WO2020032379A1 - Composition for preventing or treating cancer, comprising exosome derived from apoptotic cell-clearing macrophages - Google Patents

Abstract

The present invention relates to a composition for preventing or treating cancer, comprising exosomes derived from apoptotic cells; a use of same; and a method for treating cancer by using same. An exosome composition according to the present invention is absorbed by cancer cels, suppresses epithelial-mesenchymal transition in the cancer cells, and suppresses cancer cell invasion, thereby exhibiting an excellent effect in preventing or treating cancer.

Description

Cancer preventive or therapeutic composition comprising apoptosis-derived macrophage-derived exosomes

The present invention relates to a composition for preventing or treating cancer, the use thereof, and a method for treating cancer using the same, including apoptosis-derived macrophage-derived exosomes.

Epithelial-mesenchymal transition (EMT) is a form of cell plasticity in which epithelial cells turn into mesenchymal cells, where one cell differentiates into another. Recently, it has been known that EMT plays various roles in tissue regeneration and fibrosis, cancer development and metastasis, in addition to the formation and differentiation of fetal life.

In the course of cancer, local invasion and metastasis of tumor cells occurs, which is accompanied by epithelial-mesenchymal transition (ETM) of epithelial tumor cells. In this process, it is known that the transcriptional program of specific genes is changed to show mesenchymal phenotype, cell mobility is increased, and cell-cell or cell-extracellular matrix interaction is changed.

Cancer is the life-threatening cause of cancer metastasis, and most deaths from cancer are explained by cancer metastasis. Although the current clinically proven method for treating cancer is surgical surgery, even if the causative cancer is removed, the treatment of the patient becomes difficult by cancer cells that have metastasized to other tissues. Therefore, cancer conquest can be regarded as a fight against cancer metastasis, and much research is currently being conducted on the mechanism of cancer metastasis, but this situation does not lead to the development of a therapeutic agent.

On the other hand, exosomes are generically referred to as exosomes produced by fusion of MVB (Multivesicular bodies) with the plasma membrane and microvesicles generated by direct release from the plasma membrane, also called extracellular vesicles (extracellular vesicle).

Recent studies have reported that exosomes play an important role in processes such as intercellular signal transduction and retirement management. Recently, interest in clinical applications is increasing.

Exosomes are small vesicles of membrane structure (approximately 30-100 nm in diameter) that are secreted from a variety of cells, and within the cells called multivesicular bodies (MVBs), rather than falling directly off the plasma membrane in an electron microscope study. Originated from specific compartments and released and secreted out of cells was observed. In other words, when fusion occurs between the polycystic body and the plasma membrane, the vesicles are released into the extracellular environment, which is called an exosome. It is not clear what molecular mechanisms these exosomes are made of, but not only red blood cells, but also various immune cells and tumor cells, including B-lymphocytes, T-lymphocytes, dendritic cells, platelets, macrophages, etc. Death cells, stem cells, etc. are also known to produce and secrete exosomes in the living state.

Since these exosomes contain a variety of substances having very different characteristics depending on their origin, it is necessary to proceed with research and development on characteristics derived from specific cells.

Against this background, the inventors have discovered that exosomes derived from macrophage exposed to apoptosis cells reach cancer cells, inhibit epithelial-mesenchymal cell conversion in cancer cells, inhibit cancer cell invasion, or prevent or treat cancer. The present invention was completed by confirming the excellent effect.

An object of the present invention is to provide a pharmaceutical composition for the prevention or treatment of cancer, including exosomes derived from apoptosis-treated macrophages.

It is an object of the present invention to provide a pharmaceutical composition for inhibiting metastasis of cancer, including an exosome derived from apoptosis-treated macrophages.

It is an object of the present invention to provide a method for separating exosomes from apoptosis treated macrophages.

The present invention provides a pharmaceutical composition for preventing or treating cancer, including exosomes derived from apoptosis-treated macrophages.

In the present invention, the apoptotic cells are preferably epithelial cancer cells, and in accordance with a specific embodiment of the present invention, epithelial cancer cells are most preferred. For example, 344SQ cells, A549 cells, MDA-MB-231 cells, COLO320HSR cells, PC3 cells and the like, but is not limited thereto.

