WO2019190198A1 - 가이드 rna 및 엔도뉴클레아제를 유효성분으로 포함하는 암 치료용 약학적 조성물 - Google Patents

가이드 rna 및 엔도뉴클레아제를 유효성분으로 포함하는 암 치료용 약학적 조성물 Download PDF

Info

Publication number
WO2019190198A1
WO2019190198A1 PCT/KR2019/003585 KR2019003585W WO2019190198A1 WO 2019190198 A1 WO2019190198 A1 WO 2019190198A1 KR 2019003585 W KR2019003585 W KR 2019003585W WO 2019190198 A1 WO2019190198 A1 WO 2019190198A1
Authority
WO
WIPO (PCT)
Prior art keywords
cancer
cells
composition
tumor cell
cell killing
Prior art date
Application number
PCT/KR2019/003585
Other languages
English (en)
French (fr)
Inventor
최성화
박미진
박영훈
임정학
김동욱
인성용
박종진
Original Assignee
(주)지플러스 생명과학
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by (주)지플러스 생명과학 filed Critical (주)지플러스 생명과학
Priority to US17/041,670 priority Critical patent/US11865164B2/en
Priority to CN201980023354.9A priority patent/CN111989113B/zh
Publication of WO2019190198A1 publication Critical patent/WO2019190198A1/ko

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/43—Enzymes; Proenzymes; Derivatives thereof
    • A61K38/46—Hydrolases (3)
    • A61K38/465—Hydrolases (3) acting on ester bonds (3.1), e.g. lipases, ribonucleases
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/7105—Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/43—Enzymes; Proenzymes; Derivatives thereof
    • A61K38/46—Hydrolases (3)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/62—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
    • A61K47/64—Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents

Definitions

  • the present invention relates to a composition for anticancer comprising a guide urine and an endonuclease as an active ingredient.
  • cancer is a disease that can be triggered by various carcinogens and can be caused by variations in chromosome structure or sequence.
  • One of the most prominent features of cancer is the constant cell proliferation.
  • anti-cancer therapies include radiation that effectively kills cells, or treatment using compounds or antibodies that target specific cancer cells.
  • anticancer primary therapies including chemo / radiation therapies, can cause severe side effects and pain in patients by killing together high-proliferative normal cells, such as hair and immune cells. Therefore, there is a demand for the development of an anticancer agent capable of selectively killing only cancer cells in the body.
  • Targeted anticancer agents are anticancer agents that treat cancer by regulating certain proteins or pathways associated with cancer development.
  • the targets can be identified by comparing the total protein amount of cancer cells with the total protein amount of normal cells. That is, proteins that are specific to cancer cells or richer in cancer cells may be potential targets.
  • An example of a target protein is human epidermal growth factor receptor 2 protein 0-2. Including Trastuzumab (3 ⁇ 41 6-ya 111®) for the treatment of breast and stomach cancers that overexpress Myzo-2.
  • Several targeted therapies have been developed with antibodies against. Another approach is to target mutant proteins that cause cancer to progress. For example, the cell proliferation signal protein? Or ⁇ is present in modified forms in many breast cancers and melanoma, respectively. Many targeted therapies have been developed targeting these mutant forms. 2019/190198 1 »(: 1 ⁇ 1 ⁇ 2019/003585
  • Targeted therapies have been approved for the treatment of inoperable or metastatic cancer patients.
  • biomarker proteins that are specifically expressed in cancer cells.
  • the strength of the mutual binding between the biomarker protein and the anticancer agent, which is specifically present in cancer cells is not specific.
  • many side effects have been reported, although targeted and immunotherapeutic agents are less toxic than traditional compound anticancer agents.
  • an object of the present invention is to provide a pharmaceutical composition for treating cancer exhibiting an anticancer effect by targeting a sequence specifically present in cancer cells.
  • compositions for killing tumor cells comprising a nucleic acid sequence present in a cancer cell-specific polynucleotides and nuclease that binds complementarily to the active ingredient.
  • the present invention also provides a pharmaceutical composition for treating cancer comprising the composition.
  • composition for tumor cell killing comprising a vector loaded with a polynucleotide encoding a polynucleotide, an endonuclease and an exonuclease complementary to a nucleic acid sequence specifically present in cancer cells as an active ingredient to provide.
  • Also provided are methods of treating cancer comprising administering a composition of the present invention to a subject having cancer.
  • the pharmaceutical composition of the present invention is a drug based on high specificity between DNA and RNA, and can only target and kill only cancer cells, and thus can be customized for each patient and carcinoma.
  • SNP single nucleotide polymorphism
  • CNV gene mutation
  • FIG. 1 is a schematic diagram illustrating a process of activating nonspecific exonuclease function by crRNA guided target site binding in a CRISPR associated protein to decompose nucleic acids of target cancer cells.
  • FIG. 2 is a schematic diagram showing that one embodiment of the composition is coupled to the crRNA, CRISPR associated protein and / or exonuclease (hereinafter CRISPR PLUS system) is specifically activated in cancer cells to act as an anticancer agent.
  • CRISPR PLUS system exonuclease
  • FIG. 3 is a diagram confirming that an embodiment of the CRISPR Casl2a protein may have nonspecific exonuclease activity depending on sequence specific endonuclease enzyme activity.
  • CRISPR Casl2a CRISPR Casl2a (Cpf l) nuclease, crRNA or a combination of two molecules (RNP complex) to HEK293 (FIG. 4A) and HeLa (FIG. 4B), which are human-derived cancer cells, respectively. After 72 hours, the cell viability was measured.
  • Figure 5 confirms the induction of apoptosis by guide RNA and Cas9 specifically binding to EGFR mutation using the HCC827 cell line experimental group having pul se only, EGFR_WT and EGFR mutation.
  • FIG. 6 shows the number of viable cells in the HCC827 cell line experimental group (EGFR_E2) having pul se only, EGFR_WT and EGFR mutations tested in FIG. 5.
  • Figure 7 confirms the death of lung cancer cells by guide RNAs complementary to target genes CCR5, HPRT1, MT2, SMIM11, GNPDA2, SLC15A5 and KCNE2 in lung cancer cell line H1299.
  • NT1 means a guide show with no matching sequence to lung cancer cells and was used as a negative control.
  • guide RNA capable of complementarily binding to MT2, SMIM11, GNPDA2, SLC15A5, and KCNE2 can efficiently kill lung cancer cells.
  • FIG. 8 measures the number of living cells in order to confirm the cell death results shown in FIG. 7.
  • FIG. 9 confirms the death of lung cancer cells by guide shows complementary to target genes CCR5, HPRT1, MT2, GNPDA2, SLC15A5 and KCNE2 in lung cancer cell line H1299. At this time, the control group which performed only lipofectamine (Lipo) without the introduction of DNA was included.
  • Figure 10 shows NucBlue Live ReadyProbes Reagent and Propidium Iodide
  • the living cells of the NT1 control group and GNPDA2 experimental group were microscopically imaged using the ReadyProbes Reagent.
  • NucBlue Live ReadyProbes Reagent is a blue fluorescent dye that stains both live and dead cells.
  • Propidium Iodide ReadyProbes Reagent is also a red fluorescent dye that stains only dead cells.
  • FIG. 11 shows the number of live cells in order to confirm the death of lung cancer cells by guide RNAs complementary to target genes CCR5, HPRT1, MT2, IRX1 and ADAMTS16 in lung cancer cell line H1563.
  • FIG. 12 shows the number of living cells with time using luminescence to confirm the death of lung cancer cells by guide shows complementary to target genes HPRT1, CCR5 and MT2 in lung cancer cell line A549.
  • FIG. 13 shows the number of living cells immediately in order to confirm the death of lung cancer cells by guide RNAs complementary to target genes HPRT1, CCR5 and MT2 in lung cancer cell line A549.
  • FIG. 14 is a microscope observing the result of FIG. 13.
  • FIG. 15 shows the number of living cells over time using luminescence to confirm death of lung cancer cells by guide RNAs complementary to target genes MT2, CD68, DACH2, HERC2P2 and SHBG in lung cancer cell line A549.
  • FIG. 16 is a time course to confirm the death of breast cancer cells by guide shows complementary to target genes MT2, ERBB2 and KRT16 in breast cancer cell line SKBR3. 2019/190198 1 »(: 1 ⁇ 1 ⁇ 2019/003585
  • the number of living cells was measured using luminescence.
  • FIG. 17 shows the number of viable cells over time to confirm the death of breast cancer cells by guide shows complementary to the target genes 1 ⁇ 2, Table 1 «82 and 10 ⁇ 16 in breast cancer cell line 5-3.
  • FIG. 18 measures the number of living cells over time to confirm the death of cervical cancer cells by guide VIII complementary to the target genes ⁇ 5, ⁇ 2 and 13 ⁇ 43 ⁇ 49 in cervical cancer cell line 3 ⁇ 41. At this time, each gene 3 ⁇ 4 ⁇ 2 was above 100 and 1–3 ⁇ 49 was above 8.
  • FIG. 19 shows the number of viable cells over time to confirm the death of cervical cancer cells by target genes 03 ⁇ 45, ⁇ 1 company) 3 ⁇ 419, and Shi complementary guide show in cervical cancer cell line 3 ⁇ 41. At this time, each gene
  • Figure 2 is measured by using the luminescence of the number of living cells over time to confirm the death of cervical cancer cells by the guide show complementary to the target genes 03 ⁇ 45, 2, [1 and Company 19 in cervical cancer cells 3 ⁇ 41 will be.
  • FIG. 2 is a cell number measured using luminescence to confirm the death of cervical cancer cells by the target genes (5, 1 ⁇ 2 and 0 complementary guide 13 ⁇ 4 ⁇ ) in cervical cancer cells 3 ⁇ 41. will be.
  • 21 is a target gene 03 ⁇ 45, ⁇ 1 ⁇ 1, ⁇ ,! ⁇ ! 3 (: , The number of living cells was measured to confirm the death of colon cancer cells.
  • Figure 22 is a target gene # 2, in colorectal cancer cell # 29, The number of living cells was measured using luminescence to confirm the death of colorectal cancer cells by the guide show complementary to Ni. 00536, ⁇ , and 1 «: 9.
  • FIG. 23 confirmed whether the guide shock complementary to an effective target gene in 299, a lung cancer cell line, was effective in another lung cancer cell line, 111563. To this end, the number of living cells was measured to confirm the death of 563 lung cancer cells by the guide gene ⁇ complementary to the target genes 3 3 ⁇ 4 111, 0 2, ⁇ 5 Show 5 and ⁇ ⁇ 2.
  • Figure 25 confirms the death of lung cancer cells by guide shows complementary to 0 5, # 2, 31 ⁇ 1 11 and # 315 show 5 to confirm the effect by 0 in lung cancer cell lines 111299. At this time, Since the plunge muscle was measured, high luminescence was detected in the dead cells.
  • Figure 26 shows endonuclease function
  • a protein with an exonuclease function seedling mutations in the lung cancer cell line 11 ( ⁇ 827 and (guide show complementary to 13 ⁇ 45 and 03 £ 9 and (SEQ ID NO: 87) was used.
  • the killing capacity of lung cancer cells was significantly increased in the fusion protein to which the exonuclease is bound.
  • FIG. 27 is a microscope observing the experimental results of FIG. 26.
  • Figure 28 is an experiment to confirm the effect of the delivery system, the guide show and the endonuclease protein 0k59 is combined form! ! ? (0111 (: 1601) 1'01 ⁇ 11) confirms whether apoptosis is effective. Specifically, in lung cancer cell line 11 (X827 Capable of Complementary to Mutation It was confirmed that co-working mixed with 0339 effectively killed lung cancer cells. On the other hand, it was confirmed that the 0339 protein and guide cells used as a negative control did not kill.
  • 29 is an experiment for confirming the effect according to the delivery system, confirming that _ can effectively induce cell death.
  • the experimental group was composed of urine and 0339 complementary to 3 ⁇ 4 ⁇ 2.
  • Cell line was used as lung cancer cell line 3 ⁇ 4563.
  • Consist of 0339! 3 was used.
  • the cell line was 299, a lung cancer cell line.
  • FIG. 32 is a microscope observing the experimental results of FIG.
  • the cell line used lung cancer cell line ⁇ 0827.
  • FIG. 34 is a microscope observing the experimental results of FIG. 33. .
  • the present invention provides a tumor cell killing composition
  • a tumor cell killing composition comprising as an active ingredient a polynucleotide and a nuclease that complementarily bind to a nucleic acid specifically present in cancer cells.
  • dragon guide is a guide Refer. Show and It can be a single strand ⁇ ⁇ (13 ⁇ 416 versus ⁇ 3 ⁇ 4). Also, It can be combined with a maximum of 1 1 ⁇ 2 to activate the crisper-associated protein, and the drug can be used in combination with the virus.
  • the gene may be complementary to a gene sequence specifically present in a target cancer cell. Also, By combining with a gene sequence specifically present in the target cancer cells, the crisper-associated protein can be activated. Above show or It may be composed of 15 to 40 nucleic acids. In this case, the polynucleotide may be composed of 18 to 30, 20 to 25 nucleic acids. Work It may consist of nucleic acids.
  • the urine or solvent may include an additional sequence at 3 'in order to activate a crisper associated protein such as 0k39.
  • said tomb !? Is represented by SEQ ID NO: 87 to SEQ ID NO: 129 May be produced by
  • nuclease may be an endonuclease.
  • nucleic acid such as a shock show has a double strand or a single strand ((/ !? And It is an enzyme that can recognize and cleave this. Specifically, these are seedlings or guides The bound double- or single-stranded nucleic acid can be recognized and cleaved.
  • nuclease of the present invention Combined with the target site 2019/190198 1 » (: 1 ⁇ 1 ⁇ 2019/003585
  • Recognition may be that endonuclease function is activated.
  • endonuclease function it may be one having exonuclease activity capable of nonspecific cleavage of double-strand and / or single-strand show and / or urine.
  • a crisper associated protein such as 035123, once activated, may exhibit nonspecific exonuclease activity. In such a case And the show can be cleaved nonspecifically.
  • composition of one embodiment of the present invention is directed to a specific target site present in cancer cells ( Cancer cells can be specifically killed by nonspecific nucleases that are bound and activated thereby. Therefore, since the composition of the present invention can specifically kill only cancer cells, it can be used as an anticancer agent.
  • One embodiment of an associated protein is 0331, 03516, 0332,
  • the 0339 protein may be encoded by a nucleic acid having the sequence of SEQ ID NO: 19.
  • the ⁇ 11 protein may have an amino acid sequence of SEQ ID NO: 22.
  • the ⁇ 1 protein may be encoded by a nucleic acid having a sequence of SEQ ID NO: 21.
  • the 0202 protein may have an amino acid sequence of SEQ ID NO.
  • the 0202 protein may be encoded by a nucleic acid having a sequence of SEQ ID NO: 23.
  • nucleic acid specifically present in cancer cells refers to nucleic acids present only in cancer cells that are differentiated from normal cells. That is, it may mean a sequence different from a normal cell, and at least one nucleic acid may be different. In addition, part of the gene may be substituted or deleted. In addition, certain sequences may have repeated sequences. In this case, the repeated sequence may be a sequence existing in a cell, or may be a sequence inserted externally.
  • the nucleic acid that exists specifically to the tumor cells a nucleic acid that exists, specifically in cancer cells ever is a single nucleotide polymorphism (s ingle nucleot ide polymorphi sm, SNP), a gene cloning waterside (copy number var i at ion , CNV), structural variations (SV), insert ions, or deletion ions of genes.
  • SNP single nucleotide polymorphism
  • CNV gene cloning waterside
  • CNV structural variations
  • insert ions or deletion ions of genes.
  • the sequence specifically present in cancer cells may be SNPs present in cancer cells.
  • the target DNA present in the cancer cells having the sequence and the crRNA or guide RNA having a sequence complementary to the target urine may specifically bind to each other. Therefore, the nucleic acid specifically present in cancer cells can impart the specificity of the composition for tumor cell killing disclosed in the present invention.
  • nucleic acids specifically present in cancer cells can be used to find specific SNPs present only in cancer cells from genome sequencing of various cancer tissues, and to use them to prepare crRNAs or gRNAs. Therefore, since cancer cell-specific toxicity is a method, it may be possible to develop a patient-specific anti-cancer therapy.
  • the sequence specifically present in cancer cells may be a gene mutation (CNV) present in cancer cells.
  • CNV refers to a variation in which portions of the genome are repeated. The number of repeating genes can differ between cancer types and individuals.
  • CNV refers to a nucleic acid fragment that shows a difference in the number of repeated sequences compared to a standard reference genomic of humans, such as deletion or amplification, unlike general genes present in two copy numbers.
  • the CNV is 2 in normal cells, CNV is 4 or more in cancer cells can impart specificity of the composition for tumor cell killing.
  • the CNV may be 4, 8, 10, 12, 14, 16, 18, 20, 24, 30, 40, 50, 60, 70, 80, 90, or 100 or more.
  • the number of copies is seven or more, it can be determined as CNV.
  • Table 1 One embodiment of the copy number according to cancer cell line genes is shown in Table 1 below.
  • the CNV is one of the very important types of mutations associated with human diseases such as cancer, intellectual lectual disability, epi lepsy, schizophrenia, obesity and the like.
  • Most cancer cell lines have CNV, and guide RNAs having sequences complementary to target sequences present in CNV specifically bind to each other. Therefore, CNV specifically present in cancer cells can impart the specificity of the anticancer agent disclosed in the present invention.
  • the higher the number of CNV the more genes cleaved by the crisper-associated protein, the greater the damage to the nucleus of cancer cells.
  • the data of CNV specifically present in cancer cells can be easily confirmed through microarray, FISH (fluorescence in situ hybridization) technique, and can be used to prepare crRNA or gRNA.
  • FISH fluorescence in situ hybridization
  • CRISPR-associated proteins with crRNAs or gRNAs that target specific sequences present in the CNV of cancer cells can induce cancer cell-specific cell death. Therefore, because of the cancer cell specific toxicity, it may be possible to develop a patient-specific anti-cancer therapy.
  • a polynucleotide that complementarily binds to a gene having a particularly high CNV in a cancer cell together with a crisper-associated protein or a crisper plus protein fused with a crisper-associated protein and an exonuclease protein When used, it was confirmed that only cancer cells can be effectively killed. In addition, it was confirmed that the selection of genes with high CNV among gene mutations specifically present in cancer cells can more effectively kill cancer cells.
  • the specific sequences present in the cancer cells may be structural var i ations (SV) present in the cancer cells, wherein the invers ion, trans locat ion, and repeat base sequence are present. Short nuc leot ide repeat expansion.
  • SV structural var i ations
  • the inversion is a mutation in which a portion of the gene is reversed, and is one of the types of mutations associated with diseases such as hemophilia, lung cancer and the like.
  • the translocation is a mutation in which a portion of the chromosome breaks off and binds to another chromosome.
  • the overamplification of the repeat base sequence is a mutation in which the same sequence is repeatedly amplified.
  • SVs such as gene inversion, translocation, and overamplification of repeat base sequence
  • junction region sequence between the end of the sequence and the end of the normal cell line is a sequence existing only in the cancer cell line.
  • Guide RNAs having sequences complementary to the sequences of the SV conjugation regions present in cancer cells specifically bind to each other. Therefore, the sequence of the SV conjugation region specifically present in cancer cells can impart the specificity of the anticancer agent disclosed herein.
  • the sequence of the SV conjugation region is specific to cancer cells because the sequence does not exist in normal cells. Therefore, when processing polynucleotides and CRISPR associated proteins that complementarily bind to the sequence of the SV junction region present in cancer cells Specifically, cancer cell death may be induced. Therefore, since the specific toxicity to specific cancer cells, it may be possible to develop a patient-specific anti-cancer therapy.
  • a sequence specifically present in cancer cells may be generated by insert ion or deletion ion of a gene.
  • the guide RNA having a sequence complementary to the sequence where the mutation is inserted by the insertion or deletion can effectively kill cancer cells.
  • insertion of genes or deletion of genes specifically present in cancer cells can impart the specificity of the anticancer agents disclosed herein.
  • it is specific because it is not present in normal cells as the sequence of SV conjugation region, and treatment of CRISPR-associated protein with insertion and deletion mutant sequences present in cancer cells specifically induces cell death.
  • PAM protospacer adj mot mot i f
  • Indel insert ion and delet ion
  • the inserted gene may be a nucleic acid sequence existing in the cell, but may be a gene sequence introduced from the outside.
  • viral genes may be inserted into the cells.
  • the nucleic acid sequence of the virus can be used as a nucleic acid specifically present in cancer cells of the present invention.
  • the cancer in which insertion occurs as described above is rare, but is specific for cancer cells because it targets sequences not present in normal cells.
  • the viral sequence is integrated into several copies, the CNV is high, which can induce cancer cell death.
  • One embodiment of such a cancer may be cervical cancer caused by papillomavirus (papi lomavi rus).
  • a gRNA targeting an externally introduced gene may be a gRNA produced by DNA of SEQ ID NO: 121 to SEQ ID NO: 124.
  • a 5'-NGG-3 'sequence which is a protospacer associated mot if (PAM) sequence, may be considered together.
  • PAM protospacer associated mot if
  • genes having clear sequence information such as gene insertion, gene deletion and conjugation region, and genes with high copy number of CNV can be preferentially selected.
  • G or C is present at the 5 'and 3' ends, whether GC contents (%) of the entire sequence are contained in 40 to 60%, and in the 3 'direction of PAM, the sequence cleaved by the endogenuclease, a crisper-associated protein It can be determined whether the third to fourth base portions are A or T.
  • the binding af f ini ty of the sgRNA may be increased.
  • cleavage ef fi ciency of SpCas9 can be increased when the 3rd-4th base moiety is A or 3 'in the 3' direction of PAM, where the Streptococcus pyogenes Cas9 (SpCas9) cleaves the sequence.
  • the cancer is bladder cancer, bone cancer, blood cancer, breast cancer, melanoma, thyroid cancer, parathyroid cancer, bone marrow cancer, rectal cancer, throat, laryngeal cancer, lung cancer, esophageal cancer, pancreatic cancer, colon cancer, gastric cancer, tongue cancer, skin cancer, brain tumor, uterine cancer
  • It may be any one selected from the group consisting of head or neck cancer, gallbladder cancer, oral cancer, colon cancer, proximal cancer, central nervous system tumor, liver cancer and colon cancer.
  • it can be stomach cancer, colon cancer, liver cancer, lung cancer, breast cancer known as Korea's five major cancers.
