WO2019241641A2 - Méthodes de traitement du cancer - Google Patents

Méthodes de traitement du cancer Download PDF

Info

Publication number
WO2019241641A2
WO2019241641A2 PCT/US2019/037204 US2019037204W WO2019241641A2 WO 2019241641 A2 WO2019241641 A2 WO 2019241641A2 US 2019037204 W US2019037204 W US 2019037204W WO 2019241641 A2 WO2019241641 A2 WO 2019241641A2
Authority
WO
WIPO (PCT)
Prior art keywords
compound
unsubstituted
alkyl
benzyl
alkoxy
Prior art date
Application number
PCT/US2019/037204
Other languages
English (en)
Other versions
WO2019241641A3 (fr
Inventor
Stuart F. J. LE GRICE
David L. Spector
Wenbo XU
Fardokht A. ABULWERDI
Original Assignee
The United States Of America, As Represented By The Secretary, Department Of Health And Human Services
Cold Spring Harbor Laboratory
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by The United States Of America, As Represented By The Secretary, Department Of Health And Human Services, Cold Spring Harbor Laboratory filed Critical The United States Of America, As Represented By The Secretary, Department Of Health And Human Services
Publication of WO2019241641A2 publication Critical patent/WO2019241641A2/fr
Publication of WO2019241641A3 publication Critical patent/WO2019241641A3/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/4164—1,3-Diazoles
    • A61K31/4168—1,3-Diazoles having a nitrogen attached in position 2, e.g. clonidine
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/4164—1,3-Diazoles
    • A61K31/4184—1,3-Diazoles condensed with carbocyclic rings, e.g. benzimidazoles
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/44—Non condensed pyridines; Hydrogenated derivatives thereof
    • A61K31/445—Non condensed piperidines, e.g. piperocaine
    • A61K31/4523—Non condensed piperidines, e.g. piperocaine containing further heterocyclic ring systems
    • A61K31/454—Non condensed piperidines, e.g. piperocaine containing further heterocyclic ring systems containing a five-membered ring with nitrogen as a ring hetero atom, e.g. pimozide, domperidone
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/505—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
    • A61K31/517—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with carbocyclic ring systems, e.g. quinazoline, perimidine
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/535—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with at least one nitrogen and one oxygen as the ring hetero atoms, e.g. 1,2-oxazines
    • A61K31/5375—1,4-Oxazines, e.g. morpholine
    • A61K31/5377—1,4-Oxazines, e.g. morpholine not condensed and containing further heterocyclic rings, e.g. timolol
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A61P35/04—Antineoplastic agents specific for metastasis
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/136—Screening for pharmacological compounds
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers

Definitions

  • MALAT1 Human metastasis-associated lung adenocarcinoma transcript 1
  • ASOs antisense oligonucleotides
  • RNA Pol Il-transcribed MALAT1 is post-transcriptional ly processed by the cellular machinery that modifies tRNA, but not exported to the cytoplasm.
  • the RNA is not polyadenylated, but instead contains a highly unusual 3’-terminal structural motif designated the stability element for nuclear expression (“ENE”).
  • ENE stability element for nuclear expression
  • This element comprises a U-rich hairpin with which a 3’-genomically encoded A-rich tract interacts to form a triple helix that both protects MALAT1 from degradation and promotes nuclear retention.
  • ENE stability element for nuclear expression
  • Krtl6, which encodes for keratin 16, and csn2, which encodes for the ?-casein protein, a major milk protein, are downstream targets of MALAT1.
  • Krtl6 expression is down-regulated upon MALAT1 loss while csn2 expression increases upon depletion of MALAT1.
  • the invention provides methods of treating cancer in a patient in need thereof, wherein the cancer has upregulation MALAT1, comprising administering to the patient an effective amount of a compound of formula (I) or (II), a tautomer thereof, a stereoisomer thereof, a pharmaceutically acceptable salt thereof, or any combination thereof:
  • R 1 , R 2 , R 3 , R 4 , R 5 , X, and m are as described herein.
  • the invention further provides methods of inhibiting branching morphogenesis in a tumor organoid cell culture comprising contacting the cell culture with a compound of formula (I) or (II), a tautomer thereof, a stereoisomer thereof, a pharmaceutically acceptable salt thereof, or any combination thereof:
  • R 1 , R 2 , R 3 , R 4 , R 5 , X, and m are as described herein.
  • M5 and Ml 6 (structures below), reduced MALAT1 levels in cell culture and branching morphogenesis in a mammary tumor organoid model.
  • Computational modeling and FRET experiments demonstrated distinct binding modes for each chemotype resulting in opposing structural changes to the triplex.
  • M5 modulated downstream MALAT1 target genes in a dose-dependent manner. Identification of the biologically active small molecules targeting the MALAT1 ENE triplex of an embodiment of the invention means there is now a new category of anti-cancer therapeutics and molecular probes for treatment and investigation of MALAT 1 -driven cancers.
  • the compounds in accordance with embodiments of the invention are advantageous because, being small molecules, their pharmacokinetics properties are superior to those of oligonucleotides, which have higher molecular weights.
  • the anionic character of the oligonucleotides limits cell permeability and systemic distribution.
  • the compounds according to embodiments of the invention are highly selective to MALAT1.
  • M5 modulated MALAT1 downstream genes in a dose-response manner without affecting expression of multiple endocrine neoplasia b (“MENb”), a nuclear IncRNA encoded in the same chromosomal region as MALAT1 with a structurally-similar ENE triplex.
  • MENb multiple endocrine neoplasia b
  • Another advantage of the invention is that two or more compounds can be administered, and advantageously with synergistic effects.
  • co-administration of M5 and Ml 6 leads to synergistic treatment as they bind to different parts of the MALAT1 ENE triplex.
  • the compounds of the invention in accordance with an embodiment bind to different binding locations of the triplex and thereby avoid a competitive effect.
  • FIG. 1 is a schematic of the small molecule microarray screening utilized to identify compounds of an embodiment of the present invention.
  • a library of small molecules was spatially arrayed and covalently linked to a functionalized glass surface through an amine or an alcohol group on the molecule.
  • fluorescently-labeled MALAT1 triple helix was incubated with the slides. After incubation, the slides were washed to remove unbound oligonucleotide and imaged at 635 nm.
  • FIG. 3 is an image of organoids from MMTV-PyMT tumors after 7 days of culturing.
  • the organoids were mock infected (“Mock,” left most column), treated with DMSO (“DMSO,” 2 nd from left column), treated with M5 (“5,” 2 nd from right column), or with MALAT1 antisense oligonucleotide (“MALAT1-ASO,” right most column).
  • the labels used for Mock, DMSO, and MALAT1-ASO in this FIG. apply throughout the remaining FIG.s.
  • FIG. 6 is an FRET plot of Ml ET in the presence of vehicle (DMSO) alone and reveals the conformational landscape of this triplex across multiplexed ionic conditions. The folded triplex has higher i? FRET than partially unfolded triplex.
  • FIG. 7 is an £FRET plot of Ml ET in the presence of 10 mM M5 and shows that the signal is increased.
  • FIG. 8 is an £FRET plot of M1 ET in the presence of 10 mM Ml 6 and shows that the signal is lowered.
  • T ' FRKT was evaluated as a function of total monovalent concentrations (equimolar KC1 and NaCl) from 2.5 - 202.5 mM and magnesium
  • FIG. 9 shows the secondary structure of M1 ET with the Cy3 and Cy5 positions illustrated by circles.
  • FIG. 10 is an image showing the difference in EFRET plots in the presence and absence of 10 mM M5. The difference was calculated by subtracting the TSFRET value of FIG.
  • FIG. 11 is an image showing the difference in £FRET plots in the presence and absence of 10 mM M16. The difference was calculated by subtracting the £FRET value of FIG. 6 from the value of FIG. 8. M16 addition decreased FRET under all salt conditions.
  • FIG. 14 shows the ITC analysis of M5 (500 mM) and wild-type M1 TH (75 mM) in a 1 mM MgCb, 200 mM monovalent, and 1% DMSO in 20 mM HEPES-KOH, pH 6.9 indicates Ki ⁇ 2.93 ⁇ 1.62 mM.
  • FIG. 16 is a surface and ribbon representation of the three-dimensional structure of MALAT1 ENE triplex core crystal structure showing the distribution 246 independent dockings, shown as Van der Waals spheres, for M5. This FIG. reveals a preference for major groove binding.
  • FIG. 17 shows the highest populated docking cluster (and lowest energy) for M5 shown in surface representation buried within the triplex.
  • the single cluster, lowest energy docking of M5 makes Van der Waals interactions with the backbone phosphates and with bases of nucleotides U9, U10, and Ul 1 of the Hoogsteen strand. Similar interactions are found on the Watson-Crick strand with backbone phosphate interactions with U38, U39, and U40, as well as nucleotides U38, U39, U40, G41, and C42.
  • a single hydrogen bond is shown between the backbone phosphate of U10 and the secondary amine on M5.
  • FIG. 18 is a surface and ribbon representation of the three-dimensional structure of MALAT1 ENE triplex core crystal structure showing the distribution 156 independent dockings, shown as Van der Waals spheres, for M16. This FIG. reveals a preference for minor groove binding.
  • FIG. 19 shows the cluster distribution analysis for Ml 6 which reveals that the highest populated cluster (44% of dockings) is located in a superficial pocket formed by the G48-G49 bulge. Within this“bulge cleft” Ml 6 is positioned to make backbone phosphate hydrogen bond interactions with A67 and carbonyl nucleobase hydrogen bond interactions with U47. Van der Waals interactions are observed with the backbone and bases of A67, A68, and U47.
  • FIG. 21 is a graph showing quantification of the relative organoid branching rate of MMTV-PyMT tumors organoids with treatment of Mock, DMSO, 1 mM and 0.5 mM of M5 (labeled“5” in graph) and MALAT1 -ASO.
  • n >80 organoids from three biological replicates, bars represent ⁇ SEM.
  • the treatments are listed on the x-axis and the relative organoid branching rate is listed on the y- axis.
  • n 3 biological replicates, bars represent ⁇ SEM.
  • FIG. 24 shows scanned images of the“hits,” compound of the present invention, following scan at 635nm. Each compound was printed in duplicate on the array.
  • the top panel represents the array incubated with buffer while the bottom array represents the array incubated with 500 nM of AF647-mouse MALAT1 triple helix motif.
  • FIG. 30 shows that the conformational landscape of M1 AB in the presence of vehicle (DMSO) alone reveals population of folded and disrupted triplex across a matrix of ionic conditions.
  • Fligher EFRET represents more folded RNA and low EFRET indicates less folded RNA.
  • FIG. 31 shows the conformational landscapes of M1 AB in the presence of 10 mM M5 in which M5 increases EFRET under all ionic conditions.
  • FIG. 32 shows the conformational landscapes of M1 AB in the presence of 10 mM Ml 6 in which M5 decreases EFRET under all ionic conditions.
  • EFRET was calculated as a function of 8 monovalent concentrations (equimolar of KC1 and NaCl) and 8 magnesium concentrations.
  • Ml AB -DMSO and Ml AB -M5 were performed in duplicate.
  • Ml AB -Ml6 were performed once. The plots shown are single landscapes.
  • FIG. 33 shows the secondary structure of Ml AB with the Cy3 and Cy5 positions circled.
  • FIG. 36 shows the tertiary stability landscape of M1 ET in the absence of compound (DMSO) across a matrix of ionic conditions. Thermal stabilities are shown on a gradient to indicate low (grey in lower portion of plot) and high T m 3° (grey in upper portion of plots). Stability landscapes in the presence of 10 mM M5 (labeled“5” on graph) or Ml 6 (labeled“16” on graph). The tertiary melting temperature (7 m 3° ) was calculated across an 8 x 8 matrix of monovalent concentrations from 2.56 - 202.56 mM (equimolar of KC1 and NaCl) and magnesium concentrations from 0.1 - 1 mM. Difference plots of E m 3° in the presence (10 mM) and absence (DMSO) of M5 and M16. M5 slightly increases the stability of M1 ET under high monovalent concentrations but decreases triplex stability in low monovalent
  • Ml 6 shows no effect, within error, under all ionic conditions.
  • FIG. 37 shows the tertiary stability landscape of M1 AB in the absence of compound (DMSO) across a matrix of ionic conditions. Thermal stabilities are shown on a gradient to indicate low (grey in lower portion of plot) and high T m 3° (grey in upper portion of plots). Stability landscapes in the presence of 10 mM M5 (labeled“5” on graph) or M16 (labeled“16” on graph). Tertiary melting temperature ( T m 3° ) was calculated across an 8 x 8 matrix of monovalent concentrations from 2.56 - 202.56 mM (equimolar of KC1 and NaCl) and magnesium concentrations from 0.1 - 1 mM.
  • T m 3° Tertiary melting temperature
  • FIG. 38 shows the micromolar binding affinities (K d ) of M5 under different salt conditions monitored by FRET and DS-FRET. Fits to T m r titrations of M5 with M1 ET determine K d is 7.7 ⁇ 5.2 mM in 0.1 mM MgCb and 2.56 mM monovalent salt and K d is 2.9 ⁇
  • FIG. 39 shows the histogram analysis of M5’s single docking cluster distribution of nucleotide interactions for the Hoogsteen strand. A“count” was defined as any heavy atom or polar hydrogen within 3.5 A of M5.
  • FIG. 40 shows the histogram analysis of M5’s single docking cluster distribution of nucleotide interactions for the Watson-Crick strand.
  • A“count” was defined as any heavy atom or polar hydrogen within 3.5 A of M5.
  • FIG. 41 shows the histogram analysis of M5’s single docking cluster distribution of nucleotide interactions for the 3’ tail strand.
  • A“count” was defined as any heavy atom or polar hydrogen within 3.5 A of M5.
  • FIG. 42 shows the partial secondary structure of the MALAT1 ENE triplex region showing nucleotides involved in Van der Waals interactions and potential hydrogen bonding interactions.
  • FIG. 43 shows the full secondary structure of MALAT1 ENE triplex crystal construct (PDB ID: 4PLX) with hydrogen bond acceptor nucleotides interacting with M16.
  • FIG. 44 shows an alternative Ml 6 surface binding clusters shown as grey circles in a surface representation and labeled with their respective cluster populations.
  • FIG. 45 shows the“bulge cleft” formed by the 3’ strand nucleotides A67 and A68 and U47 adjacent to bulge nucleotides G48 and G49.
  • electronegative pocket, backbone sugar 2’ hydroxyl and nucleobase carbonyl hydrogen bonding to the Ml 6 amine make this pocket more probable over the lowest energy docking pose.
  • FIG. 46 shows a surface representation of the MALAT1 ENE triplex crystal core with the electrostatic potential mapped to the surface.
  • FIG. 47 shows that M5 and M16 do not intercalate the MALAT1 ENE triple helix.
  • Dye displacement assay with a constant concentration of 94nt MALAT1 triple helix construct and SYBRGTM II dye and in presence of increasing concentration of M5 (show as lines with triangle with pointing upward), Ml 6 (shown as lines with triangle pointing downward), and a known RNA intercalator, Ellipticine (shown as lines with a closed circle). Error bars represent the mean ⁇ SEM.
  • FIG. 48 is a graph showing that M5 modulates a MALAT1 downstream gene similar to MALAT1-ASO.
