, analgesics, solubilizers or stabilizers in the case of injections, in addition to the active ingredient.
  • pharmaceutically acceptable inert carriers for example, preservatives, analgesics, solubilizers or stabilizers in the case of injections, in addition to the active ingredient.
  • Bases excipients, lubricants or preservatives and the like.
  • composition or pharmaceutical formulation of the present invention may be administered to mammals such as rats, mice, livestock, humans, etc. by various routes, such as parenteral or oral, and the administration method may be any method commonly used in the art. It can be administered by.
  • the present invention may be administered by oral, rectal or intravenous, intramuscular, subcutaneous, intrauterine dural or intracerebroventricular injection and the like.
  • the method of administration is not limited thereto, but the exosomes are administered intravenously (Intravenous injection), administered into the subject's lungs or organs (Topical administration), or by inhalation. Can be.
  • the exosomes can be administered using a nebulizer, it can be administered using an endotracheal tube.
  • the subject means all animals including humans having developed the resistant cancer, and the cancer may be treated by administering the composition of the present invention to the subject.
  • Treatment in the present invention means any action by which the cancer is improved or beneficially altered by administering the pharmaceutical composition of the present invention.
  • Administration in the present invention refers to the action of introducing the pharmaceutical composition of the present invention to a subject by any suitable method, the route of administration may be administered via various routes orally or parenterally as long as the target tissue can be reached.
  • the present invention also provides a pharmaceutical composition for inhibiting metastasis of cancer, including an exosome derived from apoptotic cell treated macrophages.
  • the composition according to the present invention is uptake into cancer cells (uptake), inhibits EMT action and inhibits Akt / p38 signaling cascade to inhibit the penetration and metastasis of cancer cells. Accordingly, it can be used as a composition for inhibiting metastasis of cancer.
  • the present invention provides a method of treating cancer comprising administering to a subject an exosome derived from apoptosis-treated macrophages.
  • the subject refers to an animal and may be a mammal, which may typically have a beneficial effect with treatment with exosomes derived from the apoptosis-treated macrophages of the invention.
  • Preferred examples of such subjects may include primates, such as humans.
  • such subjects may include all subjects having cancer symptoms or at risk of having such symptoms.
  • a method for inhibiting metastasis of cancer comprising administering to a subject an exosome derived from apoptosis-treated macrophages.
  • the invention also provides the use of exosomes derived from apoptotic treated macrophages in the manufacture of a medicament for the treatment of cancer.
  • compositions comprising exosomes derived from killed cell treated macrophages for use in the treatment of cancer.
  • the invention also provides the use of exosomes derived from apoptotic cell treated macrophages for the treatment of cancer.
  • the invention also provides a method for separating exosomes from apoptosis treated macrophages.
  • the method for separating exosomes from killed cell treated macrophages according to the present invention may comprise the following steps:
  • step (b) separating the supernatant from the culture solution of step (a);
  • step (c) separating the exosome from the supernatant of step (b).
  • the culturing of the apoptotic cells and the macrophages is carried out for 10-30 hours, preferably 15-25 hours, for example, in X-VIVO or serum-free DMEM medium containing the killed cells. More preferably 18 to 24 hours. Through such culture, exosomes can be contained in a large amount in the gastric culture.
  • the supernatant is separated from the culture solution by separating the supernatant from the culture solution by a conventional supernatant separation method.
  • a conventional supernatant separation method For example, it can be separated under conventional supernatant separation centrifugation conditions.
  • the step of separating the exosome from the supernatant of the step (b) may use a conventional known exosome separation method.
  • a conventional known exosome separation method for example, centrifugation, ultra-fast centrifugation, filtration by filter, gel filtration chromatography, pre-flow electrophoresis, capillary electrophoresis, separation using a polymer, and the like, and combinations thereof may be used.
  • centrifugation / supercentrifugation may be performed sequentially at 100 to 300,000 g, preferably 150 to 150,000 g, to remove cell debris, non-exosome fraction, and dead cells.
  • the pharmaceutical composition of the present invention is absorbed into cancer cells and inhibits epithelial-mesenchymal cell conversion in cancer cells and down-regulates Akt / p38 signal cascade, thereby inhibiting cancer cell infiltration, thereby having an excellent effect on preventing or treating cancer and inhibiting metastasis of cancer. have.
  • Figure 2 shows the results of confirming the uptake with cancer cells analyzed after exosomes and 344SQ or A549 cells according to the present invention, GFP fluorescence through confocal microscopy.
  • Figure 3 shows the results of confirming the uptake of exosomes by incubating the lysates from 344SQ or A549 cells after incubation with exosomes collected from overexpressing GFP-PTEN human macrophage line.
  • Figure 5 shows the results of normal acini of 344SQ grown on 3D Matrigel containing exosomes and stained with anti-b-catenin (shown in light gray on green, black and white drawings) and DAPI.
  • Figure 6 shows the results confirming that the level of increased PTEN in 344SQ cells is due to the PTEN secreted from the exosomes and not the expression of PTEN through stimulation of the cells themselves by specific molecules of the exosomes.
  • 7A is a TEM image of exosomes isolated from the conditioned medium of ApoSQ-stimulated RAW cells either pretreated or untreated with 20 ⁇ GW4869. Scale bar represents 20 mm.
  • FIG. 7B shows size distribution analysis of exosomes from conditioned media of ApoSQ-stimulated RAW cells pretreated with GW4869 or pretreated with vehicle (2% DMSO in saline).
  • the horizontal axis represents particle size (nm) and the vertical axis represents particle concentration (x106 particles / ml).
  • the bar above the solid line (black dot) represents s.e.m and the value represents the mode or mean size ⁇ s.e.m from three independent experiments.
  • FIG. 8 shows qPCR analysis of PTEN mRNA in 344SQ cells 12 hours after treatment with exosomes isolated from RAW conditioned medium with or without apoptotic 344SQ cells (ExoApoSQ CM). The experiment shows the results of three replicates (mean ⁇ s.e.m.).
  • GFP-PTEN overexpressing macrophages were prepared and used. Standard lentiviral transduction was performed to prepare GFP-PTEN overexpressing macrophages.
  • HEK293T cells were infected with pLV-EGFP-PTEN, packaging (psPAX2) and envelope (pCMV-VSV-G) vectors using TransIT ® -LT1 Transfection Reagent (MIR 2300, Mirus Bio, Madison, WI, USA) and incubated overnight It was. Reagents were replaced with fresh medium for lentiviral transduction and virus supernatants were collected every 24 hours after transfection.
  • Human macrophages (hM ⁇ ) differentiated from THP-1 monocytes were prepared by exposing the supernatant with 8 ⁇ g / ml polybrene for 4 hours every virus collection time and selecting infected cells using 1 ⁇ g / ml containing puromycin-containing medium. It was. Through this, GFP-PTEN overexpressing macrophages were prepared.
  • 344SQ cells or A549 cells were irradiated with UV light at 254 nm for 10 minutes, followed by 37 ° C., 5% CO 2 conditions in RPMI-1640 medium supplemented with 10% FBS. Incubated for 2 hours under The cell nuclear morphology evaluation using the Wright-Giemsa staining sample and the microscope confirmed that approximately 70-80% of cell death occurred in the UV-irradiated cells. Lysed necrotic epithelial cancer cells were obtained in several freeze-thaw cycles.
  • Serum-starved conditions were provided under X-VIVO 10 medium (04-380Q, Lonza) for 24 hours before stimulating gastric GFP-PTEN overexpressing macrophages.
  • the culture medium was replaced with X-VIVO 10 medium containing killed or necrotic cells (apoptotic 344SQ or apoptotic A549 cells, 1.5 ⁇ 10 6 cells / ml).
  • the supernatant was obtained by centrifugation and used as a conditioned medium for exosome purification.
  • the supernatant obtained above was subjected to sequential centrifugation of 200 g, 20,000 g, and 100,000 g to remove dead cells, cell debris, and non-exosome fractions. Wash exosome pellets with ice-cold PBS containing protease inhibitors and allow ultracentrifugation (Optima L-100K, Beckman Coulter Inc., Brea, Calif., USA) for 70 minutes at 100,000 g to remove contaminated protein. was repeated. Exosomal pellets were suspended in RIPA buffer containing protease inhibitors to prepare exosomes.
  • the prepared GFP-PTEN overexpressing THP-1 macrophages of Example 1 were grown in a 150 mm culture dish until reaching 70% confluency. Then, the cells were stimulated with dead A549 cells for 24 hours, and the conditioned medium was sequentially centrifuged. Exosome pellets were suspended in 200 ⁇ l serum free RPMI to prepare exosomes. The cells (A549 or 344SQ with 1 ⁇ 10 5 cells for confocal microscopy or 3 ⁇ 10 5 cells for western blot) were then exposed to 50 ⁇ l of purified exosomes for 24 hours.
  • GFP-PTEN in cells was visualized via direct fluorescence and also identified as anti-GFP using total cell lysate. The results are shown in FIG. As confirmed in Figure 2, uptake of exosome GFP-PTEN was confirmed.
  • CM of Example 1 conditional medium containing macrophages exposed to apoptotic cells
  • CM of Example 1 conditional medium containing macrophages exposed to apoptotic cells
  • Purified exosomes from or exosomes purified from macrophages not exposed to killer cells were treated with TGF- ⁇ 1 and 344SQ cells.
  • FIG. 4A shows the results of confirming changes in protein expression of the EMT signal. As confirmed in FIG. 4a, the exosomes according to Example 1 suppressed the EMT effect by down-regulating the EMT signal.
  • Single cell suspensions containing 5,000 cells / well were placed in solidified Growth Factor Reduced Matrigel (Corning Inc) in 8 well plates.
  • Cells in RPMI1640 containing 10% FBS and 2% Matrigel were cultured and the cultures were exchanged every two or three days for one week.
  • cells were treated with conditioned medium containing TGF- ⁇ 1 (10 ng / ml) and 2% Matrigel, and then photographed with a clipse TE-300 microscope (Nikon) while incubating for 12 hours.
  • exosomes purified from ApoSQ-exposed CM conditional medium containing macrophages exposed to apoptosis cells
  • exosomes purified from macrophages not exposed to apoptosis cells with or without TGF- ⁇ 1 344SQ cells were treated.
  • 344SQ cells were fixed with 4% PFA solution for 8 minutes at room temperature.
  • formalin fixation was performed at room temperature for 30 minutes and IF-Wash buffer (0.05% NaN 3 in PBS, 0.1% BSA, 0.2% Triton X-100 and 0.05% Tween-20) were used. After fixation, samples were washed three times with washing buffer for 5 minutes each and permeabilized with 0.5% Triton X-100 in PBS at room temperature for 5 minutes.
  • 5% BSA and Mouse IgG Blocking Reagent in PBS were used for ICC and IHC, respectively. All slides stained with antibodies were then mounted with Vectashield Mounting Medium containing DAPI and imaged with a confocal microscope (LSM 800, Carl Zeiss).
  • the test was performed by treating exosomes purified from ApoSQ-stimulated macrophages transfected with siRNAs. Was performed.
  • RAW 264.7 cells were transfected with the two PTEN siRNA or control siRNA sequences in Table 1 below.
  • PTEN (# 1) 5'-CAGGAAUGAACCAUCUACA-3 '(SEQ ID NO: 1) PTEN (# 1) 5'-UGUAGAUGGUUCAUUCCUG-3 '(SEQ ID NO: 2) PTEN (# 2) 5'-CUGAGUAGAAACAAGAGUA-3 '(SEQ ID NO: 3) PTEN (# 2) 5'-UACUCUUGUUUCUACUCAG-3 '(SEQ ID NO: 4)
  • RAW 264.7 cells were transfected with the sequence or control siRNA (SN-1003_AccuTargetTM Negative Control; Bioneer Inc) at a final concentration of 100 nM according to the manufacturer's manual. After transfection overnight, the cells were further cultured for 24 hours and stimulated with apoptotic 344SQ cells.
  • sequence or control siRNA SN-1003_AccuTargetTM Negative Control; Bioneer Inc
  • 6 a shows the result of confirming that PTEN expression was suppressed as a result of transformation.
  • exosome treatment from control siRNA-transfected macrophages followed by PTEN levels increased at 12 and 24 hours in 344SQ cells.
  • treatment of exosomes from PTEN knockdown macrophages did not change PTNE levels.
  • Exosomes secreted from macrophages were isolated by sequential centrifugation, morphologically analyzed by transmission electron microscopy (TEM) and characterized by nanoparticle tracking analysis (NTA) using NanoSight.
  • TEM transmission electron microscopy
  • NTA nanoparticle tracking analysis
  • TEM was performed by the following method. The exosomes divided by 10 ul was fixed with 4% paraformaldehyde at room temperature for 1 hour. 6 ul of fixed exosome solution was applied to a copper mesh formvar coated with a carbon stabilized grid, absorbed into the grid for 5 minutes, and then accelerated at 80 kV using TEM (H-7650; Hitachi). Analyze iTEM software was used to obtain the image.
  • NanoSight polystyrene latex calibration beads 100 nm and 200 nm were applied for instrument performance check. Exosome size was determined based on light scattering and Brownian motion, and was calculated using the Stokes-Einstein equation with NTA 3.0. NTA software was used to determine the concentration of particles (particles / ml) and particle distribution (nm) and three replicate measurements were performed.
  • TEM showed a isolate containing nano size vesicles and showed a decrease in samples treated with GW4869.
  • PTEN mRNA expression in 344SQ cells was tested 12 hours after treatment with exosomes purified from ApoSQ conditioned medium or conditioned medium.
  • the composition for preventing or treating cancer comprising exosomes derived from apoptosis cells reaches cancer cells, inhibits epithelial-mesenchymal cell conversion in cancer cells, and inhibits cancer cell invasion to prevent or treat cancer metastasis. Imply an excellent effect.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • General Health & Medical Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Engineering & Computer Science (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Medicinal Chemistry (AREA)
  • Hematology (AREA)
  • Zoology (AREA)
  • Epidemiology (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Cell Biology (AREA)
  • Developmental Biology & Embryology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Virology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Marine Sciences & Fisheries (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Oncology (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)