The killed cells are preferably irradiated with UV light for 5 to 30 minutes at a wavelength of 100 to 400 nm, more preferably at 5 to 20 minutes at a wavelength of 150 to 350 nm, more preferably 200 to 300 It is most preferable to irradiate ultraviolet rays for 10 to 15 minutes at a wavelength of nm, but is not limited thereto.

The epithelial cancer cells may be incubated for 1 to 5 hours at 30 to 40 ℃ temperature under 1 to 10% CO ₂ conditions in RPMI 1604 medium added with 10% FBS after UV irradiation.

The macrophages can be any of mouse and human origin and can be bone marrow-derived macrophage or monocyte-derived macrophages. In addition, microglia, histiocytes, Hofbauer cells, mesangial cells, Kupffer cells, peritoneal macrophages, alveolar macrophages macrophage, epidermal or dermal macrophages, marginal zone macrophages, metallophilic macrophages, red pulp macrophages, white pulp macrophages) and osteoclasts (osteoclasts).

The treatment may mean culturing apoptosis cells and macrophages together. That is, it may be an exosome isolated from the culture obtained by culturing apoptosis cells and macrophages together.

The method may be as follows, for example. Incubate in X-VIVO or serum-free DMEM medium for 20-30 hours before stimulating macrophages with apoptosis. According to a specific embodiment of the present invention, it is most preferable to incubate in X-VIVO medium for 24 hours to make the serum-deficient state. To stimulate, the culture medium can be replaced with X-VIVO or serum-free DMEM medium with killed cells. It is preferable to incubate apoptosis cells and macrophages together for 10 to 30 hours after the medium change, more preferably for 15 to 25 hours, and most preferably for 18 to 24 hours.

The exosomes are 40-120 nm nanovesicles secreted from cells, including the main histocompatibility complex (MHC) and heat shock protein, which are immunologically important proteins. It induces a strong anti-tumor immune response and includes anti-inflammatory microRNAs (microRNAs) and microRNAs (microRNAs) that regulate the accumulation of collagen. In addition, it is known to play various roles such as binding to other cells and tissues to deliver membrane components, proteins, RNA.

In the present invention, there is no limitation in the method for separating exosomes, for example, in a culture medium, centrifugation, ultrafast centrifugation, filtration by filter, gel filtration chromatography, pre-flow electrophoresis, capillary electrophoresis, using polymer Separation may be carried out using a method such as separation and a combination thereof, preferably centrifugation / supercentrifugation. At this time, centrifugation / supercentrifugation, centrifugation may be performed sequentially at 100 to 300,000 g, preferably 150 to 150,000 g, to remove cell debris, non-exosome fraction, and dead cells.

The pharmaceutical composition of the present invention has an excellent effect on the prevention or treatment of cancer.

Specifically, exosomes are uptake into cancer cells, inhibit EMT action and inhibit Akt / p38 signaling cascade to inhibit cancer cell infiltration and metastasis. Accordingly, it has an excellent effect on the prevention, treatment and suppression of metastasis of cancer. Furthermore, the use of the exosomes according to the present invention has the advantage of being safe for human body and excellent effect even with a small amount of administration compared to the direct administration of apoptosis cells, macrophages or control medium.

In addition, the exosomes according to the present invention, while containing a variety of components, in particular, PTEN protein inhibits the EMT action of cancer and shows an excellent effect on cancer metastasis through Akt / p38 signaling cascade inhibition.

More specifically, the present invention is characterized by inhibiting EMT (epithelial-mesenchymal transition), characterized in that the early stage of cancer metastasis, such as cancer cell migration and infiltration due to the EMT inhibitory action. EMT is a phenomenon in which epithelial cells are converted into mesenchymal cells, and cell adhesion substances such as E-cadherin are lost and morphological changes are induced in the process of cancer formation and metastasis, causing EMT to change the epithelial tumor cells. It is known to play various roles in the transition process. In a specific embodiment of the present invention, TGF-β1 was treated to induce EMT of cells and inhibited it through exosomes.