  • RNA level of Krtl6 in MMTV-PyMT tumors organoids with treatments of Mock, DMSO, 1 mM and 0.5 mM of M5 (labeled“5” in graph) and MALAT1-ASO.
  • n 3 biological replicates, bars represent ⁇ SEM.
  • the treatments are listed on the x-axis and the relative RNA level is on the y-axis.
  • FIG. 49 is a graph showing that M5 modulates another MALAT1 downstream gene similar to MALAT1-ASO.
  • n 3 biological replicates, bars represent ⁇ SEM. (***) P ⁇
  • FIG. 50 shows the secondary structure of MALAT1 ENE triplex (left) and human IncRNA MENb triple helix (right) for comparison. There are two regions highlighted that are significantly different between the two RNAs: (1) the bulge nucleotide region (circled) and (2) the number of U*AU base triples (circled). It is not clear from the secondary structure if a cleft (binding site for Ml 6 on MALAT1 ENE triplex) is present in the MENb structure. No crystal structure of the MENb triplex is available. Additionally, the deletion of two U*AU base triples within the triple helix of MENb render a much shorter potential U*AU region (binding site for M5 on MALAT1 ENE triplex).
  • FIG. 51 shows the saturation transfer difference (STD) NMR confirmation of M5 specificity for the MALAT1 ENE triple helix.
  • the top line shows ID 1 FI NMR spectrum for M5 alone while the lines below it show the STD spectra for M5 following incubation with the ENE triplexes of MALAT1, NEAT1, and KSHV PAN, respectively.
  • the protons on the para-methoxy aryl ring appear as two doublets at 7.12 and 7.42 ppm, while the proton on methyl substituted imidazole appears as a singlet at 6.8 ppm.
  • These peaks show an STD signal in the presence of MALAT1 triplex, suggesting that this part of the molecule is interacting with the RNA.
  • FIG. 52A shows a surface representation of the top view of the three-dimensional structure of MALAT1 ENE triplex core crystal.
  • MALAT1 was altered to contain the recognition site for a Fab, allowing it to act as a“crystallization chaperone.”
  • FIG. 52B shows a surface representation of the side view of the MALAT1 ENE triplex core crystal structure shown in FIG. 52A.
  • the present invention provides, in one embodiment methods of treating cancer in a patient in need thereof, wherein the cancer has upregulation of MALAT1, comprising administering to the patient an effective amount of a compound of formula (I) or (II), a tautomer thereof, a stereoisomer thereof, a pharmaceutically acceptable salt thereof, or any combination thereof:
  • each of R 1 is independently selected from halo, C1-C6 alkyl, and Ci-C 6 alkoxy;
  • R 2 is Ci-C 6 alkyl or Ci-C 6 alkoxy
  • R 3 is a benzyl amino, benzyl amido, or benzyl ureido group, wherein the benzyl amino, benzyl amido, or benzyl ureido is optionally substituted on a phenyl ring with one or more groups selected from Ci-C 6 alkoxy-, halo-, and Ci-C 6 alkyl;
  • each of R 4 and R 5 is independently H or Ci-C 6 alkyl
  • R 6 is unsubstituted C6-C10 aryl, unsubstituted 5-8 membered heteroaryl, unsubstituted 3-8 membered cycloalkyl, unsubstituted 3-8 membered heterocycloalkyl, unsubstituted 3-8 membered alkyl, unsubstituted 3-8 membered heterocyclyl alkyl, or a combination thereof;
  • m is an integer 0-3; and
  • an effective amount of compound of formula (I) is administered to the patient.
  • R 1 is halo, C1-C3 alkyl, or C1-C3 alkoxy
  • R 2 is C1-C3 alkyl or C2-C5 alkoxy
  • R 3 is a benzyl amino, benzyl amido, or benzyl ureido group, wherein the benzyl amino, benzyl amido, or benzyl ureido is optionally substituted on a phenyl ring with one or more groups selected from C1-C3 alkoxy-, F-, C1-, and C1-C3 alkyl
  • m is 0-2.
  • R ! is Br, methyl, or C1-C2 alkoxy
  • R 2 is methyl or C2-C5 alkoxy
  • R 3 is a benzyl amino, benzyl amido, or benzyl ureido group, wherein the benzyl amino, benzyl amido, or benzyl ureido is optionally substituted on a phenyl ring with one or more groups selected from Ci alkoxy-, F-, C1-, or methyl- groups; and m is 0-2.
  • a compound of formula (I) is selected from
  • R 1 is a halogen selected from fluorine, chlorine, bromine, or iodine.
  • R 1 is fluorine.
  • R 1 is chlorine.
  • R 1 is iodine.
  • R 1 is bromine.
  • R 1 is Ci-C 6 alkoxy (e.g., Ci alkoxy, C2 alkoxy, C3 alkoxy, C 4 alkoxy, C 5 alkoxy, C 6 alkoxy). In an embodiment, R 1 is C1-C5 alkoxy. ln an embodiment, R 1 is C 1 -C 4 alkoxy. In an embodiment, R' is C 1 -C3 alkyl. In an embodiment, R 1 is C1-C2 alkoxy. In an embodiment, R 1 is Ci alkoxy.
  • R 1 is Ci-Ce alkyl (e.g., Ci alkyl, C 2 alkyl, C3 alkyl, C 4 alkyl, C5 alkyl, and Ce alkyl). In an embodiment, R 1 is C 1 -C 5 alkyl. In an embodiment, R 1 is Ci-C 4 alkyl. In an embodiment, R 1 is Ci-C 3 alkyl. In an embodiment, R 1 is C 1 -C 2 alkoxy. In an embodiment, R 1 is Ci alkoxy.
  • R 2 is Ci-C 6 alkoxy (e.g., Ci alkoxy, C 2 alkoxy, C 3 alkoxy, C 4 alkoxy, C 5 alkoxy, C 6 alkoxy). In an embodiment, R 2 is C1-C5 alkoxy. In an embodiment, R 2 is Ci-C 4 alkoxy. In an embodiment, R 2 is C 1 -C 3 alkyl. In an embodiment, R 2 is Ci-C 2 alkoxy. In an embodiment, R 2 is Ci alkoxy.
  • R 2 is Ci-C 6 alkyl (e.g., Ci alkyl, C 2 alkyl, C3 alkyl, C 4 alkyl, C5 alkyl, and C 6 alkyl). In an embodiment, R 2 is C1-C5 alkyl. In an embodiment, R 2 is C1-C4 alkyl. In an embodiment, R 2 is C1-C3 alkyl. In an embodiment, R 2 is C1-C2 alkoxy. In an embodiment, R 2 is Ci alkoxy.
  • R 3 is a benzyl amino, benzyl amido, or benzyl ureido group, wherein the benzyl amino, benzyl amido, or benzyl ureido is optionally substituted on a phenyl ring with one or more groups selected from Ci-C 6 alkoxy- (e.g., Ci alkoxy, C2 alkoxy, C3 alkoxy, C 4 alkoxy, C5 alkoxy, Ce alkoxy), halo- (e.g., fluorine, chlorine, bromine, or iodine), and Ci-C 6 alkyl (e.g., Ci alkyl, C2 alkyl, C 3 alkyl, C 4 alkyl, C5 alkyl, and Ce alkyl).
  • Ci-C 6 alkoxy- e.g., Ci alkoxy, C2 alkoxy, C3 alkoxy, C 4 alkoxy, C5 alkoxy, Ce alkoxy
  • R 3 is benzyl amino. In an embodiment, R 3 is benzyl amino substituted on the aromatic ring with at least one Ci-C 6 alkoxy (e.g., Ci alkoxy, C2 alkoxy, C3 alkoxy, C 4 alkoxy, C5 alkoxy, Ce alkoxy). In an embodiment, R 3 is benzyl amino substituted with at least one C1-C5 alkoxy. In an embodiment, R 3 is benzyl amino substituted with at least one Ci-C 4 alkoxy. In an embodiment, R 3 is benzyl amino substituted with at least one C1-C3 alkoxy. In an embodiment, R 3 is benzyl amino substituted with at least one C1-C2 alkoxy.
  • Ci-C 6 alkoxy e.g., Ci alkoxy, C2 alkoxy, C3 alkoxy, C 4 alkoxy, C5 alkoxy, Ce alkoxy.
  • R 3 is benzyl amino substituted with at least one C1-
  • R 3 is benzyl amino substituted with one Ci-C 6 alkoxy (e.g., Ci alkoxy, C 2 alkoxy, C 3 alkoxy, C 4 alkoxy, C5 alkoxy, Ce alkoxy). In an embodiment, R 3 is benzyl amino substituted with one methoxy.
  • Ci-C 6 alkoxy e.g., Ci alkoxy, C 2 alkoxy, C 3 alkoxy, C 4 alkoxy, C5 alkoxy, Ce alkoxy.
  • m is an integer of 0-3. In an embodiment, m is a range of numbers or an individual number between and including 0-3 (i.e., 0, 1, 2, 3, 0-1, 0-2, 1-2, 1-3, or 2-3). Preferably, m is 1.
  • R 1 is Ci alkoxy
  • R 2 is C1-C3 alkyl
  • R 3 is benzyl amino substituted with one Ci-C 6 alkoxy
  • m is 1.
  • an effective amount of compound of formula (II) is administered to the patient.
  • R 4 is H.
  • R 4 is Ci-C 6 alkyl (e.g., Ci alkyl, C 2 alkyl, C 3 alkyl, C 4 alkyl, Cs alkyl, and C 6 alkyl).
  • R 5 is H.
  • R 5 is Ci-C 6 alkyl (e.g., Ci alkyl,
  • R 6 is unsubstituted C6-C10 aryl, unsubstituted 5-8 membered heteroaryl, unsubstituted 3-8 membered cycloalkyl, unsubstituted 3-8 membered heterocycloalkyl, unsubstituted 3-8 membered alkyl, unsubstituted 3-8 membered heterocyclyl alkyl, or a combination thereof.
  • “a combination thereof’ means that only one R 6 moiety (“primary R 6 moiety”) is attached to the nitrogen as indicated in formula (II), however, additional moieties can be attached to the
  • R 6 can be:
  • R 4 is H or Ci-C 3 alkyl
  • R 5 is H or Ci-C 3 alkyl
  • R 6 is unsubstituted C 6 -Cs aryl, unsubstituted 5-8 membered heteroaryl, unsubstituted 3-6 membered cycloalkyl, unsubstituted 3-6 membered heterocycloalkyl, unsubstituted 3-6 membered alkyl, unsubstituted 3-6 membered heterocyclyl alkyl, or a combination thereof.
  • R 4 is H or methyl
  • R 5 is H or methyl
  • R 6 is unsubstituted C 6 -C 8 aryl, unsubstituted 6-8 membered heteroaryl, unsubstituted 4-6 membered cycloalkyl, unsubstituted 4-6 membered heterocycloalkyl, unsubstituted 4-6 membered alkyl, unsubstituted 4-6 membered heterocyclyl alkyl, or a combination thereof.
  • the compound of formula (II) is selected from
  • R 4 is C1-C3 alkyl
  • R 5 is H
  • R 6 is C1-C3 cycloalkyl
  • X is not present.
  • the compound of formula (II) is:
  • the cancer is selected from lung cancer (e.g., non-small cell lung cancer), bladder carcinoma, breast cancer, cervical cancer, colon cancer, colorectal cancer, endometrial cancer, esophageal cancer, gastric cancer, hepatocellular carcinoma, lymphoblastoid cancer, melanoma, multiple myeloma, neuroblastoma, osteosarcoma, ovarian cancer, pituitary adenoma, prostate cancer, and renal cell cancer.
  • lung cancer e.g., non-small cell lung cancer
  • bladder carcinoma breast cancer
  • cervical cancer colon cancer
  • colorectal cancer endometrial cancer
  • esophageal cancer gastric cancer
  • hepatocellular carcinoma lymphoblastoid cancer
  • melanoma multiple myeloma
  • neuroblastoma neuroblastoma
  • osteosarcoma ovarian cancer
  • pituitary adenoma prostate cancer
  • renal cell cancer e.g., adenoma
  • the compound of formula (I) or (II), a tautomer thereof, a stereoisomer thereof, a pharmaceutically acceptable salt thereof, or any combination thereof binds structural element for nuclear expression (ENE) of MALAT1.
  • ENE structural element for nuclear expression
  • the MALAT1 ENE has at least 50% identity to
  • the MALAT1 ENE is a 60 nucleotide long sequence which is a small portion of the entire 8,000+ nucleotide MALAT1 sequence.
  • the ENE has at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% identity to SEQ ID NO: 1.
  • the compound of formula (I) or (II), a tautomer thereof, a stereoisomer thereof, a pharmaceutically acceptable salt thereof, or any combination thereof does not reduce MENb RNA levels following administration of the compound.
  • the compounds of formula (I) and (II) bind the ENE of MALAT1, they do not bind the ENE of MENb. Accordingly, the levels of MENb RNA are not reduced by administration of a compound of formula (I) or (II), a tautomer thereof, a stereoisomer thereof, a pharmaceutically acceptable salt thereof, or any combination thereof (or when the compound of formula (I) or (II), a tautomer thereof, a stereoisomer thereof, a
  • “does not reduce MENb RNA levels” means that the MENb RNA level following administration (or exposure to) of the compound is not less than the MENb RNA level before administration (or exposure to) the compound.
  • the MENb RNA levels following administration (or exposure to) of the compound can be more, the same, or less by a small amount attributable to a margin of error, as the MENb RNA level before administration (or exposure to) the compound.
  • a MENb RNA level is unknown before administration (or exposure to) the compounds, the MENb RNA level could be tested after a sufficient time in which the effect of the administration (or exposure to) the compound is deemed to no longer have an impact on the MENb RNA level.
  • a combination of two or more compounds described herein are co-administered to the patient in a suitable manner and in suitable doses; for example, simultaneously, sequentially, or cyclically.
  • a compound of formula (I) or (II), a tautomer thereof, a stereoisomer thereof, a pharmaceutically acceptable salt thereof, or any combination thereof can be administered to the patient in the form of a pharmaceutical composition.
  • An embodiment of the invention provides a pharmaceutical composition comprising at least one compound of formula (I) or (II), a tautomer thereof, a stereoisomer thereof, a pharmaceutically acceptable salt thereof, or any combination thereof, and a pharmaceutically acceptable carrier.
  • the pharmaceutically acceptable excipients described herein, for example, vehicles, adjuvants, carriers or diluents, are well-known to those who are skilled in the art and are readily available to the public.
  • the pharmaceutically acceptable carrier is one that is chemically inert to the active compounds and one that has no detrimental side effects or toxicity under the conditions of use.
  • compositions can be administered as oral, sublingual, transdermal, subcutaneous, topical, absorption through epithelial or mucocutaneous linings, intravenous, intranasal, intraarterial, intramuscular, intratumoral, peritumoral, interperitoneal, intrathecal, rectal, vaginal, or aerosol formulations.
  • the pharmaceutical composition is administered orally or intravenously.