Abstract

본 발명은 사멸화 세포로부터 유래된 엑소좀을 포함하는 암의 예방 또는 치료용 조성물, 이의 용도, 및 이를 이용한 암의 치료 방법에 관한 것이다. 본 발명에 따른 엑소좀 조성물은 암세포로 흡수되고 암세포에서 상피-간엽 세포 전환을 억제하고, 암세포의 침윤을 억제함으로써 암의 예방 또는 치료에 우수한 효과가 있다.

Description

사멸화 세포 처리 대식 세포 유래 엑소좀을 포함하는 암 예방 또는 치료용 조성물
본 발명은 사멸화 세포 처리 대식세포 유래된 엑소좀을 포함하는 암의 예방 또는 치료용 조성물, 이의 용도, 및 이를 이용한 암의 치료 방법에 관한 것이다.
EMT(epithelial-mesenchymal transition, 상피세포의 간엽화 현상)는 상피세포가 간엽세포로 바뀌는 것으로 한 종류의 세포가 다른 종류의 세포로 분화하는 세포 형성성(cell plasticity)의 한 가지 형태이다. 최근에 EMT가 태생기의 조직 형성과 분화 외에도 조직의 재생과 섬유화, 암의 발생과 전이 과정에 다양한 역할을 하고 있다는 사실이 알려져 있다.
암의 진행과정에서는 종양세포의 국소적 침습(local invasion)과 전이가 일어나는데 이 과정에서 상피성 종양세포의 상피세포의 간엽전환(epithelial-mesenchymal transition, EMT)이 동반된다. 이 과정에서 간엽성 표현형을 나타내기 위해 특정 유전자의 전사 프로그램이 변화하며, 세포의 이동성이 증가하고, 세포-세포 사이, 혹은 세포-세포외기질 사이 상호작용이 변화한다고 알려져 있다.
암이 생명에 위협이 되는 가장 큰 원인은 암세포의 전이성에 있으며, 암으로 인한 사망의 대부분은 암 전이로 설명된다. 현재 임상적으로 입증된 보편적인 암 치료 방법이 외과 수술이지만, 원인이 되는 암이 제거되더라도 다른 조직으로 전이된 암세포에 의해 환자의 치료가 어렵게 된다. 따라서 암 정복은 실질적으로는 암 전이와의 싸움이라 볼 수 있으며, 현재 암 전이 기전에 관해 많은 연구가 진행되고 있으나, 이렇다 할 치료제 개발로 이어지지는 못하고 있는 실정이다.
한편, 엑소좀은 MVB(Multivesicular bodies)가 원형질막과 융합되어 생성되는 엑소좀과 원형질막에서 직접 방출되어 생성되는 마이크로베시클(microvesicle)을 총칭하는 것으로 세포밖 소포체(extracellular vesicle)라고도 한다.
최근 연구 보고에 따르면 엑소좀을 통해 세포 간 신호 전달 및 폐기 관리와 같은 과정에서 중요한 역할을 한다고 보고 되어 있어, 최근 임상 적용에 대한 관심이 증가하고 있다.
엑소좀은 다양한 세포들로부터 분비되는 막 구조의 작은 소낭(대략 30-100 nm의 직경)으로서, 전자현미경을 통한 연구에서 원형질막으로부터 직접 떨어져 나가는 것이 아니라 다낭체(multivesicular bodies, MVBs)라고 불리는 세포 내 특정 구획에서 기원하며 세포 밖으로 방출, 분비되는 것이 관찰되었다. 즉, 다낭체와 원형질막의 융합이 일어나면 소낭들은 세포 밖 환경으로 방출되는데, 이것을 엑소좀이라고 한다. 이러한 엑소좀이 어떤 분자적 기작에 의해 만들어지는지 확실히 밝혀진 바가 없으나, 적혈구 세포뿐만 아니라, B-림프구, T-림프구, 수지상 세포, 혈소판, 대식 세포 등을 포함한 다양한 종류의 면역 세포들과 종양 세포, 사멸세포, 줄기세포 등도 살아 있는 상태에서 엑소좀을 생산하여 분비한다고 알려졌다.
이러한 엑소좀은 이의 유래에 따라 매우 다른 특징을 가지고 있는 다양한 물질들을 포함하고 있기 때문에 특정 세포 유래에 따른 특성에 관한 연구 개발을 진행할 필요가 있다.
이러한 배경 하에, 본 발명자들은 사멸화 세포에 노출된 대식세포(macrophage)로부터 유래된 엑소좀이 암세포로 도달하고 암세포에서 상피-간엽 세포 전환을 억제하고, 암세포의 침윤을 억제함으로써 암의 예방 또는 치료에 우수한 효과를 나타냄을 확인하여 본 발명을 완성하였다.
본 발명의 목적은 사멸화 세포 처리된 대식 세포로부터 유래된 엑소좀을 포함하는 암의 예방 또는 치료용 약학 조성물을 제공하는 것이다.
본 발명의 목적은 사멸화 세포 처리된 대식 세포로부터 유래된 엑소좀을 포함하는 암의 전이 억제용 약학 조성물을 제공하는 것이다.
본 발명의 목적은 사멸화 세포 처리된 대식 세포로부터 엑소좀을 분리하는 방법을 제공하는 것이다.
본 발명은 사멸화 세포 처리된 대식 세포로부터 유래된 엑소좀을 포함하는 암의 예방 또는 치료용 약학 조성물을 제공한다.
본 발명에서 사멸화 세포(apoptotic cell)는 상피 암세포(epithelial cancer cells)를 이용하는 것이 바람직하며, 본 발명의 구체적인 실시예에 의하면 상피 암 세포인 것이 가장 바람직하다. 예를 들어, 344SQ 세포, A549 세포, MDA-MB-231 세포, COLO320HSR 세포, PC3 세포 등이 있으며, 이에 한정되지 않는다.
상기 사멸화 세포는 상피 암세포를 100 내지 400 nm 파장으로 5 내지 30분 동안 자외선을 조사하는 것이 바람직하며, 150 내지 350 nm 파장으로 5 내지 20분 동안 자외선을 조사하는 것이 더욱 바람직하며, 200 내지 300 nm 파장으로 10 내지 15분 동안 자외선을 조사하는 것이 가장 바람직하나, 이에 한정되는 것은 아니다.
상기 상피 암세포는 자외선 조사된 후, 10% FBS가 첨가된 RPMI 1604 배지에서 1 내지 10% CO2 조건하에서 30 내지 40℃ 온도로 1 내지 5시간 동안 배양할 수 있다.
상기 대식세포는 마우스 및 인간 유래 어느 것이든 가능하며, 골수유래 대식세포 (bone marrow-derived macrophage) 또는 단핵구 유래 대식세포 (monocyte-derived macrophages)일 수 있다. 또한, 소교세포(microglia), 조직구(histiocytes), 호프바우어세포(Hofbauer cells), 혈관사이세포(mesangial cells), 쿠퍼세포(Kupffer cells), 복강 대식세포(peritoneal macrophages), 폐포 대식세포 (alveolar macrophage), 표피 또는 진피 대식세포 (epidermal or dermal macrophages), 가장자리구역 대식세포 (marginal zone macrophages), 금속친화성 대식세포 (metallophilic macrophages), 적수 대식세포 (Red pulp macrophages), 백수 대식세포 (white pulp macrophages) 및 파골세포(osteoclasts)로 이루어진 군에서 선택될 수 있다.
상기 처리는 사멸화 세포와 대식세포를 함께 배양하는 것을 의미할 수 있다. 즉, 사멸화 세포와 대식세포를 함께 배양하여 얻은 배양액으로부터 분리된 엑소좀일 수 있다.
이의 방법은 예컨대 다음과 같을 수 있다. 사멸화 세포로 대식 세포를 자극 시키기 전, 20 내지 30시간 동안 X-VIVO 또는 무혈청 DMEM 배지에서 배양한다. 본 발명의 구체적인 실시예에 의하면 X-VIVO 배지에서 24시간 동안 배양하여 혈청-결핍 상태로 만드는 것이 가장 바람직하다. 자극하기 위해, 배양 배지를 사멸화 세포가 포함된 X-VIVO 또는 무혈청 DMEM 배지로 교체할 수 있다. 배지 교체 후 10 내지 30시간 동안 사멸화 세포와 대식세포를 함께 배양하는 것이 바람직하며, 15 내지 25시간 동안 배양하는 것이 더욱 바람직하며, 18 내지 24시간 동안 배양하는 것이 가장 바람직하다.