In the present invention, the cancer may be selected from various carcinomas that are not limited to a specific carcinoma. For example, it may be any one selected from the group consisting of lung cancer, breast cancer, prostate cancer and colon cancer.

In the present invention, the exosomes according to the present invention included in the pharmaceutical composition as an active ingredient, but is not limited thereto, at a concentration of 1 to 200 μg / ml, or at a concentration of 5 to 150 μg / ml, or 10 It may be included in the pharmaceutical composition at a concentration of from 100 μg / ml to the subject.

The pharmaceutical composition according to the present invention can be used alone as an anticancer therapy.

In addition, the pharmaceutical composition according to the present invention may be used simultaneously, separately or sequentially with radiation or an anticancer agent, if necessary.

Specifically, the pharmaceutical composition may be administered as a separate therapeutic agent, or may be administered in combination with radiation or other therapeutic agents, and may be administered sequentially or simultaneously with conventional radiation or anticancer therapeutic agents. In addition, it is important to administer an amount that can be administered singly or in multiple doses, taking into account all of the above factors and obtaining the maximum effect in a minimum amount without side effects.

In the present invention, the pharmaceutical composition may include a pharmaceutically effective amount of exosomes alone or may include one or more pharmaceutically acceptable carriers, excipients or diluents. A pharmaceutically effective amount herein means an amount sufficient to prevent, ameliorate and treat the symptoms of cancer.

The pharmaceutically effective amount of the exosomes according to the present invention may be appropriately changed depending on the degree of symptoms of cancer, the age, weight, health condition, sex, route of administration and duration of treatment of the patient. For example, a suitable dosage may be 0.0001 to 100 mg / kg body weight.

In addition, the term "pharmaceutically acceptable" refers to a composition which, when administered physiologically and humanly, does not normally cause an allergic reaction such as gastrointestinal disorders, dizziness or the like. Examples of such carriers, excipients and diluents include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, Polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil. In addition, fillers, anti-coagulants, lubricants, wetting agents, fragrances, emulsifiers and preservatives may be further included.

The pharmaceutical composition for preventing or treating cancer of the present invention may be administered in a unit dosage form suitable for administration in the body of a patient according to a conventional method in the pharmaceutical field. Formulations suitable for this purpose include parenteral injectables such as injectable ampoules, injectables such as infusion bags, sprays such as aerosol preparations and the like. The injection ampoule may be mixed with the injection solution immediately before use, and as the injection solution, physiological saline, glucose, mannitol, and Ringer's solution may be used. The infusion bag may also be made of polyvinyl chloride or polyethylene and may be Baxter, Becton-Dickinson, Medcep, National Hospital Products, or Terumo. An injection bag of a cinnamon yarn can be illustrated.

The pharmaceutical composition may contain one or more pharmaceutically acceptable inert carriers, for example, preservatives, analgesics, solubilizers or stabilizers in the case of injections, in addition to the active ingredient. Bases, excipients, lubricants or preservatives and the like.

The composition or pharmaceutical formulation of the present invention thus prepared may be administered to mammals such as rats, mice, livestock, humans, etc. by various routes, such as parenteral or oral, and the administration method may be any method commonly used in the art. It can be administered by. The present invention may be administered by oral, rectal or intravenous, intramuscular, subcutaneous, intrauterine dural or intracerebroventricular injection and the like.

Specifically, the method of administration is not limited thereto, but the exosomes are administered intravenously (Intravenous injection), administered into the subject's lungs or organs (Topical administration), or by inhalation. Can be. In addition, the exosomes can be administered using a nebulizer, it can be administered using an endotracheal tube.

In the present invention, the subject means all animals including humans having developed the resistant cancer, and the cancer may be treated by administering the composition of the present invention to the subject.

Treatment in the present invention means any action by which the cancer is improved or beneficially altered by administering the pharmaceutical composition of the present invention.

Administration in the present invention refers to the action of introducing the pharmaceutical composition of the present invention to a subject by any suitable method, the route of administration may be administered via various routes orally or parenterally as long as the target tissue can be reached.