  • the compounds of formula (I) or (II), a tautomer thereof, a stereoisomer thereof, a pharmaceutically acceptable salt thereof, or any combination thereof can be administered orally to a subject in need thereof.
  • Formulations suitable for oral administration can include (a) liquid solutions, such as an effective amount of the compound dissolved in diluents, such as water, saline, or orange juice and include an additive, such as cyclodextrin (e.g., a-, b-, or g-cyclodextrin, hydroxypropyl cyclodextrin) or polyethylene glycol (e.g., PEG400); (b) capsules, sachets, tablets, lozenges, and troches, each containing a predetermined amount of the active ingredient, as solids or granules; (c) powders; (d) suspensions in an appropriate liquid; and (e) suitable emulsions and gels.
  • diluents such as water, saline, or orange juice
  • an additive such as cyclodextrin (e.g., a-, b-, or g-cyclodextrin, hydroxypropyl cyclodext
  • Liquid formulations may include diluents, such as water and alcohols, for example, ethanol, benzyl alcohol, and the polyethylene alcohols, either with or without the addition of a pharmaceutically acceptable surfactant, suspending agent, or emulsifying agent.
  • diluents such as water and alcohols, for example, ethanol, benzyl alcohol, and the polyethylene alcohols, either with or without the addition of a pharmaceutically acceptable surfactant, suspending agent, or emulsifying agent.
  • Capsule forms can be of the ordinary hard- or soft-shelled gelatin type containing, for example, surfactants, lubricants, and inert fillers, such as lactose, sucrose, calcium phosphate, and cornstarch.
  • Tablet forms can include one or more of lactose, sucrose, mannitol, corn starch, potato starch, alginic acid, microcrystalline cellulose, acacia, gelatin, guar gum, colloidal silicon dioxide, croscarmellose sodium, talc, magnesium stearate, calcium stearate, zinc stearate, stearic acid, and other excipients, colorants, diluents, buffering agents, disintegrating agents, moistening agents, preservatives, flavoring agents, and pharmacologically compatible carriers.
  • Lozenge forms can comprise the active ingredient in a flavor, usually sucrose and acacia or tragacanth, as well as pastilles comprising the active ingredient in an inert base, such as gelatin and glycerin, or sucrose and acacia, emulsions, gels, and the like containing, in addition to the active ingredient, such carriers as are known in the art.
  • a flavor usually sucrose and acacia or tragacanth
  • pastilles comprising the active ingredient in an inert base, such as gelatin and glycerin, or sucrose and acacia, emulsions, gels, and the like containing, in addition to the active ingredient, such carriers as are known in the art.
  • Formulations suitable for parenteral administration include aqueous and non- aqueous, isotonic sterile injection solutions, which can contain anti-oxidants, buffers, bacteriostats, and solutes that render the formulation isotonic with the blood of the intended recipient, and aqueous and non-aqueous sterile suspensions that can include suspending agents, solubilizers, thickening agents, stabilizers, and preservatives.
  • the compounds of formula (1) or (II), a tautomer thereof, a stereoisomer thereof, a pharmaceutically acceptable salt thereof, or any combination thereof can be administered in a physiologically acceptable diluent in a pharmaceutical carrier, such as a sterile liquid or mixture of liquids, including water, saline, aqueous dextrose and related sugar solutions, an alcohol, such as ethanol, isopropanol, or hexadecyl alcohol, glycols, such as propylene glycol or polyethylene glycol, glycerol ketals, such as 2, 2-dimethyl- l,3-dioxolane-4-methanol, ethers, such as
  • poly(ethyleneglycol) 400 an oil, a fatty acid, a fatty acid ester or glyceride, or an acetylated fatty acid glyceride with or without the addition of a pharmaceutically acceptable surfactant, such as a soap or a detergent, suspending agent, such as pectin, carbomers, methylcellulose, hydroxypropylmethylcellulose, or carboxymethylcellulose, or emulsifying agents and other pharmaceutical adjuvants.
  • a pharmaceutically acceptable surfactant such as a soap or a detergent
  • suspending agent such as pectin, carbomers, methylcellulose, hydroxypropylmethylcellulose, or carboxymethylcellulose, or emulsifying agents and other pharmaceutical adjuvants.
  • Oils which can be used in parenteral formulations include petroleum, animal, vegetable, or synthetic oils. Specific examples of oils include peanut, soybean, sesame, cottonseed, corn, olive, petrolatum, and mineral. Suitable fatty acids for use in parenteral formulations include oleic acid, stearic acid, and isostearic acid. Ethyl oleate and isopropyl myristate are examples of suitable fatty acid esters.
  • Suitable soaps for use in parenteral formulations include fatty alkali metal, ammonium, and triethanolamine salts
  • suitable detergents include (a) cationic detergents such as, for example, dimethyl dialkyl ammonium halides, and alkyl pyridinium halides, (b) anionic detergents such as, for example, alkyl, aryl, and olefin sulfonates, alkyl, olefin, ether, and monoglyceride sulfates, and sulfosuccinates, (c) nonionic detergents such as, for example, fatty amine oxides, fatty acid alkanolamides, and polyoxyethylene-polypropylene copolymers, (d) amphoteric detergents such as, for example, alkyl-beta-aminopropionates, and 2-alkyl-imidazoline quaternary ammonium salts, and (3) mixtures thereof.
  • the parenteral formulations typically contain from about 0.5 to about 25% by weight of the compounds of formulas (I) and (II), a tautomer thereof, a stereoisomer thereof, a pharmaceutically acceptable salt thereof, or any combination thereof, in solution. Suitable preservatives and buffers can be used in such formulations.
  • such compositions may contain one or more nonionic surfactants having a hydrophilic-lipophilic balance (HLB) of from about 12 to about 17.
  • HLB hydrophilic-lipophilic balance
  • the quantity of surfactant in such formulations ranges from about 5 to about 15% by weight.
  • Suitable surfactants include polyethylene sorbitan fatty acid esters, such as sorbitan monooleate and the high molecular weight adducts of ethylene oxide with a hydrophobic base, formed by the condensation of propylene oxide with propylene glycol.
  • the parenteral formulations can be presented in unit-dose or multi-dose sealed containers, such as ampoules and vials, and can be stored in a freeze-dried (lyophilized) condition requiring only the addition of the sterile liquid carrier, for example, water, for injections, immediately prior to use. Extemporaneous injection solutions and suspensions can be prepared from sterile powders, granules, and tablets of the kind previously described.
  • Topically applied compositions are generally in the form of liquids (e.g., mouthwash), creams, pastes, lotions and gels.
  • Topical administration includes application to the oral mucosa, which includes the oral cavity, oral epithelium, palate, gingival, and the nasal mucosa.
  • the composition contains at least one active component and a suitable vehicle or carrier. It may also contain other components, such as an anti irritant.
  • the carrier can be a liquid, solid or semi-solid ln embodiments, the composition is an aqueous solution, such as a mouthwash. Alternatively, the composition can be a dispersion, emulsion, gel, lotion or cream vehicle for the various components.
  • the primary vehicle is water or a biocompatible solvent that is substantially neutral or that has been rendered substantially neutral.
  • the liquid vehicle can include other materials, such as buffers, alcohols, glycerin, and mineral oils with various emulsifiers or dispersing agents as known in the art to obtain the desired pH, consistency and viscosity. It is possible that the compositions can be produced as solids, such as powders or granules. The solids can be applied directly or dissolved in water or a biocompatible solvent prior to use to form a solution that is substantially neutral or that has been rendered substantially neutral and that can then be applied to the target site.
  • the vehicle for topical application to the skin can include water, buffered solutions, various alcohols, glycols such as glycerin, lipid materials such as fatty acids, mineral oils, phosphoglycerides, collagen, gelatin and silicone based materials.
  • the compounds of formulas (I) and (II), a tautomer thereof, a stereoisomer thereof, a pharmaceutically acceptable salt thereof, or any combination thereof, alone or in combination with other suitable components, can be made into aerosol formulations to be administered via inhalation.
  • aerosol formulations can be placed into pressurized acceptable propellants, such as dichlorodifluoromethane, propane, nitrogen, and the like. They also may be formulated as pharmaceuticals for non-pressured preparations, such as in a nebulizer or an atomizer.
  • the compound of the invention can be formulated as inclusion complexes, such as cyclodextrin inclusion complexes, or liposomes.
  • inclusion complexes such as cyclodextrin inclusion complexes, or liposomes.
  • Liposomes can serve to target a compound of the invention to a particular tissue, such as lymphoid tissue or. Liposomes can also be used to increase the half-life of a compound of the invention.
  • the dose administered to the patient, particularly human and other mammals, in accordance with embodiments of the present invention should be sufficient to affect the desired response.
  • dosage will depend upon a variety of factors, including the age, condition or disease state, predisposition to disease, genetic defect or defects, and body weight of the mammal.
  • the size of the dose will also be determined by the route, timing and frequency of administration as well as the existence, nature, and extent of any adverse side effects that might accompany the administration of a particular inhibitor and the desired effect. It will be appreciated by one of skill in the art that various conditions or disease states may require prolonged treatment involving multiple administrations.
  • Effective amounts may vary depending upon the biological effect desired in the individual, condition to be treated, and/or the specific characteristics of the compound of formula (I) or a pharmaceutically acceptable salt thereof, and the individual (e.g., a 70 kg patient on average).
  • any suitable dose of the compounds of formulas (I) and (II), a tautomer thereof, a stereoisomer thereof, a pharmaceutically acceptable salt thereof, or any combination thereof can be administered to the subject (e.g., human), according to the type of disease (e.g., cancer) to be treated.
  • the dose of the compounds of formulas (I) and (II), a tautomer thereof, a stereoisomer thereof, a pharmaceutically acceptable salt thereof, or any combination thereof desirably comprises about 0.001 mg per kilogram (kg) of the body weight of the mammal (mg/kg) to about 400 g/kg.
  • the minimum dose is any suitable amount, such as about 0.001 mg/kg, about 0.005 mg/kg, about 0.0075 mg/kg, about 0.01 mg/kg, about 0.05 mg/kg, about 0.075 mg/kg, about 0.1 mg/kg, about 0.15 mg/kg, about 0.2 mg/kg, about 0.4 mg/kg, about 0.75 mg/kg, about 1 mg/kg, about 2 mg/kg, about 3 mg/kg, about 5 mg/kg, about 10 mg/kg, about 15 mg/kg, about 20 mg/kg, about 30 mg/kg, about 50 mg/kg, about 60 mg/kg, about 75 mg/kg, about 100 mg/kg, about 150 mg/kg, about 175 mg/kg, about 200 mg/kg, about 250 mg/kg, about 275 mg/kg, or about 300 mg/kg).
  • the maximum dose is any suitable amount, such as about 350 mg/mg, about 300 mg/kg, about 275 mg/kg, about 250 mg/kg, about 200 mg/kg, about 175 mg/kg, about 150 mg/kg, about 100 mg/kg, about 75 mg/kg, about 60 mg/kg, about 50 mg/kg, about 30 mg/kg, about 20 mg/kg, about 15 mg/kg, about 10 mg/kg, about 5 mg/kg, about 3 mg/kg, about 2 mg/kg, about 1 mg/kg, about 0.75 mg/kg, about 0.4 mg/kg, or about 0.2 mg/kg). Any two of the foregoing minimum and maximum doses can be used to define a close-ended range or can be used singly to define an open-ended range.
  • the term“treat” does not necessarily imply complete elimination of a cancer. Rather, there are varying degrees of treatment of which one of ordinary skill in the art recognizes as having a benefit or therapeutic effect.
  • the cancer can be treated to any extent through the present inventive method.
  • at least about 10% (e.g., at least about 20%, at least about 30%, or at least about 40%) of the symptoms of the cancer is reduced upon administration of a compound described herein.
  • at least about 50% (e.g., at least about 60%, at least about 70%, or at least about 80%) of the symptoms of the cancer is reduced upon administration of a compound described herein.
  • at least about 90% e.g., at least about 95%, at least about 99%, or at least about 100%
  • the symptoms of the cancer is reduced upon administration of a compound described herein.
  • the patient to be treated typically is a mammal.