  • nucleic acids present in the cancer are p53, PTEN, APC, MSH2, HBV,
  • gastric cancer may be a mutation of P53 and PTEN, known as tumor suppressor genes.
  • colorectal cancer may be a mutation of the APC and MSH2 gene.
  • liver cancer is mainly caused by infection with HBV and HCV viruses, so HBV or Nucleic acids can be targets.
  • lung cancer may be targeted by mutation of the EGFR gene
  • breast cancer may be a target of mutation of the BRCA1 / 2 gene.
  • nucleic acid sequences specific to cancer cells are utilized as nucleic acid sequences specific to cancer cells, and the genes can be used for the production of crRNA or gRNA.
  • any SNP of DNA specifically present in cancer cells can be used.
  • One embodiment of the nucleic acid sequence specifically present in cancer cells may be, but is not limited to, the sequence described in Table 2 below.
  • the 0-13 seed show that targets the nucleic acid sequence specifically present in the cancer cells may include one or more shock show or dragon show sequences.
  • the combination of!? ⁇ Or 1? ⁇ may be appropriately selected depending on the purpose of cancer treatment and the type of cancer. That is, different ⁇ ⁇ can be selected and used.
  • the tumor killing composition of the present invention may further comprise an exonuclease.
  • exonuclease is an enzyme that cleaves nucleotides from the 5 'end or 3' end direction of a nucleic acid molecule.
  • the exonuclease may be a 5′- 33 ′ nuclease that degrades the nucleic acid in the 5 ′ to 3 ′ direction.
  • the exonuclease may be a 3 '-> 5' nuclease that degrades the nucleic acid in the 3 'to 5' direction.
  • one embodiment of the 5 '->3' nuclease may be seedlings derived from E. coli or 13 ⁇ 4. It may also be 15 from bacteriophage 15.
  • one embodiment of the 3 ' ⁇ 5' nuclease may be seedling I derived from eukaryotic or prokaryotic cells. have. It may also be Exo III derived from E. coli. It may also be Trexl or Trex2 derived from humans.
  • nucleases having 5 '->3' and 3 '->5' bidirectional cleavage activity may be Exo VII or RecBCD from E. coli.
  • in one embodiment may be 5 '->3' lambda exonuclease derived from E. coli. It can also be Mungbean derived from Vigna radiata, capable of cleaving single chain DNA.
  • exonuclease Exoribonuc lease T TREX2, TREX1, RecBCD, Exodeoxyribonuclease I, Exodeoxyribonuclease III, Mungbean exonuclease, RecE, RecJ, T5, Lambda exonuclease, Exonuclease VI I small unit, Exonuclease VII , Exo I, Exo III, Exo VII and Lexo can be any one selected from the group consisting of.
  • exonuclease is Exoribonuc lease T (SEQ ID NO: 4),
  • RecBCD_RecC SEQ ID NO: 8
  • RecBCELRecD SEQ ID NO: 9
  • the present invention provides a tumor cell killing composition
  • a tumor cell killing composition comprising, as an active ingredient, a polynucleotide and a fusion protein in which an endonuclease and an exonuclease bind complementarily to a nucleic acid specifically present in cancer cells.
  • a tumor cell killing composition comprising, as an active ingredient, a polynucleotide and a fusion protein in which an endonuclease and an exonuclease bind complementarily to a nucleic acid specifically present in cancer cells.
  • the CRISPR ⁇ AS system capable of effectively killing cells having a desired nucleic acid sequence by binding the exonuclease to crRNA and CRISPR associated proteins is named CRISPR PLUS.
  • the fusion protein to which the endonuclease and exonuclease are bound is Cas9-Exor i bonuc 1 ease T, Cas9-REX2, Cas9-TREX1, Cas9_RecBCD_RecB, Cas9-RecBCD_RecC, Cas9-RecBCD_RecD, Cas9_Exodeoxyri bonuc lease I, Cas9- Exodeoxyribonuclease III, Cas9-Mungbean, Cas9-RecJ, Cas9-RecE, Cas9-T5, Cas9- Lambda, Cas9-Exonuc lease VII small unit, Cas9_Exonuc lease VII large unit, Cpf 1-Exor i bonuc 1 ease T, Cpfl-REX2 , Cpf 1-TREX1, Cp f l-RecBCD_RecB, Cpf 1- RecBCD_RecC, Cp
  • cell death rate was increased even in a small number of CNVs, such as CCR5, a gene of CNV 2, and endonuclease. Better apoptosis was observed than when using zebra.
  • the linker may be an albumin linker or a peptide linker.
  • the linker may be composed of 1 to 50 amino acids, 3 to 40 amino acids, 10 to 30 amino acids.
  • the peptide linker may be a peptide consisting of Gly and Ser residues.
  • the peptide linker is leucine (Leu, L), isoleucine (lie, I), alanine (Ala, A), valine (Val, V), proline (Pro, P), lysine (Lys, K), arginine It may be a peptide consisting of 1 to 1 ⁇ amino acids selected from the group consisting of (Arg, R), asparagine (Asn, N), serine (Ser, S) and glutamine (Gin, Q). In addition, the linker may be a polypeptide consisting of 3 to 15 amino acids consisting of glycine (Gly, G) and serine (Ser, S) residues, it may be composed of 6 to 11.
  • a pharmaceutical composition for treating cancer comprising the composition for killing tumor cells of one embodiment described above.
  • the tumor or cancer may be bladder cancer, bone cancer, blood cancer, breast cancer, melanoma, thyroid cancer, parathyroid cancer, bone marrow cancer, rectal cancer, throat, laryngeal cancer, lung cancer, esophageal cancer, pancreatic cancer, colon cancer, gastric cancer, tongue cancer, skin cancer, brain tumor, uterine cancer It may be any one selected from the group consisting of head or neck cancer, gallbladder cancer, oral cancer, colon cancer, proximal cancer, central nervous system tumor, liver cancer and colon cancer.
  • the formulation of the pharmaceutical composition of the present invention may be parenteral. If formulated 2019/190198 1 »(: 1 ⁇ 1 ⁇ 2019/003585
  • formulations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, suppositories.
  • non-aqueous solvent and suspending solvent propylene glycol (1) 1 (1 1: 1 for 1611 ⁇ 2), polyethylene glycol, vegetable oils such as olive oil, injectable esters such as ethyl oleate, and the like can be used.
  • compositions of the present invention may be administered parenterally, and may be administered intratumorally, intravenously, intramuscularly, intradermal, subcutaneous, intraperitoneal, intraarterial, intraventricular, intralesional, intrathecal, topical, and combinations thereof. It can be administered by either route selected from the group consisting of.
  • the dosage of the pharmaceutical composition of the present invention varies depending on the weight of the patient, age, sex, health condition, diet, time of administration, administration method, excretion rate and severity of the disease, and may be appropriately selected by those skilled in the art. Can be.
  • the pharmaceutical composition of the present invention 100 Specifically, it can be administered from 1 / 13 ⁇ 4 to 1 ⁇ cg. Administration may be administered once a day or may be divided several times. Therefore, the above dosage does not limit the scope of the present invention in any aspect.
  • the present invention is for killing tumor cells comprising as an active ingredient a vector loaded with a polynucleotide and a polynucleotide encoding an endonuclease complementary to a nucleic acid sequence specifically present in cancer cells To provide a composition.
  • nucleic acid specifically present in cancer cells “endonuclease” and “exonuclease” are as described above, and “complementarily binds to nucleic acid specifically present in cancer cells.
  • Polynucleotides to be.
  • the urine nucleic acid can produce an amino acid or an enzyme that can complementarily bind to a nucleic acid sequence specifically present in cancer cells. At this time, As described above.
  • composition is a polynucleotide that I) complementarily binds to a nucleic acid sequence specifically present in cancer cells and polynucleotides encoding the endonuclease) can be loaded into one vector. If necessary, a polynucleotide complementarily binding to a nucleic acid sequence specifically present in the 0 cancer cell; 2019/190198 1 »(: 1 ⁇ 1 ⁇ 2019/003585
  • Polynucleotides encoding endonucleases can be loaded and used in each vector.
  • composition may further include a polynucleotide encoding an exonuclease ' in the vector.
  • polynucleotides complementarily binding to nucleic acid sequences specifically present in the 0 cancer cells, a) polynucleotides encoding endonucleases, and 1 1 1) polynucleotides encoding exonuclease are required. Can be loaded onto each vector and used.
  • a polynucleotide that complementarily binds to a nucleic acid sequence specifically present in cancer cells may be a composition for tumor cell killing comprising a vector loaded with a polynucleotide encoding a fusion protein to which an associated protein and an exonuclease are bound as an active ingredient.
  • a polynucleotide encoding an 0839 ⁇ 601 fusion protein fused with an endonuclease 0k39, which is a crisper associated protein, and a parent !, an exonuclease was used.
  • the vector may be a viral vector or a plasmid vector, but is not limited thereto.
  • a polynucleotide that complementarily binds to a nucleic acid sequence specifically present in the cancer cell Vectors loaded with polynucleotides encoding associated proteins and / or polynucleotides encoding exonucleases can be prepared by cloning methods known in the art, and are not particularly limited thereto.
  • the present invention also provides a method of treating cancer, comprising administering the above-described composition for killing tumor cells to a subject.
  • the polynucleotide and the nuclease protein that complementarily bind to the nucleic acid sequence specifically present in the cancer cells may be administered to the individual suffering from the cancer.
  • exonucleases can be added and administered to individuals with cancer in the form.
  • the pharmaceutical composition of the present invention can be administered to mammals such as domestic animals and humans by various routes. All modes of administration can be expected, for example intratumoral administration, intravenous, intramuscular, intradermal, subcutaneous, intraperitoneal, intraarterial, intraventricular, intralesional, intrathecal, topical, and combinations thereof. It can be administered by either route selected from the group consisting of.
  • the targeting gene was found in the exon part of the protospacer adj acent mot i f (PAM, 5 '-NGG-3') sequence, and the upper 20 mer sequence was defined as the protospacer sequence. At least three types of protospacers were designed because the editing efficiency in the cell differs depending on the position of the target sequence.
  • Oligonucleotides were synthesized by binding 5′-TAGG_3 ′ bases to the 20 mer sequence 5 ′ and 5′-AAAC-3 ′ to the 3 ′ portion of the complementary sequence. Two synthesized sequence oligomers were adjusted to 100 uM and 2 uL each was diluted in 46 uL purified water.
  • Annealing was performed using a thermocycler, and treated for 5 minutes at 95 ° C., was treated for 10 minutes by lowering the temperature to 55 ° C at a rate of 4 ° C / sec.
  • T7 promoter SEQ ID NO: TAATACGACTCACTATAGG
  • crRNA scaffold sequence SEQ ID NO: 2
  • TmACGkCTCkCTm ( ⁇ TGkGACCGcA ( ⁇ lCTCGGTrmGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCC GTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC-y i ⁇ 3).
  • ligation was performed to the vector treated with the restriction enzyme (100 to 200 ng / uL). 5 anneal mixtures 6 uL, vector 2 uL, T4 DNA ligase 10X Buf fer (Pr omega C126B) 1 uL, and 1 uL of T4 DNA ligase (Promega M180A) were placed in a 1.5 uL Eppendorf tube and mixed by tapping Incubate overnight at 4 ° C. The ligation mixture was transformed into E. coli DH5a. Sanger sequencing with M13 primers confirmed cloning with the following sequences:
  • the outcome of the warrior 1; (111 1; 1'0 yo 611, ⁇ 1908) was purified pure, and the concentration was estimated with a spectrophotometer. In general, at least about 1 to 2 of 0 "13 ⁇ 4 was obtained. At this time, attention was paid to contamination of 1 336.
  • the purified urine was diluted and dispensed to the required concentration and amount and stored at -80 ° (: Pay attention to
  • Oligomers were synthesized for sequences comprising the 17 promoter and 11 ⁇ for 111 0 transcription and complementary sequences, respectively:
  • Annealing was carried out using 3 ⁇ 461'111007 (: 161 '), and the treatment was performed at 95 ° (1 min for 5 minutes) and the temperature was lowered to 55 ° (: at a rate of 4 ° [ ⁇ 6 (:) for 10 minutes.
  • the 5th product 4 ⁇ (800 ⁇ ) was reacted for about 4 to 8 hours at 50 ⁇ reaction volume using 17 ⁇ ( ⁇ ), 1354) to transfer 0 "show at 1:10.
  • Purification was performed by ethanol deposition, and the concentration was determined using a spectrophotometer, usually about 1 to 2 or more achingos were obtained and attention was paid to ⁇ 336 contamination. Busy- Stored at 80 ° C., pay attention to temperature changes and shock.
  • the protospacer refers to a targeting sequence that gRNA can complementarily bind to DNA in the host cell.
  • Protospacer sequences were assayed by insertion into PUC19, or pGEM vectors via cloning, and sequencing with M13 primers.
  • Substrate DNA was amplified and purified by polymerase chain reaction using M13 primer at a concentration of 100 ngAiL-
  • the genome editing function of the containing CRISPR / Cas protein was confirmed to be activated by crRNA-guided target sequence binding to activate the function of nonspecific nucleases that degrade DNA or RNA molecules.
  • a schematic diagram thereof is shown in FIG. 1.
  • Cancer cells have their own chromosomal mutations or single nucleotide polymorphisms (SNPs), including gene mutations, at specific genomic sites that do not exist in normal cells, depending on the tissue from which they are derived and the type of cancer.
  • This cancer-specific SNP was used as a cancer cell specific marker of the present invention.
  • Cancer cell specific SNPs were used for the synthesis of crRNAs comprising sequences complementary to SNPs and recognized by CRISPR PLUS proteins, including CRISPR associated proteins and exonucleases containing these crRNAs. Sequence specific binding between SNPs and crRNAs in cancer cell genomes activated the genome editing function of the CRISPR PLUS protein, resulting in target DNA / RNA breakage. The activation then activated the intrinsic nonspecific nuclease function of CRISPR PLUS which irreversibly destroys ds and ss DNA / RNA molecules in cancer cells, resulting in cell death. These results are shown in a schematic diagram in FIG.
  • Example 3 Confirmation of Endonuclease Function of SpyCas9 (SEQ ID NO: 46) (In vitro) After diluting NEBufferä 3.1 to the final IX concentration in nuclease-free purified water and adding 120 nM of nuclease and 120 nM of crRNA, RNP complex formation was induced. After mixing was incubated at room temperature for about 15 minutes. About 200 ng of substrate DNA was added and tapped and reacted at 37 ° C. In order to confirm the response to the substrate DNA without the target sequence, the non-targeting DNA was put in this step. The final volume of the reaction solution was adjusted to 20 uL. After the reaction, the gel loading dye solution was added and mixed well.
  • the stained reaction 12 was electrophoresed with lkb DNA marker (Thermo Scientific, SM0311). Then, the substrate DNA band cut by the activity of the nuclease was observed.
  • SEO 2 (54x1) sequences are shown in SEQ ID NO: 132, SEQ ID NO: 133, and SEQ ID NO: 134, respectively.
  • Example 5 Cytotoxicity Assay HeLa cells, human cancer derived cells, were cultured in a 5% CO 2 incubator at 37 ° C. using DMEM / 10% FBS growth medium. One day before transformation, 2.5 ⁇ 10 4 cells were plated in 96 wells in 100 ul culture. Blank (background control) put only 100 media. The next day, transfection using CRISPR / Cas nuclease and crRNA complex (RNP) was performed according to the conditions shown in Table 3 below. One of the crRNAs has sequence specificity for the human DHCR7 gene, and the other has sequence specificity for the DWARF5 gene of rice.
  • RNP CRISPR / Cas nuclease and crRNA complex
  • WST_l Cell proliferation Reagent, Roche 0501594401
  • WST_l Cell proliferation Reagent, Roche 0501594401
  • CRISPR / Casl2a nuclease is toxic to cells depending on sequence specific enzyme activity.
  • Cells transfected with the same conjugate showed no change in viability (HEK293) or a slight fall (HeLa) at 24 and 48 hours. This means that some time is required for the toxicity of CRISPR / Casl2a nuclease to affect cells.
  • RNP conjugates were prepared by mixing crisnuclease and crRNA, and then transfected into cancer cells and normal cells, and cancer cell specific killing effects were analyzed using a WST-1 based cell viability assay.
  • the used crRNA was prepared to target the sequence (SEQ ID NO: 43) specifically present in EGFR of lung cancer.
  • Lipofectamine Cas Plus Reagent was added and incubated at room temperature for 5 minutes. Another tube was prepared during the incubation of the tube. 5ul of Opti-MEM and 0.3ul of Lipofectamin CRISPRMAX Reagent were mixed and incubated at room temperature for 5 minutes. The two tubes were mixed and incubated at room temperature for 10 minutes. The mixed tube solution was dropped into each well in which cells grew. The cells were then incubated in a 5% CO 2 incubator at a temperature of 37 ° C.
  • WST-l (Cel 1 proliferation Reagent, Roche 0501594401) was added to each well by 10 ul on a clean bench, then in a 5% C0 2 incubator at a temperature of 37 ° C. And color change (heat is red _> dark red). After 10 minutes, the absorbance of the background and the sample was measured at 420 to 480 nm and 690 nm using a FLUOstar Omega ELISA reader. Cytotoxicity of CRISPR / Cas nucleases in target and non-target crRNAs was analyzed.
  • lung cancer cells specifically killed in the group treated with the target crRNA in lung cancer cells As a result, it was confirmed that lung cancer cells specifically killed in the group treated with the target crRNA in lung cancer cells.
  • the Cas9 protein expression vector (PM59, Addgene plasmid # 62988) was used to demonstrate that multi-cleavage can be induced in the genome of HCC827 cells, which are lung cancer cells, to cause cell death.
  • Vectors were delivered inside the cell by electroporation, and HCC827 cells were used to cause multi-cleavage in the genome.
  • Guide shows targeting the E2 mutant sequence of the EGFR gene were used.
  • the E2 mutant sequence of the EGFR gene is known to exist in about 18 or more multi-copy.
  • HCC827 cells were cultured in 75T flasks with RPMI-1640 (10% fetal bovine serum) medium in an amount of about 50% density, followed by trypsinizat ion and PBS washing, and finally Neon Electroporation Buffer. Resuspend in the urine. 10 (jL Neon pipette tips were loaded with 150, 000 cells and 500 vectors, followed by electroporation at 1300 V, 20 ms and 2 pulses. RPM 1-1640 ( The cells were recovered in 10% fetal bovine serum, and cells were harvested and counted after 6 days, and the results are shown in FIGS. 5 and 6.
  • the EGFR_E2 experimental group compared to the EGFRJVT experimental group (pSpCas9 (BB) -2A-Puro (PX459) V2.0-EGFR_WT) having no target sequence as compared with the electric pulse group. It was confirmed that the number of cells of (BB) -2A-Puro (PX459) V2.0_EGFR_E2) was significantly reduced. Specifically, 83% cell death was induced in the EGFR_E2 experimental group. Through this, when the Cas9 protein and cell genome sequence specific multi-target guide RNA is put into cancer cells, it was confirmed that the cell death.
  • Example 8 Confirmation of apoptosis effect according to target position in lung cancer cell H1299
  • Example 8.1 Introduction of gRNA and Crisper Proteins through Lipofection
  • the experimental results show that the NKnon target) known to be absent from H1299) and CCR5 and HPRT1 having only a pair of target positions showed similar amounts of cell killing effects.
  • MT2 which is known to cut more than 100 sites, showed apoptosis effect by dropping the amount of living cells to about 50% compared to these.
  • SMIM11 about 74%), GNPDA2 (about 58%), SLC15A5 (about 45%), and KCNE2 (about 77%) were found to have a higher killing effect than MT2.
  • SMIM11 and KCNE2 were more effective than MT2.
  • the killing effect was excellent. Copy number of each experimental group, Essentiality ⁇ ⁇ It is shown in Table 6, it was shown in Figure 7 by observing the morphology (morphology) of cells in each experimental group under a microscope.
  • NT1 and HPRT1 were 70% of CCR5.
  • MT2 the number of cells dropped by 25% compared to NT1, and in the three CNV-targeted species (GNPDA2, SLC15A5 and KCNE2), more cells were killed, and the number of cells using Trypan blue was significantly increased. I could't get it.
  • GNPDA2, SLC15A5 and KCNE2 the cell death rate of about 43%, about 23%, about 50%, about 86%, about 99%, about 99% and about 99% Indicated.
  • the NT1 and GNPDA2 experimental groups were selected as representatives of the experimental group with a lot of cells and the dead group. Afterwards, each well was microscopically imaged using NucBlue Live ReadyProbes Reagent and Propidium Iodide ReadyProbes Reagent. This is shown in FIG. 10. Analysis of the percentage of living cells by fluorescence was similar to the result shown in FIG. 9.
  • a concentration of 1) 111011 ⁇ 11 was treated and selected for 72 hours. Then, the culture medium of each well was removed by suction, and washed once with IX tables in 500 ml. Then, Trypsin-EDTA treatment to remove all the cells. After staining with Trypan blue dye, the number of living cells was measured. The results are shown in FIG.
  • Example 10 Confirmation of Apoptosis Effect According to Target Location in Lung Cancer Cell A549
  • DNA 500 expressing Cas9 protein and gRNA in lung cancer cell A549 was introduced by electroporation (Lonza). Cultured A549 cells were washed with IX PBS and then removed from the bottom by treatment with Trypsin-mTA. The required cell number was removed, washed once with IX PBS, released with SF buffer (Lonza) and mixed with each DNA. Cell and DNA mixture was placed in an electroporation device (Lonza) to apply an electric shock. As a control, we added NT1, 1 copy that is not aligned in the human gene sequence, and the condition that targets CRT5 which has the housekeeping gene HPRT1, 1 copy gene, and the condition of giving electric shock only (pulse only) were added. .
  • MT2 condition was confirmed that about 90% of the cells died. After introduction of DNA, it is selected by puromycin and before microscopic measurement. As a result of the cell number measurement, more than 50% of cells were recovered by targeting HPRT1 and CCR5 having only one copy compared to NT1 control, while 90% of cells were killed and only 10% of cells were recovered by MT2 condition. (Blue arrow: recovered cell colony). Therefore, it was confirmed that apoptosis occurred when inducing multi DNA break using Cas9 protein in A549 cells.