The present invention also provides a pharmaceutical composition for inhibiting metastasis of cancer, including an exosome derived from apoptotic cell treated macrophages.

As described above, the composition according to the present invention is uptake into cancer cells (uptake), inhibits EMT action and inhibits Akt / p38 signaling cascade to inhibit the penetration and metastasis of cancer cells. Accordingly, it can be used as a composition for inhibiting metastasis of cancer.

The present invention provides a method of treating cancer comprising administering to a subject an exosome derived from apoptosis-treated macrophages.

In the present invention, terms such as "exosomes derived from apoptosis-treated macrophages", "cancer", "administration" and the like are the same as described above.

The subject refers to an animal and may be a mammal, which may typically have a beneficial effect with treatment with exosomes derived from the apoptosis-treated macrophages of the invention. Preferred examples of such subjects may include primates, such as humans. In addition, such subjects may include all subjects having cancer symptoms or at risk of having such symptoms.

Provided is a method for inhibiting metastasis of cancer comprising administering to a subject an exosome derived from apoptosis-treated macrophages.

The invention also provides the use of exosomes derived from apoptotic treated macrophages in the manufacture of a medicament for the treatment of cancer.

The invention also provides compositions comprising exosomes derived from killed cell treated macrophages for use in the treatment of cancer.

The invention also provides the use of exosomes derived from apoptotic cell treated macrophages for the treatment of cancer.

The invention also provides a method for separating exosomes from apoptosis treated macrophages.

The method for separating exosomes from killed cell treated macrophages according to the present invention may comprise the following steps:

(a) culturing the killed cells with macrophages;

(b) separating the supernatant from the culture solution of step (a); And

(c) separating the exosome from the supernatant of step (b).

In the step (a), the culturing of the apoptotic cells and the macrophages is carried out for 10-30 hours, preferably 15-25 hours, for example, in X-VIVO or serum-free DMEM medium containing the killed cells. More preferably 18 to 24 hours. Through such culture, exosomes can be contained in a large amount in the gastric culture.

In the step (b), the supernatant is separated from the culture solution by separating the supernatant from the culture solution by a conventional supernatant separation method. For example, it can be separated under conventional supernatant separation centrifugation conditions.

In the step (c), the step of separating the exosome from the supernatant of the step (b) may use a conventional known exosome separation method. For example, centrifugation, ultra-fast centrifugation, filtration by filter, gel filtration chromatography, pre-flow electrophoresis, capillary electrophoresis, separation using a polymer, and the like, and combinations thereof may be used. Is centrifugation / supercentrifugation. At this time, centrifugation / supercentrifugation, centrifugation may be performed sequentially at 100 to 300,000 g, preferably 150 to 150,000 g, to remove cell debris, non-exosome fraction, and dead cells.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In general, the nomenclature used herein is well known and commonly used in the art.

The pharmaceutical composition of the present invention is absorbed into cancer cells and inhibits epithelial-mesenchymal cell conversion in cancer cells and down-regulates Akt / p38 signal cascade, thereby inhibiting cancer cell infiltration, thereby having an excellent effect on preventing or treating cancer and inhibiting metastasis of cancer. have.

1 shows the results of confirming the presence of exosome PTEN in the non-aqueous compartment by Western blot analysis using anti-GFP and CD63 antibodies. (sol: water soluble, Ins: insoluble)

Figure 2 shows the results of confirming the uptake with cancer cells analyzed after exosomes and 344SQ or A549 cells according to the present invention, GFP fluorescence through confocal microscopy.

Figure 3 shows the results of confirming the uptake of exosomes by incubating the lysates from 344SQ or A549 cells after incubation with exosomes collected from overexpressing GFP-PTEN human macrophage line.

4 shows the results confirming the inhibition of EMT and phosphorylation of Akt / p38 signal cascades from purified exosomes from macrophages stimulated with apoptosis cancer cells. (h: time, ExoCM: exosome from dead cell untreated macrophages ExoApoSQCM: exosome from dead cell treated macrophages)

Figure 5 shows the results of normal acini of 344SQ grown on 3D Matrigel containing exosomes and stained with anti-b-catenin (shown in light gray on green, black and white drawings) and DAPI.