상기 엑소좀(exosome)은 세포들로부터 분비되는 40~120 nm 크기의 나노소포체로, 면역학적으로 중요한 단백질인 주조직적합체(main histocompatibility complex, MHC)와 열 충격 단백질(heat shock protein)을 포함하여 강력한 항종양 면역 반응을 유도하며, 항염증성의 마이크로 RNA(microRNA)와 콜라겐(collagen)의 축적을 조절하는 마이크로 RNA(microRNA)를 포함한다. 또한, 다른 세포 및 조직에 결합하여 막 구성요소, 단백질, RNA를 전달하는 등 다양한 역할을 하는 것으로 알려져 있다.
본 발명에서 엑소좀을 분리하는 방법에는 제한이 없으며, 예를 들면 배양액에서, 원심분리, 초고속 원심분리, 필터에 의한 여과, 겔 여과 크로마토그래피, 프리-플로우 전기영동, 모세관 전기영동, 폴리머를 이용한 분리 등의 방법 및 이들의 조합을 이용하여 분리할 수 있으며, 바람직하게는 원심분리/초원심분리이다. 이때, 원심분리/초원심분리는, 100 내지 300,000 g, 바람직하게 150 내지 150,000 g에서 순차적으로 원심분리를 수행하여 세포 찌꺼기, 비-엑소좀 분획, 죽은 세포 등을 제거할 수 있다.
본 발명의 약학 조성물은 암의 예방 또는 치료에 우수한 효과를 가진다.
구체적으로, 엑소좀은 암세포로 흡수(uptake)되며, EMT 작용을 억제하고 Akt/p38 신호 cascade 억제하여 암세포의 침투 및 전이를 억제한다. 이에 따라 암의 예방, 치료 및 전이 억제에 우수한 효과를 가진다. 더욱이 본 발명에 따른 엑소좀의 이용은 사멸화세포, 대식세포 또는 조정 배지를 직접 투여하는 것과 대비하여 인체에 안전하고 소량의 투여로써도 우수한 작용 효과를 나타낼 수 있다는 장점을 지닌다.
또한 본 발명에 따른 엑소좀은 다양한 성분을 함유하면서도 특히 PTEN 단백질을 함유함으로써 암의 EMT 작용을 억제하고 Akt/p38 신호 cascade 억제를 통한 암 전이에 우수한 효과를 보인다.
보다 구체적으로, 본 발명은 EMT(epithelial-mesenchymal transition)를 억제하는 것을 특징으로 하며, EMT 억제작용으로 인한 암세포 이동 및 침투 등 암 전이 초기 단계를 억제하는 것을 특징으로 한다. EMT는 상피세포가 간엽세포로 바뀌는 현상으로, 암 형성 및 전이 과정에서 E-cadherin 등의 세포 접착 물질이 소실되고 형태학적 변화가 유발되어 상피성 종양세포의 변화를 유발시켜 EMT가 암의 진행 및 전이 과정에 다양한 역할을 한다고 알려져 있다. 본 발명의 구체적인 실시예에서는 TGF-β1을 처리하여 세포의 EMT를 유발하고 이를 엑소좀을 통하여 억제하였다.
본 발명에 있어서 암은 특정 암종에 한정되지 않은 다양한 암종 중 선택되는 것일 수 있다. 예컨대, 폐암, 유방암, 전립선암 및 대장암으로 이루어진 군으로부터 선택되는 어느 하나일 수 있다.
본 발명에 있어서, 약학 조성물에 유효성분으로 포함되는 본 발명에 따른 엑소좀은, 이에 제한되지는 않으나, 1 내지 200 ㎍/㎖의 농도로, 또는 5 내지 150 ㎍/㎖의 농도로, 또는 10 내지 100 ㎍/㎖의 농도로 약학 조성물에 포함되어 개체에 처리될 수 있다.
본 발명에 따른 약학 조성물은 단독의 항암 요법으로 이용될 수 있다.
또한 본 발명에 따른 약학 조성물은 상황에 따라 필요하다면 방사선 또는 항암제와 동시, 분리 또는 순차적으로 사용될 수 있다.
구체적으로, 상기 약학 조성물은 개별 치료제로 투여하거나, 방사선 또는 다른 치료제와 병용하여 투여될 수 있고, 종래의 방사선 치료 또는 항암 치료제와는 순차적 또는 동시에 투여될 수 있다. 또한, 단일 또는 다중 투여될 수 있으며, 상기 요소를 모두 고려하여 부작용 없이 최소한의 양으로 최대 효과를 얻을 수 있는 양을 투여하는 것이 중요하다.
발명에 있어서, 상기 약학 조성물은 약학적으로 유효한 양의 엑소좀을 단독으로 포함하거나 하나 이상의 약학적으로 허용되는 담체, 부형제 또는 희석제를 포함할 수 있다. 상기에서 약학적으로 유효한 양이란 암의 증상을 예방, 개선 및 치료하기에 충분한 양을 의미한다.
본 발명에 따른 엑소좀의 약학적으로 유효한 양은 암의 증상 정도, 환자의 연령, 체중, 건강상태, 성별, 투여 경로 및 치료 기간 등에 따라 적절히 변화될 수 있다. 예컨대 적절한 투여량은 0.0001 내지 100 mg/체중kg일 수 있다.
또한, 상기 "약학적으로 허용되는"이란 생리학적으로 허용되고 인간에게 투여될 때, 통상적으로 위장 장애, 현기증과 같은 알레르기 반응 또는 이와 유사한 반응을 일으키지 않는 조성물을 의미한다. 상기 담체, 부형제 및 희석제의 예로는, 락토즈, 덱스트로즈, 수크로즈, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말티톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로즈, 폴리비닐피롤리돈, 물, 메틸하이드록시벤조에이트, 프로필하이드록시벤조에이트, 탈크, 마그네슘 스테아레이트 및 광물유를 들 수 있다. 또한, 충진제, 항응집제, 윤활제, 습윤제, 향료, 유화제 및 방부제 등을 추가로 포함할 수 있다.
상기 본 발명의 암 예방 또는 치료용 약학 조성물은 약학적 분야에서 통상의 방법에 따라 환자의 신체 내 투여에 적합한 단위투여형의 제제로 제형화시켜 투여할 수 있다. 이러한 목적에 적합한 제형으로는 비경구투여 제제로서 주사용 앰플과 같은 주사제, 주입 백과 같은 주입제, 및 에어로졸 제제와 같은 분무제 등이 바람직하다. 상기 주사용 앰플은 사용 직전에 주사액과 혼합 조제할 수 있으며, 주사액으로는 생리 식염수, 포도당, 만니톨, 링거액 등을 사용할 수 있다. 또한, 주입 백은 염화폴리비닐 또는 폴리에틸렌 재질의 것을 사용할 수 있으며, 박스터 (Baxter), 벡톤 디킨슨(Becton-Dickinson), 메드셉(Medcep), 내셔날 호스피탈 프로덕츠(National Hospital Products) 또는 테루모(Terumo)사의 주입 백을 예시할 수 있다.
상기 약학 조성물에는 상기 유효성분 외에 하나 또는 그 이상의 약학적으로 허용가능한 통상의 불활성 담체, 예를 들어, 주사제의 경우에는 보존제, 무통화제, 가용화제 또는 안정화제 등을, 국소 투여용 제제의 경우에는 기제 (base), 부형제, 윤활제 또는 보존제 등을 추가로 포함할 수 있다.
이렇게 제조된 본 발명의 조성물 또는 약학적 제제는 쥐, 생쥐, 가축, 인간 등의 포유동물에 비경구, 경구 등의 다양한 경로로 투여될 수 있으며, 투여 방법은 당업계에서 통상적으로 사용하는 모든 방식에 의해 투여될 수 있다. 이에 제한되지는 않으나, 경구, 직장 또는 정맥, 근육, 피하, 자궁내 경막 또는 뇌혈관 내 (intracerebroventricular) 주사 등에 의해 투여될 수 있다.