  • DNA 500 expressing the Cas9 protein and each CNV target gRNA into a cancer cell A549 was introduced by electroporation (Lonza). Cultured A549 cells were washed with IX PBS and then removed from the bottom by treatment with Trypsin-EDTA. The required cell number was removed, washed once with IX PBS, released with SF buffer (Lcmza) and mixed with each DNA. Cell and DNA mixture was placed in an electroporation device (Lonza) to apply an electric shock. As a control, a condition in which a pET21a vector capable of expressing protein in E. coli was introduced, a condition of giving an electric shock (pulse only), and a condition of no treatment (no pulse) were added.
  • Example 11 Confirmation of apoptosis effect according to the target position in breast cancer cells ⁇ BR3
  • DNA 500 expressing Cas9 protein and each CNV target gRNA in breast cancer cell SKBR3 was introduced by electroporation (Lonza).
  • SKBR3 cells in culture were washed with IX PBS and then removed from the bottom by treatment with Trypsin-EDTA. The required number of cells was removed, washed once with IX PBS, released with SF buf fer (Lonza) and mixed with each DNA.
  • Cell and DNA mixture was placed in an electroporation device (Lonza) to apply an electric shock.
  • NTKnon target not aligned in the human gene sequence a condition of giving an electric shock (pul se only), and a condition of no treatment (no pul se) were added.
  • cells were inserted into 2 wells in 24 wells and 3 times in 96 wells.
  • DNA 500 expressing Cas9 protein and each CNV target gRNA in breast cancer cell SKBR3 was introduced by electroporation (Lonza).
  • SKBR3 cells in culture were washed with IX PBS, and then removed from the bottom by treatment with Tryps in-EDTA. The required cell number was removed, washed once with IX PBS, released with SF buf fer (Lonza), and mixed with each DNA.
  • Cell and DNA mixture was placed in an electroporation device (Lonza) to apply an electric shock.
  • a condition that targets the house keeping gene HPRT1 was added with NT1 and 1 copy not aligned in the human gene sequence. After introducing the DNA by electric shock, 2 to 24 wells Cells were added in repetition.
  • Example 12 Confirmation of Apoptosis According to Target Location in Cervical Cancer Cell HeLa
  • Example 12.1. Confirmation of cell death by CNV target and HPV gene target
  • Vector 600 expressing Cas9 protein and gRNA was introduced into HeLa cells, a cervical cancer cell line, by electroporation.
  • HeLa cells in culture were washed with IX PBS, and then removed from the bottom by treatment with DTA in Trypsin. The required number of cells was removed, washed once with IX PBS, released with SE buf fer (Lonza), and mixed with each vector.
  • Cell and DNA mixture was placed in an electroporation device (Lonza) to apply an electric shock.
  • As a control group we added CCR5, which is a non-essent ial gene of 1 copy, and MT2, which targets more than 100 non-essential ial genes, and there were more than 30 copies of PRDM9, which is more than 8 copies in HeLa.
  • An experiment was conducted to induce HeLa cell specific apoptosis by targeting a gene derived from a known human Papi l loma virus (HPV).
  • CNV target PRDM9 and HPY gene target HPV_1 are similar to MT2 conditions or induce apoptosis. It was confirmed. Specifically, in FIG. 18, cell death rates of about 50% and about 80% were shown in MT2 and PRDM9. In addition, in FIG. 19, cell death rates of about 50%, about 40% and about 40% were shown in MT2, PRDM9, and HPVJL. Therefore, it was confirmed that apoptosis occurred when CNV and HPV genes containing only HeLa cells were induced with target DNA Break using Cas9 protein.
  • the process of introducing the DNA vector into the HeLa cell by electric shock is the same as the method of Example 12.1.
  • the cells were put in two replicates in 96 wells. Then, the degree of living cells undergoing metabolism was determined by luminescence by measuring the amount of ATP in cells using Cell Titer glo 2.0 at intervals of 24, 48 and 72 hours.
  • a control vector expressing GFP, a condition targeting CCR5, a non-essential gene of 1 copy, and an MT2 condition targeting 100 or more non essential genes were added.
  • the CCR5 target cutting only one site in HeLa cells and the pulse only containing only GFP showed a similar degree of luminescence signal.
  • the CNV target PRDM9 and HPV gene target HPV_1 was confirmed to induce more cell death than MT2 conditions. Specifically, cell death rates of about 50%, about 65% and about 65% were shown in MT2, PRDM9 and HPV_1.
  • NT condition that targets non-human genome to MT2 condition that targets 1 copy of non-essential gene CCR5 and more than 10 non-essential genes.
  • MT2 condition that targets 1 copy of non-essential gene CCR5 and more than 10 non-essential genes.
  • NT1 20 mer of non-target sgRNA is expressed.
  • NT2 and NT3 are 10 mer and 5 mer, respectively.
  • HPV Human Papilloma Virus
  • the CCR5 target that cuts only one site in HeLa cells showed a luminescence signal of about 75% when compared to NT3 having a 5 mer spacer, and induced 99.5% cell death under MT2 conditions compared to NT3.
  • HPV_1 the HPV gene target, was found to kill about 90% of cells when compared to NT3 conditions. Therefore, it was confirmed by the Cell Titer Glo method that apoptosis occurs when the HPV gene having only HeLa cells is induced with the target DNA Break using Cas9 protein.
  • Example 13 Confirmation of apoptosis effect according to the target position in colorectal cancer cell HT29 Example 13.1. Confirmation of Colon Cancer Cell Death by CNV Target
  • 1 ⁇ 2 / ⁇ The treatment was selected for 90 hours. Then, the cultures of each well were removed by suction and recovered with normal media (McC0Y + 10% FBS, 1% P / S) for 12 days. Afterwards, wash IX PBS with 500JJ and wash once. All cells were detached by treatment with Trypsin-EDTA. After staining with Trypan blue dye, these cells were measured twice and averaged. The results are shown in FIG.
  • NT1 which is known to have no target sequence
  • CCR5 which are single targets
  • HPRT1 had about 47% of cells left over NT1
  • MT2 and four CNV targets (TRAPPC, LINC00536, TRPS1, and CDK8), which cut more than 100 repeat sequences throughout the genome, were 2% compared to NT1.
  • Cell viability of 3%, 18%, 20% and 4.2% is shown. In other words, the CNV target was confirmed to effectively kill cancer cells.
  • HT-29 colon cancer cell line
  • 500 ng of DNA expressing the Cas9 protein and each CNV target gRNA was electrophoresis. Introduced into HT-29 cells by perforation (Lonza). Cultured HT-29 cells were washed with IX PBS and then removed from the bottom by treatment with Trypsin-EDTA. The required number of cells was removed, washed once with IX PBS, released with SF buffer (Lonza) and mixed with each DNA. The cell and DNA mixture was placed in an electroporator (Lonza) and subjected to electroshock.
  • TRAPPC9 CNV targets which target 100 or more sites, compared to 20% to 45% of the CDV8, LINC00536, and TRPS1 CNV targets. Induced death.
  • the transfection time point was selected for 72 hours by treatment with a concentration of 1
  • H1299 cells, a lung cancer cell line were detached with Trypsin-EDTA and plated with 1.3xl0 4 in white 96 wells.
  • DNA 500 expressing Cas9 protein and each CNV target gRNA was introduced by using a liposome.
  • 0.3 ⁇ of liposome reagent I was mixed with 5 pL of opti-MEM (tube 1).
  • Tube 2 was prepared by mixing 0.2
  • the method is a method of measuring the degree of cell death according to the degree of luminescence when AnnV is attached to the PS (phosphatidylserine) site exposed to the outer cell membrane when cell death occurs.
  • KCNE2, GNPDA2, SMIM11 and SLC15A5 showed about 30% to 40% cell death rate.
  • Cas9 protein expression vector (PX459, Addgene plasmid # 62988) was used to demonstrate that multi-cleavage in the genome of HCC827 cells, which are lung cancer cells, could cause cell death.
  • human codon-optimized Rec J protein was co-expressed in the PX459 vector to amplify the cell death effect.
  • Vectors were delivered internally by electroporation and guide shows were used to target the E2 mutant sequence of the HCC827 cell EGFR gene to generate multi-cleavage in the genome.
  • HCC827 cells were incubated in a 75T flask with RPM1-1640 (10% fetal bovine serum) medium in an amount of about 50% density, followed by trypsinization and PBS washing.
  • RPM1-1640 10% fetal bovine serum
  • Electroporation Buffer seedlings After loading 150,000 cells and 500 ng of vector into a 10
  • the experimental group targeting CCR5 using Cas9-RecJ exhibited about 50% cell death
  • the EGFR_E2 experimental group using Cas9-RecJ showed 80% cell death.
  • Example 17 Confirmation of apoptosis effect by EGFR mutant sequence specific guide RNA and apoptosis effect using
  • Cas 9 / sgRNA r ibonucleoprotein can cause mul t i -c leavage in the genome of HCC827 cells, which are lung cancer cells, and cause cell death.
  • RNPs were delivered internally by electroporation and a guide show was used to target the E2 mutant sequence of the HCC827 cell EGFR gene to generate mul t -cleavage into the genome.
  • HCC827 cells were cultured in a 75T flask in RPMI-1640 (10% fetal bovine serum) medium in an amount of about 50% density, and then resuspended in Neon El ectroporat ion Buf fer seedlings after trypsinization and PBS washing. After loading 150,000 cells and 1.2 [RNP] into the 10
  • the number of cells in the experimental group containing RNPs targeting the EGFR_E2 sequence was significantly reduced when compared with samples given only electric pulse (pulse only) or samples containing only Cas protein or guide show. Specifically, in the experimental group containing the RNP targeting the EGFR_E2 sequence, the cell death rate was about 35%.
  • Example 18 Confirmation of Apoptosis Effect by JTT2 Sequence Specific Guide RNA and Apoptosis Effect Using RNP
  • Cas9 / sgRNA r ibonucleoprotein can be used to cause multi-cleavage in the genome of H1563 cells, which are lung cancer cells. Cell death was achieved by electroporation.
  • MT2 a guide RNA that can target more than 100 sites in the human genome.
  • H1563 cells were incubated in 75T flasks with RPMI-1640 (10% fetal bovine serum) medium in an amount of about 50% density, followed by trimming and PBS washing.
  • RPMI-1640 10% fetal bovine serum
  • H1299 cells which are lung cancer cells
  • Cas9 protein was used to cause multi-cleavage in the genome of H1299 cells, which are lung cancer cells, to cause cell death.
  • H1299 cells which have relatively high transfection efficiency, were used in the experiment and RNPs were delivered inside the cells by electroporation.
  • MT2 Three kinds of guide RNAs were used as guide RNAs for generating multi-cleavage in the genome: MT2, GNPDA2 and SMIM11.
  • GNPDA2 oncogenes
  • SMIM11 non-essential genes
  • CNV copy-number variation
  • H1299 cells were cultured in 75T flasks with RPM 1-1640 (10% fetal bovine serum) medium in an amount of about 50% density, and then resuspended in Neon Electroporat ion Buf fer urine after trimming and PBS washing. 10
  • Casl2a protein expression vector can cause cell death by causing double or mul t-cleavage in the genome of HCC827 cells, which are lung cancer cells.
  • the DNA and amino acid sequences of Casl2a are shown in SEQ ID NOs: 135 and 136.
  • Vectors were delivered inside the cell by electroporation and crRNA (sequence targeting the wild type non-essent al gene CCR5 (SEQ ID NO: 138), or the EGFR.E2 mutant sequence known to have more than 18 copies in HCC827 cells). Number 139).
  • HCC827 cells were approximately 50% in RPM 1-1640 (10% fetal bovine serum) medium in a 75T flask. After culturing in the amount of density, trimming and PBS washing were finally carried out to Neon Electroporat ion Buf fer urine. The 10
  • the EGFR_WT sequence (SEQ ID NO: 137) used as a control is a sequence not known to exist in HCC827 cells. The results are shown in FIGS. 33 and 34.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Epidemiology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • Genetics & Genomics (AREA)
  • Biochemistry (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

본 발명은 crRNA 및 엔도뉴클레아제를 유효성분으로 포함하는 암 치료용 약학적 조성물에 관한 것이다. 본 발명은 DNA와 RNA가 특이적으로 결합하는 성질에 기초하여 암세포를 특이적으로 치료함으로써 환자 또는 세포 유형의 필요에 따라 맞춤화될 수 있다. 본 발명에 따른 CRISPR PLUS 시스템의 뉴클레아제 활성은 crRNA와 암세포에 특이적으로 존재하는 유전자와의 결합에 의해 활성화될 수 있다. 따라서, 본 발명의 암 치료 효과는 현재 개발된 다른 항암제보다 더욱 특이적이다.

Description

2019/190198 1»（：1^1{2019/003585
【명세세
【발명의 명칭】
가이드
Figure imgf000003_0001
및 엔도뉴클레아제를 유효성분으로 포함하는 암 치료용 약학적 조성물
【기술분야】
본 발명은 가이드 요 및 엔도뉴클레아제를 유효성분으로 포함하는 항암용 조성물에 관한 것이다.
【배경기술】
항암 치료 기술의 혁신적인 발전에도 불구하고 암은 여전히 인간에게 가장 위협적인 질병이다. 암은 다양한 발암물질에 의해 촉발될 수 있으며, 염색체 구조나 염기 서열상의 변이에 의해 유발될 수 있는 질병이다. 암의 가장 두드러진 특징 중 하나는 끊임없는 세포 증식이다. 현재 가장 많이 사용되는 항암 치료법은 세포를 효율적으로 사멸시키는 방사선이나， 특정 암세포를 타겟하는 화합물 또는 항체를 이용한 치료법이 있다. 그러나, 화학/방사선 치료법을 포함한 항암 1차 치료법은 머리카락과 면역 세포와 같이 체내에서 증식성이 높은 정상 세포를 함께 사멸시킴으로써 환자에게 심각한 부작용과 고통을 유발할 수 있다. 따라서， 체내에 있는 암세포만을 선택적으로 사멸시킬 수 있는 항암제의 개발이 요구되고 있는실정이다.
이러한 니즈에 부합하여 표적 치료 항암제에 대한 연구가 활발하게 진행되고 있다. 표적 치료 항암제는 암 발병과 관련된 특정 단백질이나 암 발병과 관련된 경로를 조절함으로써 암을 치료하는 항암제이다. 암세포에 특이적인 표적을 확인하기 위해 암세포의 총 단백질량과 정상 세포의 총 단백질량을 비교함으로써 표적을 확인할 수 있다. 즉， 암세포에 특이적으로 존재하거나, 암세포에 더 풍부한 단백질은 잠재적 표적이 될 수 있다. 표적 단백질의 예로는 인간 표피성장인자 수용체 2 단백질 0班묘-2）이 있다. 四묘-2를 과발현하는 유방암 및 위암을 치료하기 위해， 트라스투즈맙（¾1 6야111®）을 포함한
Figure imgf000003_0002
대한 항체를 이용한 여러 가지 표적 치료제가 개발되었다. 또 다른 접근법은, 암의 진행을 유발하는 돌연변이 단백질을 타겟으로 하는 것이다. 예를 들어, 세포 증식 신호 단백질 ?에 또는 ■는 많은 유방암 및 흑색종에서 각각 변형된 형태로 존재한다. 많은 표적 치료제가 이러한 돌연변이 형태를 타겟으로 하여 개발되었으며, 이렇게 개발된 2019/190198 1»（：1^1{2019/003585
표적 치료제는 수술이 불가능하거나 전이성인 암 환자를 치료할 수 있도록 승인되었다.
최근 개발된 표적 치료제 및 면역치료제는 암세포에서 특이적으로 발현되는 바이오마커 단백질을 이용하였다. 그러나 암세포에 특이적으로 존재하는 바이오마커 단백질과 항암제 사이의 상호 결합의 강도는 특이적이지 않아 간혹 부작용이 나타나기도 한다. 또한, 표적 치료제 및 면역치료제는 전통적인 화합물 항암제에 비해 독성이 적음에도 여전히 많은 부작용이 보고되었다.
따라서， 항암 치료 분야에서 체내 암세포를 특이적으로 타겟팅하는 항암 치료제의 개발이 여전히 요구되고 있는 실정이다. 특히， 암세포를 차별화 하는 가장 큰 특징인 염기 서열상의 차이를 이용한 항암제의 개발은 인류의 오랜 숙원이었다.
【발명의 상세한설명】
【기술적 과제】
암세포에 존재하는 염색체 구조 이상이나 정상세포와 상이한 암세포 내의 염기서열은 암세포와 정상세포를 구분하는 중요한 판단 기준이 될 수 있다. 따라서, 이러한 염색체나 염기서열의 차이점은 암세포 치료를 위한 중요한 표적이 될 수 있다. 따라서， 본 발명의 목적은 암세포에 특이적으로 존재하는 서열을 타겟팅하여 항암효과를 나타내는 암 치료용 약학적 조성물을 제공하는 것이다.
【기술적 해결방법】
상기 목적을 달성하기 위해,’ 암세포에 특이적으로 존재하는 핵산 서열에 상보적으로 결합하는 폴리뉴클레오티드 및 뉴클레아제를 유효성분으로 포함하는 종양세포 살해용조성물을 제공한다.
또한, 상기 조성물을포함하는 암 치료용 약학적 조성물을 제공한다.
또한， 암세포에 특이적으로 존재하는 핵산 서열에 상보적으로 결합하는 폴리뉴클레오티드， 엔도뉴클레아제 및 엑소뉴클레아제를 코딩하는 폴리뉴클레오티드가 적재된 벡터를 유효성분으로 포함하는 종양 세포 살해용 조성물을 제공한다.
또한， 본 발명의 조성물을 암에 걸린 개체에 투여하는 단계를 포함하는 암을 치료하는 방법을 제공한다.
【발명의 효과】 본 발명의 약학 조성물은 DNA와 RNA 간의 높은 특이성에 기반한 약물로서, 암세포만을 특이적으로 타겟팅하고 살해할 수 있으므로， 환자별, 암종별로 맞춤화될 수 있다. 특히， 암세포에만 존재하는 단일염기다형성 (SNP) 및/또는 유전자복제수변이 (CNV)를 갖는 유전자를 선별함으로써 환자의 암세포만을 효율적으로 살해할 수 있다. 또한， 정상세포에는 타겟팅하는 유전자가 존재하지 않아 암세포만을 효율적으로 제거할 수 있으므로 종래 항암제에 비해 안정성이 우수하다. 특히, 크리스퍼 연관 단백질에 엑소뉴클레아제 중 RecJ가 결합된 융합 단백질을 이용할 경우 더욱 우수한항암제를 제공할수 있다.
【도면의 간단한설명】
도 1은 CRISPR 연관 단백질 중 crRNA 가이드된 타겟 부위 결합에 의해 활성화되어 비특이적 엑소뉴클레아제 기능이 활성화되어 타겟 암세포의 핵산을 분해하는 과정을 모식도로 나타낸 것이다.
도 2는 일 실시예인 crRNA, CRISPR 연관 단백질 및/또는 엑소뉴클레아제가 결합된 조성물 (이하 CRISPR PLUS 시스템)이 암세포에서 특이적으로 활성화되어 항암제로 작용하는 것을 나타내는모식도이다.
도 3은 일 실시예인 CRISPR Casl2a 단백질이 서열 특이적 엔도뉴클레아제 효소 활성에 의존적으로 비특이적 엑소뉴클레아제 활성을 가질 수 있다는 것을 확인한도면이다.
도 4는 인간 유래 암세포인 HEK293(도 4A)과 HeLa (도 4B)에 CRISPR Casl2a(Cpf l) 뉴클레아제, crRNA 혹은 두 분자의 결합체 (RNP complex)를 각각 형질감염시킨 후, 24， 48, 72시간 후에 세포의 생존도를 측정한 결과를 나타낸 것이다.
도 5는 pul se only, EGFR_WT 및 EGFR 돌연변이를 가지는 HCC827 세포주 실험군을 이용하여， EGFR 돌연변이에 특이적으로 결합하는 가이드 RNA 및 Cas9에 의한 세포사멸 유도를 확인한 것이다.
도 6은 도 5에서 실험한 pul se only, EGFR_WT 및 EGFR 돌연변이를 가지는 HCC827세포주 실험군 (EGFR_E2)에서 생존한세포수를 측정한 것이다.
도 7은 폐암 세포주인 H1299에서 타겟 유전자인 CCR5, HPRT1 , MT2, SMIM11 , GNPDA2 , SLC15A5 및 KCNE2에 상보적인 가이드 RNA에 의한 폐암 세포의 사멸을 확인한 것이다. 이때， 가이드 RNA와 Cas9을 코딩하는 핵산을 도입하기 위하여 lipofection을 수행하였다. NT1은 폐암 세포에 일치하는 서열이 없는 가이드 쇼를 의미하며 음성 대조군으로 이용되었다. 특히， MT2, SMIM11, GNPDA2, SLC15A5 및 KCNE2에 상보적으로 결합 가능한 가이드 RNA는 폐암 세포를 효율적으로 사멸시킬 수 있음을 확인하였다.
도 8은 도 7의 나타낸 세포 사멸 결과를 확인하기 위하여 살아있는 세포 수를측정한 것이다.
도 9는 폐암 세포주인 H1299에서 타겟 유전자인 CCR5, HPRT1, MT2, GNPDA2, SLC15A5 및 KCNE2에 상보적인 가이드 쇼에 의한 폐암 세포의 사멸을 확인한 것이다. 이때， DNA의 도입 없이 리포펙타민 (Lipo)만수행한 대조군을 포함시켰다. 도 10은 NucBlue Live ReadyProbes Reagent 및 Propidium Iodide
ReadyProbes Reagent를 이용하여 NT1 대조군 및 GNPDA2 실험군의 살아있는 세포들을 현미경을 이미징한 것이다. 이때, NucBlue Live ReadyProbes Reagent는 살아있는 세포와 죽은 세포를 모두 염색하는 파란색 형광 염색 물질이다. 또한， Propidium Iodide ReadyProbes Reagent는 죽은 세포만 염색하는 빨간색 형광 염색 물질이다.
도 11은 폐암 세포주 H1563에서 타겟 유전자인 CCR5, HPRT1, MT2, IRX1 및 ADAMTS16에 상보적인 가이드 RNA에 의한 폐암 세포의 사멸을 확인하기 위해， 살아있는 세포수를 측정한 것이다.
도 12는 폐암 세포주 A549에서 타겟 유전자인 HPRT1, CCR5 및 MT2에 상보적인 가이드 쇼에 의한 폐암 세포의 사멸을 확인하기 위해, 시간에 따른 살아있는 세포수를 발광도를 이용하여 측정한 것이다.