Figure 6 shows the results confirming that the level of increased PTEN in 344SQ cells is due to the PTEN secreted from the exosomes and not the expression of PTEN through stimulation of the cells themselves by specific molecules of the exosomes.

7A is a TEM image of exosomes isolated from the conditioned medium of ApoSQ-stimulated RAW cells either pretreated or untreated with 20 μΜ GW4869. Scale bar represents 20 mm.

FIG. 7B shows size distribution analysis of exosomes from conditioned media of ApoSQ-stimulated RAW cells pretreated with GW4869 or pretreated with vehicle (2% DMSO in saline). The horizontal axis represents particle size (nm) and the vertical axis represents particle concentration (ｘ106 particles / ml). The bar above the solid line (black dot) represents s.e.m and the value represents the mode or mean size ± s.e.m from three independent experiments.

FIG. 8 shows qPCR analysis of PTEN mRNA in 344SQ cells 12 hours after treatment with exosomes isolated from RAW conditioned medium with or without apoptotic 344SQ cells (ExoApoSQ CM). The experiment shows the results of three replicates (mean ± s.e.m.).

Hereinafter, the present invention will be described in more detail with reference to Examples. These examples are intended to illustrate the present invention more specifically, but the scope of the present invention is not limited by these examples.

Example 1 Preparation of Killed Cell-Derived Exosomes

GFP-PTEN overexpressing macrophages were prepared and used. Standard lentiviral transduction was performed to prepare GFP-PTEN overexpressing macrophages. HEK293T cells were infected with pLV-EGFP-PTEN, packaging (psPAX2) and envelope (pCMV-VSV-G) vectors using TransIT ^® -LT1 Transfection Reagent (MIR 2300, Mirus Bio, Madison, WI, USA) and incubated overnight It was. Reagents were replaced with fresh medium for lentiviral transduction and virus supernatants were collected every 24 hours after transfection. Human macrophages (hMФ) differentiated from THP-1 monocytes were prepared by exposing the supernatant with 8 μg / ml polybrene for 4 hours every virus collection time and selecting infected cells using 1 μg / ml containing puromycin-containing medium. It was. Through this, GFP-PTEN overexpressing macrophages were prepared.

In addition, to prepare killed or necrotic cells, 344SQ cells or A549 cells were irradiated with UV light at 254 nm for 10 minutes, followed by 37 ° C., 5% CO ₂ conditions in RPMI-1640 medium supplemented with 10% FBS. Incubated for 2 hours under The cell nuclear morphology evaluation using the Wright-Giemsa staining sample and the microscope confirmed that approximately 70-80% of cell death occurred in the UV-irradiated cells. Lysed necrotic epithelial cancer cells were obtained in several freeze-thaw cycles. Cell death and necrosis were stained with Annexin V-FITC / propidium iodide (BD Biosciences, San Jose, Calif.), Followed by flow cytometry using the FACSCalibur system (BD Biosciences). cytometric analysis).

Then, co-culture with the overexpressing macrophages and killed A549 cells.

Specifically, Serum-starved conditions were provided under X-VIVO 10 medium (04-380Q, Lonza) for 24 hours before stimulating gastric GFP-PTEN overexpressing macrophages. For stimulation the culture medium was replaced with X-VIVO 10 medium containing killed or necrotic cells (apoptotic 344SQ or apoptotic A549 cells, 1.5 × 10 ⁶ cells / ml). After 24 hours, the supernatant was obtained by centrifugation and used as a conditioned medium for exosome purification.

The supernatant obtained above was subjected to sequential centrifugation of 200 g, 20,000 g, and 100,000 g to remove dead cells, cell debris, and non-exosome fractions. Wash exosome pellets with ice-cold PBS containing protease inhibitors and allow ultracentrifugation (Optima L-100K, Beckman Coulter Inc., Brea, Calif., USA) for 70 minutes at 100,000 g to remove contaminated protein. Was repeated. Exosomal pellets were suspended in RIPA buffer containing protease inhibitors to prepare exosomes.

Example 2. Identification of the prepared exosomes

Western blot was performed to confirm the prepared exosomes.