구체적으로, 투여 방법은 이에 제한되지는 않으나, 엑소좀을 정맥 내로 투여(정맥주사; Intravenous injection)하거나, 대상체의 폐 또는 기관 내로 투여(국소 투여; Topical administration)하거나, 흡입(inhalation)에 의해 투여될 수 있다. 또한, 상기 엑소좀은 네블라이져 (nebulizer)를 사용하여 투여될 수 있으며, 기관 내 튜브를 사용하여 투여될 수 있다.
본 발명에서 개체란 상기 내성 암이 발병된 인간을 포함한 모든 동물을 의미하며, 본 발명의 조성물을 개체에 투여함으로써, 암을 치료할 수 있다.
본 발명에서 치료란 본 발명의 약학 조성물을 투여함으로써, 암이 호전되거나 이롭게 변경시키는 모든 행위를 의미한다.
본 발명에서 투여란 어떠한 적절한 방법으로 대상에게 본 발명의 약학 조성물을 도입하는 행위를 의미하며, 투여 경로는 목적 조직에 도달할 수 있는 한 경구 또는 비경구의 다양한 경로를 통하여 투여될 수 있다.
본 발명은 또한 사멸화 세포 처리된 대식 세포로부터 유래된 엑소좀을 포함하는 암의 전이 억제용 약학 조성물을 제공한다.
앞서 살핀바와 같이, 본 발명에 따른 조성물은 암세포로 흡수(uptake)되며, EMT 작용을 억제하고 Akt/p38 신호 cascade 억제하여 암세포의 침투 및 전이를 억제한다. 이에 따라 암의 전이 억제용 조성물로 이용될 수 있다.
본 발명은 사멸화 세포 처리된 대식 세포로부터 유래된 엑소좀을 대상체에 투여하는 단계를 포함하는 암의 치료방법을 제공한다.
본 발명에 "사멸화 세포 처리된 대식 세포로부터 유래된 엑소좀", "암", "투여" 등의 용어는 상기에서 설명한 바와 동일하다.
상기 대상체는 동물을 말하며, 전형적으로 본 발명의 사멸화 세포 처리된 대식 세포로부터 유래된 엑소좀을 이용한 치료로 유익한 효과를 나타낼 수 있는 포유동물일 수 있다. 이러한 대상체의 바람직한 예로 인간과 같은 영장류가 포함될 수 있다. 또한 이와 같은 대상체들에는 암의 증상을 갖거나 이와 같은 증상을 가질 위험이 있는 대상체들이 모두 포함될 수 있다.
사멸화 세포 처리된 대식 세포로부터 유래된 엑소좀을 대상체에 투여하는 단계를 포함하는 암의 전이 억제 방법을 제공한다.
본 발명은 또한 암의 치료를 위한 약제의 제조에서 사멸화 세포 처리된 대식 세포로부터 유래된 엑소좀의 용도를 제공한다.
본 발명은 또한 암의 치료에 사용하기 위한 사멸화 세포 처리된 대식 세포로부터 유래된 엑소좀을 포함하는 조성물을 제공한다.
본 발명은 또한 암의 치료를 위한 사멸화 세포 처리된 대식 세포로부터 유래된 엑소좀의 용도를 제공한다.
본 발명은 또한 사멸화 세포 처리된 대식 세포로부터 엑소좀을 분리하는 방법을 제공한다.
본 발명에 따른 사멸화 세포 처리된 대식 세포로부터 엑소좀을 분리하는 방법은 아래 단계를 포함할 수 있다 :
(a) 사멸화 세포를 대식 세포와 배양하는 단계;
(b) 상기 (a) 단계의 배양액으로부터 상층액을 분리하는 단계; 및
(c) 상기 (b) 단계의 상층액으로부터 엑소좀을 분리하는 단계.
상기 (a) 단계에 있어서 사멸화 세포와 대식세포의 배양은 예를 들어 사멸화 세포가 포함된 X-VIVO 또는 무혈청 DMEM 배지에 대식세포를 10 내지 30시간 동안, 바람직하게 15 내지 25시간 동안, 보다 바람직하게 18 내지 24시간 동안 배양하는 단계를 포함할 수 있다. 이러한 배양을 통해 엑소좀이 위 배양액에 다량 포함될 수 있다.
상기 (b) 단계에 있어서, 배양액으로부터 상층액을 분리는 통상의 상층액 분리 방법에 의한 배양액으로부터의 상층액 분리이다. 예컨대 통상의 상층액 분리 원심분리 조건 하에 분리할 수 있다.
상기 (c) 단계에 있어서, 상기 (b) 단계의 상층액으로부터 엑소좀을 분리하는 단계는 통상의 알려진 엑소좀 분리 방법을 이용할 수 있다. 예컨대, 원심분리, 초고속 원심분리, 필터에 의한 여과, 겔 여과 크로마토그래피, 프리-플로우 전기영동, 모세관 전기영동, 폴리머를 이용한 분리 등의 방법 및 이들의 조합을 이용하여 분리할 수 있으며, 바람직하게는 원심분리/초원심분리이다. 이때, 원심분리/초원심분리는, 100 내지 300,000 g, 바람직하게 150 내지 150,000 g에서 순차적으로 원심분리를 수행하여 세포 찌꺼기, 비-엑소좀 분획, 죽은 세포 등을 제거할 수 있다.
다른 식으로 정의되지 않는 한, 본 명세서에서 사용된 모든 기술적 및 과학적 용어들은 본 발명이 속하는 기술 분야에서 숙련된 전문가에 의해서 통상적으로 이해되는 것과 동일한 의미를 갖는다. 일반적으로, 본 명세서에서 사용된 명명법은 본 기술분야에서 잘 알려져 있고 통상적으로 사용되는 것이다.
본 발명의 약학 조성물은 암세포로 흡수되고 암세포에서 상피-간엽 세포 전환을 억제하고 Akt/p38 신호 cascade를 하향 조절함으로써, 암세포의 침윤을 억제하여 암의 예방 또는 치료와 암의 전이 억제에 우수한 효과가 있다.
도 1은 항-GFP 및 CD63 항체를 사용하여 웨스턴 블랏 분석을 통해 비수용성 구획에서 엑소좀 PTEN의 존재를 확인한 결과를 나타낸다. (sol: 수용성, Ins: 불용성)
도 2는 본 발명에 따른 엑소좀과 344SQ 또는 A549 세포 처리 후, GFP 형광을 공초점 현미경을 통해 분석한 암세포로 uptake를 확인한 결과를 나타낸다.
도 3은 과발현 GFP-PTEN 인간 대식세포 주로부터 수거된 엑소좀으로 함께 배양 후 344SQ 또는 A549 세포로부터의 용해물을 웨스턴 블랏으로 분석하여 엑소좀의 uptake를 확인한 결과를 나타낸다.
도 4는 사멸화 암 세포로 자극된 대식세포로부터의 정제된 엑소좀의 EMT 억제, Akt/p38 signal cascades의 인산화 억제를 확인한 결과를 나타낸다. (h: 시간, ExoCM: 사멸세포 미처리 대식세포로부터 엑소좀 ExoApoSQCM: 사멸세포 처리 대식세포로부터 엑소좀)
도 5는 344SQ의 정상 acini를 엑소좀을 함유하는 3D Matrigel에 자라게 하고 항-b-카테닌(녹색, 흑백 도면상에서는 연한 회색으로 보임) 및 DAPI로 염색한 결과를 나타낸다.
도 6은 344SQ 세포에서 증가된 PTEN의 수준이 엑소좀에서 분비된 PTEN에 의한 것이고 엑소좀의 특정 분자에 의한 세포 자체의 자극을 통한 PTEN의 발현이 아닌 것을 확인한 결과를 나타낸다.
도 7의 a는 20 μM GW4869로 전처리되거나 되지 않은 ApoSQ-stimulated RAW 세포의 조건배지로부터 분리된 엑소좀의 TEM 이미지이다. 스케일 바는 20 mm을 나타낸다.
도 7의 b는 GW4869로 전처리되거나 비히클(식염수 내 2 % DMSO)로 전처리된 ApoSQ-stimulated RAW 세포의 조건 배지로부터 엑소좀의 크기 분포 분석을 나타낸다. 가로 축은 입자 크기 (nm)를 나타내고, 세로 축은 입자 농도(x106 particles/ml)를 나타낸다. 실선 위 바(검은색 점)는 s.e.m을 나타내고, 값은 세개의 독립된 실험으로부터 모드(mode) 또는 평균 크기 ± s.e.m를 나타낸다.
도 8은 apoptotic 344SQ 세포(ExoApoSQ CM)로 또는 apoptotic 344SQ 세포없이(ExoCM) RAW 조건 배지로부터 분리된 엑소좀으로 처리 12시간 후 344SQ 세포에서 PTEN mRNA의 qPCR 분석을 나타낸다. 실험은 3회 반복 수행된 결과를 나타낸다 (mean ± s.e.m.).