도 13은 폐암 세포주 A549에서 타겟 유전자인 HPRT1, CCR5 및 MT2에 상보적인 가이드 RNA에 의한 폐암 세포의 사멸을 확인하기 위해， 살아있는 세포 수를 즉정한 것이다.
도 14는 도 13의 결과를 현미경으로 관찰한 것이다.
도 15는 폐암 세포주 A549에서 타겟 유전자인 MT2, CD68, DACH2, HERC2P2 및 SHBG에 상보적인 가이드 RNA에 의한 폐암 세포의 사멸을 확인하기 위해 시간에 따른살아있는 세포 수를 발광도를 이용하여 측정한 것이다.
도 16은 유방암 세포주 SKBR3에서 타겟 유전자인 MT2, ERBB2 및 KRT16에 상보적인 가이드 쇼에 의한 유방암 세포의 사멸을 확인하기 위해 시간에 따른 2019/190198 1»（：1^1{2019/003585
살아있는 세포 수를 발광도를 이용하여 측정한 것이다.
도 17은 유방암 세포주 5 요3에서 타겟 유전자인 1\ 2， 표1«82 및 10奸16에 상보적인 가이드 쇼에 의한 유방암 세포의 사멸을 확인하기 위해 시간에 따른 살아있는 세포수를 즉정한 것이다.
도 18은 자궁경부암 세포주 ¾1 에서 타겟 유전자인 ^5, 紅2 및 1¾¾9에 상보적인 가이드 附桃에 의한 자궁경부암 세포의 사멸을 확인하기 위해 시간에 따른 살아있는 세포 수를 측정한 것이다. 이때, 각 유전자의
Figure imgf000007_0001
¾伴2는 100 이상, 1?¾9는 8 이상이었다.
도 19는 자궁경부암 세포주 ¾1 에서 타겟 유전자인 0¾5， 附 ?1社）¾19 및 시에 상보적인 가이드 쇼에 의한 자궁경부암 세포의 사멸을 확인하기 위해 시간에 따른 살아있는 세포 수를 측정한 것이다. 이때， 각 유전자의
Figure imgf000007_0002
2, 1肝2는 100 이상, ?1社19는 8 이상， _1은 30이었다.
도 2 는 자궁경부암 세포 ¾1 에서 타겟 유전자인 0¾5, 2， ［1 및 社 19에 상보적인 가이드 쇼에 의한 자궁경부암 세포의 사멸을 확인하기 위해 시간에 따른살아있는 세포 수를 발광도를 이용하여 측정한 것이다.
도 2아3는 자궁경부암 세포 ¾1 에서 타겟 유전자인 （期?5， 1評2 및 0에 상보적인 가이드 1¾植에 의한 자궁경부암 세포의 사멸을 확인하기 위해 세포 수를 발광도를 이용하여 측정한 것이다. 이때， 인간 유전체에 없는 영역을 타겟하는 ［ 서열인 肝1， ［2 및 3을 음성 대조군으로 포함시켰다.
도 21은 대장암 세포주 肝29에서 타겟 유전자인 0¾5， 卵1샜1， 附 , !^!3（:，
Figure imgf000007_0003
의한 대장암 세포의 사멸을 확인하기 위해 살아있는 세포 수를 측정한 것이다.
도 22는 대장암 세포 財29에서 타겟 유전자인 附2，
Figure imgf000007_0004
니 00536， 卵와 및 1 «：9에 상보적인 가이드 쇼에 의한 대장암 세포의 사멸을 확인하기 위해 살아있는 세포 수를 발광도를 이용하여 측정한 것이다.
도 23은 폐암 세포주인 299에서 효과적인 타겟 유전자에 상보적인 가이드 볘쇼가 다른 폐암 세포주인 111563에서도 효과가 있는지 확인하였다. 이를 위해， 타겟 유전자 3 ¾111， 0 2， 此 5쇼5 및 ｝ 炯2에 상보적인 가이드 班植에 의한 563 폐암세포의 사멸을 확인하기 위해 살아있는 세포 수를 측정한 것이다.
도 24는 도 23의 실험 결과를 현미경으로 관찰한 것이다. 2019/190198 1»（：1^1{2019/003585
도 25는 폐암 세포주인 111299에서 0 에 의한 효과를 확인하기 위하여， 0 5, 狀炯2， 31\1 11 및 쑈315쇼5에 상보적인 가이드 쇼에 의한 폐암 세포의 사멸을 확인한 것이다. 이때,
Figure imgf000008_0001
크요근 를 넣어 측정하였으므로, 사멸한 세포에서 높은 발광이 검출되었다.
도 26은 엔도뉴클레아제 기능이 있는
Figure imgf000008_0002
단백질인 0339과 엑소뉴클레아제 기능이 있는 단백질인 1¾ 를 융합한 단백질의 암 세포 살상 효능을 측정하기 위하여, 폐암 세포주 11(å827 내의 ［ 묘 돌연변이 및 (1¾5에 상보적인 가이드 쇼와 03£9 및
Figure imgf000008_0003
(서열번호 87)를 이용하였다. 그 결과, 엑소뉴클레아제가 결합된 융합단백질에서 폐암 세포의 살상 능력이 현저히 증가됨을 확인하였다.
도 27은 도 26의 실험 결과를 현미경으로 관찰한 것이다.
도 28은 전달 시스템에 따른 효과를 확인하기 위한 실험으로， 가이드 쇼와 엔도뉴클레아제 단백질인 0크59이 결합된 형태인 ! ?(!· 01111(：1601)1'01^11)가 세포 사멸 효능이 있는지를 확인한 것이다. 구체적으로， 폐암 세포주인 11(X827에
Figure imgf000008_0004
돌연변이에 상보적으로 결합 가능한
Figure imgf000008_0005
0339을 혼합한 犯作가 효율적으로 폐암 세포를 사멸시킴을 확인하였다. 반면， 음성 대조군으로 사용한 0339 단백질 및 가이드 세포를 사멸시키지 못함을 확인하였다.
도 29는 전달 시스템에 따른 효과를 확인하기 위한 실험으로, _가 효과적으로 세포 사멸을 유도할 수 있는지를 확인한 것이다. 대조군으로는
Figure imgf000008_0006
사용하였고， 실험군으로는 ¾伴2에 상보적인 요 및 0339로 이루어진 —를 이용하였다. 세포주는 폐암 세포주인 ¾563을 이용하였다.
도 30은 전달 시스템에 따른 효과를 확인하기 위한 실험으로， 가 효과적으로 세포 사멸을 유도할 수 있는지를 확인한 것이다. 대조군으로는
Figure imgf000008_0007
및 0&59 단백질을 사용하였고， 실험군으로는 ^5, 6 2 및 3¾1 11에 상보적인 쇼 및 0339로 이루어진 요 를 이용하였다. 세포주는 폐암 세포주인 ¾299를 이용하였다.
도 31은 전달 시스템에 따른 효과를 확인하기 위한 실험으로, !3가 효과적으로 세포 사멸을 유도할 수 있는지를 확인한 것이다. 대조군으로는 3요1¾植 및 0339 단백질을 사용하였고， 실험군으로는 0고5 및 ¾伴2에 상보적인
Figure imgf000008_0008
및
0339로 이루어진 !3를 이용하였다. 세포주는 폐암 세포주인 299를 이용하였다. \¥02019/190198 1»（：1^1{2019/003585
도 32는 도 30의 실험 결과를 현미경으로 관찰한 것이다.
도 33은 타겟 유전자인
Figure imgf000009_0001
상보적인 가이드 요·와 033123를 이용하여 세포 사멸 유도를 확인한 것이다. 세포주는 폐암 세포추인 敗 0827을 이용하였다.
도 34는 도 33의 실험 결과를 현미경으로 관찰한 것이다. .
【발명의 실시를 위한 최선의 형태】
본 발명은 일 측면으로, 암세포에 특이적으로 존재하는 핵산에 상보적으로 결합하는 폴리뉴클레오티드 및 뉴클레아제를 유효성분으로 포함하는 종양 세포 살해용조성물을 제공한다.
이때, 상기 폴리뉴클레
Figure imgf000009_0002
일 수 있다.
Figure imgf000009_0003
0?13?요 쇼라 불리운다. 또한， 용요■는 가이드
Figure imgf000009_0004
지칭한다. 例쇼 및
Figure imgf000009_0005
단일 가닥 ■\（ 1¾16 대 ■¾） 일 수 있다. 또한，
Figure imgf000009_0006
七대 1 ½와 결합하여 크리스퍼 연관 단백질을 작동하게 할 수 있으며, 아몌情는 크 四쇼와 결합된 형태로 이용될 수 있다. 이때,
Figure imgf000009_0007
타겟이 되는 암세포에 특이적으로 존재하는 유전자 서열에 상보적안서열을 가질 수 있다. 또한，
Figure imgf000009_0008
타겟이 되는 암세포에 특이적으로 존재하는 유전자 서열과 결합하여 크리스퍼 연관 단백질이 활성을 나타내게 할 수 있다. 상기 쇼 또는
Figure imgf000009_0009
15 내지 40개의 핵산으로 구성된 일 수 있다. 이때， 상기 폴리뉴클레오티드는 18 내지 30개， 20 내지 25개의 핵산으로 구성될 수 있다. 일
Figure imgf000009_0010
핵산으로 구성될 수 있다. 또한, 요· 또는 용 桃는 0크39과 같은 크리스퍼 연관 단백질이 활성을 갖게 하기 위해 3'에 추가적인 서열을 포함할 수 있다. 일 실시예로 상기 묘!? 는 서열번호 87 내지 서열번호 129로 표시되는
Figure imgf000009_0011
에 의해 생산되는 요 일 수 있다.
본 명세서에서 사용된 용어, "뉴클레아제"는 엔도뉴클레아제 일 수 있다.
연관 단백질일 수 있다. 본 발명에서 사용된 용어,
Figure imgf000009_0012
別쇼와 같은 핵산이 이중 가닥 혹은 단일 가닥을 가질 경우（（ /!? 및
Figure imgf000009_0013
이를 인식하여 절단할 수 있는 효소이다. 구체적으로, 이들은 묘 또는 가이드
Figure imgf000009_0014
결합된 이중가닥 혹은 단일가닥 핵산을 인식하여 이를 절단할수 있다.
본 발명의 뉴클레아제의 일 구체예는，
Figure imgf000009_0015
표적 부위와 결합된 것을 2019/190198 1»（：1^1{2019/003585
인식하여 엔도뉴클레아제 기능이 활성화되는 것일 수 있다. 또한, 엔도뉴클레아제 기능이 활성화됨에 따라, 이중가닥 및/또는 단일가닥 쇼 및/또는 요를 비특이적 절단할 수 있는 엑소뉴클레아제 활성을 가지는 것일 수 있다. 또한， 상기 035123와 같은 크리스퍼 연관 단백질은 일단 활성화되면， 비특이적 엑소뉴클레아제 활성이 나타날수 있다. 이러한 경우
Figure imgf000010_0001
및 쇼를 비특이적으로 절단할수 있다.
따라서， 본 발명의 일 구체예의 조성물은 암세포에 존재하는 특정 표적 부위에 ( 附 또는
Figure imgf000010_0002
결합되고, 이에 의해 활성화되는 비특이적 뉴클레아제에 의해 암세포를 특이적으로 사멸시킬 수 있다. 따라서， 본 발명의 조성물은 암세포만을 특이적으로 살해할수 있으므로, 항암제로 활용될 수 있다.
구체적으로， 상기 。요比 !? 연관 단백질의 일 구체예는 0331, 03516, 0332,
0833, 0384, 0835, 0856, 0337, 0838, 0839, 03810, 033128, 0331213， 033120, 03812(1, 083126, 03312空, 0831211， 033121 , 088133, 088135, 083130, 08813(1, 03314, 0371, 0872, 0873, 0861, 0562, 0801, 0302, 0335, 。 요 , 031^2， 051113 , 031114, 0 5 , ◦ 6, 01111， 0^3， 0:^4， 0^5， 010*6, 0351 , 0 2, 0853, 03x17, 03x14, 03x10,
Figure imgf000010_0003
20의 아미노산 서열을 가질 수 있다. 이때, 상기 0339 단백질은 서열번호 19의 서열을 갖는 핵산에 의해 코딩되는 것일 수 있다. 또한, 상기 ^11 단백질은 서열번호 22의 아미노산 서열을 가질 수 있다. 이때, 상기 ^1 단백질은 서열번호 21의 서열을 갖는 핵산에 의해 코딩되는 것일 수 있다. 또한, 상기 0202 단백질은 서열번호 24의 아미노산 서열을 가질 수 있다. 이때， 상기 0202 단백질은 서열번호 23의 서열을 갖는 핵산에 의해 코딩되는 것일 수 있다.
본 명세서에서 사용된 용어， "암세포에 특이적으로 존재하는 핵산"은 정상세포와 차별화되는 암세포에만 존재하는 핵산을 의미한다. 즉， 정상 세포와 상이한 서열을 의미할 수도 있으며, 적어도 1개의 핵산이 상이할 수 있다. 또한， 유전자의 일부가 치환， 결실된 것일 수 있다. 또한, 특정 시퀀스가 반복된 서열을 가질 수 있다. 이때, 반복되는 서열은 세포내에 존재하였던 서열일 수 있으며， 외부에서 삽입된 서열일 수 있다. 일 구체예로， 암세포에 특이적으로 존재하는 핵산은 암세포에 특이적으로 존’재하는 핵산은 단일염기다형성 (s ingle nucleot ide polymorphi sm, SNP) , 유전자복제수변이 (copy number var i at ion, CNV) , 구조적 변이 (structural var i at ions , SV) , 유전자의 삽입 ( insert ion) 또는 유전자의 결실 (delet ion)의 특징을 갖는 것일 수 있다.
구체적으로, 암세포에 특이적으로 존재하는 서열은 암세포에 존재하는 SNP일 수 있다. 상기 서열을 갖는 암세포 내에 존재하는 타겟 DNA와 타겟 요에 상보적인 서열을 갖는 crRNA 또는 가이드 RNA는 서로 특이적으로 결합할 수 있다. 따라서， 암세포 내에 특이적으로 존재하는 핵산은 본원 발명에 개시된 종양 세포 살해용 조성물의 특이성을 부여할 수 있다. 특히， 암세포에 특이적으로 존재하는 핵산은 여러 암조직의 유전체 서열분석으로부터 암세포에만 존재하는 특이적 SNP를 찾아서 이를 이용해서 crRNA 또는 gRNA를 제작할 수 있다. 따라서 , 암세포 특이적 독성을 나타내는 방식이므로， 환자 맞춤형 항암치료제 개발이 가능 할수 있다.
또한, 암세포에 특이적으로 존재하는 서열은 암세포에 존재하는 유전자복제수변이 (CNV)일 수 있다. CNV는 유전체의 일부분들이 반복되어 나타나는 변이를 의미한다. 반복되는 유전자의 수는 암종류나 개체별로 서로 다르게 나타날 수 있다. 통상적으로， CNV는 2개의 카피 수 (copy number)로 존재하는 일반적인 유전자들과는 달리 결실， 증폭되는 등 인간의 표준 참조 게·놈과 비교해 반복되는 서열의 숫자의 차이를 보이는 핵산 조각을 의미한다. 일 구체예로, 정상세포에서는 CNV가 2이나， 암세포에서 CNV가 4 이상인 유전자는 종양 세포 살해용 조성물의 특이성을 부여할 수 있다. 이때， CNV는 4, 8， 10， 12， 14， 16， 18, 20 , 24, 30 , 40 , 50 , 60, 70 , 80, 90 또는 100 이상일 수 있다. 구체적으로 카피 수가 7개 이상인 경우 CNV로 판정할 수 있다. 암세포주별 유전자에 따른 카피 수의 일 구체예를 하기 표 1에 나타내었다.
【표 1]
Figure imgf000011_0001
Figure imgf000012_0001
상기 CNV는 암 (cancer), 지적 장애 (intel lectual disability) , 뇌전증 (epi lepsy) , 조현병 (schizophrenia) , 소아비만 (obesity) 등과 같은 인간의 질병과 연관성이 있는 매우 중요한 변이 유형 중 하나이다. 대부분의 암세포주 (cancer cell line)는 CNV를 가지고 있으며, CNV 내에 존재하는 타겟 서열에 상보적인 서열을 갖는 가이드 RNA는 서로 특이적으로 결합한다. 따라서， 암세포 내에 특이적으로 존재하는 CNV는 본원 발명에 개시된 항암제의 특이성을 부여할 수 있다. 특히, CNV의 수가 높을수록 크리스퍼 연관 단백질에 의해 절단되는유전자가 많아， 암세포의 핵이 크게 손상될 수 있다.
특히， 암세포에 특이적으로 존재하는 CNV의 데이터는 마이크로어레이 (microarray)， FISH( fluorescent in situ hybridization) 기법 등을 통해 쉽게 확인할 수 있으며, 이를 이용해서 crRNA 또는 gRNA를 제작할 수 있다. 암세포의 CNV 내에 존재하는 특정 서열을 타겟하는 crRNA 또는 gRNA와 CRISPR 연관 단백질을 함께 처리할 경우 암세포 특이적으로 세포 사멸이 유도될 수 있다. 따라서， 암세포 특이적 독성을 나타내는 방식이므로， 환자 맞춤형 항암치료제 개발이 가능 할수 있다.
본 발명의 일 실시예에서는, CNV의 예상 copy number(N)는 copy number value(V)로부터 하기의 식을 이용하여 계산될 수 있다: N=2x2v.
본 발명의 일 실시예에서는 암세포에서만 특이적으로 높은 CNV를 가지는 유전자에 상보적이 결합을 하는 폴리뉴클레오티드를 크리스퍼 연관 단백질 혹은 크리스퍼 연관 단백질과 엑소뉴클레아제 단백질을 융합한 크리스퍼 플러스 단백질과 함께 이용될 경우, 암세포만을 효과적으로 사멸시킬 수 있음을 확인하였다. 또한, 암세포에만 특이적으로 존재하는 유전자 돌연변이 중에서 CNV가 높은 유전자를 선별할 경우 더욱 효과적으로 암세포를 사멸시킬 수 있음을 확인하였다.
또한, 그 외에도 암세포에 특이적으로 존재하는 서열은 암세포에 존재하는 구조적 변이 (structural var i at ions , SV)일 수 있으며， 상기 는 역위 ( invers ion)， 전좌 (trans locat ion) , 반복염기서열의 과다증폭 (short nuc leot ide repeat expansion) 등일 수 있다.
상기 역위는 유전자의 일부분이 뒤집어진 돌연변이로서， 혈우병， 폐암 등과 같은 질병과 연관성이 있는 변이 유형 중 하나이다. 상기 전좌는 염색체의 일부분이 떨어져나와 다른 염색체에 결합하는 돌연변이이다. 상기 반복염기서열의 과다증폭은 같은서열이 계속 반복되어 과다증폭된 돌연변이다.
대부분의 암세포주는 유전자 역위, 전좌， 반복염기서열의 과다증폭 등과 같은 SV를 가지고 있으며， 가 일어난 서열 말단과 정상세포주 서열 말단 사이의 접합 영역 서열 (junct ion 서열)은 해당 암세포주에만 존재하는 서열이다. 암세포 내에 존재하는 SV 접합 영역의 서열에 상보적인 서열을 갖는 가이드 RNA는 서로 특이적으로 결합한다. 따라서, 암세포 내에 특이적으로 존재하는 SV 접합 영역의 서열은본원 발명에 개시된 항암제의 특이성을 부여할수 있다.
특히, SV 접합 영역의 서열은 CNV와 다르게 정상세포에는 없는 서열이므로 암세포에 특이적이다. 따라서， 암세포 내에 존재하는 SV 접합 영역의 서열에 상보적으로 결합하는 폴리뉴클레오티드와 CRISPR 연관 단백질을 처리할 경우 특이적으로 암세포 사멸이 유도할 수 있다. 따라서， 특정 암세포에만 특이적으로 독성을 나타내는 방식이므로， 환자 맞춤형 항암치료제 개발이 가능 할수 있다.
또한， 암세포에 특이적으로 존재하는 서열은 유전자의 삽입 ( insert ion) 또는 유전자의 결실 (delet ion)에 의해 생성될 수 있다. 이때， 상기 삽입 또는 결실되어 돌연변이가 일어난 서열에 상보적인 서열을 갖는 가이드 RNA는 효과적으로 암세포를 사멸시킬 수 있다. 따라서, 암세포 내에 특이적으로 존재하는 유전자의 삽입 또는 유전자의 결실은 본원 발명에 개시된 항암제의 특이성을 부여할 수 있다. 특히, 삽입 및 결실의 경우， SV 접합 영역의 서열과 동일하게 정상세포에는 없는 서열이므로 특이적이고, 암세포 내에 존재하는 삽입 및 결실 돌연변이 서열에 CRISPR 연관 단백질을 처리할 경우 특이적으로 세포 사멸이 유도될 수 있다. 그러나， 삽입 및 결실 돌연변이 서열을 타겟으로 하는 경우에는, Indel ( insert ion 및 delet ion) 주위에 유전자가 인식할 수 있는 PAM(protospacer adj acent mot i f ) 서열을 필요로 할수 있다.
또한， 삽입되는 유전자는 세포내에 존재하는 핵산 서열일 수도 있으나, 외부로부터 도입된 유전자 서열일 수 있다. 특히， 바이러스 감염 등에 의해 유발되는 암세포의 경우 바이러스 유전자가 세포내에 삽입될 수 있다. 이러한 경우 바이러스의 핵산 서열이 본 발명의 암세포에 특이적으로 존재하는 핵산으로 이용될 수 있다. 특히, 상기와 같이 삽입이 발생하는 암은 흔지 않지만, 정상세포에는 없는 서열을 타겟으로 하기 때문, 암세포에 특이적이다. 또한， vi ral 서열이 여러 카피 (copy)로 통합되어 있을 경우， CNV가 높아 확실히 암세포의 사멸을 유도할 수 있다. 이러한 암의 일 구체예는 파필로마바이러스 (papi lomavi rus)에 의해 유발되는 자궁경부암일 수 있다. 이러한, 외부에서 도입된 유전자를 타겟팅하는 gRNA의 일 실시예는서열번호 121 내지 서열번호 124의 DNA에 의해 생성되는 gRNA일 수 있다. 또한， 암세포에 특이적인 유전자를 선별하고， 상기 유전자에 상보적인 폴리뉴클레오티드 서열을 선별하기 위하여， PAM(protospacer associ ated mot i f ) 서열인 5' -NGG-3 ' 서열을 함께 고려할 수 있다. 일 구체예로， 암세포주 특이적인 서열 주변에 5' -NGG-3 ' 서열이 있을 경우， 3' 방향으로 20 뉴클레오타이드를 표적으로 지정할 수 있다. 또한, 표적 유전자의 선별시， 유전자의 삽입， 유전자의 결실 및 접합 영역 등의 서열 정보가 명확한 유전자 및 CNV의 카피수가 높은 유전자를 우선하여 선별할 수 있다. 또한, 표적 서열을 선별하기 위하여， 서열의 5 '과 3’ 말단에 G 또는 C 존재여부， 서열 전체의 GC contents(%)가 40 내지 60%에 포함되는지 여부 및 크리스퍼 연관 단백질인 엔도뉴클레아제가 절단하는 서열인 PAM의 3’ 방향으로 3번째 - 4번째 염기 부분이 A 또는 T인지를 확인할 수 있다. 상기 서열의 5 '과 3’ 말단에 G 또는 C 존재하는 경우와 서열 전체의 GC contents(%)가 40 내지 60%에 포함되는 경우, sgRNA의 결합 친화성 (binding af f ini ty)이 높아질 수 있다. 특히, Streptococcus pyogenes Cas9(SpCas9)이 서열을 절단하는 부위인 PAM의 3’ 방향으로 3번째 - 4번째 염기 부분이 A또는 인 경우， SpCas9의 절단 효율 (cleavage ef f i ciency)이 높아질 수 있다.