Western blots were performed for identification of exosome-PTEN in conditioned medium with anti-CD63 (ab216130, Abcam) or anti-GFP PTEN (9559, Cell Signaling Technology).

The results are shown in FIG.

As confirmed in FIG. 1, the presence of exosomes and PTEN contained therein in the non-aqueous compartment was confirmed.

Example 3 Uptake Confirmation of Exosomes to Cancer Cells

The prepared GFP-PTEN overexpressing THP-1 macrophages of Example 1 were grown in a 150 mm culture dish until reaching 70% confluency. Then, the cells were stimulated with dead A549 cells for 24 hours, and the conditioned medium was sequentially centrifuged. Exosome pellets were suspended in 200 μl serum free RPMI to prepare exosomes. The cells (A549 or 344SQ with 1 × 10 ⁵ cells for confocal microscopy or 3 × 10 ⁵ cells for western blot) were then exposed to 50 μl of purified exosomes for 24 hours.

GFP-PTEN in cells was visualized via direct fluorescence and also identified as anti-GFP using total cell lysate. The results are shown in FIG. As confirmed in Figure 2, uptake of exosome GFP-PTEN was confirmed.

In addition, similar to the above experimental conditions, it was confirmed again that the exosome GFP-PTEN was absorbed into cancer cells by Western blot with an anti-GFP antibody and the results are shown in FIG. As confirmed in FIG. 3, the uptake of exosomes into cancer cells was also confirmed by Western blot.

The results confirmed the movement and uptake of exosomes derived from macrophages exposed to apoptosis cells to cancer cells.

Example 4 Confirmation of Downregulation of EMT and Akt / p38 Signal Cascade of Exosomes

ApoSQ-exposed CM of Example 1 (conditional medium containing macrophages exposed to apoptotic cells) to confirm the effect of exosomes secreted from macrophages on EMT and Akt / p38 signaling cascade, cancer cell infiltration Purified exosomes from or exosomes purified from macrophages not exposed to killer cells were treated with TGF-β1 and 344SQ cells.

The analysis results are shown in FIG. 4.

4A shows the results of confirming changes in protein expression of the EMT signal. As confirmed in FIG. 4a, the exosomes according to Example 1 suppressed the EMT effect by down-regulating the EMT signal.

4 b and c show the Akt / p38 signal cascade. As confirmed in b and c of Figure 4 exosomes according to Example 1 has the effect of inhibiting cancer infiltration and metastasis by downregulating the Akt / p38 signaling cascade.

Example 5. Confirmation of anti-invasive effect of exosomes

Single cell suspensions containing 5,000 cells / well were placed in solidified Growth Factor Reduced Matrigel (Corning Inc) in 8 well plates. Cells in RPMI1640 containing 10% FBS and 2% Matrigel were cultured and the cultures were exchanged every two or three days for one week. After incubation, cells were treated with conditioned medium containing TGF-β1 (10 ng / ml) and 2% Matrigel, and then photographed with a clipse TE-300 microscope (Nikon) while incubating for 12 hours. In culture conditions, exosomes purified from ApoSQ-exposed CM (conditional medium containing macrophages exposed to apoptosis cells) or exosomes purified from macrophages not exposed to apoptosis cells with or without TGF-β1 344SQ cells were treated.

After the reaction, 344SQ cells were fixed with 4% PFA solution for 8 minutes at room temperature. For staining 344SQ acini, paraffin embedded tumors or frozen skin tissues in Matrigel 3-D culture, formalin fixation was performed at room temperature for 30 minutes and IF-Wash buffer (0.05% NaN _{3 in} PBS, 0.1% BSA, 0.2% Triton X-100 and 0.05% Tween-20) were used. After fixation, samples were washed three times with washing buffer for 5 minutes each and permeabilized with 0.5% Triton X-100 in PBS at room temperature for 5 minutes. 5% BSA and Mouse IgG Blocking Reagent in PBS were used for ICC and IHC, respectively. All slides stained with antibodies were then mounted with Vectashield Mounting Medium containing DAPI and imaged with a confocal microscope (LSM 800, Carl Zeiss).