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 본 발명을 보다 구체적으로 설명하기 위한 것으로, 본 발명의 범위가 이들 실시예에 의해 제한되는 것은 아니다.
실시예 1. 사멸화 세포 유래 엑소좀의 제조
GFP-PTEN 과발현 대식세포를 제조하여 사용하였다. GFP-PTEN 과발현 대식세포의 제조를 위해서 표준 렌티바이러스 transduction을 수행하였다. HEK293T 세포를 TransIT®-LT1 Transfection Reagent (MIR 2300, Mirus Bio, Madison, WI, USA)를 사용하여 pLV-EGFP-PTEN, packaging (psPAX2) 및 envelope (pCMV-VSV-G) 벡터로 감염시키고 밤새 배양하였다. 렌티바이러스 transduction을 위해 시약을 신선한 배지로 대체하고 바이러스 상층액을 형질감염 후 24시간마다 수집하였다. THP-1 monocyte로부터 분화된 인간 대식세포(hMФ)를 매 바이러스 수집 시간 4시간 동안 8 μg/ml polybrene로 상층액을 노출시키고 감염된 세포를 1 μg/ml 함유 퓨로마이신 함유 배지를 사용하여 선택하여 제조하였다. 이를 통해 GFP-PTEN 과발현 대식세포를 제조하였다.
또한, 사멸화 또는 괴사된 세포를 제조하기 위해, 344SQ 세포 또는 A549 세포는 254 nm 파장으로 10분 동안 자외선 조사된 후, 10% FBS가 첨가된 RPMI-1640 배지에서 37℃, 5% CO2 조건하에서 2시간 동안 배양하였다. Wright-Giemsa 염색 시료와 현미경을 이용한 세포 핵 형태 평가에서 대략 70 내지 80%의 세포 사멸이 자외선 조사 세포에서 나타남을 확인하였다. 용해된 괴사(necrotic) 상피 암세포는 여러 번의 동결-해동 사이클로 수득하였다. 세포의 사멸 및 괴사는 아넥신 V-FITC/요오드화프로피디움(Annexin V-FITC/propidium iodide)(BD Biosciences, San Jose, CA)으로 염색한 후, FACSCalibur system(BD Biosciences)을 이용한 유세포 분석(flow cytometric analysis)을 수행하여 확인하였다.
그리고 나서, 상기 과발현 대식세포와 사멸화 A549 세포와 공동배양을 수행하였다.
구체적으로, 위 GFP-PTEN 과발현 대식세포를 자극하기 전에 24시간 동안 X-VIVO 10 배지 (04-380Q, Lonza) 하에서 Serum-starved 조건을 제공하였다. 자극을 위하여 배양 배지를 사멸화 또는 괴사된 세포 (apoptotic 344SQ 또는 apoptotic A549 세포, 1.5 X 106 cells/ml)를 포함하는 X-VIVO 10 배지로 교체하였다. 24시간 후 상층액을 원심분리를 통해 획득하고 엑소좀 정제를 위해 조건배지로 사용하였다.
위 획득된 상층액을 200 g, 20,000 g 및 100,000 g의 순차적 원심분리 대상으로 하여 죽은 세포, 세포 찌꺼기, 비-엑소좀 분획을 제거하였다. 프로테아제 억제제를 포함하는 ice-cold PBS로 엑소좀 펠렛을 세척하고, 초원심분리(Optima L-100K, Beckman Coulter Inc., Brea, CA, USA)를 오염된 단백질을 제거하기 위해 100,000 g에서 70분 동안 반복하였다. 엑소좀 펠렛을 프로테아제 억제제를 포함하는 RIPA 버퍼로 현탁하여, 엑소좀을 제조하였다.
실시예 2. 제조된 엑소좀의 확인
위 제조된 엑소좀을 확인하기 위하여 웨스턴 블랏을 수행하였다.
웨스턴 블랏을 항-CD63 (ab216130, Abcam) 또는 항-GFP PTEN (9559, Cell Signaling Technology)로 조건 배지 내 엑소좀-PTEN의 확인을 위해 수행하였다.
그 결과를 도 1에 나타내었다.
도 1에서 확인되는 바와 같이, 비수용성 구획에서 엑소좀 및 이에 포함된 PTEN의 존재를 확인하였다.
실시예 3. 암세포로의 엑소좀의 Uptake 확인
상기 실시예 1의 제조된 GFP-PTEN 과발현 THP-1 대식세포를 150 mm 배양 접시에 70 % confluency에 도달할 때까지 키웠다. 그리고 나서, 사멸 A549 세포로 24시간 자극하고, 조건 배지를 순차적 원심분리하였다. 엑소좀 펠렛을 200 μl 무혈청 RPMI로 현탁하여 엑소좀을 제조하였다. 그리고 나서, 세포 (공초점 현미경을 위한 1 × 105 세포 또는 웨스턴 블랏을 위한 3 × 105 세포로 A549 또는 344SQ)를 50 μl의 정제된 엑소좀에 24시간 동안 노출하였다.
세포에서 GFP-PTEN을 직접 형광을 통해 시각화하고 또한 총 세포 용해물을 사용하여 항-GFP로 확인하였다. 그 결과를 도 2에 나타내었다. 도 2에서 확인되는 바와 같이, 엑소좀 GFP-PTEN의 흡수(uptake)가 확인되었다.
또한 위 실험 조건과 유사하게 웨스턴 블랏을 통해서 엑소좀 GFP-PTEN이 암세포에 흡수되는 것을 항-GFP 항체로 다시 확인하여 그 결과를 도 3에 나타내었다. 도 3에서 확인되는 바와 같이, 엑소좀을 암 세포로 흡수하는 것을 웨스턴 블랏을 통해서도 확인하였다.
상기 결과를 통해서 사멸화 세포에 노출된 대식세포로부터 유래된 엑소좀이 암세포로의 이동 및 흡수(uptake)를 확인하였다.
실시예 4. 엑소좀의 EMT 및 Akt/p38 신호 cascade의 하향조절 확인
EMT 및 Akt/p38 신호 cascade, 암 세포 침투에 대한 대식세포로부터 분비된 엑소좀의 영향을 확인하기 위해 상기 실시예 1의 ApoSQ-exposed CM(사멸화 세포에 노출된 대식세포를 포함하는 조건 배지)으로부터 정제된 엑소좀 또는 사멸화세포에 노출되지 않은 대식세포로부터 정제된 엑소좀을 TGF-β1과 344SQ 세포에 처리하였다.
이를 분석한 결과를 도 4에 나타내었다.
도 4의 a는 EMT 신호의 단백질 발현 변화를 확인한 결과를 나타낸다. 도 4의 a에서 확인되는 바와 같이 실시예 1에 따른 엑소좀은 EMT 신호를 하향 조절함으로써 EMT 효과를 억제하였다.
도 4의 b 및 c는 Akt/p38 신호 cascade를 나타낸다. 도 4의 b 및 c에서 확인되는 바와 같이 실시예 1에 따른 엑소좀은 Akt/p38 신호 cascade를 하향조절함으로써 암의 침투 및 전이를 억제하는 효과를 나타낸다.
실시예 5. 엑소좀의 항-침투 효과 확인
5,000 cells/well을 포함하는 단일 세포 현탁액을 8 웰 플레이트 내 solidified Growth Factor Reduced Matrigel (Corning Inc)에 위치시켰다. 10% FBS 및 2% Matrigel을 포함하는 RPMI1640 내 세포를 배양하고 배양액을 일주간 매 2일 또는 3일에 교환하였다. 배양 후, 세포를 TGF-β1 (10 ng/ml) and 2% Matrigel를 포함하는 조건 배지로 처리하고, 그리고 나서 12시간 동안 배양하면서 clipse TE-300 microscope (Nikon)으로 촬영하였다. 배양 조건에서는 ApoSQ-exposed CM(사멸화 세포에 노출된 대식세포를 포함하는 조건 배지)으로부터 정제된 엑소좀 또는 사멸화세포에 노출되지 않은 대식세포로부터 정제된 엑소좀을 TGF-β1과 함께 또는 없이 344SQ 세포에 처리하였다.