상기 암의 일 구체예는 방광암， 골암， 혈액암， 유방암， 흑색종양， 갑상선암， 부갑상선암， 골수암， 직장암， 인후암， 후두암， 폐암, 식도암, 췌장암, 대장암， 위암， 설암， 피부암, 뇌종양, 자궁암， 두부 또는 경부암, 담낭암， 구강암， 결장암， 항문 부근암, 중추신경계 종양， 간암 및 대장암으로 구성된 군으로부터 선택되는 어느 하나 일 수 있다. 특히, 우리나라 5대 암으로 알려진 위암， 대장암， 간암， 폐암, 유방암 일 수 있다.
상기 암에 존재하는 특이적으로 존재하는 핵산은 p53 , PTEN, APC , MSH2 , HBV,
HCV 및 EGFR로 구성된 군에서 선택되는 어느 하나의 유전자의 돌연변이일 수 있으나， 이에 한정되는 것은 아니다. 구체적으로 위암의 경우 종양 억제 유전자로 알려진 P53과 PTEN의 돌연변이 일 수 있다. 또한, 대장암의 경우 APC와 MSH2 유전자의 돌연변이 일 수 있다. 또한， 간암은 HBV, HCV 바이러스의 감염이 주요 원인이므로, HBV 또는
Figure imgf000015_0001
핵산이 타겟이 될 수 있다. 또한, 폐암은 EGFR 유전자의 돌연변이가 타겟이 될 수 있으며, 유방암은 BRCA1/2 유전자의 변이가 주요타겟일 수 있다.
상술한 바와 같이 암의 발생과 밀접하게 연관된 유전자의 돌연변이 및 바이러스 유전자는 암세포에 특이적으로 존재하는 핵산 서열로 활용되어, 상기 유전자는 crRNA 또는 gRNA의 제작을 위해 사용될 수 있다. 이때， 암세포에 특이적으로 존재하는 DNA의 SNP라면 어떤 것이라도 사용 가능하다. 암세포에 특이적으로 존재하는 핵산 서열의 일 구체예는 하기의 표 2에 기재된 서열일 수 있으나 이에 제한되는 것은 아니다.
【표 2】
Figure imgf000015_0002
Figure imgf000016_0003
이때, 상기 암세포에 특이적으로 존재하는 핵산 서열을 타겟팅하는 0?13묘 쇼는 하나 이상의 例쇼 또는 용 쇼 서열을 포함할 수 있다. 예를 들어， 난소암 또는 유방암에 존재하는
Figure imgf000016_0001
엑손 10 또는 11을 동시에 타겟팅할 수 있는 요 또는 용 쇼를 사용할 수 있다. 또한，
Figure imgf000016_0002
엑손 11을 타겟팅 하는 두개 이상의 요· 또는 용1?■를 사용할 수 있다. 이와 같이 !?· 또는 용1?■의 조합은 암 치료 목적 및 암의 종류에 따라 적합하게 선택될 수 있다. 즉， 서로 다른 §■를 선택하여 사용할수 있다.
상기 본 발명의 종양살해용조성물은 엑소뉴클레아제를 더 포함할수 있다. 본 명세서에서 사용된 용어, "엑소뉴클레아제"는 핵산 분자의 5’ 말단 또는 3' 말단 방향으로부터 뉴클레오티드를 절단해나가는 효소이다. 따라서, 상기 엑소뉴클레아제는 핵산을 5’에서 3' 방향으로 분해하는 5’- ñ3’ 뉴클레아제일 수 있다. 또한， 상기 엑소뉴클레아제는 핵산을 3'에서 5’ 방향으로 분해하는 3'->5' 뉴클레아제일 수 있다.
구체적으로， 상기 5'->3’ 뉴클레아제의 일 구체예는 대장균 유래의 묘 묘 또는 1¾ 일 수 있다. 또한, 박테리오파지 15 유래의 15일 수 있다. 또한， 상기 3’〜 ñ5’ 뉴클레아제의 일 구체예는 진핵세포 또는 원핵세포 유래의 묘 I 일 수 있다. 또한, 대장균 유래의 Exo III 일 수 있다. 또한， 인간 유래의 Trexl 또는 Trex2일 수 있다. 그 외에도 5'->3' 및 3'->5' 양방향 절단 활성이 있는 뉴클레아제로는 대장균 유래의 Exo VII 또는 RecBCD 일 수 있다. 또한， 일 구체예로 대장균 유래의 5’->3’ 람다 엑소뉴클레아제 일 수 있다. 또한, 단일 사슬 DNA를 절단할수 있는 Vigna radiata유래의 Mungbean일 수 있다.
이때， 상기 엑소뉴클레아제의 구체예로는 Exoribonuc lease T, TREX2, TREX1, RecBCD , Exodeoxyribonuclease I, Exodeoxyribonuclease III , Mungbean exonuclease, RecE, RecJ , T5, Lambda exonuclease, Exonuclease VI I small unit , Exonuclease VII large unit , Exo I , Exo III , Exo VII 및 Lexo로 구성된 군으로부터 선택되는 어느 하나일 수 있다.
구체적으로, 상기 엑소뉴클레아제는 Exoribonuc lease T（서열번호 4）,
T則: X2（서열번호 5）, TMXU서열번호 6）, RecBCD_RecB（서열번호 7）,
RecBCD_RecC（서열번호 8）, RecBCELRecD（서열번호 9）, Exodeoxyribonuclease
1（서열번호 10） , Exodeoxyribonuclease 111（서열번호 11）, Mungbean exonuclease（서열번호 12）, RecJ（서열번호 13） , RecE（서열번호 14） , T5（서열번호 15）, Lambda exonuclease（서열번호 16）, Exonuclease VII small unit（서열번호 17） , 및 Exonuclease VI I large unit（서열번호 18）으로 이루어진 군에서 선택되는 어느 하나일 수 있다.
본 발명은 또 다른 측면으로, 암세포에 특이적으로 존재하는 핵산에 상보적으로 결합하는 폴리뉴클레오티드 및 엔도뉴클레아제와 엑소뉴클레아제가 결합된 융합단백질을 유효성분으로포함하는 종양 세포 살해용조성물을 제공한다. 이때， "암세포에 특이적으로 존재하는 핵산”， "암세포에 특이적으로 존재하는 핵산에 상보적으로 결합하는 "폴리뉴클레오티드" , "엔도뉴클레아제 " 및 ’’엑소뉴클레아제’’는상술한 바와 같다.
일 구체예로 crRNA 및 CRISPR 연관 단백질에 상기 엑소뉴클레아제를 결합하여 원하는 핵산서열이 존재하는 세포를 효과적으로 사멸시킬 수 있는 CRISPR八: AS시스템을 CRISPR PLUS라 명명하였다.
일 구체예로， 상기 엔도뉴클레아제 및 엑소뉴클레아제가 결합된 융합단백질은 Cas9-Exor i bonuc 1 ease T, Cas9-REX2 , Cas9-TREX1 , Cas9_RecBCD_RecB , Cas9-RecBCD_RecC , Cas9-RecBCD_RecD , Cas9_Exodeoxyri bonuc lease I, Cas9 - Exodeoxyribonuclease III , Cas9-Mungbean , Cas9-RecJ , Cas9-RecE, Cas9-T5, Cas9- Lambda , Cas9-Exonuc lease VII small unit , Cas9_Exonuc lease VII large unit , Cpf 1-Exor i bonuc 1 ease T, Cpfl-REX2, Cpf 1-TREX1 , Cp f l-RecBCD_RecB , Cpf 1- RecBCD_RecC , Cpf l-RecBCD_RecD , Cpf 1-Exodeoxyribonuclease I, Cpf 1- Exodeoxyribonuclease III , Cpf 1-Mungbean, Cpf 1-RecJ , Cpf 1-RecE, Cpf 1-T5, Cpf 1- Lambda , Cpf 1-Exonuc lease VII small unit 또는 Cpf 1-Exonuc lease VI I large unit일 수 있으며, 바람직하게는 Cas9-RecJ 또는 Cpfl-RecJ일 수 있으나 이에 제한되는 것은 아니다.
본 발명의 일 실시예에서， 엔도뉴클레아제 및 엑소뉴클레아제가 결합된 CRISPR PLUS 단백질을 이용하는 경우， CNV가 2인 유전자인 CCR5와 같이 적은 수의 CNV에서도 세포사멸률이 증가하였으며， 엔도뉴클레아제만을 이용하였을 때보다 더 우수한 세포사멸 효과가 관찰되었다.
이때， 상기 엔도뉴클레아제와 엑소뉴클레아제는 링커를 통해 결합된 것일 수 있다. 상기 링커는 알부민 링커 또는 펩티드 링커일 수 있다. 이때, 상기 링커는 1 내지 50개의 아미노산， 3 내지 40개의 아미노산, 10 내지 30개의 아미노산으로 이루어질 수 있다. 또한， 상기 펩티드 링커는 Gly 및 Ser 잔기로 구성된 펩티드일 수 있다. 또한， 상기 펩티드 링커는 루신 (Leu, L), 이소루신 (lie, I), 알라닌 (Ala, A), 발린 (Val,V)， 프롤린 (Pro, P) , 라이신 (Lys, K) , 아르기닌 (Arg, R), 아스파라진 (Asn, N) , 세린 (Ser, S) 및 글루타민 (Gin, Q)으로 구성된 군에서 선택되는 1 내지 1◦개의 아미노산으로 구성된 펩티드일 수 있다. 또한， 상기 링커는 글라이신 (Gly, G) 및 세린 (Ser, S) 잔기로 구성된 3 내지 15개의 아미노산으로 구성된 폴리펩티드가 될 수 있으며， 6 내지 11개로 구성될 수 있다. 본 발명의 다른 측면으로, 상술한 일 구체예의 종양 세포 살해용 조성물을 포함하는 암 치료용 약학적 조성물을 제공한다.
이때， 상기 종양 또는 암은 방광암, 골암， 혈액암， 유방암, 흑색종양, 갑상선암， 부갑상선암, 골수암, 직장암， 인후암， 후두암, 폐암， 식도암, 췌장암, 대장암， 위암， 설암, 피부암， 뇌종양, 자궁암, 두부 또는 경부암， 담낭암， 구강암, 결장암, 항문 부근암, 중추신경계 종양, 간암 및 대장암으로 구성된 군으로부터 선택되는 어느 하나일 수 있다.
본 발명의 약학적 조성물의 제형은 비경구용일 수 있다. 제제화할 경우에는 2019/190198 1»（：1^1{2019/003585
보통 사용하는 충진제, 증량제， 결합제， 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제된다. 특히, 비경구 투여를 위한 제제에는 멸균된 수용액, 비수성용제， 현탁제， 유제， 동결건조제제， 좌제가 포함된다. 비수성용제 및 현탁용제로는 프로필렌글리콜（1）1（ 161½ 용1 （：01）， 폴리에틸렌 글리콜， 올리브 오일과 같은 식물성 기름， 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다.
본 발명의 약학적 조성물은 비경구로 투여될 수 있으며, 종양내 투여， 정맥내， 근육내， 피내， 피하， 복강내， 소동맥내, 심실내， 병변내， 척추강내， 국소， 및 이들의 조합으로 구성된 군으로부터 선택되는 어느 하나의 경로로 투여될 수 있다.
본 발명의 약학적 조성물의 투여량은 환자의 체중， 연령, 성별, 건강상태， 식이， 투여시간， 투여방법， 배설율 및 질환의 중증도에 따라 그 범위가 다양하며， 당업자에 의해 적절하게 선택될 수 있다. 바람직한 효과를 위해서, 본 발명의 약학적 조성물을 1일 0.01
Figure imgf000019_0001
100
Figure imgf000019_0002
구체적으로는 1 /1¾ 내지 1 八 cg으로 투여할 수 있다. 투여는 하루에 한번 투여할 수도 있고, 수회 나누어 투여할 수 있다. 따라서， 상기 투여량은 어떠한 면으로든 본 발명의 범위를 한정하는 것은 아니다.
또한， 본 발명은 다른측면으로, 암세포에 특이적으로 존재하는 핵산서열에 상보적으로 결합하는 폴리뉴클레오티드 및 엔도뉴클레아제를 코딩하는 폴리뉴클레오티드가 적재된 벡터를 유효성분으로 포함하는 종양 세포 살해용 조성물을 제공한다.
이때， "암세포에 특이적으로 존재하는 핵산"， "엔도뉴클레아제" 및 "엑소뉴클레아제’’는 상술한 바와 같다. 또한， "암세포에 특이적으로 존재하는 핵산에 상보적으로 결합하는 폴리뉴클레오티드”는
Figure imgf000019_0003
이다. 상기 요 핵산은 암세포에 특이적으로 존재하는 핵산 서열에 상보적으로 결합할 수 있는 아 쇼 또는 ■를 생산할수 있다. 이때,
Figure imgf000019_0004
상술한 바와 같다.
상기 조성물은 I） 암세포에 특이적으로 존재하는 핵산 서열에 상보적으로 결합하는 폴리뉴클레오티드 및 ） 엔도뉴클레아제를 코딩하는 폴리뉴클레오티드가 하나의 벡터에 적재될 수 있는 것이다. 필요에 따라, 상기 0 암세포에 특이적으로 존재하는 핵산 서열에 상보적으로 결합하는 폴리뉴클레오티드 및 ） 2019/190198 1»（：1^1{2019/003585
엔도뉴클레아제를 코딩하는 폴리뉴클레오티드가 각각의 벡터에 적재되어 사용될 수 있다.
또한, 상기 조성물은 엑소뉴클레아제를 코딩하는 폴리뉴클레오티드가 상기 벡터에 추가적으로’ 포함할 수 있다. 또한, 상기 0 암세포에 특이적으로 존재하는 핵산 서열에 상보적으로 결합하는 폴리뉴클레오티드, ) 엔도뉴클레아제를 코딩하는 폴리뉴클레오티드 , 및 1 1 1 ) 엑소뉴클레아제를 코딩하는 폴리뉴클레오티드가 필요에 따라각각의 벡터에 적재되어 사용될 수 있다.
일 구체예에서는 암세포에 특이적으로 존재하는 핵산 서열에 상보적으로 결합하는 폴리뉴클레오티드，
Figure imgf000020_0001
연관 단백질 및 엑소뉴클레아제가 결합된 융합단백질을 코딩하는 폴리뉴클레오티드가 적재된 벡터를 유효성분으로 포함하는 종양 세포 살해용 조성물일 수 있다. 본 발명의 일 실시예에서는 크리스퍼 연관 단백질인 엔도뉴클레아제인 0크39과 엑소뉴클레아제인 모 ·!가 융합된 0839^601 융합단백질을코딩하는 폴리뉴클레오티드를 적재하여 사용하였다.
상기 벡터는 바이러스 벡터 또는 플라스미드 벡터일 수 있으나， 이에 제한되는 것은 아니다. 상기 암세포에 특이적으로 존재하는 핵산 서열에 상보적으로 결합하는 폴리뉴클레오티드，
Figure imgf000020_0002
연관 단백질을 코딩하는 폴리뉴클레오티드 및/또는 엑소뉴클레아제를 코딩하는 폴리뉴클레오티드가 적재된 벡터는 당업계에 공지된 클로닝 방법으로 제조될 수 있으며， 그 방법에 특별히 제한되는 것은 아니다.
또한, 본 발명은 상술한 종양 세포 살해용 조성물을 개체에 투여하는 단계를 포함하는 암을 치료하는 방법을 제공한다.
이때， 암세포에 특이적으로 존재하는 핵산 서열에 상보적으로 결합하는 폴리뉴클레오티드와 뉴클레아제 단백질이 결합된 형태로 암에 걸린 개체에 투여될 수 있다. 또한， 엑소뉴클레아제를 추가하여 형태로 암에 걸린 개체에 투여할 수 있다. 본 발명의 약학 조성물은 가축， 인간 등의 포유동물에 다양한 경로로 투여될 수 있다. 투여의 모든 방식은 예상될 수 있는데， 예를 들면， 종양내 투여， 정맥내， 근육내, 피내, 피하， 복강내， 소동맥내， 심실내, 병변내， 척추강내， 국소, 및 이들의 조합으로 구성된 군으로부터 선택되는 어느 하나의 경로로 투여될 수 있다.
【발명의 실시를 위한 형태】 이하， 본 발명을 하기 실시예에 의하여 더욱 상세하게 설명한다. 단， 하기 실시예는 본 발명을 예시하기 위한 것일 뿐, 본 발명의 범위가 이들만으로 한정되는 것은 아니다.
제조예 1. Cas9을위한 crRNA제작
타겟팅하는 유전자의 정확한 염기서열을 유전자 서열분석을 통하여 확보하였다. 타겟팅하는 유전자는 엑손 (exon) 부분에서 protospacer adj acent mot i f (PAM, 5 ' -NGG-3 ' ) 서열을 찾은 후, 그의 상위부분 20 mer 서열을 protospacer 서열로 정하였다. 목표 서열의 위치에 따라 세포 내에서 편집 효율이 차이가 나기 때문에, protospacer를 적어도 세 종류로 디자인하였다.
20 mer 서열 5 ' 부분에 5’-TAGG_3’ 염기를 결합하고, 상보서열의 3’ 부분에는 5' -AAAC-3 ' 결합하여 각각의 올리고뉴클레오티드 (올리고머)를 합성하였다. 합성된 두 서열 올리고머를 100 uM로 맞추고 각각 2 uL씩 취해 46 uL의 정제수에 희석하였다.
Thermocycler를 이용하여 어닐링 (anneal ing)을 진행하였고, 95°C에서 5분 처리하고， 4°C/sec의 속도로 55°C까지 온도를 낮춰 10분 동안 처리하였다. In vi tro 전사를 위한 T7 promoter (서열번호 1： TAATACGACTCACTATAGG)와 crRNA 스캐폴드 서열 (서열번호 2 :
GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAMGTGGCACCGAGTCGGTGC) 을 포함하는 pUC19 벡터 약 5 내지 10 을 Bsal 제한효소로 하룻밤 동안 절단 후, 정제하였다. 이의 서열은 5’-
TmACGkCTCkCTm(^TGkGACCGcA(^lCTCGGTrmGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCC GTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC-y i^^ 3)로 표시하였다.
이후, 제한효소가 처리된 벡터 (100 내지 200 ng/uL)에 라이게이션 ( l igat ion)을 진행하였다. 5번의 어닐링 혼합물 6 uL, 벡터 2 uL, T4 DNA 리가아제 10X Buf fer(Pr omega C126B) 1 uL, 및 T4 DNA 리가아제 (Promega M180A) 1 uL를 1.5 uL 에펜도르프 튜브에 넣고 탭핑으로 섞어준 후， 4°C에서 하룻밤 동안 인큐베이션하였다. 대장균 DH5a에 라이게이션 혼합물을 넣어 형질전환하였다. M13 프라이머를 이용한 생어 시퀀싱을통해 하기 서열로 클로닝 여부를 확인하였다:
5’-TAATACGACTCACTATAGG (서열번호 1)-20 mer protospacer 서열- GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC ( 2019/190198 1»（：1^1{2019/003585
서열번호 2） -3’ .
이와 같이 만들어진 서열을 이용하여， 17 （제 근!·,
Figure imgf000022_0001
및 아別쇼 스캐폴드를 포함한 부위를 중합효소 연쇄반응（ᄄ요）을 통해 증폭하고， 아가로오즈겔 전기영동으로 확인한 후， 정제하였다.
Figure imgf000022_0002
17 比 打明레， 能1354）를 이용하여 10번의 결과물 약 800 예를 50 此 반응 볼륨에서 약 4내지 8시간 반응시켜 ^¾ 를 !；! 에서 전사하였다.
전사의 결과물을
Figure imgf000022_0003
1;（111 1；1'0요611, ■1908）를 이용하여 정제한 순수한 확보하였고， 분광 광도계로 농도를 추정하였다. 일반적으로 약 1 내지 2 이상의 0"1¾ 를 수득하였다. 이때， 1 336 오염에 주의하였다. 정제된 요■를 필요한 농도와 양으로 희석 및 분주하여 -80。（:에서 보관하였고, 온도 변화 및 충격에 주의하였다.
제조예 2.0?£10뇨3123）을위한 1¾ 제작
타겟팅하는 유전자의 정확한 염기서열을 유전자 서열분석을 통하여 확보하였다 . 타겟 부위를 정하고 , 엑손 부분에서 1）】"01；05?%6 크이 11101； （? \1, 5’-11^-3’） 서열을 찾아 그의 하위부분 24
Figure imgf000022_0005
서열을
Figure imgf000022_0004
서열로 정하였다. 이때，
Figure imgf000022_0006
서열의 구아닌과 사이토신의 함량이 약 50% 정도 되는 곳을 타겟으로 정하였다. 목표 서열의 위치에 따라 세포 내에서 편집 효율이 차이가 나기 때문에， 1）1ᅳ01；03?3061·를 적어도 세 종류를 디자인하였다.
111 0 전사를 위한 17 프로모터와 아1^ 를 포함한 서열과 상보 서열에 대해 각각올리고머를 합성하였다:
Figure imgf000022_0007
（서열번호 25） - 24 01^ 애? 서열- . 합성된 올리고머
Figure imgf000022_0008
들어있는 최종 볼륨 20 1 의 혼합물을 만들었다. 이때， 뉴클레아제가 없는 정제수를 이용하였다.