The results are shown in FIG. As shown in FIG. 5, treatment with purified exosomes reversed the inhibitory effect of polarized acinar structure formation of 344SQ cells induced by TGF-β1 in 3D Matrigel culture. These results indicate that the anti-invasive effect due to exosomes treatment.

Example 6. Confirmation of Effect by Exosome PTEN

To confirm that it is not an effect of PTEN expression in the cancer cells themselves, which can be stimulated by certain molecules of exosomes from macrophages, the test was performed by treating exosomes purified from ApoSQ-stimulated macrophages transfected with siRNAs. Was performed.

RAW 264.7 cells were transfected with the two PTEN siRNA or control siRNA sequences in Table 1 below.

PTEN (# 1)	5'-CAGGAAUGAACCAUCUACA-3 '(SEQ ID NO: 1)
PTEN (# 1)	5'-UGUAGAUGGUUCAUUCCUG-3 '(SEQ ID NO: 2)
PTEN (# 2)	5'-CUGAGUAGAAACAAGAGUA-3 '(SEQ ID NO: 3)
PTEN (# 2)	5'-UACUCUUGUUUCUACUCAG-3 '(SEQ ID NO: 4)

Specifically, using a GeneSilencer siRNA Transfection Reagent (Genlantis Inc), RAW 264.7 cells were transfected with the sequence or control siRNA (SN-1003_AccuTargetTM Negative Control; Bioneer Inc) at a final concentration of 100 nM according to the manufacturer's manual. After transfection overnight, the cells were further cultured for 24 hours and stimulated with apoptotic 344SQ cells.

The results are shown in FIG.

6 a shows the result of confirming that PTEN expression was suppressed as a result of transformation.

According to FIG. 6 b, exosome treatment from control siRNA-transfected macrophages followed by PTEN levels increased at 12 and 24 hours in 344SQ cells. However, treatment of exosomes from PTEN knockdown macrophages did not change PTNE levels. These results show that the increased level of PTEN in 344SQ cells is due to PTEN derived from exosomes secreted from macrophages and not the expression of PTEN through stimulation of the cell itself by specific molecules of exosomes.

Example 7. Confirmation of the Role of Exosomes for Delivery

To demonstrate the role of exosomes for delivery, Raw cells were pretreated with 20 μM of GW4869, an exosome biogenesis / release inhibitor, followed by ApoSQ. Exosomes secreted from macrophages were isolated by sequential centrifugation, morphologically analyzed by transmission electron microscopy (TEM) and characterized by nanoparticle tracking analysis (NTA) using NanoSight.

Specifically, TEM was performed by the following method. The exosomes divided by 10 ul was fixed with 4% paraformaldehyde at room temperature for 1 hour. 6 ul of fixed exosome solution was applied to a copper mesh formvar coated with a carbon stabilized grid, absorbed into the grid for 5 minutes, and then accelerated at 80 kV using TEM (H-7650; Hitachi). Analyze iTEM software was used to obtain the image.

Specifically, nanoparticle tracking analysis was performed using a NanoSight NS300 system (Malvern Instruments, United Kingdom). NanoSight polystyrene latex calibration beads of 100 nm and 200 nm were applied for instrument performance check. Exosome size was determined based on light scattering and Brownian motion, and was calculated using the Stokes-Einstein equation with NTA 3.0. NTA software was used to determine the concentration of particles (particles / ml) and particle distribution (nm) and three replicate measurements were performed.

As can be seen in FIG. 7A, TEM showed a isolate containing nano size vesicles and showed a decrease in samples treated with GW4869.

In addition, as can be seen in Figure 7b, the presence or absence of pretreatment of GW4869 did not affect the size distribution of exosomes from the macrophages, it was confirmed that only the concentration of exosomes decrease due to GW4869 treatment.

Example 8 Identification of Increased PTEN Protein Levels in Recipient 344SQ Cells Affected by Initial Phase by PTEN mRNA Transcription Stimulated by Specific Molecules of Exosomes

PTEN mRNA expression in 344SQ cells was tested 12 hours after treatment with exosomes purified from ApoSQ conditioned medium or conditioned medium.