  • Mammals include, but are not limited to, the order Rodentia, such as mice, and the order Logomorpha, such as rabbits.
  • the mammals are from the order Carnivora, including Felines (cats) and Canines (dogs), Artiodactyla, including Bovines (cows) and Swines (pigs) or of the order Perssodactyla, including Equines (horses).
  • the mammals are of the order Primates, Ceboids, or Simioids (monkeys) or of the order Anthropoids (humans and apes).
  • the mammal is a human.
  • the compounds of formulas (I) and (II), a tautomer thereof, a stereoisomer thereof, a pharmaceutically acceptable salt thereof can be administered with another treatment.
  • the additional treatment can be a radiation treatment.
  • the radiation treatment can be any suitable radiation treatment used in the treatment of cancer.
  • the additional treatment can be a chemotherapeutic agent.
  • the chemotherapeutic agent can be any suitable chemotherapeutic agent, for example, the chemotherapeutic agent can be selected from the group consisting of asparaginase, busulfan, carboplatin, cisplatin, daunorubicin, doxorubicin, fluorouracil, gemcitabine, hydroxyurea, methotrexate, paclitaxel, rituximab, vinblastine, and vincristine.
  • the chemotherapeutic agent can be administered simultaneously, sequentially, or cyclically, with a compound of formulas (I) and (II), a tautomer thereof, a stereoisomer thereof, or a pharmaceutically acceptable salt thereof.
  • the chemotherapeutic agent can be administered before a compound of formulas (I) and (II), a tautomer thereof, a stereoisomer thereof, or a pharmaceutically acceptable salt thereof.
  • the chemotherapeutic agent can be administered after a compound of formulas (I) and (II), a tautomer thereof, a stereoisomer thereof, or a pharmaceutically acceptable salt thereof.
  • the chemotherapeutic agent can be administered
  • a compound of formulas (I) and (II), a tautomer thereof, a stereoisomer thereof, a pharmaceutically acceptable salt thereof reduces the likelihood that cancer will metastasize. If the tumor has already metastasized, then administration of a compound of formulas (I) and (II), a tautomer thereof, a stereoisomer thereof, or a pharmaceutically acceptable salt thereof reduces the number or volume of metastatic tumors.
  • the patient has metastatic cancer.
  • administration of a compound of formulas (I) and (II), a tautomer thereof, a stereoisomer thereof, a pharmaceutically acceptable salt thereof reduces or delays further metastasizing of established metastases. Further, administration of a compound of formulas (I) and (II), a tautomer thereof, a stereoisomer thereof, a
  • pharmaceutically acceptable salt thereof reduces the amount or size, e.g., volume or diameter, of metastases (e.g., by at least by about 5%, at least by about 10%, at least by about 20%, at least by about 30%, at least by about 40%, at least by about 50%, at least by about 60%, at least by about 70%, at least by about 80%, or at least by about 90%).
  • a compound of formulas (I) and (II), a tautomer thereof, a stereoisomer thereof, a pharmaceutically acceptable salt thereof may be administered before one or more tumor(s) has been removed from the mammal.
  • a compound of formulas (I) and (II), a tautomer thereof, a stereoisomer thereof, a pharmaceutically acceptable salt thereof may be
  • the tumor(s) may be removed, for example, by surgery.
  • the present invention provides, in another embodiment, methods of inhibiting branching morphogenesis in a tumor organoid cell culture comprising contacting the cell culture with a compound selected from a compound of formulas (I) and (II), a tautomer thereof, a stereoisomer thereof, a pharmaceutically acceptable salt thereof, or any
  • the tumor organoid cell culture is a mouse mammary gland organoid.
  • the tumor organoid cell culture expresses MALAT1.
  • a combination of two or more compounds described herein are provided to the cell culture.
  • the two compounds can be provided sequentially or simultaneously.
  • M5 and Ml 6 are provided to the cell culture.
  • alkyl refers to a straight or branched, saturated, aliphatic radical having the number of carbon atoms indicated.
  • Alkyl can include any number of carbons, such as Ci -2 , Ci -3 , Ci -4 , Ci -5 , Ci_6, Ci -7 , Ci -8 , C1-9, CMO, C2-3, C 2 -4, C 2-5 , C 2 -6, C3-4, C 3-5 , C3-6, C4-5, C4-6, and C5-6.
  • Ci-6 alkyl includes, but is not limited to, methyl, ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl, tert-butyl, pentyl, isopentyl, hexyl, etc.
  • Alkyl can also refer to alkyl groups having up to 8 carbons atoms, such as, but not limited to, heptyl and octyl.
  • Unsaturated carbocyclic groups also include aryl groups.
  • aryl refers to an aromatic ring system having any suitable number of ring atoms and any suitable number of rings.
  • Aryl groups can include any suitable number of ring atoms, such as, 6, 7, 8, 9, or 10 ring atoms.
  • Aryl groups can be monocyclic, fused to form bicyclic or tricyclic groups, or linked by a bond to form a biaryl group.
  • Representative aryl groups include phenyl, naphthyl, and biphenyl.
  • Other aryl groups include benzyl, which has a methylene linking group.
  • Some aryl groups have from 6 to 10 ring atoms, such as phenyl or naphthyl.
  • Hetero- as part of another substituent (e.g., heteroaryl, heterocycloalkyl, and heterocyclyl) refers to a monocyclic or fused bicyclic or tricyclic aromatic ring assembly containing 3 to 8 ring atoms, where each of from 1 to 5 of the ring atoms is a heteroatom, such as N, O, or S. Heteroaryl groups can include any number of ring atoms, such as 5 to 8,
  • heteroaryl groups 5 to 7, 5 to 6, 6 to 7, or 6 to 8 ring atoms. Any suitable number of heteroatoms can be included in the heteroaryl groups.
  • Heterocycloalkyl refers to a saturated ring system having from 3 to 8 ring atoms and from 1 to 3 heteroatoms of N, O, and S. Suitable heteroatoms also be include, but are not limited to, B, Al, Si, and P. The heteroatoms can be oxidized to form moieties, such as, but not limited to, -S(O)- and -S(0) 2 -. Heterocycloalkyl groups can include any number of ring atoms, such as, 3 to 6, 4 to 6, 5 to 6, 3 to 8, 4 to 8, 5 to 8, or 6 to 8 ring atoms.
  • heterocycloalkyl groups can include groups such as aziridine, azetidine, pyrrolidine, piperidine, azepane, azocane, quinuclidine, pyrazolidine,
  • Heterocycloalkyl groups can be linked via any position on the ring.
  • aziridine can be 1- or 2-aziridine
  • azetidine can be 1- or 2- azetidine
  • pyrrolidine can be 1-, 2- or 3-pyrrolidine
  • piperidine can be 1-, 2-, 3- or 4-piperidine
  • pyrazolidine can be 1-, 2-, 3-, or 4-pyrazolidine
  • imidazolidine can be 1-, 2-, 3- or 4-imidazolidine
  • piperazine can be 1-, 2-, 3- or 4-piperazine
  • tetrahydrofuran can be 1- or 2-tetrahydrofuran
  • oxazolidine can be 2-, 3-, 4- or 5-oxazolidine
  • isoxazolidine can be 2-, 3-, 4- or 5-isoxazolidine
  • thiazolidine can be 2-, 3-, 4- or 5-thiazolidine
  • isothiazolidine can be 2-, 3-, 4- or 5- isothiazolidine
  • Heterocyclyl alkyl refers to a heterocycloalkyl wherein an atom of hydrogen is removed from a ring position.
  • the terms“halo” and“halogen,” by themselves or as part of another substituent, refer to a fluorine, chlorine, bromine, or iodine atom.
  • amino refers to a moiety -NR 7 , wherein each R 7 group is H or alkyl. An amino moiety can be ionized to form the corresponding ammonium cation.
  • the term“amido” refers to a moiety -NRsC(O)- or -C(0)N(Rs) 2 , wherein each R 8 group is H or alkyl.
  • ureido refers to a moiety -NH 2 CONH.
  • stereochemistry and can be in the form of a single stereoisomer, a mixture of two or more stereoisomers (e.g., an epimer, a mixture of diastereomers and/or enantiomers, a racemic mixture).
  • the phrase“salt” or“pharmaceutically acceptable salt” is intended to include nontoxic salts synthesized from the parent compound and which contain a basic or acidic moiety by conventional chemical methods. Generally, such salts can be prepared by reacting the free acid or base forms of these compounds with a stoichiometric amount of the appropriate base or acid in water or in an organic solvent, or in a mixture of the two.
  • an inorganic acid e.g., hydrochloric acid, sulfuric acid, phosphoric acid, or hydrobromic acid
  • an organic acid e.g., oxalic acid, malonic acid, citric acid, fumaric acid, lactic acid, malic acid, succinic acid, tartaric acid, acetic acid,
  • trifluoroacetic acid gluconic acid, ascorbic acid, methylsulfonic acid, or benzylsulfonic acid
  • an inorganic base e.g., sodium hydroxide, potassium hydroxide, calcium hydroxide, magnesium hydroxide, or ammonium hydroxide
  • an organic base e.g., methylamine, diethylamine, triethylamine, triethanolamine, ethylenediamine,
  • tris(hydroxymethyl)methylamine, guanidine, choline, or cinchonine), or an amino acid (e.g., lysine, arginine, or alanine) can be used.
  • amino acid e.g., lysine, arginine, or alanine
  • nonaqueous media such as ether, ethyl acetate, ethanol, isopropanol, or acetonitrile are typical. Lists of suitable salts are found in Remington’s Pharmaceutical Sciences, 22 nd revised ed., Pharmaceutical Press, 2012, and Journal of Pharmaceutical Science, 104: 12 (2015).
  • a salt of an alkali metal e.g., sodium or potassium
  • alkaline earth metal e.g., calcium
  • ammonium can be provided.
  • the phrase“inhibiting branching morphogenesis in a tumor organoid cell culture” means that following contact of the cell culture with a compound of formulas (I) and (II), a tautomer thereof, a stereoisomer thereof, a pharmaceutically acceptable salt thereof, the cell culture has less observable branching as compared to untreated cell culture.
  • the phrase“cancer has upregulation of MALAT1” refers to at least one cancer cell of a tissue origin which expresses MALAT1 at a higher rate as compared to a healthy cell of the same tissue origin.
  • the terms“cancer,”“neoplasm,” and“tumor” are used herein to refer to cells which exhibit autonomous, unregulated growth, such that the cells exhibit an aberrant growth phenotype characterized by a significant loss of control over cell proliferation.
  • Cells of interest for detection, analysis, and/or treatment in the context of the invention include cancer cells (e.g., cancer cells from an individual with cancer), malignant cancer cells, pre-metastatic cancer cells, metastatic cancer cells, and non-metastatic cancer cells. Cancers of virtually every tissue are known.
  • the phrase“cancer burden” refers to the quantum of cancer cells or cancer volume in a subject. Reducing cancer burden accordingly refers to reducing the number of cancer cells or the cancer cell volume in a subject.
  • cancer cell refers to any cell that is a cancer cell (e.g., from any of the cancers for which an individual can be treated, e.g., isolated from an individual having cancer) or is derived from a cancer cell, e.g., clone of a cancer cell.
  • a cancer cell can be from an established cancer cell line, can be a primary cell isolated from an individual with cancer, can be a progeny cell from a primary cell isolated from an individual with cancer, and the like.
  • the term can also refer to a portion of a cancer cell, such as a sub-cellular portion, a cell membrane portion, or a cell lysate of a cancer cell.
  • cancers are known to those of skill in the art, including solid tumors such as carcinomas, sarcomas, glioblastomas, melanomas, lymphomas, and myelomas, and circulating cancers such as leukemias.
  • solid tumors such as carcinomas, sarcomas, glioblastomas, melanomas, lymphomas, and myelomas
  • circulating cancers such as leukemias.
  • cancer includes any form of cancer, including but not limited to, solid tumor cancers (e.g., lung, prostate, breast, bladder, colon, ovarian, pancreas, kidney, liver, glioblastoma, medulloblastoma, leiomyosarcoma, head & neck squamous cell carcinomas, melanomas, and neuroendocrine) and liquid cancers (e.g., hematological cancers); carcinomas; soft tissue tumors; sarcomas; teratomas; melanomas; leukemias;
  • solid tumor cancers e.g., lung, prostate, breast, bladder, colon, ovarian
  • pancreas kidney, liver, glioblastoma, medulloblastoma, leiomyosarcoma, head & neck squamous cell carcinomas, melanomas, and neuroendocrine
  • liquid cancers e.g., hematological cancers
  • carcinomas e.g.
  • lymphomas and brain cancers, including minimal residual disease, and including both primary and metastatic tumors.
  • Any cancer is a suitable cancer to be treated by the subject methods and compositions.
  • Carcinomas are malignancies that originate in the epithelial tissues. Epithelial cells cover the external surface of the body, line the internal cavities, and form the lining of glandular tissues.