¾61'111007（：161'를 이용하여 어닐링을 진행하였고, 95°（1에서 5분 처리하고， 4。〔八6（：의 속도로 55°（:까지 온도를 낮춰 10분 동안 처리하였다.
Figure imgf000022_0009
17別 打 레， 能1354）를 이용하여 5번의 결과물 4此（800明）를 50此 반응 볼륨에서 약 4 내지 8시간 반응시켜 0" 쇼를 1：10에서 전사하였다. 전사의 결과물인 犯 를 에탄올 침적 방법으로 정제하여 확보하였고, 분광 광도계로 농도를 구하였다. 보통 약 1 내지 2 明八 이상의 아別쇼를 얻게 되었고, ^336 오염에 주의하였다. 정제된 1 를 필요한 농도와 양으로 희석 및 분주하여 - 80°C에서 보관하였고， 온도 변화 및 충격에 주의하였다.
제조예 3. 기질 DNA제작
Cas9 혹은 Cpf l의 protospacer가 타겟팅하는 염기서열을 가운데 부위에 위치하도록 하여, 약 1 내지 1.5 kbp의 dsDNA를 중합효소연쇄 반응을 이용하여 타겟 유전자를 포함한 template로부터 증폭하였다. 이때, 상기 protospacer란 gRNA가 숙주세포내의 DNA에 상보적으로 결합할 수 있는 타겟팅 염기서열을 의미한다.
클로닝을 통해 PUC19 , 혹은 pGEM 벡터에 삽입한 후, M13 프라이머를 이용해 시퀀싱을 함으로써， protospacer 서열을 검정하였다. M13 프라이머를 이용한 중합효소 연쇄반응으로 기질 DNA를 증폭한 후 정제하여 100 ngAiL의 농도로 -
20°C에서 보관하였다.
실시예 1. crRNA에 의한 CRISPR/Cas 단백질의 비특이적 뉴클레아제 기능 활성화확인
Figure imgf000023_0001
포함하는 CRISPR/Cas 단백질의 게놈 편집 기능이 crRNA- 가이드된 타겟 시퀀스 결합에 의해 활성화되어 DNA 또는 RNA 분자를 분해하는 비특이적 뉴클레아제의 기능을 활성시킴을 확인하였다. 이의 개략적인 모식도를 도 1에 나타내었다.
실시예 2. CRISPR PLUS의 암세포특이적인 SNP인식 및 암세포사멸
암세포는 유래 조직과 암의 유형에 따라， 정상 세포에는 존재하지 않는 특정 게놈 부위에 유전자 변이를 포함한 자체 염색체 변이 또는 단일 염기 다형성 (SNPs)을 가지고 있다. 이러한 암-특이 SNP는 본 발명의 암세포 특이적인 마커로 사용되었다. 암세포 특이적인 SNP는 SNP에 상보적인 서열을 포함하는 crRNA의 합성에 사용되었고， 이 crRNA를 포함하는 CRISPR 연관 단백질 및 엑소뉴클레아제를 포함하는 CRISPR PLUS 단백질에 의해 인식되었다. 암세포의 게놈에서 SNP와 crRNA 사이의 서열 특이적인 결합은 CRISPR PLUS 단백질의 게놈 편집 기능을 활성화시켜 타겟 DNA/RNA 파손을 일으켰다. 이후, 상기 활성화는 암세포 내 ds 및 ss DNA/RNA 분자를 비가역적으로 파괴하는 CRISPR PLUS의 내제적인 비특이적 뉴클레아제 기능을 활성화시켜, 세포 사멸을 초래하였다. 이러한 결과를 도 2에 모식도로 나타내었다.
실시예 3. SpyCas9(서열번호 46)의 엔도뉴클레아제 기능 확인 (In vitro) 뉴클레아제가 제거된 정제수에 NEBufferä 3.1을 최종 IX농도로 희석하고， 뉴클레아제 120 nM및 crRNA 120 nM를 넣어준 후， RNP complex형성을 유도하였다. 혼합 후 상온에서 약 15분간 인큐베이션하였다. 약 200 ng의 기질 DNA를 추가하고 탭핑한 후 37°C에서 반응시켰다. 목표 서열이 없는 기질 DNA에 대한 반응을 함께 확인하기 위해， 이 단계에서 타겟팅이 되지 않는 DNA를 넣어주었다. 반응액의 최종 볼륨은 20 uL로 조절하였고. 반응 후 젤 로딩 염색액을 넣고 잘 섞어주었다. 2% 아가로오즈 겔을 만든 후 (Agarose, Sepro, GenDEPOT, A0224-050) , 염색이 된 반응물 12 를 lkb DNA마커 (Thermo Scientific, SM0311)와 함께 전기영동하였다. 이후， 뉴클리아제의 활성에 의해 잘려진 기질 DNA밴드를 관찰하였다.
그 결과, 목표 서열이 없는 기질 DNA만을 반응시킬 경우 DNA가 절단되지 않음을 확인하였다. 그러나, 타겟팅이 되는 DNA를 함께 넣어주면, 모든 DNA가 절단되는 것을 확인하였다.
실시예 4. Cpfl의 비특이적 액소뉴클레아제 기능 확인 (In vitro)
뉴클레아제가 제거된 정제수에 NEBuffer™ 1.1을 final IX농도로 희석하고, CRISPR/Casl2a 120 nM 및 crRNADHCR7 120 이을 넣어준 후, RNP complex 형성을 유도하였다. 230 의 RNP 결합체를 200 의 기질 DNA를 조심스럽게 추가 및 탭핑한후 37°C에서 반응시켰다. 이때, 기질 DNA는 특이 혹은 비특이 DNA기질 단독, 혹은 특이 DNA와 비특이 DNA를 함께 섞은 후, NEBuffer 1.1 버퍼에서 1.5 시간 혹은 24시간 동안 37°C에서 인큐베이션하였다. 반응액의 최종 볼륨은 20 uL로 조절하였다.
원하는 반응 시간후, 젤 로딩 염색약을 넣고 잘섞어주었다. 2% 아가로오즈 겔을 만든 후 (Agarose, Sepro, GenDEPOT, A0224-050) , 염색이 된 반응물 12 uL를 lkb DNA 마커 (Thermo Scientific, SM0311)와 함께 전기영동하였다. 뉴클리아제의 활성에 의해 잘려진 기질 DNA밴드를 관찰하였다. 그 결과는 도 3에 나타내었다. 크리스퍼 뉴클레아제가 보유한 서열 비특이적 엑소뉴클레아제 활성을 증명하기 위하여， 크리스퍼 뉴클레아제와 특이적, 그리고 비특이적 DNA 기질을 이용한 in vitro DNA절단 실험을 수행한 결과， 서열 특이적 엔도뉴클레아제 효소 활성에 의존적으로 비특이적 엑소뉴클레아제 활성을 가지고 있음을 확인하였다.
구체적으로，
Figure imgf000024_0001
인간 DHCR7 유전자를 타게팅하는 crRNA, 그리고, crRNA가 타게팅하는 서열을 가지는 특이 DNA 기질(DNA #1， 1.5 此) 혹은 2019/190198 1»（：1^1{2019/003585
!? 의 타게팅 서열이 없는 비특이 0 （0 #2 , 0.5此）를 1.5 시간 혹은 24 시간 동안 인큐베이션하여 I） 절단을 유도하고, 이를 아가로즈 젤에서 확인하였다（도 3 참조）. 이때，
Figure imgf000025_0001
상보적으로 결합하는
Figure imgf000025_0002
（ 예사（143比13） 및
（比0 2（54此1）） 서열을 각각 서열번호 132， 서열번호 133 및 서열번호 134로 나타내었다.
특이 0 기질을 뉴클레아제 및 쇼와 1.5 시간 동안 인큐베이션 하였을 때, 기질은 서열 특이적으로 절단되어 약 0.7 의 절편으로 되었다（윗 패널 레인 3）， 그러나 ]· 없을 경우 절단은 일어나지 않은 것（윗 패널 레인 4）을 확인하였다. 비특이 를 동일한 조건에서 인큐베이션 했을 때는 쇼 존재에 관계없이 0 의 절단이 일어나지 않았다（윗 패널 레인 5， 6）.
특이
Figure imgf000025_0003
기질과 비특이 기질을 동시에 뉴클레아제로 처리했을 경우에는， 예상대로 기질만이 절단되는 것이 관찰되었다（윗 패널 레인 7， 8）. 또한， 특이 기질과 뉴클레아제
Figure imgf000025_0004
인큐베이션 시간을 24 시간으로 늘였을 때， 특이 0 기질과 그 절편 모두 사라지는 것이 관찰 되었다（아래 패널 레인 3）. 이는 0 가 크리스퍼 뉴클레아제의 엑소뉴클아제 활성에 의해 잘려졌다는 것을 의미한다.
같은 실험을
Figure imgf000025_0006
상태에서 했을 때，
Figure imgf000025_0005
사라지지 않는 것을 볼 때（아래 패널 레인 4）, 이 결과는 엑소뉴클레아제 활성은
Figure imgf000025_0007
서열 특이적 효소 활성에 의존적임을 의미한다. 또한, 비특이 0 를 뉴클레아제 및 （ 1¾桃로 24시간 동안 처리 했을때， 0 가 사라지지 않고 유지되는 것에서도 증명되었다（아래 패널 레인 5 , 6）.
또한， 특이 0 기질과 비특이 기질을 동시에 뉴클레아제 및 ~1¾秋로 24 시간 처리했을 때， 특이 , 비특이 기질 모두가 분해되어 사라지며（아래 패널 레인 7）, 이것은
Figure imgf000025_0008
존재 하에서만 일어나는 것임이 관찰되었다（아래 패널 레인 8）. 이는 서열특이적 엔도뉴클레아제 기능의 활성화에 의해 유도된 （꾜比묘八: 33123의 엑소뉴클레아제 기능이 서열 비특이적으로 작동한다는 것을 의미한다.
따라서, 이 실험 결과는 ◦요 묘八: 3 23는 서열특이적 효소 활성에 의존적으로, 비특이적 엑소뉴클레아제의 활성을 가지고 있음을 의미한다.
실시예 5. 세포독성 분석 인간 암 유래 세포인， HeLa 세포는 DMEM/10% FBS 성장 배지를 이용하여 37°C의 온도로 5% C02 인큐베이터에서 배양하였다. 형질전환 하루 전， 2.5 X 104 세포를 100 ul 배양액에 풀어 96웰에 플레이팅하였다. Blank(background control)는 100 의 media만 넣어주었다. 다음날, CRISPR/Cas 뉴클레아제와 crRNA complex(RNP)를 이용한 형질감염을 하기 표 3과 같은 조건별로 수행하였다. 상기 crRNA 중 하나는 인간 DHCR7 유전자에 서열 특이성을 가지며 , 다른 하나는 벼의 DWARF5유전자에 서열 특이성을 가지는 것이다.
【표 3]
Figure imgf000026_0001
2.4 nM을 섞은 후, 상온에서 10분간 인큐베이션하였다. 같은 튜브에 0.17 의 Lipofectamine Cas Plus Reagent를 넣고 상온에서 5분간 인큐베이션하였다. 상기 튜브를 인큐베이션 하는 동안 다른 튜브를 준비하였다. Opt i-MEM 5 ul, Lipofectamin CRISPRMAX Reagent 0.3 ul를 섞고， 상온에서 5분간 인큐베이션하였다. 상기 두 튜브를 섞어준 후， 상온에서 10분간 인큐베이션하였다. 섞어준 튜브 용액을 세포가자라는 각 웰에 방울방울 넣어주었다. 이후, 세포를 37° (:의 온도로 5% C02 인큐베이터에서 배양하였다.
24, 48 및 72시간 후， 깨끗한 벤치 (bench)에서 WST_l(Cell proliferation Reagent, Roche 0501594401)를 10 씩 각 웰에 첨가한 후， 37° (:의 온도로, 5% C02 인큐베이터에 넣고 색깔 변화를 관찰하였다 (열은 빨강 - ñ 진한 빨강) . 10분 후, FLUOstar Omega ELISA reader(BMG Labtech)를 이용하여, 420 내지 480 nm와 690 nm에서 background와 샘플의 흡광도를 측정하였다. 타겟 crRNA와 비타겟 crRNA에서의 CRISPR/Cas뉴클레아제의 세포 독성을 분석하였다.
인간 유래 암세포인 HEK293도 4A)와 HeLa (도 4B)에 CRISPR/Cas12a 뉴클레아제， crRNA 혹은 두 분자의 결합체 (RNP complex)를 각각 형질감염시킨 후， 24 , 48 , 72 시간 후에 세포의 생존도를 WST-1을 이용한 생존도 에세이로 측정하였다. 그 결과， 뉴클레아제 혹은 crRNA 만을 형질감염시킨 세포는 24 , 48 , 72시간 모두에서 생존도의 변화가 거의 없음을 나타내었다 (도 4 참조) . 이러한 결과는 뉴클레아제와 crRNA자체는 세포에 독성이 없음을 의미한다.
반면에， 서열 특이적 효소 활성을 보유한 결합체에 의해 형질감염된 세포는
72시간에서 그 생존도가 현저히 떨어지는 현상을 보였다. 이 결과는 CRISPR/Casl2a 뉴클레아제가 서열 특이적 효소 활성에 의존적으로 세포에 독성을 나타냄을 의미한다. 같은 결합체로 형질감염된 세포가 24， 48시간에서는 생존도에 변화가 없든지 (HEK293) 혹은 경미하게 떨어지는 (HeLa) 현상을 보였다. 이는 CRISPR/Casl2a 뉴클레아제의 독성이 세포에 영향을 미치기 위하여 어느 정도의 시간이 필요함을 의미한다.
일반적으로, CRISPR/Cas 뉴클레아제의 서열 특이적 효소 활성이 세포내에서 24시간부터 48시간까지 꾸준히 진행됨이 알려져 있다. 또한, 이 활성에 의해서 뒤이어 세포 독성을 나타내는 비특이적 뉴클레아제 활성이 유도됨을 유추해 볼 때， 72시간 후에 나타나는 세포독성은, 뉴클레아제 활성과 무관한 간접적 효과가 아니라， 뉴클레아제의 서열 특이적 효소활성과 연관된 기능에 의해 야기 되는 것이라고 할 수 있다. 그럼에도， 특이적 crRNA를 사용한 경우에 비특이적인 crRNA를사용한 경우에 비해 세포독성이 높음을 확인할수 있었다.
그러므로, 이 실험의 결과는 CRISPR/Casl2a 뉴클레아제는 서열 특이적 효소활성에 의존적으로 세포에 독성을 나타내어 생존도를 떨어뜨리는 기능을 가지고 있음을 보여준다.
실시예 6. 암세포특이적 독성 분석
인간유래 폐암세포와 정상세포의 유전자 서열을 분석하여 암세포에서만 특이적으로 존재하는 SNP를 찾아내고, 이를 타게팅할 수 있는 crRNA를 합성하였다. 크리스퍼 뉴클레아제와 crRNA를 혼합하여 RNP 결합체를 만든 후， 암세포와 정상세포에 형질감염 시키고， 암세포 특이적 사멸 효과를 WST-1 기반 세포 생존도 에세이를 이용하여 분석하였다. 이때， 사용한 crRNA는 폐암의 EGFR에 특이적으로 존재하는서열 (서열번호 43)을 타겟팅하도록 제조하였다.
형질전환 하루 전, 2.5 X 104 세포를 100 ul 배양액에 풀어 96웰에 플레이팅하였다. Blank (background control )는 100 의 medi a만 넣어주었다. 다음 날， ◦요比묘八:쇼 뉴클레아제와
Figure imgf000028_0001
이용한 형질감염을 하기 표
4와 같은조건으로 수행하였다.
【표 4]
Figure imgf000028_0002
각 웰당 1.51111 튜브에 如 -]犯¾11胎(1 5 III， ?!?八:쇼 2.4油， !? 2.4 nM을 섞은 후， 상온에서 10분간 인큐베이션하였다. 같은 튜브에 0.17 의
Lipofectamine Cas Plus Reagent를 넣고 상온에서 5분간 인큐베이션하였다. 상기 튜브를 인큐베이션 하는 동안 다른 튜브를 준비하였다. Opti-MEM 5 ul, Lipofectamin CRISPRMAX Reagent 0.3 ul를 섞고， 상온에서 5분 간 인큐베이션하였다. 상기 두 튜브를 섞어준 후, 상온에서 10분간 인큐베이션하였다. 섞어준 튜브 용액을 세포가 자라는 각 웰에 방울방울 넣어주었다. 이후, 세포를 37°C의 온도로 5% C02 인큐베이터에서 배양하였다.
24, 48 및 72시간 후, 깨끗한 벤치 (bench)에서 WST-l(Cel 1 proliferation Reagent , Roche 0501594401)를 10 ul씩 각 웰에 첨가한 후, 37°C의 온도로， 5% C02 인큐베이터에 넣고 색깔 변화를 관찰하였다 (열은 빨강 _> 진한 빨강) . 10분 후， FLUOstar Omega ELISA reader를 이용하여， 420 내지 480 nm와 690 nm에서 background와 샘플의 흡광도를 측정하였다. 타겟 crRNA와 비타겟 crRNA에서의 CRISPR/Cas뉴클레아제의 세포 독성을 분석하였다.
그 결과, 폐암세포에서 타겟 crRNA를 처리한 군에서만 특이적으로 폐암세포가사멸하는 것을 확인하였다.
실시예 7. EGFR돌연변이 서열 특이적 가이드 RNA에 의한 세포 사멸 효과 확인
본 실시예에서는 Cas9 단백질 발현 벡터 (PM59， Addgene plasmid #62988)를 이용해 폐암 세포인 HCC827 세포의 유전체에 multi -cleavage를 일으켜 세포 사멸을 일으킬 수 있음을 증명하였다. 전기천공법 (electroporation)으로 세포 내부에 벡터들을 전달 하였으며, 유전체에 multi-cleavage를 일으키기 위해 HCC827세포 EGFR 유전자의 E2 돌연변이 서열을 타겟하는 가이드 쇼를 사용하였다. EGFR 유전자의 E2 돌연변이 서열은 약 18개 이상의 multi -copy로 존재하는 것으로 알려져 있다.
HCC827 세포는 75T 플라스크에서 RPMI-1640(10% 소태아혈청 (fetal bovine serum)) 배지로 약 50% 밀도의 양으로 배양한 후， 트립신화 (trypsinizat ion) 및 PBS 세척을 거쳐 최종적으로 Neon Electroporation Buffer 요에 리서스펜드 (resuspend) 하였다. 10 (jL Neon 파이펫 팁 (tip)에 150, 000개의 세포와 500 의 벡터를 로딩한 후， 1300 V, 20 ms 및 2 pulses의 조건으로 전기천공법을 진행하였다. 이후, RPM 1-1640 (10% 소태아혈청 (fetal bovine serum)) 배지에서 회복시키고， 6일 후 세포들을 수확하여 카운팅 (counting)을 실시하였다. 그 결과를 도 5 및 도 6에 나타내었다.
도 5 및 도 6에 나타난 바와 같이， electric pulse 군과 비교하였을 때, 타겟 서열이 존재하지 않는 EGFRJVT 실험군 (pSpCas9(BB)-2A-Puro(PX459)V2.0- EGFR_WT)에 비해 EGFR_E2 실험군 (pSpCas9(BB)-2A-Puro(PX459)V2.0_EGFR_E2)의 세포수가 현저하게 감소한 것을 확인하였다. 구체적으로, 상기 EGFR_E2 실험군에서 83%의 세포사멸이 유도되었다. 이를 통해, 암세포에 Cas9 단백질과 세포 유전체 서열 특이적 multi-target 가이드 RNA를 넣어주었을 때 세포 사멸을 일으킨다는 것을 확인할 수 있었다.
실시예 8. 폐암세포 H1299에서 표적 위치에 따른세포사멸 효과 확인 실시예 8.1. Lipofection을통한 gRNA및 크리스퍼 단백질 도입
24 웰 플레이트에서， 웰 1개당 폐암 세포인 H1299를 1.5x10s개 만큼 깔아주고, 24시간 후에 각 웰에 하기 표 5와 같은 종류의 DNA CCR5, HPRT1, MT2, SMIM11, GNPDA2, SLC15A5 및 KCNE2)를 도입하였다. 도입을 위해, Lipofectamine 3000 시약을 사용하였고， 제조사에서 제공하는 매뉴얼을 따랐으며 , DNA를 500 ng씩 사용하였다.
【표 5】
Figure imgf000029_0004
상기 도입 즉, 트랜스펙션 (打크애군 이!) 시점을 기점으로 하여 72시간 후， 각 웰의 배양액을 모두 석션으로 제거하고
Figure imgf000029_0001
500 ᅭ만큼 넣어 한 번 세척하였다. 이후,
Figure imgf000029_0003
처리하여 세포를 모두 떼어냈다. 이들을
Figure imgf000029_0002
blue 염색약을 이용하여 염색한 후， 살아있는 세포 수를 즉정하였다. 그 결과를 도 7 및 도 8에 나타내었다.
도 8에 나타난 바와 같이, 실험 결과 H1299에서 자르는 표적 서열이 존재하지 않는다고 알려진 NKnon target）와 한 쌍의 표적 위치만을 가지는 CCR5 및 HPRT1은 서로 비슷한 양의 세포 사멸 효과를 보였다. 반면, 100 군데 이상을 자른다고 알려진 MT2는 이들에 비해 살아있는 세포의 양이 약 50% 수준으로 떨어짐으로써 세포 사멸 효과를 나타내었다. 또한, 폐암 세포주의 표적 위치인 SMIM11（약 74%） , GNPDA2 약 58%）， SLC15A5 약 45%） 및 KCNE2 약 77%）에서 모두 MT2만큼 높은 사멸 효과를 확인하였으며， 이중 SMIM11과 KCNE2는 MT2보다 사멸 효과가 우수하였다. 각 실험군의 Copy number , Essentiality^· 하기 표 6에 나타내었으며， 각 실험군에서 세포의 형태（morphology）를 현미경으로 관찰하여 도 7에 나타내었다.