Specifically, cells were grown after being grown until reaching 80% confluence in three repetitions in a 6-well plate similar to the above experimental conditions. Then, quantitative analysis was performed using a Real-Time PCR system (AppliedBiosystems, Step One Plus), and the primer sequences for the PTEN gene used in the Real-Time PCR system are shown in SEQ ID NOs: 5 and 6 as follows.

	Forward (5 '-> 3')	Reverse (5 '-> 3')
PTEN	CCATTACCCGGCTGCGGTCC (SEQ ID NO: 5)	TCGCTGATGCCCCTCGCTCT (SEQ ID NO: 6)

The results are shown in FIG. Excessive PTEN mRNA in recipient 344SQ cells showed no effect after 12 hours of purified exosomes. These results show that increased PTEN protein levels in recipient 344SQ cells are not affected by the initial phase by PTEN mRNA transcription stimulated by specific molecules of exosomes.

From the above results, the composition for preventing or treating cancer comprising exosomes derived from apoptosis cells reaches cancer cells, inhibits epithelial-mesenchymal cell conversion in cancer cells, and inhibits cancer cell invasion to prevent or treat cancer metastasis. Imply an excellent effect.

Claims (17)

1. A pharmaceutical composition for preventing or treating cancer, including an exosome derived from apoptosis-treated macrophages.
2. The pharmaceutical composition for preventing or treating cancer of claim 1, wherein the killed cells are epithelial cancer cells.
3. The pharmaceutical composition for preventing or treating cancer of claim 1, wherein the macrophages are bone marrow-derived macrophages or monocyte-derived macrophages.
4. The method of claim 1, wherein the macrophages are microglia, histiocytes, Hofbauer cells, mesialial cells, Kupffer cells, peritoneal macrophages ), Alveolar macrophage, epidermal or dermal macrophages, marginal zone macrophages, metallophilic macrophages, red pulp macrophages , White pulp macrophages and osteoclasts (osteoclasts) is any one selected from the group consisting of a pharmaceutical composition for the prevention or treatment of cancer.
5. The pharmaceutical composition for preventing or treating cancer of claim 1, wherein the exosome comprises a PTEN protein.
6. The pharmaceutical composition for preventing or treating cancer of claim 1, wherein the cancer is any one selected from the group consisting of lung cancer, breast cancer, prostate cancer, and colorectal cancer.
7. The pharmaceutical composition for preventing or treating cancer of claim 1, wherein the prevention or treatment of cancer is by inhibiting penetration or metastasis of the cancer.
8. The pharmaceutical composition for preventing or treating cancer of claim 1, wherein the exosomes derived from the apoptosis-treated macrophages are separated from the culture obtained by culturing the apoptosis and macrophages together.
9. Pharmaceutical composition for inhibiting metastasis of cancer comprising exosomes derived from apoptosis-treated macrophages.
10. (a) culturing the killed cells with macrophages;

    (b) separating the supernatant from the culture solution of step (a); And

    (c) separating the exosomes from the apoptosis-treated macrophages comprising the step of separating the exosomes from the supernatant of step (b).
11. The method of claim 10, wherein the step of culturing the killed cells of step (a) with the macrophages is to incubate the macrophages in X-VIVO or serum-free DMEM medium containing the killed cells for 10 to 30 hours , A method for separating exosomes from apoptosis treated macrophages.
12. The method according to claim 10, wherein the step of separating the exosome from the supernatant of step (b) of step (c) is exo from apoptosis treated macrophages, which is separation by centrifugation, ultracentrifugation or both. How to separate a moth.
13. A method of treating cancer comprising administering to a subject an exosome derived from apoptosis-treated macrophages.
14. The method of claim 13, wherein the killed cells are epithelial cancer cells.
15. The method of claim 13, wherein the macrophages are bone marrow-derived macrophages or monocyte-derived macrophages.
16. Use of exosomes derived from apoptotic cell treated macrophages in the manufacture of a medicament for the treatment of cancer.
17. A composition comprising an exosome derived from apoptotic cell treated macrophages for use in the treatment of cancer.

Images