상기 반응 후, 344SQ 세포를 상온에서 8분간 4% PFA 용액으로 고정시켰다. Matrigel 3-D 배양에서 344SQ acini, 파라핀 포매 종양 또는 동결 피부 조직을 염색하기 위해, 포말린 고정을 30분 동안 상온에서 수행하고 IF-Wash buffer (PBS 내 0.05% NaN3, 0.1% BSA, 0.2% Triton X-100 and 0.05% Tween-20)를 사용하였다. 고정 후, 시료를 각각 5분 동안 워싱 버퍼로 3회 워싱하고 5분간 상온에서 PBS 내 0.5 % Triton X-100로 permeabilize하였다. PBS 내 5% BSA 및 Mouse IgG Blocking Reagent가 ICC 및 IHC를 위해 각각 사용되었다. 이어서, 항체로 염색된 모든 슬라이드는 DAPI를 포함하는 Vectashield Mounting Medium로 마운팅되고 confocal microscope (LSM 800, Carl Zeiss)로 이미지화하였다.
그 결과를 도 5에 나타내었다. 도 5에 나타낸 바와 같이 정제된 엑소좀으로 처리가 3D Matrigel 배양에서 TGF-β1에 의해 유도되는 344SQ 세포의 polarized acinar 구조 형성 억제효과를 반전시켰다. 이러한 결과는 엑소좀 처리로 인한 항-침투 효과가 나타남을 의미한다.
실시예 6. 엑소좀 PTEN에 의한 효과 확인
대식세포로부터 엑소좀의 특정 분자에 의한 자극될 수 있는 암세포 자체에서의 PTEN 발현에 의한 효과가 아님을 확인하기 위하여, siRNA를 형질감염시킨 ApoSQ-stimulated 대식세포로부터 정제된 엑소좀을 처리하여 시험을 수행하였다.
RAW 264.7 세포를 하기 표 1의 2종의 PTEN siRNA 또는 대조군 siRNA 서열로 형질 감염시켰다.
PTEN (#1) 5'-CAGGAAUGAACCAUCUACA-3' (서열번호 1)
PTEN (#1) 5'-UGUAGAUGGUUCAUUCCUG-3'(서열번호 2)
PTEN (#2) 5'-CUGAGUAGAAACAAGAGUA-3' (서열번호 3)
PTEN (#2) 5'-UACUCUUGUUUCUACUCAG-3' (서열번호 4)
구체적으로, GeneSilencer® siRNA Transfection Reagent (Genlantis Inc)을 사용하여 제조사 매뉴얼에 따라 100 nM의 최종 농도로 상기 서열 또는 control siRNA (SN-1003_AccuTargetTM Negative Control; Bioneer Inc)로 RAW 264.7 세포를 형질 감염 시켰다. 밤새 형질 감염 후, 세포를 24시간 더 배양하고 apoptotic 344SQ 세포로 자극하였다.
그 결과를 도 6에 나타내었다.
도 6의 a는 형질전환 결과 PTEN 발현이 억제되었음을 확인한 결과를 나타낸다.
도 6의 b에 따르면, 대조군 siRNA-transfected 대식세포로부터 엑소좀 처리에 이어서 344SQ 세포에서 PTEN 수준이 12시간 및 24시간에 증가하였다. 그러나, PTEN knockdown 대식세포로부터 엑소좀의 처리는 PTNE 수준에 변화를 가져오지 못했다. 이 결과는 344SQ 세포에서 증가된 PTEN의 수준이 대식세포에서 분비된 엑소좀으로부터 유래된 PTEN에 의한 것이고 엑소좀의 특정 분자에 의한 세포 자체의 자극을 통한 PTEN의 발현이 아닌 것을 보여준다.
실시예 7. 전달을 위한 엑소좀의 역할 확인
전달을 위한 엑소좀의 역할을 입증하기 위하여, 엑소좀 biogenesis/release 억제제인 GW4869 20 μM으로 Raw 세포를 전처리하고, 이어서 ApoSQ로 처리하였다. 대식세포로부터 분비된 엑소좀은 순차적 원심분리를 통해 분리하였고, 투과 전자 현미경(TEM)을 통해 형태학적으로 분석하고 NanoSight를 사용하여 나노파티클 추적 분석(NTA)로 특징화하였다.
구체적으로 TEM은 다음 방법으로 수행하였다. 엑소좀을 10 ul로 나눈 것을 1 시간 동안 상온에서 4 % 파라포름알데히드로 고정하였다. 고정된 엑소좀 용액 6 ul을 탄소 안정화된 그리드로 코팅된 구리 메쉬 포름바(Formvar)에 도포하고, 5분간 그리드로 흡수시킨 후, TEM(H-7650; Hitachi)을 사용하여 80 kV의 가속 전압에서 분석하였다. iTEM software를 이미지를 얻기 위해 사용하였다.
구체적으로 나노파티클 추적 분석은 NanoSight NS300 system (Malvern Instruments, United Kingdom)을 이용하여 수행하였다. 100 nm 및 200 nm의 NanoSight 폴리스티렌 라텍스 캘리브레이션 비드를 기기 성능 체크를 위해 적용하였다. 엑소좀의 크기는 light scattering 및 Brownian motion을 기반으로 결정하였고, NTA 3.0으로 Stokes-Einstein equation을 사용하여 계산하였다. NTA 소프트웨어를 입자(입자/ml)의 농도 및 입자 분포(nm)를 측정하기 위해 사용하였고, 3회 반복 측정을 수행하였다.
도 7의 a에서 확인할 수 있는 바와 같이, TEM은 나노 크기 베지클을 함유하는 분리물을 보여주었고, GW4869로 처리된 샘플에서 감소된 것을 보여주었다.
또한, 도 7의 b에서 확인할 수 있는 바와 같이, GW4869의 전처리 유무는 대식세포로부터 엑소좀의 크기 분포에 영향을 주지 않았으며, 엑소좀의 농도만이 GW4869 처리로 인해 감소하는 것을 확인할 수 있었다.
실시예 8. recipient 344SQ 세포에서 증가된 PTEN 단백질 수준이 엑소좀의 특정 분자에 의해 자극된 PTEN mRNA 전사에 의한 초기 phase에 영향을 받는 것인지에 관한 확인
ApoSQ 조건 배지 또는 조건배지로부터 정제된 엑소좀 처리 12시간에 344SQ 세포 내 PTEN mRNA 발현을 실험하였다.
구체적으로, 앞서는 실험조건과 유사하게 6-well 플레이트에서 3 회 반복으로 80 % 컨플루언스에 이를 때까지 세포를 키운 후 추출하였다. 그리고 나서 Real-Time PCR 시스템 (AppliedBiosystems, Step One Plus)을 이용하여 정량적 분석을 수행하였으며, Real-Time PCR 시스템에 사용된 PTEN 유전자에 대한 프라이머 서열은 아래와 같이 서열번호 5 및 6에 나타내었다.
Forward (5'->3') Reverse (5'->3')
PTEN CCATTACCCGGCTGCGGTCC(서열번호 5) TCGCTGATGCCCCTCGCTCT(서열번호 6)
그 결과를 도 8에 나타내었다. recipient 344SQ 세포에서 PTEN mRNA의 과다는 정제된 엑소좀의 12시간 후 영향을 보이지 않았다. 이들 결과는 recipient 344SQ 세포에서 증가된 PTEN 단백질 수준이 엑소좀의 특정 분자에 의해 자극된 PTEN mRNA 전사에 의한 초기 phase에 영향을 받지 않는 내용을 보여준다.
상기 결과들로부터 사멸화 세포로부터 유래된 엑소좀을 포함하는 암의 예방 또는 치료용 조성물이 암세포로 도달하고 암세포에서 상피-간엽 세포 전환을 억제하고, 암세포의 침윤을 억제함으로써 암의 전이 예방 또는 치료에 우수한 효과가 있음을 암시한다.