【표 6]
Figure imgf000030_0002
실시예 8.2. 리포펙타민을 이용한 _및 크리스퍼 단백질 도입
24 웰 플레이트에서, 웰 1개당 폐암 세포인 ¾299 세포를 1.5산05개 만큼 깔아주고， 24시간 후에 각 웰에 하기 표 7과 같은 종류의 ·를 도입하였다. 도입을 위해 느 근 크 : 크용 를 사용하였고, 제조사에서 제공하는 매뉴얼을 따랐으며
Figure imgf000030_0001
500 씩 사용하였다.
【표 7]
Figure imgf000030_0003
상기 DNA 도입 즉， 트랜스펙션 시점을 기점으로 하여 48시간 후， 각 웰의 배양액을 모두 석션으로 제거하고 IX PBS를 500 |止 만큼 넣어 한 번 세척하였다. 이후， Trypsin-EDTA를 처리하여 세포를 모두 떼어냈다. 이들을 Trypan blue 염색약을 이용하여 염색한 후, 살아있는 세포 수를 측정하였다. 그 결과를 도 9및 도 10에 나타내었다. 본 실시예에서는 DNA의 도입 없이 Lipofection만 수행한 실험군을 포함시켰다.
도 9에 나타난 바와 같이, Lipofection only(Lipo only)에 비해 CCR5에서 살아있는 세포의 수가 80% 정도 수준으로 떨어짐을 관찰하였다. NT1 , HPRT1의 경우 CCR5 대비 70% 정도로 나타났다. MT2에서는 NT1에 비해 25% 수준으로 세포 수가 떨어졌으며, CNV를 표적으로 한 3종 (GNPDA2 , SLC15A5 및 KCNE2)에서는 더욱 많은 세포가 사멸하여 Trypan blue를 이용한 세포 수 측정법으로는 살아있는 세포를 유의미하게 찾아낼 수 없었다. 구체적으로， NT1， CCR5 , HPRT1 , MT2 , GNPDA2 , SLG15A5 및 KCNE2에서 각각 약 43%， 약 23%, 약 50% , 약 86%, 약 99%, 약 99% 및 약 99%의 세포사멸률을 나타내었다.
NT1 및 GNPDA2 실험군을 각각 세포들이 많이 살아있는 실험군과 많이 죽은 실험군의 대표로 선정하였다. 이후, NucBlue Live ReadyProbes Reagent 및 Propidium Iodide ReadyProbes Reagent를 이용하여 각 웰에서 현미경으로 이미징하였다. 이를 도 10에 나타내었다. 형광으로 살아있는 세포의 비율을 분석한 결과, 도 9에 나타난 결과와 유사하였다.
실시예 9. 폐암세포 H1563에서 표적 위치에 따른세포사멸 효과 확인
24 웰 플레이트에서， 웰 1개당 H1563 세포를 1.5xl05개 만큼 깔아주고, 24시간 후에 각 웰에 하기 표 8과 같은 종류의 DNA를 도입하였다. 도입을 위해 Lipofectamine3000 reagent를 사용하였고, 제조사에서 제공하는 매뉴얼을 따랐으며, DNA를 500 ng씩 사용하였다.
【표 8]
Figure imgf000031_0002
Figure imgf000031_0001
농도의 1)111011^ 11을 처리하여 72시간 동안 셀렉션하였다. 이후， 각 웰의 배양액을 모두 석션으로 제거하고， IX 표 를 500 ᅭ만큼 넣어 한 번 세척하였다. 이후, Trypsin-EDTA를 처리하여 세포를 모두 떼어냈다. 이들을 Trypan blue 염색약을 이용하여 염색한 후， 살아있는 세포 수를 측정하였다. 그 결과를 도 11에 나타내었다.
도 11에 나타난 바와 같이, 단일 표적인 CCR5와 대비하여 HPRT1은 52%정도 수준， MT2에서는 43% 수준, 그리고 CNV를 표적으로 한 2종(IRX1 및 ADAMTS16)에서는 각각 37% 및 40%로 적은 양의 세포들이 남아있었다. 이를 통해， 많은 양의 D況(double strand breaker)를 유도함으로써 CCR5와 같은 단일 표적에 비해 세포사멸 효과를높일 수 있음을 확인하였다.
실시예 10. 폐암세포 A549에서 표적 위치에 따른세포사멸 효과 확인 실시예 10.1. multi타겟에 의한 A549세포사멸 확인
페암 세포 A549에 Cas9 단백질과 gRNA가 발현되는 DNA 500 을 전기 천공법 (Lonza)으로 도입하였다. 배양 중인 A549 세포를 IX PBS로 세척한 후, Trypsin-mTA를 처리하여 바닥에서 떼어내었다. 필요한 세포 수를 덜어내어 IX PBS로 1번 세척한 후, SF buffer(Lonza)로 풀어준 후 각각의 DNA와 섞었다. 세포와 DNA 혼합액을 전기천공장치 (Lonza)에 넣어 전기충격을 가하였다. 대조군으로서 인간 유전자서열에서 얼라인(align)되지 않는 NT1, 1 copy를 가지며 house keeping gene인 HPRT1, 1 copy의 유전자를 가지는 CCR5를 타겟하는 조건， 그리고 전기충격만주는 조건(pulse only)을 추가하였다.
전기충격으로 DNA를 도입한후， 24 웰에 2 반복， 그리고 96 웰에 3 반복으로 세포를 넣어주었다. DNA 도입 24， 42 및 72시간 후， 50 |JL의 CellTiter Glo reagent를 96 웰에 넣어주었다. FLUOstar omega reader 기계에 플레이.트를 넣고 2분간 흔들어 주었다. 그리고， 10분 동안 상온에서 반응시킨 후, 발광도를 측정하였다. 상기 방법은 세포 내의 ATP양을 기반으로 대사과정을 하고 있는 살아있는 세포 양을 발광도를 통해 판별하는 방법이다. 그 결과를 도 12에 나타내었다.
도 12에 나타난 바와 같이， 3가지 대조군 (NT1 , HPRT1 및 CCR5)에 비해 100 곳 이상을 타겟하는 MT2 조건에서 시간이 지남에 따라 20% 내지 50%의 세포사멸이 유도되었다.
DNA도입 24시간 후， 24 웰에 1 pg/mL의 puromycin을 넣고， 전기충격만 준 조건에서 세포가 90% 정도 사멸하는 시점에서 세포배양액을 바꿔주어 세포를 회복시켰다. 5일 내지 7일 회복시킨 후, 각 웰에서 세포를 떼어내어 trypan blue로 염색한 후， 살아있는 세포 수를 측정하였다. 그 결과를 도 13에 나타내었다. 한편, DNA 도입 후， puromycin으로 셀렉션(selection)한 후 세포 수를 측정하기 전 현미경으로 관찰한사진을 도 14에 나타내었다. 그 결과 puromycin 저항성이 없는 전기중격만 준 조건에서는 세포가 살아남지 않아 컨트롤이 되었고, NT1 , HPRT1조건에 비해 CCR5를 타겟했을때, 50%정도의 세포사멸이 보였다. 그리고 MT2 조건은 약 90%의 세포가 사멸한 것으로 확인되었다. DNA 도입 후 puromycin으로 selection 한 후 세포수를 측정하기전 현미경으로 관찰한 사진이다. 세포수 측정결과와 마찬가지로 NT1 컨트롤에 비해서 1 copy만 가지는 HPRT1， CCR5를 타겟할 경우 50% 이상의 세포가 회복 되는 반면 MT2 조건의 경우 90%정도의 세포는 사멸이 일어났고， 10% 세포만 회복되는 것을 관찰하였다 (파란색 화살표: 회복된 세포 colony) . 따라서 A549 세포에 Cas9 단백질을 이용하여 multi DNA Break를 유도하였을 때 세포사멸이 일어나는 것을 확인하였다.
실시예 10.2. CNV타겟에 의한 A549세포사멸 확인
폐암세포주인 A549세포에 CNV를 가지는 유전자를 타겟하여 Cas9 단백질로 DNA break를 유도했을때， 세포사멸 정도를 확인하였다. 구체적으로， 페암 세포인 A549에 Cas9 단백질과 각 CNV 타겟 gRNA가 발현되는 DNA 500 을 전기 천공법 (Lonza)으로 도입하였다. 배양 중인 A549 세포를 IX PBS로 세척한 후, Trypsin-EDTA를 처리하여 바닥에서 떼어내었다. 필요한 세포 수를 덜어내어 IX PBS로 1번 세척한 후, SF buffer(Lcmza)로 풀어준 후 각 DNA와 섞었다. 세포와 DNA 혼합액을 전기천공장치 (Lonza)에 넣어 전기충격을 가하였다. 대조군으로서 대장균에서 단백질 발현할 수 있는 pET21a 벡터 (vector)를 도입한 조건, 전기충격만 주는 조건(pulse only), 및 아무런 처리도 하지 않은 조건(no pulse)을 추가하였다.
전기충격으로 DNA를 도입한 후， 96 웰에 각 조건당 3 반복으로 세포를 넣어주었다. DNA 도입 24， 44 및 51시간 후， 50 此의 CellTiter Glo reagent를 웰마다 넣어주었다. FLUOstar omega reader 기계에 플레이트를 넣고 2분간 흔들어 주었다. 그리고， 10분 동안 상온에서 반응시킨 후, 발광도를 측정하였다. 그 결과를 도 15에 나타내었다.
도 15에 나타난 바와 같이, 3가지 대조군(pulse only, pET21a 및 no pulse)에 비해 100곳 이상을 타겟하는 MT2 조건에서 시간이 지남에 따라 20% 내지 50%의 세포 사멸이 유도되었다. 또한， CD68 , DACH2 및 HERC2P2 3종의 ◦ 타겟은 MT2와 유사한 세포사멸을 유도하였고， SHBG의 ◦ 타겟은 대조군에 비해 70% 내지 80%의 세포 사멸을 유도하였다. 따라서， A549 세포가 가지고 있는 CNV 4종 (CD68, DACH2, HERC2P2 및 SHBG2)을 Cas9 단백질을 이용하여 타겟 DNA Break를 유도하였을 때 세포사멸이 일어나는 것을 확인하였다.
실시예 11. 유방암세포況 BR3에서 표적 위치에 따른세포사멸 효과 확인 실시예 11.1. CNV타겟에 의한 SKBR3세포사멸 확인
유방암세포인 SKBR3에 Cas9 단백질과 각 CNV타겟 gRNA가 발현되는 DNA 500 을 전기천공법 (Lonza)으로 도입하였다. 배양 중인 SKBR3 세포를 IX PBS로 세척한 후， Trypsin-EDTA를 처리하여 바닥에서 떼어내었다. 필요한 세포 수를 덜어 내어 IX PBS로 1번 세척한 후， SF buf fer(Lonza)로 풀어준 후 각 DNA와 섞었다. 세포와 DNA 혼합액을 전기천공장치 (Lonza)에 넣어 전기충격을 가하였다. 대조군으로서 인간 유전자서열에서 얼라인되지 않는 NTKnon target ) , 전기충격만 주는 조건 (pul se only) , 및 아무런 처리도 하지 않은 조건 (no pul se)을 추가하였다. 전기충격으로 DNA를 도입한 후， 24 웰에 2 반복 및 96 웰에 3 반복으로 세포를 넣어주었다.
DNA ·도입 24， 42 및 48시간 후, 50 此의 Cel lTi ter Glo reagent를 96 웰에 넣어주었다. FLUOstar omega reader 기계에 플레이트를 넣고 2분간 흔들어 주었다. 그리고， 10분 동안 상온에서 반응시킨 후， 발광도를 측정하였다. 그 결과를 도 16에 나타내었다.
도 16에 나타난 바와 같이, 3가지 대조군 (NT1 , pul se only 및 no pul se)에 비해 100곳 이상을 타겟하는 MT2 조건에서 30%의 세포사멸이 유도되었다. 또한
ERBB2 및 KRT16 2종의 CNV 타겟은 대조군에 비해 40% 내지 50%의 세포사멸을 유도하였다.
실시예 11.2. CNV타겟에 의한 SKBR3세포사멸 확인
유방암 세포인 SKBR3에 Cas9 단백질과 각 CNV타겟 gRNA가 발현되는 DNA 500 을 전기천공법 (Lonza)으로 도입하였다. 배양 중인 SKBR3 세포를 IX PBS로 세척한 후， Tryps in-EDTA를 처리하여 바닥에서 떼어내었다. 필요한 세포 수를 덜어 내어 IX PBS로 1번 세척한 후， SF buf fer (Lonza)로 풀어준 후 각 DNA와 섞었다. 세포와 DNA 혼합액을 전기천공장치 (Lonza)에 넣어 전기충격을 가하였다. 대조군으로서 인간 유전자서열에서 얼라인되지 않는 NT1 , 1 copy를 가지며 house keeping gene인 HPRT1을 타겟하는 조건을 추가하였다. 전기충격으로 DNA를 도입한 후, 24 웰에 2 반복으로 세포를 넣어주었다.
DNA 도입 48시간 후， 24 웰의 각 웰에서 세포를 떼어내어 trypan blue로 염색한 후 살아있는 세포수를 측정하였다. 그 결과를 도 17에 나타내었다. 도 17에 나타난 바와 같이， 대조군에 비해 100곳 이상을 타겟하는 MT2 조건에서 40%의 세포사멸을 유도하였고, ERBB2 및 KRT16 2종의 CNV 타겟은 대조군에 비해 40% 내지 50%의 세포사멸을 유도하였다. 따라서 , SKBR3 세포가 가지고 있는 CNV 2종 (ERBB2 및 KRT16)을 Cas9 단백질을 이용하여 타겟 DNA Break를 유도하였을 때 세포사멸이 일어나는 것을 확인하였다.
실시예 12. 자궁경부암세포 HeLa에서 표적 위치에 따른세포사멸 확인 실시예 12.1. CNV타겟과 HPV유전자타겟에 의한세포사멸 확인
자궁경부암 세포주인 HeLa 세포에 Cas9 단백질과 gRNA가 발현되는 벡터 600 을 전기천공법으로 도입하였다. 배양 중인 HeLa 세포를 IX PBS로 세척한 후， Trypsin내 DTA를 처리하여 바닥에서 떼어내었다. 필요한 세포 수를 덜어 내어 IX PBS로 1번 세척한 후， SE buf fer(Lonza)로 풀어준 후 각 벡터와 섞었다. 세포와 DNA 혼합액을 전기천공장치 (Lonza)에 넣어 전기충격을 가하였다. 대조군으로서 1 copy의 non essent ial gene인 CCR5를 타겟하는 조건과 100개 이상의 non essent i al gene을 타겟하는 MT2 조건을 추가하였고， 실험군으로 HeLa에서 8 copy 이상 있는 것으로 알려진 PRDM9와 30 copy 이상 있는 것으로 알려진 Human Papi l lomaVi rus(HPV) 유래의 유전자를 타겟하여 HeLa세포 특이적 세포사멸을 유도하는실험을 진행하였다.
전기충격으로 DNA를 도입한 후， 24 웰에 2 반복으로 세포를 넣어준 후， 24시간이 지나 0.5 |jg/Ml의 Puromycin을 넣어 DNA 벡터가 안 들어간 세포들을 죽이는 셀렉션 과정을 진행하였다. 셀렉션 3일 후， Puromycin이 안 들어간 세포배양액으로 바꿔주어 세포를 배양하였다. 3 내지 4일 후， 각 웰에서 세포를 떼어내어 trypan blue로 염색한 후 살아있는 세포 수를 측정하였다. 그 결과를 도 18 및 도 19에 나타내었다.
도 18 및 도 19에 나타난 바와 같이, HeLa 세포에서 1곳만 자르는 CCR5와 비교했을 때, 100곳 이상을 타겟하는 MT2 조건이 시간이 지남에 따라 약 50%의 세포사멸이 유도되는 것을 확인할 수 있었다. 또한, CNV 타겟인 PRDM9와 HPY 유전자 타겟인 HPV_1의 경우 MT2 조건과 유사하거나 더 많은 세포사멸을 유도하는 것을 확인하였다. 구체적으로， 도 18에서， MT2 및 PRDM9에서 약 50% 및 약 80%의 세포사멸률을 나타내었다. 또한， 도 19에서, MT2 , PRDM9 및 HPVJL에서 약 50%, 약 40% 및 약 40%의 세포사멸률을 나타내었다. 따라서, HeLa 세포만 가지고 있는 CNV와 HPV 유전자를 Cas9 단백질을 이용하여 타겟 DNA Break를 유도하였을 때 세포사멸이 일어나는 것을 확인하였다.
실시예 12.2. CNV타겟과 HPV유전자타겟에 의한세포사멸 확인
전기충격으로 HeLa세포에 DNA벡터를 도입하는 과정은 상기 실시예 12.1의 방법과 동일하다. 전기충격으로 DNA를 도입한 후， 96 웰에 2 반복으로 세포를 넣어주었다. 이후, 24， 48 및 72시간 간격으로 Cell Titer glo 2.0을 사용하여 세포 내의 ATP양을 측정함으로써 대사과정을 하고 있는 살아있는 세포 정도를 발광도로 판별하였다. 대조군으로는 GFP를 발현하는 대조군 벡터， 1 copy의 non essential gene인 CCR5를 타겟하는 조건, 그리고 100개 이상의 non essential gene을 타겟하는 MT2 조건을 추가하였다. 실험군으로 HeLa에서 8 copy 이상 있는 것으로 알려진 PRDM9와 30 copy 이상 있는 것으로 알려진 Human Papilloma Virus (HPV) 유래의 유전자를 타겟하여 HeLa세포 특이적 세포사멸을 유도하는 실험을 진행하였다. 그 결과를 도 20a에 나타내었다.
도 20a에 나타난 바와 같이 , HeLa세포에서 1곳만 자르는 CCR5 타겟과 GFP만 들어간 Pulse only는 비슷한 정도의 luminescence signal을 나타내었다. 또한， CCR5에 비하여 MT2 조건에서 약 50% 세포사멸이 유도되는 것을 확인할 수 있었다. 또한， CNV타겟인 PRDM9와 HPV유전자 타겟인 HPV_1의 경우 MT2 조건보다 더 많은 세포사멸을 유도하는 것을 확인하였다. 구체적으로， MT2 , PRDM9 및 HPV_1에서 약 50%, 약 65% 및 약 65%의 세포사멸률을 나타내었다.
따라서， HeLa 세포만 가지고 있는 CNV와 HPV 유전자를 Cas9 단백질을 이용하여 타겟 DNA Break를 유도하였을 때 세포사멸이 일어나는 것을 확인하였다.
실시예 12.3. HPV유전자타겟에 의한세포사멸 확인
전기충격으로 HeLa 세포에 DNA 벡터를 도입하는 과정은 실시예 12.1의 방법과 동일하다. 기존의 1 copy의 non essential gene인 CCR5과 10◦개 이상의 non essential gene을 타겟하는 MT2 조건에 인간 유전체에 없는 영역을 타겟하는 NT 조건을 추가하였다. NT1의 경우 20 mer의 non-target sgRNA를 발현하는 조건, NT2 및 NT3은 non-target sgRNA의 spacer의 길이가 각각 10 mer , 5 mer인 조건이다. 실험군으로 HeLa에서 30 copy이상 있는 것으로 알려진 Human Papilloma Virus(HPV) 유래의 유전자를 타겟하여 HeLa세포 특이적 세포사멸을 유도하는 실험을 진행하였다. 전기충격으로 DNA를 도입한 후, 24 웰에 2 반복으로 세포를 넣어준 후, 24시간이 지나 0.5 |jg/mL Puromycin을 넣어 DNA벡터가 안 들어간 세포들을 죽이는 셀렉션 과정을 진행하였다. 셀렉션 3일 이후， Puromycin이 안 들어간 세포배양액으로 바꿔주어 세포를 배양하고， 10일 후， 각 웰에서 세포를 떼어내어 Cell Titer Glo 방법으로 luminescence signal을 즉정하였다. 그 결과를 도 20b에 나타내었다.
도 20b에 나타난 바와 같이, HeLa 세포에서 1곳만 자르는 CCR5 타겟은 5 mer의 spacer를 가지는 NT3와 비교하였을 때 75% 정도의 luminescence signal을 보였고， NT3에 비하여 MT2 조건에서 약 99.5% 세포사멸이 유도되는 것을 확인할 수 있었다. 또한， HPV 유전자 타겟인 HPV_1의 경우 NT3 조건과 비교하였을 때, 약 90%의 세포를 죽이는 것을 확인할 수 있었다. 따라서， HeLa 세포만 가지고 있는 HPV유전자를 Cas9 단백질을 이용하여 타겟 DNA Break를 유도하였을 때 세포사멸이 일어나는 것을 Cell Titer Glo방법을통해 확인하였다.
실시예 13. 대장암세포 HT29에서 표적 위치에 따른세포사멸 효과 확인 실시예 13.1. CNV타겟에 의한 대장암세포사멸 확인
24 웰 플레이트에서, 웰 1개당 H1563 세포를 1.5xl05개 만큼 깔아주고, 24시간 후에 각 웰에 하기 표 9와 같은 종류의 DNA를 도입하였다. 도입을 위해 Lipofectamine3000 reagent를 사용하였고， 제조사에서 제공하는 매뉴얼을 따랐으며， DNA를 500 ng씩 사용하였다.
【표 9]
Figure imgf000037_0002
상기 도입 즉， 트랜스펙션 시점을 기점으로 하여 24시간 후에 1 |½/此 농도의
Figure imgf000037_0001
처리하여 90시간 동안 셀렉션하였다. 이후， 각 웰의 배양액을 모두 석션으로 제거하고, 12일 동안 normal media(McC0Y+10% FBS, 1% P/S)로 리커버 (recover )하였다. 이후, IX PBS를 500 |JL만큼 넣어 한 번 세척해준 후, Trypsin-EDTA을 처리하여 세포를 모두 떼어내었다. 이들을 Trypan blue 염색약을 이용하여 염색한 후， 살아있는 세포 수를 두 번 측정하여 평균 처리하였다. 그 결과를 도 21에 나타내었다.
도 21에 나타난 바와 같이， 표적 시퀀스가 없다고 알려진 NT1과 단일 표적인 CCR5는 서로 오차 범위 이내의 차이를 나타내었다. HPRT1은 NT1 대비 47% 정도 수준의 세포가 남았으며, genome 전체에서 repeat sequence를 100 군데 이상 자르는 positive control인 MT2와 네 개의 CNV표적 (TRAPPC， LINC00536, TRPS1 및 CDK8)들은 차례대로 NT1 대비 2%, 3%, 18%, 20% 및 4.2%의 세포 생존율을 나타내었다. 즉, CNV표적은 암세포를 효과적으로사멸시킬 수 있음을 확인하였다.