  • carcinomas include, but are not limited to, adenocarcinoma (cancer that begins in glandular (secretory) cells such as cancers of the breast, pancreas, lung, prostate, and colon) adrenocortical carcinoma; hepatocellular carcinoma; renal cell carcinoma; ovarian carcinoma; carcinoma in situ; ductal carcinoma; carcinoma of the breast; basal cell carcinoma; squamous cell carcinoma; transitional cell carcinoma; colon carcinoma; nasopharyngeal carcinoma; multilocular cystic renal cell carcinoma; oat cell carcinoma; large cell lung carcinoma; small cell lung carcinoma; non-small cell lung carcinoma; and the like.
  • Carcinomas may be found in prostrate, pancreas, colon, brain (usually as secondary metastases), lung, breast, and skin.
  • Soft tissue tumors are a highly diverse group of rare tumors that are derived from connective tissue.
  • soft tissue tumors include, but are not limited to, alveolar soft part sarcoma; angiomatoid fibrous histiocytoma; chondromyoxid fibroma; skeletal chondrosarcoma; extraskeletal myxoid chondrosarcoma; clear cell sarcoma; desmoplastic small round-cell tumor; dermatofibrosarcoma protuberans; endometrial stromal tumor;
  • osteosarcoma primitive neuroectodermal tumor; alveolar rhabdomyosarcoma; embryonal rhabdomyosarcoma; benign or malignant schwannoma; synovial sarcoma; Evan’s tumor; nodular fasciitis; desmoid-type fibromatosis; solitary fibrous tumor; dermatofibrosarcoma protuberans (DFSP); angiosarcoma; epithelioid hemangioendothelioma; tenosynovial giant cell tumor (TGCT); pigmented villonodular synovitis (PVNS); fibrous dysplasia;
  • TGCT tenosynovial giant cell tumor
  • PVNS pigmented villonodular synovitis
  • myxofibrosarcoma myxofibrosarcoma; fibrosarcoma; synovial sarcoma; malignant peripheral nerve sheath tumor; neurofibroma; pleomorphic adenoma of soft tissue; and neoplasias derived from fibroblasts, myofibroblasts, histiocytes, vascular cells/endothelial cells, and nerve sheath cells.
  • a sarcoma is a rare type of cancer that arises in cells of mesenchymal origin, e.g., in bone or in the soft tissues of the body, including cartilage, fat, muscle, blood vessels, fibrous tissue, or other connective or supportive tissue.
  • Different types of sarcoma are based on where the cancer forms. For example, osteosarcoma forms in bone, liposarcoma forms in fat, and rhabdomyosarcoma forms in muscle.
  • sarcomas include, but are not limited to, askin’s tumor; sarcoma botryoides; chondrosarcoma; ewing’s sarcoma; malignant hemangioendothelioma; malignant schwannoma; osteosarcoma; and soft tissue sarcomas (e.g., alveolar soft part sarcoma; angiosarcoma; cystosarcoma phyllodesdermatofibrosarcoma protuberans (DFSP); desmoid tumor; desmoplastic small round cell tumor; epithelioid sarcoma; extraskeletal chondrosarcoma; extraskeletal osteosarcoma; fibrosarcoma;
  • askin s tumor
  • sarcoma botryoides chondrosarcoma
  • ewing’s sarcoma malignant hemangioendothelioma
  • malignant schwannoma malignant schwannoma
  • GIST gastrointestinal stromal tumor
  • hemangiopericytoma hemangiosarcoma (more commonly referred to as“angiosarcoma”); kaposi’s sarcoma; leiomyosarcoma; liposarcoma; lymphangiosarcoma; malignant peripheral nerve sheath tumor (MPNST); neurofibrosarcoma; synovial sarcoma; and undifferentiated pleomorphic sarcoma).
  • MPNST peripheral nerve sheath tumor
  • neurofibrosarcoma synovial sarcoma
  • undifferentiated pleomorphic sarcoma undifferentiated pleomorphic sarcoma
  • a teratoma is a type of germ cell tumor that may contain several different types of tissue (e.g., can include tissues derived from any and/or all of the three germ layers:
  • endoderm including, for example, hair, muscle, and bone.
  • Teratomas occur most often in the ovaries in women, the testicles in men, and the tailbone in children.
  • Melanoma is a form of cancer that begins in melanocytes (cells that make the pigment melanin). Melanoma may begin in a mole (skin melanoma), but can also begin in other pigmented tissues, such as in the eye or in the intestines.
  • Leukemias are cancers that start in blood-forming tissue, such as the bone marrow, and cause large numbers of abnormal blood cells to be produced and enter the bloodstream.
  • leukemias can originate in bone marrow-derived cells that normally mature in the bloodstream.
  • Leukemias are named for how quickly the disease develops and progresses (e.g., acute versus chronic) and for the type of white blood cell that is affected (e.g., myeloid versus lymphoid).
  • Myeloid leukemias are also called myelogenous or myeloblastic leukemias.
  • Lymphoid leukemias are also called lymphoblastic or lymphocytic leukemia.
  • Lymphoid leukemia cells may collect in the lymph nodes, which can become swollen.
  • leukemias include, but are not limited to, Acute myeloid leukemia (AML), Acute lymphoblastic leukemia (ALL), Chronic myeloid leukemia (CML), and Chronic lymphocytic leukemia (CLL).
  • Lymphomas are cancers that begin in cells of the immune system.
  • lymphomas can originate in bone marrow-derived cells that normally mature in the lymphatic system.
  • One category of lymphoma is Hodgkin lymphoma (HL), which is marked by the presence of a type of cell called the Reed- Sternberg cell.
  • HL Hodgkin lymphoma
  • Examples of Hodgkin lymphomas include nodular sclerosis classical Hodgkin lymphoma (CHL), mixed cellularity CHL, lymphocyte-depletion CHL, lymphocyte-rich CHL, and nodular lymphocyte predominant HL.
  • Non-Hodgkin lymphomas includes a large, diverse group of cancers of immune system cells.
  • Non-Hodgkin lymphomas can be further divided into cancers that have an indolent (slow-growing) course and those that have an aggressive (fast-growing) course.
  • NHL non-Hodgkin lymphomas
  • Examples of non-Hodgkin lymphomas include, but are not limited to, AIDS-related
  • Lymphomas anaplastic large-cell lymphoma, angioimmunoblastic lymphoma, blastic NK- cell lymphoma, Burkitt’s lymphoma, Burkitt-like lymphoma (small non-cleaved cell lymphoma), chronic lymphocytic leukemia/small lymphocytic lymphoma, cutaneous T-Cell lymphoma, diffuse large B-Cell lymphoma, enteropathy-type T-Cell lymphoma, follicular lymphoma, hepatosplenic gamma-delta T-Cell lymphomas, T-Cell leukemias, lymphoblastic lymphoma, mantle cell lymphoma, marginal zone lymphoma, nasal T-Cell lymphoma, pediatric lymphoma, peripheral T-Cell lymphomas, primary central nervous system lymphoma, transformed lymphomas, treatment-related T-Cell lymphomas, and
  • Brain cancers include any cancer of the brain tissues. Examples of brain cancers include, but are not limited to, gliomas (e.g., glioblastomas, astrocytomas,
  • oligodendrogliomas oligodendrogliomas, ependymomas, and the like
  • meningiomas meningiomas
  • pituitary adenomas and vestibular schwannomas
  • primitive neuroectodermal tumors medulloblastomas
  • The“pathology” of cancer includes all phenomena that compromise the wellbeing of the patient. This includes, without limitation, abnormal or uncontrollable cell growth, metastasis, interference with the normal functioning of neighboring cells, release of cytokines or other secretory products at abnormal levels, suppression or aggravation of inflammatory or immunological response, neoplasia, premalignancy, malignancy, and invasion of surrounding or distant tissues or organs, such as lymph nodes.
  • the phrases“cancer recurrence” and“tumor recurrence,” and grammatical variants thereof, refer to further growth of neoplastic or cancerous cells after diagnosis of cancer. Particularly, recurrence may occur when further cancerous cell growth occurs in the cancerous tissue.
  • metastasis refers to the growth of a cancerous tumor in an organ or body part, which is not directly connected to the organ of the original cancerous tumor. Metastasis will be understood to include micrometastasis, which is the presence of an undetectable amount of cancerous cells in an organ or body part that is not directly connected to the organ of the original cancerous tumor. Metastasis can also be defined as several steps of a process, such as the departure of cancer cells from an original tumor site, and migration and/or invasion of cancer cells to other parts of the body.
  • the terms“recipient,”“individual,”“subject,” and“patient,” are used interchangeably and refer to any mammalian subject for whom diagnosis, treatment, or therapy is desired (e.g., humans).
  • the phrase“synergistic combination” in the context of this invention includes the combination of two compounds of the present invention, such as M5 and Ml 6, that in combination elicit a synergistic effect on cancer cells compared to either administered alone.
  • administering refers to parenteral, intravenous, intraperitoneal, intramuscular, intratumoral, intralesional, intranasal, or subcutaneous administration, oral administration, administration as a suppository, topical contact, intrathecal administration, or the implantation of a slow-release device, e.g., a mini-osmotic pump, to the subject.
  • Embodiments of the present subject matter described herein may be beneficial alone or in combination, with one or more other embodiments. Without limiting the foregoing description, certain non-limiting embodiments of the disclosure numbered 1-38 are provided below. As will be apparent to those of skill in the art upon reading this disclosure, each of the individually numbered embodiments may be used or combined with any of the preceding or following individually numbered embodiments. This is intended to provide support for all such combinations of embodiments and is not limited to combinations of embodiments explicitly provided below:
  • a method of treating cancer in a patient in need thereof, wherein the cancer has upregulation of MALAT1, comprising administering to the patient an effective amount of compound of formula (I) or (II), a tautomer thereof, a stereoisomer thereof, a
  • R 1 is independently selected from halo, Ci-C 6 alkyl, and Ci-C 6 alkoxy
  • R 2 is Ci-Ce alkyl or Ci-C 6 alkoxy
  • R 3 is a benzyl amino, benzyl amido, or benzyl ureido group, wherein the benzyl amino, benzyl amido, or benzyl ureido is optionally substituted on a phenyl ring with one or more groups selected from Ci-C 6 alkoxy-, halo-, and Ci-C 6 alkyl;
  • each of R 4 and R 5 is independently H or Ci-C 6 alkyl
  • R 6 is unsubstituted C6-C10 aryl, unsubstituted 5-8 membered heteroaryl, unsubstituted 3-8 membered cycloalkyl, unsubstituted 3-8 membered heterocycloalkyl, unsubstituted 3-8 membered alkyl, unsubstituted 3-8 membered heterocyclyl alkyl, or a combination thereof;
  • m is an integer 0-3;
  • R 1 is halo, C 1 -C 3 alkyl, or C 1 -C3 alkoxy
  • R 2 is C1-C3 alkyl or C2-C5 alkoxy
  • R 3 is a benzyl amino, benzyl amido, or benzyl ureido group, wherein the benzyl amino, benzyl amido, or benzyl ureido is optionally substituted on a phenyl ring with one or more groups selected from C1-C3 alkoxy-, F-, C1-, and C1-C3 alkyl;
  • R 1 is Br, methyl, or C1-C2 alkoxy
  • R 2 is methyl or C2-C5 alkoxy
  • R 3 is a benzyl amino, benzyl amido, or benzyl ureido group, wherein the benzyl amino, benzyl amido, or benzyl ureido is optionally substituted on a phenyl ring with one or more groups selected from Ci alkoxy-, F-, C1-, or methyl- groups;
  • R 4 is H or C1-C3 alkyl
  • R 5 is H or C1-C3 alkyl
  • R 6 is unsubstituted Ce-Cs aryl, unsubstituted 5-8 membered heteroaryl, unsubstituted 3-6 membered cycloalkyl, unsubstituted 3-6 membered heterocycloalkyl, unsubstituted 3-6 membered alkyl, unsubstituted 3-6 membered heterocyclyl alkyl, or a combination thereof.
  • R 4 is H or methyl
  • R 5 is H or methyl
  • R 6 is unsubstituted C Cx aryl, unsubstituted 6-8 membered heteroaryl, unsubstituted 4-6 membered cycloalkyl, unsubstituted 4-6 membered heterocycloalkyl, unsubstituted 4-6 membered alkyl, unsubstituted 4-6 membered heterocyclyl alkyl, or a combination thereof.
  • R 4 and R 5 are independently H or Ci-C 6 alkyl;
  • R 6 is unsubstituted C6-C10 aryl, unsubstituted 5-8 membered heteroaryl, unsubstituted 3-8 membered cycloalkyl, unsubstituted 3-8 membered heterocycloalkyl, unsubstituted 3-8 membered alkyl, unsubstituted 3-8 membered heterocyclyl alkyl, or a combination thereof.
  • cancer selected from lung cancer, bladder carcinoma, breast cancer, cervical cancer, colon cancer, colorectal cancer, endometrial cancer, esophageal cancer, gastric cancer, hepatocellular carcinoma, lymphoblastoid cancer, melanoma, multiple myeloma, neuroblastoma, osteosarcoma, ovarian cancer, pituitary adenoma, prostate cancer, and renal cell cancer.
  • a method of inhibiting branching morphogenesis in a tumor organoid cell culture comprising contacting the cell culture with a compound selected from a compound of formula (I) or (II), a tautomer thereof, a stereoisomer thereof, a
  • each of R 1 is independently selected from halo, Ci-C 6 alkyl, and Ci-C 6 alkoxy;
  • R 2 is Ci-C 6 alkyl or Ci-C 6 alkoxy
  • R 3 is a benzyl amino, benzyl amido, or benzyl ureido group, wherein the benzyl amino, benzyl amido, or benzyl ureido is optionally substituted on a phenyl ring with one or more groups selected from Ci-C 6 alkoxy-, halo-, and Ci-C 6 alkyl;