Claims (17)

  1. 사멸화 세포 처리된 대식 세포로부터 유래된 엑소좀을 포함하는 암의 예방 또는 치료용 약학 조성물.
  2. 제1항에 있어서, 사멸화 세포는 상피 암세포(epithelial cancer cells)인 암의 예방 또는 치료용 약학 조성물.
  3. 제1항에 있어서, 대식 세포는 골수유래 대식세포 (bone marrow-derived macrophage) 또는 단핵구 유래 대식세포 (monocyte-derived macrophages)인 암의 예방 또는 치료용 약학 조성물.
  4. 제1항에 있어서, 대식 세포는 소교세포(microglia), 조직구(histiocytes), 호프바우어세포(Hofbauer cells), 혈관사이세포(mesangial cells), 쿠퍼세포(Kupffer cells), 복강 대식세포(peritoneal macrophages), 폐포 대식세포 (alveolar macrophage), 표피 또는 진피 대식세포 (epidermal or dermal macrophages), 가장자리구역 대식세포 (marginal zone macrophages), 금속친화성 대식세포 (metallophilic macrophages), 적수 대식세포 (Red pulp macrophages), 백수 대식세포 (white pulp macrophages) 및 파골세포(osteoclasts)로 이루어진 군에서 선택되는 어느 하나인 암의 예방 또는 치료용 약학 조성물.
  5. 제1항에 있어서, 엑소좀은 PTEN 단백질을 포함하는 것인 암의 예방 또는 치료용 약학 조성물.
  6. 제1항에 있어서, 상기 암은 폐암, 유방암, 전립선암 및 대장암으로 이루어진 군으로부터 선택되는 어느 하나인 암의 예방 또는 치료용 약학 조성물.
  7. 제1항에 있어서, 상기 암의 예방 또는 치료는 암의 침투 또는 전이 억제에 의한 것인 암의 예방 또는 치료용 약학 조성물.
  8. 제1항에 있어서, 사멸화 세포 처리된 대식 세포로부터 유래된 엑소좀은 사멸화 세포와 대식세포를 함께 배양하여 얻은 배양액으로부터 분리된 것인 암의 예방 또는 치료용 약학 조성물.
  9. 사멸화 세포 처리된 대식 세포로부터 유래된 엑소좀을 포함하는 암의 전이 억제용 약학 조성물.
  10. (a) 사멸화 세포를 대식 세포와 배양하는 단계;
    (b) 상기 (a) 단계의 배양액으로부터 상층액을 분리하는 단계; 및
    (c) 상기 (b) 단계의 상층액으로부터 엑소좀을 분리하는 단계를 포함하는 사멸화 세포 처리된 대식 세포로부터 엑소좀을 분리하는 방법.
  11. 제10항에 있어서, 상기 (a) 단계의 사멸화 세포를 대식세포와 배양하는 단계는 사멸화 세포가 포함된 X-VIVO 또는 무혈청 DMEM 배지에 대식세포를 10 내지 30시간 동안 배양하는 것인, 사멸화 세포 처리된 대식 세포로부터 엑소좀을 분리하는 방법.
  12. 제10항에 있어서, 상기 (c) 단계의 상기 (b) 단계의 상층액으로부터 엑소좀을 분리하는 단계는 원심분리, 초원심분리 또는 이들 모두에 의한 분리인 사멸화 세포 처리된 대식 세포로부터 엑소좀을 분리하는 방법.
  13. 사멸화 세포 처리된 대식 세포로부터 유래된 엑소좀을 대상체에 투여하는 단계를 포함하는 암의 치료방법.
  14. 제13항에 있어서, 사멸화 세포는 상피 암세포(epithelial cancer cells)인 암의 치료 방법.
  15. 제13항에 있어서, 대식 세포는 골수유래 대식세포 (bone marrow-derived macrophage) 또는 단핵구 유래 대식세포 (monocyte-derived macrophages)인 암의 치료 방법.
  16. 암의 치료를 위한 약제의 제조에서 사멸화 세포 처리된 대식 세포로부터 유래된 엑소좀의 용도.
  17. 암의 치료에 사용하기 위한 사멸화 세포 처리된 대식 세포로부터 유래된 엑소좀을 포함하는 조성물.
PCT/KR2019/007379 2018-08-06 2019-06-19 사멸화 세포 처리 대식 세포 유래 엑소좀을 포함하는 암 예방 또는 치료용 조성물 Ceased WO2020032379A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR20180091437 2018-08-06
KR10-2018-0091437 2018-08-06

Publications (1)

Publication Number Publication Date
WO2020032379A1 true WO2020032379A1 (ko) 2020-02-13

Family

ID=69415253

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2019/007379 Ceased WO2020032379A1 (ko) 2018-08-06 2019-06-19 사멸화 세포 처리 대식 세포 유래 엑소좀을 포함하는 암 예방 또는 치료용 조성물

Country Status (2)

Country Link
KR (1) KR20200016163A (ko)
WO (1) WO2020032379A1 (ko)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112773775A (zh) * 2021-01-13 2021-05-11 广东药科大学 一种负载去甲斑蝥素外泌体的制备方法及其应用
CN116196332A (zh) * 2021-11-30 2023-06-02 上海交通大学医学院附属第九人民医院 凋亡小体在制备治疗脓毒血症产品中的应用
EP4309660A1 (en) * 2022-07-18 2024-01-24 Lietuvos Sveikatos Mokslu Universitetas Extracellular vesicles and particles from immune cells for providing anticancer activity
CN119074959A (zh) * 2024-11-06 2024-12-06 广东医科大学附属医院 巨噬细胞膜囊泡修饰的丹参外泌体及其制备方法和应用

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2025249993A1 (ko) * 2024-05-29 2025-12-04 이화여자대학교 산학협력단 암 질환 치료용 조성물 및 이의 스크리닝 방법

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20160346334A1 (en) * 2014-02-05 2016-12-01 Stc.Unm Exosomes as a therapeutic for cancer
US20170143812A1 (en) * 2015-11-20 2017-05-25 Therapeutic Solutions International, Inc. Exosome mediated innate and adaptive immune stimulation for treatment of cancer
KR20170092095A (ko) * 2016-02-01 2017-08-10 이화여자대학교 산학협력단 사멸화된 세포를 이용한 암 전이 억제용 조성물

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20160346334A1 (en) * 2014-02-05 2016-12-01 Stc.Unm Exosomes as a therapeutic for cancer
US20170143812A1 (en) * 2015-11-20 2017-05-25 Therapeutic Solutions International, Inc. Exosome mediated innate and adaptive immune stimulation for treatment of cancer
KR20170092095A (ko) * 2016-02-01 2017-08-10 이화여자대학교 산학협력단 사멸화된 세포를 이용한 암 전이 억제용 조성물

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
KIM, Y.-B. ET AL: "Programming of macrophages by apoptotic cancer cells inhibits cancer progression through exosomal PTEN and PPARy ligands", 10 November 2017 (2017-11-10), pages 1 - 75, XP055686150, Retrieved from the Internet <URL:https://www.biorxiv.org/content/biorxiv/early/2017/11/10/217562.full.pdf> DOI: 10.1101/217562 *
YOON, Y.-S.: "Macrophages programmed by apoptotic cells inhibit epithelial-mesenchymal transition in lung alveolar epithelial cells via PGE 2, PGD 2, and HGF", SCIENTIFIC REPORTS, vol. 6, no. 1, 20992, 15 February 2016 (2016-02-15), pages 1 - 18, XP055686154, ISSN: 2045-2322, DOI: 10.1038/srep20992 *

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112773775A (zh) * 2021-01-13 2021-05-11 广东药科大学 一种负载去甲斑蝥素外泌体的制备方法及其应用
CN116196332A (zh) * 2021-11-30 2023-06-02 上海交通大学医学院附属第九人民医院 凋亡小体在制备治疗脓毒血症产品中的应用
EP4309660A1 (en) * 2022-07-18 2024-01-24 Lietuvos Sveikatos Mokslu Universitetas Extracellular vesicles and particles from immune cells for providing anticancer activity
WO2024018359A1 (en) * 2022-07-18 2024-01-25 Lietuvos Sveikatos Mokslu Universitetas Extracellular vesicles and particles from immune cells for providing
CN119074959A (zh) * 2024-11-06 2024-12-06 广东医科大学附属医院 巨噬细胞膜囊泡修饰的丹参外泌体及其制备方法和应用

Also Published As

Publication number Publication date
KR20200016163A (ko) 2020-02-14

Similar Documents

Publication Publication Date Title
WO2020032379A1 (ko) 사멸화 세포 처리 대식 세포 유래 엑소좀을 포함하는 암 예방 또는 치료용 조성물
Johnson et al. Neuroprotective effects of intravitreal mesenchymal stem cell transplantation in experimental glaucoma
KR101788885B1 (ko) 세포 요법에 사용하기 위한 방법 및 조성물
EP3443966B1 (en) Composition for treating chronic pulmonary disease, comprising exosome derived from thrombin-treated stem cell
WO2013025042A2 (ko) 줄기세포 유래 미세소포를 포함하는 신경 생성 촉진용 조성물
EP3423070B1 (en) 3-d collagen scaffold-generated exosomes and uses thereof
JP5597171B2 (ja) 腫瘍細胞移動の抑制方法及びこれに用いる薬剤
WO2016133254A1 (ko) 세포의 지질막에서 유래된 나노소포체 및 이의 용도
WO2019124666A2 (ko) 인터류킨-17 억제제 및 종양괴사인자-알파 억제제를 유효성분으로 포함하는 호중구성 폐 염증질환의 예방 또는 치료용 약학적 조성물
WO2015142061A1 (ko) 줄기세포 유래 엑소좀을 유효성분으로 포함하는 뇌 염증성 질환의 치료용 조성물
ITPD20090135A1 (it) Nuovi agenti regolatori dell&#39;attivita&#39; citochinica
WO2019151744A1 (ko) 성체줄기세포 유래의 나노베시클 및 이의 표적 치료용 용도
WO2021210872A1 (ko) 트롬빈 처리 줄기세포에서 유래된 엑소좀을 포함하는 당뇨병성 피부질환 예방 또는 치료용 조성물
WO2017014485A1 (ko) 세포융합능력을 도입한 중간엽줄기세포 및 그 용도
Zhang et al. Favipiravir ameliorates bleomycin-induced pulmonary fibrosis by reprogramming M1/M2 macrophage polarization
EP3964219A1 (en) Pharmaceutical composition for treating sepsis or systemic inflammatory response syndrome, comprising isolated mitochondria as active ingredient
Rostami et al. The role of Dental-derived stem cell-based therapy and their derived extracellular vesicles in post-COVID-19 syndrome-induced tissue damage
WO2022045813A1 (ko) 엑소좀을 유효성분으로 포함하는 폐암 치료, 예방 또는 전이 억제용 약학적 조성물
WO2017146468A1 (ko) 줄기세포의 효능 개선을 위한 조성물 및 방법
Han et al. Enhancing antitumor immunity through the combination of cholesterolized TLR7 agonist liposomes and radiotherapy: a role for IL‐1β and the inflammasome pathway
KR20200102358A (ko) 수지상세포로의 분화 유도용 조성물
Luo et al. [Retracted] Promotion of Differentiating Bone Marrow Mesenchymal Stromal Cells (BMSCs) into Cardiomyocytes via HCN2 and HCN4 Cotransfection
WO2014051338A2 (ko) 말초혈액 단핵세포를 유효성분으로 포함하는 예방 또는 치료용 약제학적 조성물
CN110833545A (zh) 脱水亚硝基尼索地平在制备防治脓毒症的药物中的应用
CN106959373B (zh) 干扰素-γ作为咳嗽药物靶点的用途

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 19847051

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 19847051

Country of ref document: EP

Kind code of ref document: A1