  • each of R 4 and R 5 is independently H or Ci-C 6 alkyl
  • R 6 is unsubstituted C6-C10 aryl, unsubstituted 5-8 membered heteroaryl, unsubstituted 3-8 membered cycloalkyl, unsubstituted 3-8 membered heterocycloalkyl, unsubstituted 3-8 membered alkyl, unsubstituted 3-8 membered heterocyclyl alkyl, or a combination thereof;
  • m is an integer 0-3;
  • R 1 is halo, C 1 -C 3 alkyl, or C 1 -C 3 alkoxy
  • R 2 is C 1 -C 3 alkyl or C 2 -C 5 alkoxy
  • R 3 is a benzyl amino, benzyl amido, or benzyl ureido group, wherein the benzyl amino, benzyl amido, or benzyl ureido is optionally substituted on a phenyl ring with one or more groups selected from C ] -C 3 alkoxy-, F-, C1-, and C1-C3 alkyl;
  • R 1 is Br, methyl, or C1-C2 alkoxy
  • R 2 is methyl or C 2 -C5 alkoxy
  • R 3 is a benzyl amino, benzyl amido, or benzyl ureido group, wherein the benzyl amino, benzyl amido, or benzyl ureido is optionally substituted on a phenyl ring with one or more groups selected from Ci alkoxy-, F-, C1-, or methyl- groups;
  • R 4 is H or Ci-C 3 alkyl
  • R 5 is H or C 1 -C 3 alkyl; and R 6 is unsubstituted C'e-Cs aryl, unsubstituted 5-8 membered heteroaryl, unsubstituted 3-6 membered cycloalkyl, unsubstituted 3-6 membered heterocycloalkyl, unsubstituted 3-6 membered alkyl, unsubstituted 3-6 membered heterocyclyl alkyl, or a combination thereof;
  • R 4 is H or methyl
  • R 5 is H or methyl
  • R 6 is unsubstituted C 6 -Cs aryl, unsubstituted 6-8 membered heteroaryl, unsubstituted 4-6 membered cycloalkyl, unsubstituted 4-6 membered heterocycloalkyl, unsubstituted 4-6 membered alkyl, unsubstituted 4-6 membered heterocyclyl alkyl, or a combination thereof.
  • R 4 and R 5 is independently H or Ci-C 6 alkyl
  • R 6 is unsubstituted C 6 -Cio aryl, unsubstituted 5-8 membered heteroaryl, unsubstituted 3-8 membered cycloalkyl, unsubstituted 3-8 membered heterocycloalkyl, unsubstituted 3-8 membered alkyl, unsubstituted 3-8 membered heterocyclyl alkyl, or a combination thereof.
  • R 5 is H
  • R 6 is C 1 -C 3 cycloalkyl
  • X is not present.
  • AAAGGUUUUUCUUUUCCUGAGAAAUUUCUCAGGUUUUGCUUUUUAAAAAAAAAA AGC AAAA-3’ (SEQ ID NO: 1).
  • SNR signal-to-noise ratio
  • the library included compounds having primary or secondary amines or primary alcohol functionalities (for covalent linkage to the microarray slide), purchased from (i) commercial vendors (ii) the National Center for Advancing Translational Sciences
  • Mechanism Interrogation PlatE library (a collection of FDA approved drugs, clinical candidates and well-annotated inhibitors, see Mathews Griner, L.A. et al.,“High-throughput combinatorial screening identifies drugs that cooperate with ibrutinib to kill activated B-cell- like diffuse large B-cell lymphoma cells,” Proc. Nat’l. Acad. Sci. USA, 1 11 : 2349-54 (2014)) and (iii) the freely-available NCI diversity set V (see Developmental Therapeutics Program NCI/NIH Approved Oncology Drugs Set Information: A set of FDA-approved anticancer drugs to enable cancer research (2016)).
  • g-aminopropyl silane (GAPS) microscope slides were functionalized with a short Fmoc-protected amino polyethylene glycol spacer. After deprotection with piperidine, 1,6- diisocyanatohexane was coupled to the surface by urea bond formation to provide functionalized isocyanate-coated microarray slides that can react with primary and secondary amines and primary alcohols to form immobilized small molecule libraries.
  • the 26,229 small molecule stock solutions (lOmM in DMSO), dyes, and controls were printed on seven slides each containing ⁇ 3,745 distinct molecules printed in duplicate.
  • the stock was further diluted to 500 nM with folding buffer (25 mM sodium cacodylate, 50 mM KC1, 1 mM MgCb, pH 6.9) and annealed by heating to 95 °C for 3 min, snap cooling on ice for 10 min and slow equilibration to room temperature for 1 h. Following incubation, slides were gently washed twice for 2 min in folding buffer with 0.01% TWEENTM 20, and once in folding buffer, and dried by centrifugation for 2 min at 4000 rpm. Fluorescence intensity was measured (650 nm excitation, 670 nm emission) on an Innopsys Innoscan 1100 AL Microarray Scanner. The scanned image was aligned with the corresponding GenePix Array List (“GAL”) file to identify individual features.
  • folding buffer 25 mM sodium cacodylate, 50 mM KC1, 1 mM MgCb, pH 6.9
  • folding buffer 25 mM sodium cacodylate, 50 mM
  • DMSO dimethyl sulfoxide
  • ASO MALAT1 antisense oligonucleotide
  • the latter targets a region unrelated to the ENE triple helix and was previously demonstrated to reduce MALAT1 accumulation in vitro and in vivo (see Arun, et al.,“Differentiation of mammary tumors and reduction in metastasis upon MATAL1 IncRNA loss,” Genes Dev., 30: 34-51 (2016)).
  • mock- and DMSO-treated cells underwent extensive branching morphogenesis.
  • cells treated with M5 remained as spherical acini (see FIG. 3).
  • M5 and M16 reduced MALAT1 levels by 54% and 41% (FIG. 4 and 26), respectively.
  • M5 and M16 also decreased organoid branching by 38% and 27% (FIG. 5 and 27), respectively.
  • Monovalent stocks were prepared similar to MgCb stocks but contained equimolar NaCl and KC1 at concentrations between 0 - 1000 mM. Final reactions contained 100hM RNA, 10 mM compound, 20 mM HEPES-KOH, pH 6.9, 0.1 - 1 mM MgCb, and 2.5 - 202.5 mM monovalent salt including 2.5 mM K + from the HEPES buffer.
  • the microplate was covered with tin foil prior to centrifugation at 1000 x g for 2 minutes at room temperature. The plate was incubated at room temperature for ⁇ 1 hour before recording fluorescence measurements.
  • RNA was diluted to 200nM in four different salt conditions: lmM MgCb and 2.5 mM monovalent (Condition I), 0.1 mM MgCb and 2.5 mM monovalent (Condition II), 0.1 mM MgCl 2 and 52.5 mM monovalent salt (Condition III), and lmM MgCb and lOOmM monovalent (Condition IV).
  • RNA was dispensed into in eight wells in 384-well microplate, followed by 20m1 from the compound titration stock solutions, yielding final concentrations of l OOnM RNA and 0 - 100 mM compound.
  • the microplate was sealed and covered with tin foil prior to centrifugation for 2 min at 1 ,000 x g at room temperature.
  • the sealed plate was incubated ⁇ l hour prior to recording room temperature FRET as described above.
  • 25m1 of the titration samples was transferred into a qPCR plate, which was sealed and centrifuged at 1,000 x g for 2 min at room temperature.
  • MALAT1 triplex reports on structural changes at the base of the triple helix and adjacent Pl helix.
  • High FRET efficiency indicates a well formed triplex, while lower energy transfer is diagnostic of triplex (or PI helix) unwinding.
  • the M1 ET construct contained fluorescently labeled MALAT-ENE and MALAT- Tail.
  • MALAT-ENE was synthesized containing a 3’ Cy3 fluorophore.
  • MALAT-Tail was synthesized containing a 5’ Cy5 dye.
  • the M1 AB construct contained fluorescently labeled MALAT-A and MALAT-B RNAs.
  • MALAT-A was synthesized containing a 3’ Cy3 fluorophore.
  • MALAT-B was synthesized containing a 3’ C7 amino linker, which was subsequently labeled with Cy5.
  • Synthetic RNAs were purified by denaturing polyacrylamide gel electrophoresis and electroelution (Elutrap, GE). Eluates were concentrated using ethanol precipitation, resuspended in water, and stored at -20°C until further use.
  • the 3’ C7 amino linker of MALAT-B was labeled using Cy5 NHS ester monoreactive dye.
  • 1 tube of dye (PA25001, GE LifeSciences) was dissolved in 14m1 100% DMSO and added 100 - 500pg of RNA in 0.1M sodium carbonate (pH 8.5) to a final volume of lOOpL. The reaction was incubated overnight at room temperature with shaking.
  • the second labeling reaction was resuspended in 50 mM
  • bimolecular constructs were annealed in 1 : 1.5 molar ratio (Ml ET ratio is MALAT-ENE-Cy3:MALAT- Tail-Cy5; M1 AB ratio is MALAT-B-Cy5:MALAT-A-Cy3) and refolded in a buffer of 20 mM HEPES-KOH, pH 6.9, and 1 mM MgCb for ⁇ 1 hour before loading onto an ENrich SEC70 column (Bio-Rad) pre-equilibrated in the same refolding buffer.
  • Triplex complexes were selected based on overlapping absorbance peaks monitored at 260 nm (RNA), 550 nm (Cy3), and 650 nm (Cy5).
  • Binding interactions were further characterized by isothermal titration calorimetry
  • RNA was incubated at room temperature for ⁇ 1 hour prior to SEC purification.
  • the purified fraction was concentrated using centrifugal ultrafiltration (Millipore).
  • M5 centrifugal ultrafiltration
  • the syringe contained 500mM M5 in an identical buffer.
  • the overall low enthalpy of binding for M5 is consistent with its lack of charge and limited hydrogen bonding potential.
  • binding of M5 is entropically-driven and may reflect release of multiple water molecules or ions upon binding in a deep pocket on the RNA.
  • the structure of the MALAT1 triple helix core solved using x-ray crystallography was obtained from the Protein Data Bank (PDBID:4PLX) and edited to contain only a single macromolecular chain (chain A).
  • the AMBER 16 molecular dynamics package was used to add all missing hydrogen atoms, adjust bond lengths, angles, and dihedral angles based on the OL3 set of RNA force-field parameters.
  • the LigPrep program was used to generate the three-dimensional structure of M5 and Ml 6, which were subsequently energy-minimized using the AMBER ff03 force-field.
  • the AutoDock 4.0 suite of programs was used to prepare and generate all docking poses using the MALAT1 triple helix structure (receptor) and the structures of M5 and Ml 6 (ligands).
  • the receptor was designated as rigid and all ligands were designated as fully flexible around all rotatable bonds.
  • Atomic charges were assigned to all atoms using the Gastiger charge formalism.
  • the docking search grid was chosen to be the maximum size of the receptor molecule (126 x 62 x 66 xyz grid points) with a grid spacing of 0.5 A.
  • a Lamarckian genetic algorithm using an initial population of 300 conformers, 27,000 generations, 10 6 energy evaluations, and a mutation rate of 0.2 was used to conduct 300 independent dockings for each ligand onto an identical receptor grid.
  • the 247 and 157 unique final docking poses for M5 and Ml 6, respectively, were histogrammed by energy and further parsed into unique structural clusters representing >5% of total docking poses.
  • this approach employs a flexible ligand and rigid receptor to calculate independent docking events utilizing a Lamarckian genetic algorithm (300 trials, initial population of 300, 2.7 x 10 4 generations, and 10 6 energy evaluations). A total of 246 and 156 distinct docking poses were identified for M5 and M16, respectively (FIG. 16 and 18). To evaluate the molecular interactions more closely, docking poses were parsed into clusters based on their structural localization (FIG. 17, 19, and 43). Each individual cluster comprises more than 5% of the total docking poses for that compound.
  • M5 is capable of making non-specific interactions with other nucleotides within the major groove but only within a very narrow region (FIG. 39-44).
  • Molecular docking events for Ml 6 indicate a significantly different binding mode, i.e., docking positions are distributed along the narrow minor groove surface of the ENE triplex (FIG. 18).
  • the most probable docking cluster for Ml 6 is located on the RNA surface (FIG. 19). Additional clusters for Ml 6 were also identified, though comprising many fewer docking events (FIG. 44). Importantly, two of these clusters also localize to the triple helix surface, and a third cluster found in the major groove is only minimally populated.
  • M5 was used in a dose-dependent manner to confirm decreased MALAT1 levels and branching morphogenesis in the mammary tumor organoid model (FIG. 20-21).
  • several previously reported downstream targets of MALAT1 upon treatment with M5 were evaluated. These included krtl6, which encodes for keratin 16, and was reported to be down-regulated upon MALAT1 loss, and csn2, which encodes for the /?-casein protein, a major milk protein, which increases upon depletion of MALAT1.
  • M5’s effect was consistent with the effect seen following MALAT1 ASO treatment (FIG. 48-49). This finding is consistent with the above studies strengthening the proposition that M5’s biological target is MALAT1 ENE triplex.
  • STD NMR Saturation Transfer Difference
  • MALAT1 ENE MALAT1 ENE.
  • equivalent M5 signals were absent when it was incubated with the ENE triplexes of NEAT 1 and KSHV PAN, further highlighting M5’s selectivity.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Epidemiology (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Wood Science & Technology (AREA)
  • Pathology (AREA)
  • Genetics & Genomics (AREA)
  • Analytical Chemistry (AREA)
  • Immunology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Zoology (AREA)
  • Oncology (AREA)
  • Molecular Biology (AREA)
  • Hospice & Palliative Care (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

L'invention concerne des méthodes de traitement du cancer chez un patient en ayant besoin, le cancer présentant une régulation à la hausse de MALAT1, comprenant l'administration au patient d'une quantité efficace d'un composé de formule (I) ou (II), son tautomère, son stéréoisomère, son sel pharmaceutiquement acceptable, ou toute combinaison de ceux-ci : où R1, R2, R3, R4, R5, X et m sont tels que décrits dans la description. L'invention concerne également des procédés d'inhibition de la morphogenèse de ramification dans une culture de cellules organoïdes tumorales comprenant la mise en contact de la culture cellulaire avec un composé de formule (I) ou (II), son tautomère, son stéréoisomère, son sel pharmaceutiquement acceptable, ou toute combinaison de ceux-ci. Dans les formules (I) et (II), R1, R2, R3, R4, R5, X et m sont tels que décrits dans la description.
PCT/US2019/037204 2018-06-14 2019-06-14 Méthodes de traitement du cancer WO2019241641A2 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201862685026P 2018-06-14 2018-06-14
US62/685,026 2018-06-14

Publications (2)

Publication Number Publication Date
WO2019241641A2 true WO2019241641A2 (fr) 2019-12-19
WO2019241641A3 WO2019241641A3 (fr) 2020-02-20

Family

ID=67263054

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2019/037204 WO2019241641A2 (fr) 2018-06-14 2019-06-14 Méthodes de traitement du cancer

Country Status (1)

Country Link
WO (1) WO2019241641A2 (fr)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114504649A (zh) * 2022-02-22 2022-05-17 山东大学齐鲁医院 Malat1抑制剂在腹主动脉瘤防治中的应用
EP4006013A4 (fr) * 2019-07-26 2023-06-28 Ajou University Industry-Academic Cooperation Foundation Nouveau composé à petites molécules inhibant la voie de transmission du signal de tlr7 et tlr9 et son utilisation

Non-Patent Citations (8)

* Cited by examiner, † Cited by third party
Title
"Goodman And Gilman's: The Pharmacological Bases of Therapeutics", 1990, MACK PUBLISHING CO.
"Pharmaceutics and Pharmacy Practice", 1982, J. B. LIPPINCOTT CO., pages: 238 - 250
"Remington's Pharmaceutical Sciences", 2012, PHARMACEUTICAL PRESS
ARUN ET AL.: "Differentiation of mammary tumors and reduction in metastasis upon MATAL1 IncRNA loss", GENES DEV., vol. 30, 2016, pages 34 - 51
DEVELOPMENTAL THERAPEUTICS PROGRAM NCI/NIH, APPROVED ONCOLOGY DRUGS SET INFORMATION: A SET OF FDA-APPROVED ANTICANCER DRUGS TO ENABLE CANCER RESEARCH, 2018
JOURNAL OF PHARMACEUTICAL SCIENCE, vol. 104, 2015, pages 12
MATHEWS GRINER, L.A. ET AL.: "High-throughput combinatorial screening identifies drugs that cooperate with ibrutinib to kill activated B-cell-like diffuse large B-cell lymphoma cells", PROC. NAT'L. ACAD. SCI. USA, vol. 111, 2014, pages 2349 - 54, XP055218384, DOI: doi:10.1073/pnas.1311846111
WILUSZ: "Noncoding RNAs: Re-writing dogmas of RNA processing and stability", BIOCHIM. BIOPHYS. ACTA, vol. 1859, 2016, pages 128 - 38, XP029378014, DOI: doi:10.1016/j.bbagrm.2015.06.003

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP4006013A4 (fr) * 2019-07-26 2023-06-28 Ajou University Industry-Academic Cooperation Foundation Nouveau composé à petites molécules inhibant la voie de transmission du signal de tlr7 et tlr9 et son utilisation
CN114504649A (zh) * 2022-02-22 2022-05-17 山东大学齐鲁医院 Malat1抑制剂在腹主动脉瘤防治中的应用

Also Published As

Publication number Publication date
WO2019241641A3 (fr) 2020-02-20

Similar Documents

Publication Publication Date Title
JP6193268B2 (ja) Ｃｄｋ８／ｃｄｋ１９選択的阻害剤、ならびに癌のための抗転移および化学防御の方法におけるそれらの使用
ES2473597T3 (es) Derivados de 2-indolil imidazo[4,5-d]fenantrolina y su uso en el tratamiento del cáncer
US11014902B2 (en) MYC G-quadruplex stabilizing small molecules and their use
WO2018133795A1 (fr) Inhibiteur de l'ezh2 et son utilisation
US20120128693A1 (en) Cadherin-11 inhibitors and methods of use thereof
WO2019241641A2 (fr) Méthodes de traitement du cancer
US10011598B2 (en) Small molecules targeting repeat r(CGG) sequences
US20200291005A1 (en) Compositions and methods for inhibiting acss2
Bi et al. Discovery of highly potent nicotinamide phosphoribosyltransferase degraders for efficient treatment of ovarian cancer
CN109310650A (zh) 用于减少过表达c-myc的癌症中的c-myc的化合物
JP6008305B2 (ja) Ｔａｃｃ３を標的とする小化合物
KR20170141542A (ko) 위암을 예방 및 치료하는 rhoa 억제제의 약학적 조성물
US9309247B2 (en) 2-substituted imidazo[4,5-D]phenanthroline derivatives and their use in the treatment of cancer
US20240287054A1 (en) Compounds that bind non-canonical g-quadruplex structures and methods of making and using the same
US20230322853A1 (en) Compounds and compositions for the treatment of proliferative diseases and disorders
JP2023530734A (ja) アイソフォーム特異的アルデヒドデヒドロゲナーゼ阻害剤
JP2012162500A (ja) エリスロポエチン受容体の阻害を利用した癌治療剤
WO2014057511A1 (fr) Utilisation d'emicorons en tant qu'inducteurs sélectifs d'un dommage de l'adn télomérique

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 19739771

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 19739771

Country of ref document: EP

Kind code of ref document: A2