실시예 13.2. CNV타겟에 의한 대장암세포사멸 확인
CNV를 가지는 4종의 CDK8, LINC00536, TRPS1 및 TRAPPC9 유전자 및 MT2를 표적으로 하여 HT-29(결장암 세포주)의 특이적 사멸을 확인하기 위해 Cas9 단백질과 각 CNV타겟 gRNA를 발현하는 DNA 500 ng을 전기천공법 (Lonza)으로 HT-29 세포에 도입하였다. 배양중인 HT-29 세포를 IX PBS로 세척한 후, Trypsin-EDTA를 처리하여 바닥에서 떼어내었다. 필요한 세포 수를 덜어내어 IX PBS로 1번 세척한 후， SF buffer(Lonza)로 풀어준 후 각 DNA와 섞었다. 세포와 DNA 혼합물을 전기천공장치 (Lonza)에 넣고 전기충격을 가하였다. 대조군으로 인간 게놈에서 정렬되지 않은 NTKnon target) 및 전기충격만주는 조건(pulse only)을 추가하였다. 전기충격 후, 96웰에 각 조건마다 4반복으로 플레이팅 (plating)하였다. DNA도입 24시간 후, 50 |JL의 Cel ITiter Glo reagent를 96웰에 넣어주었다. FLUOstar omega reader 기계에 플레이트를 넣고 2분간 흔들어 주고, 10분 동안 상온에서 반응시킨 후 발광도를 측정하였다. 그 결과를 도 22에 나타내었다.
도 22에 나타난 바와 같이， 대조군에 비해 100곳 이상을 타겟하는 MT2 조건과 TRAPPC9 CNV 타겟에서 90¾＞의 세포사멸이 유도되었고， CDK8, LINC00536 및 TRPS1 3종의 CNV타겟은 20%내지 45%의 세포사멸을 유도하였다.
실시예 14. 폐암세포 H1563세포에서 H1299에서 사용된 타겟 유전자에 의한 세포사멸 효과비교
24 웰 플레이트에서, 웰 1개당 H1563 세포를 1.5xl05개 만큼 깔아주고， 24시간 후에 각 웰에 하기 표 10과 같은 종류의 DNA를 도입하였다. 도입을 위해 Lipofectamine3000 reagent를 사용하였고， 제조사에서 제공하는 매뉴얼을 따랐으며， 를 500 씩 사용하였다.
【표 10】
Figure imgf000039_0001
상기 도입 즉， 트랜스펙션 시점을 기점으로 하여 24시간 후에 1 |福/此 농도의 을 처리하여 72시간 동안 셀렉션하였다. 이후, 각 웰의 배양액을 모두 석션으로 제거하고, IX PBS를 500 此만큼 넣어 한 번 세척해준 후 Trypsin- ffiTA를 처리하여 세포를 모두 떼어내었다. 이들을 Trypan blue 염색약을 이용하여 염색한 후, 살아있는 세포 수를 측정하였다. 그 결과를 도 23에 나타내었다. 이때, 사용한 DNA표적들은 CCR5를 제외하고 모두 H1299에서 증폭되어있는 표적들이므로 genome 상에서 12군데 이상을 잘라， 사멸 효과를 보았던 표적들 (도 8 및 도 9 참조)이다. 그러나, H1563 세포에서는 이와 같이 증폭된 CNV가 존재하지 않으므로， 상기 표적들은모두 CCR5와 같이 두 군데의 표적 위치만을자르게 된다.
도 23에 나타난 바와 같이， 폐암세포 H1563에서는 이들 표적들이 폐암세포 H1299에서와 같이 사멸 효과를 보이지 않았으며， CCR5에 대비했을 때 오히려 더 높은 세포 생존률을 보여주었다. 다만， KCNE2의 경우， H1563에서도 높은 세포 사멸 효과를 나타내는 것으로 관찰되었다. 이는 도 24의 현미경상 이미지에서 유추되는 세포 사멸 트렌드와도 일치하는 결과였다. KCNE2의 세포 사멸 효과는 알 수 없는 모종의 이유에서 일어났을 것으로 추측되며, 이를 제외한 나머지 H1299의 세 개의 CNV 표적들 (SMIM11 , GNPDA2 및 SLC15A5)이 H1563에서 세포 사멸을 일으키지 않았으므로 CNV의 세포 특이적 사멸 효과를 확인할 수 있었다.
실시예 15. CNV타겟에 의한폐암세포 H1299세포의 세포사멸 측정
형질전환 하루 전, 폐암세포주인 H1299 세포를 Trypsin-EDTA로 떼어낸 후, white 96 웰에 1.3xl04을 플레이팅하였다. 다음 날， Cas9 단백질과 각 CNV 타겟 gRNA가 발현되는 DNA 500 를 리포좀을 이용한 방법으로 도입하였다. 0.3 ᅭ의 리포좀 reagent I와 5 pL의 opti-MEM을 섞어두었다(tube 1) . 0.2 |jL의 리포좀 reagent II, 5 此의 opti-MEM, 및 각 조건의 DNA 500 ng를 섞어주어 tube 2를 제작하였다. 이후， tube 1과 혼합하여 상온에서 15분 동안 방치하였다. 리포좀과 DNA 혼합액을 96 웰에 11 此씩 넣어주었다. 3시간 후, AnnV reagent를 넣고， 형질전환 24시간후 발광 정도를 측정하였다. 그 결과를 도 25에 나타내었다. 상기 방법은 세포사멸이 일어날 때 바깥쪽 세포막에 노출되는 PS(phosphatidylserine) site에 AnnV가 붙어 발광하게 되면, 발광 정도에 따라 세포 사멸의 정도를 측정하는 방법이다.
상기 실험 결과， KCNE2 , GNPDA2 , SMIM11 및 SLC15A5에서 약 30% 내지 40%의 세포사멸률을 나타내었다. 상기 결과를 통해， H1299 세포가 가지고 있는 CNV 4종 (GNPDA2， KCNE2 , SLC15A5 및 SMIM11)을 Cas9 단백질을 이용하여 타겟 DNA break를 유도했을 때， 세포막에 PS가 노출되면서 세포사멸이 일어나는 것을 확인할 수 있었다.
실시예 16. EGFR돌연변이 서열 특이적 가이드 RNA에 의한 세포 사멸 효과 및 Cas9-RecJ융합단백질(CRISPR PLUS)을 이용한세포사멸 효과 확인
본 실시예에서는 Cas9 단백질 발현 벡터 (PX459， Addgene plasmid #62988)를 이용해 폐암세포인 HCC827 세포의 유전체에 multi -cleavage를 일으켜 세포 사멸을 일으킬 수 있음을 증명하였다. 또한， 인간 코돈 최적화된 Rec J 단백질을 PX459 벡터에 함께 발현시켜 세포 사멸 효과를 증폭시킬 수 있음을 확인하였다. 전기천공법으로 세포 내부에 벡터들을 전달하였으며, 유전체에 multi -cleavage를 일으키기 위해 HCC827세포 EGFR 유전자의 E2 돌연변이 서열을 타겟하는 가이드 쇼를사용하였다.
HCC827세포는 75T플라스크에서 RPM1-1640(10%소태아혈청) 배지로 약 50% 밀도의 양으로 배양한 후 트립신화 및 PBS 세척을 거쳐 최종적으로 Neon
Electroporation Buffer 묘에 리서스펜드 하였다. 10|_iL Neon 파이펫 팁에 150,000개의 세포와 500 ng의 벡터를 로딩한 후, 1300 V, 20 ms 및 2 pulses 조건으로 전기천공법을 진행하였다. 이후, RPMI-1640(10% 소태아혈청) 배지에서 회복시키고， 4일 후 세포들을 수확해 카운팅을 실시하였다. 그 결과를 도 26및 도 27에 나타내었다.
도 26 및 도 27에 나타난 바와 같이， 대조군으로 사용한 electric pulse만 준 샘플(pulse only)과 비교해 봤을 때， 타겟 서열이 존재하지 않는 EGFR_WT 실험군에 비해 EGFR_E2 실험군의 세포수가 현저하게 감소하였다. 구체적으로, Cas9을 사용하여 CCR5를 타겟한 실험군의 경우 세포 수의 변화가 없었으나， EGFR_E2를 타겟한 실험군의 경우 약 33%의 세포사멸률을 나타내었다. 또한, Rec J 단1^질을 함께 발현 시켰을 시 mul t i -cleavage에 의한 세포 사멸 효과가 증폭 되는 것뿐만 아니라， single target을 절단했을 때에도 세포 수가 줄어드는 현상을 관찰하였다. 구체적으로， Cas9-RecJ를 사용하여 CCR5를 타겟한 실험군의 경우 약 50%의 세포사멸률을 나타내었고， Cas9-RecJ를 사용하여 EGFR_E2 실험군의 경우 80%의 세포사멸률은 나타내었다. 상기 실험을 통해, 암세포에 Cas9 단백질과 세포 유전체 서열 특이적 mul t i -target 가이드 RNA를 넣어 주었을 때 세포 사멸을 일으키며 CRISPR PLUS단백질로 그 효과를 조절할수 있음을 알수 있었다.
실시예 17. EGFR 돌연변이 서열 특이적 가이드 RNA에 의한 세포 사멸 효과 및 를 이용한세포사멸 효과확인
본 실시예에서는 Cas9 / sgRNA r ibonucleoprotein(Cas9 RNP)를 이용해 폐암세포인 HCC827 세포의 유전체에 mul t i -c leavage를 일으켜 세포 사멸을 일으킬 수 있음을 증명하였다. 전기천공법으로 세포 내부에 RNP들을 전달하였으며, 유전체에 mul t i -cleavage를 일으키기 위해 HCC827세포 EGFR 유전자의 E2 돌연변이 서열을타겟하는 가이드 쇼를사용하였다.
HCC827 세포는 75T 플라스크에서 RPMI-1640(10% 소태아혈청) 배지로 약 50% 밀도의 양으로 배양한 후, 트립신화 및 PBS 세척을 거쳐 최종적으로 Neon El ectroporat ion Buf fer 묘에 리서스펜드 하였다. 10 |JL Neon 파이펫 팁에 150 ,000개의 세포와 1.2 ［ 의 RNP를 로딩한 후, 1300 V, 20 ms 및 2 pul ses의 조건으로 전기천공법을 진행하였다. 이후, RPMI-1640(10% 소태아혈청) 배지에서 회복시키고， 1일 후 세포들을 수확해 카운팅을 실시하였다. 그 결과를 도 28에 나타내었다.
도 28에 나타난 바와 같이 , electr ic pul se만 준 샘플 (pulse only)이나， Cas 단백질 혹은 가이드 쇼만 넣은 샘플들과 비교해 봤을 때， EGFR_E2 서열을 타겟하는 RNP를 넣은 실험군의 세포수가 현저하게 감소하였다. 구체적으로， 상기 EGFR_E2 서열을 타겟하는 RNP를 넣은 실험군의 경우， 약 35%의 세포사멸률을 나타내었다. 상기 실험을 통해, 암세포에 Cas9 단백질과 세포 유전체 서열 특이적 mult i -target 가이드 RNA를 넣어 주었을 때 세포 사멸을 일으키며 Cas9 RNP로 그 효과를 조절할수 있음을 확인할수 있었다.
실시예 18. JTT2 서열 특이적 가이드 RNA에 의한 세포 사멸 효과 및 RNP를 이용한세포사멸 효과확인 본 실시예에서는 Cas9 / sgRNA r ibonucleoprotein(Cas9 를 이용해 폐암세포인 H1563 세포의 유전체에 multi -cleavage를 일으켜 세포 사멸을 일으킬 수 있음을 증명하였다. 전기천공법으로 세포 내부에 RNP들을 전달 하였으며, 유전체에 multi -cleavage를 일으키기 위해 인간 유전체에서 약 100군데 이상을 타겟할수 있는 가이드 RNA인 MT2를사용하였다.
H1563 세포는 75T 플라스크에서 RPMI-1640(10% 소태아혈청) 배지로 약 50% 밀도의 양으로 배양한 후， 트림신화 및 PBS 세척을 거쳐 최종적으로 Neon
Electroporation Buffer 요에 리서츠펜드 하였다. 10|JL Neon 파이펫 팁에 150, 000개의 세포와 1.2|jM의 RNP를 로딩한 후， 1200 V, 20 ms 및 2 pulses의 조건으로 전기천공법을 진행하였다. 이후， RPM 1-1640 (10% 소태아혈청) 배지에서 회복시키고, 2일 후 세포들을 수확해 카운팅을 실시하였다. 그 결과를 도 29에 나타내었다.
도 29에 나타난 바와 같이, electric pulse만 준 샘플 (pulse only)이나, 가이드 RNA만 넣은 샘플들과 비교해 봤을 때, MT2 서열을 타겟하는 RNP를 넣은 실험군의 세포수가 현저하게 감소한 것을 확인 하였다. 구체적으로, 상기 MT2 서열을 타겟하는 RNP를 넣은 실험군의 경우, 약 35%의 세포사멸률을 나타내었다. 상기 실험을 통해， 암세포에 Cas9 단백질과 세포 유전체 서열 특이적 multi-target 가이드 요를 넣어 주었을 때 세포 사멸을 일으키며 RNP로 그 효과를 조절할 수 있음을 확인할수 있었다.
실시예 19. MT2, GNPDA2 및 SMIM11 서열 특이적 가이드 RNA에 의한 세포 사멸 효과 및 RNP를 이용한세포사멸 효과확인
본 실시예에서는 Cas9 단백질을 이용해 폐암세포인 H1299 세포의 유전체에 multi -cleavage를 일으켜 세포 사멸을 일으킬 수 있음을 증명하였다. 여러 암세포들 중에서 트랜스펙션 효율이 비교적 높은 H1299 세포를 실험에 이용하였으며 전기천공법으로 세포 내부에 RNP들을 전달하였다.
유전체에 multi -cleavage를 일으키기 위한 가이드 RNA로 세 종류의 가이드 RNA를 사용하였다: MT2, GNPDA2 및 SMIM11. H1299 세포 특이적 유전체 서열 분석 정보를 토대로 copy-number variation(CNV) 이 높은 유전자들 중 약 12 copy 이상 존재하는 oncogene (GNPDA2)과 약 40 copy 이상 존재하는 non-essential 유전자 (SMIM11)를 타겟하는 가이드 쇼를 제작하였다. 인간 유전체 서열에 존재하는모든 Cas9 proto-spacer adj acent mot i f（PAM, 5'-NGG_3'）를 분석해 100군데 이상을 타겟할 수 있는 가이드 RNA인 MT2를 제작하였다. 또한， 트랜스펙션 유무를 확인하기 위해 C-terminus 부분에 GFP가 달린 Cas9 단백질을 제작해 사용하였다.
H1299세포는 75T 플라스크에서 RPM 1-1640（10% 소태아혈청） 배지로 약 50% 밀도의 양으로 배양한 후， 트림신화 및 PBS 세척을 거쳐 최종적으로 Neon Electroporat ion Buf fer 요에 리서스펜드 하였다. 10|JL Neon 파이펫 팁에
150,000개의 세포와 1.2[M Cas9-GFP 단백질과 1.5_ 가이드 RNA로 만든 RNP complement를 로딩한 후， 1300 V, 20 ms 및 2 pulses의 조건으로 전기천공법을 진행하였다. 이후, RPM 1-1640（10% 소태아혈청） 배지에서 회복시키고, 이틀 후 Promega사의 Cel ITi ter-Glo 2.0을 이용해 살아있는 세포 신호（luminescence）를 이용하여 세포 수를 관찰해 비교하였다. 그 결과를 도 30 내지 도 32에 나타내었다. 도 30 내지 도 32에 나타난 바와 같이, 단백질만 넣거나 가이드 RNA만 넣어준 샘플과 비교해 봤을 때, s ingle-target이 존재하는 것으로 알려진 CCR5 타겟 실험군에서는 유의미한 세포 사멸이 관찰되지 않았다. 하지만， mul t i- cleavage를 일으키는 RNP를 넣어준 MT2 , GNPDA2 및 SMIM11 실험군에서는 유의미한 세포사멸이 관찰되었다. 구체적으로, 상기 RNP를 넣어준 MT2 , GNPDA2 및 SMIM11 실험군에서 각각 약 33%, 약 71% 및 약 40%의 세포사멸률을 나타내었다. 상기 실험을 통해 암세포에 Cas9 단백질과 세포 유전체 서열 특이적 mul t i-target 가이드 쇼를 넣어 주었을 때 세포 사멸을 일으키며 RNP로 그 효과를 조절할 수 있음을 확인할수 있었다.
실시예 20. Casl2a 단백질을 이용한 서열 특이적 세포 사멸 효과 및 돌연변이 CNV서열 특이적 세포사멸 효과확인
본 실시예에서는 Casl2a 단백질 발현 벡터를 이용해 폐암세포인 HCC827 세포의 유전체에 double 혹은 mul t i -cleavage를 일으켜 세포 사멸을 일으킬 수 있음을 증명하였다. 본 발명에서， Casl2a의 DNA 및 아미노산 서열을 서열번호 135 및 136으로 나타내었다. 전기천공법으로 세포 내부에 벡터들을 전달하였으며， 야생형 non-essent i al 유전자인 CCR5（서열번호 138）, 혹은 HCC827 세포에서 18 카피 이상이 존재하는 것으로 알려진 EGFR.E2 돌연변이 서열을 타겟하는 crRNA（서열번호 139）를사용하였다.
HCC827 세포는 75T 플라스크에서 RPM 1-1640（10% 소태아혈청） 배지로 약 50% 밀도의 양으로 배양한 후 트림신화 및 PBS 세척을 거쳐 최종적으로 Neon Electroporat ion Buf fer 요에 리서스펜드 하였다. 10 |jL Neon 파이펫 팁에 150 , 000개의 세포와 500 ng의 벡터를 로딩 후 1300 V 20 ms 2 pulses 조건으로 전기천공법을 진행하였다. 이후 RPM 1-1640（10% 소태아혈청） 배지에서 회복시키고， 6일 후 세포들을 수확해 발광 신호를 측정함으로써 세포 양을 정량하였다. 한편， 대조군으로 사용한 EGFR_WT 서열（서열번호 137）은 HCC827 세포에는 존재하지 않는 것으로 알려진 서열이다. 그 결과를 도 33 및 도 34에 나타내었다.
도 33 및 도 34에 나타난 바와 같이， 대조군과 비교해 봤을 때， CCR5을 타겟한 실험군에서는 세포가 약 76% 사멸하였고, EGFR_E2를 타겟한 실험군에서는 세포가 약 83%사멸하였다. 본 실험을 통해 copy number에 관계없이 암세포 특이적 서열을 Casl2a 단백질을 이용해 절단했을때， 타겟 특이적 세포사멸을 일으킬 수 있음을 확인할수 있었다.

Claims

【청구의 범위】
【청구항 1]
암세포에 특이적으로 존재하는 핵산에 상보적으로 결합하는 폴리뉴클레오티드 및 뉴클레아제를 유효성분으로 포함하는 종양 세포 살해용 조성물.
【청구항 2]
제 1항에 있어서，
상기 폴리뉴클레오티드는 crRNA 또는 gRNA 인 것인， 종양 세포 살해용 조성물.
【청구항 3】
제 1항에 있어서，
상기 뉴클레아제는 엔도뉴클레아제인 것인, 종양 세포 살해용 조성물.
【청구항 4]
제 1항에 있어서，
상기 뉴클레아제는 CRISPR연관 단백질인 것인， 종양 세포 살해용조성물.
【청구항 5]
제 4항에 있어서，
상기 CRISPR 연관 단백질은 Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, CaslO, Casl2a, Casl2b, Casl2c , Casl2d, Casl2e, Casl2g, Casl2h, Casl2i , Casl3a, Casl3b, Casl3c, Casl3d, Casl4, Csyl, Csy2, Csy3, Csel, Cse2, Cscl, Csc2, Csa5, Csn2, CsMT2 , Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4, CsxlO, Csxl6, CsaX, Csx3, Csxl, Csxl5, Csfl, Csf2, Csf3 및 Csf4로 구성된 군으로부터 선택되는 어느 하나의 뉴클라아제인 것인， 종양 세포살해용조성물.
【청구항 6]
제 1항에 있어서,
암세포에 특이적으로 존재하는 핵산은 단일염기다형성 (single nucleotide polymorphism, SNP) , 유전자복제수변이 (copy number variation, CNV) , 구조적 변이 (structural variations, SV) , 유전자의 삽입 (insertion) 또는 유전자의 결실 (deletion)의 특징을 갖는 것인, 종양 세포 살해용 조성물.
【청구항 7]
제 6항에 있어서，
상기 구조적 변이는 역위 (inversion)， 전좌 (translocat ion) 또는 반복염기서열의 과다증폭 (short nucleotide repeat expansion)의 특징을 갖는 것인， 종양 세포 살해용조성물.
【청구항 8]
제 6항에 있어서，
상기 암세포에 특이적으로 존재하는 핵산은 유전자복제수변이 (CNV)가 적어도 4인 유전자에서 선택되는 것인, 종양 세포 살해용조성물.
【청구항 9]
제 8항에 있어서，
상기 암세포에 특이적으로 존재하는 핵산은 유전자복제수변이 (CNV)가 적어도 7인 유전자에서 선택되는 것인， 종양 세포 살해용조성물.
【청구항 10】
제 1항에 있어서，
상기 암세포에 특이적으로 존재하는 핵산은 p53, PTEN, APC, MSH2, HBV, HCV 및 EGFR로 구성된 군에서 선택되는 어느 하나의 유전자의 돌연변이인 것인, 종양 세포 살해용조성물.
【청구항 11】
제 1항에 있어서，
엑소뉴클레아제를 추가적으로 포함하는 것인， 종양세포 살해용조성물.
【청구항 12】
제 11항에 있어서，
상기 엑소뉴클레아제는 RecBCD, RecE， RecJ, T5, Exo I, Exo III, Exo VII, Lexo, TREX2, Exoribonuc lease T, TREX1, Mungbean exonuclease 및 Lambda으로 구성된 군으로부터 선택되는 어느 하나의 엑소뉴클레아제인 것인， 종양 세포 살해용조성물.
【청구항 13】
암세포에 특이적으로 존재하는 핵산에 상보적으로 결합하는 폴리뉴클레오티드 및 엔도뉴클레아제와 엑소뉴클레아제가 결합된 융합단백질을 유효성분으로 포함하는 종양 세포 살해용조성물.
【청구항 14】
제 13항에 있어서，
상기 엔도뉴클레아제와 엑소뉴클레아제는 링커를 통해 결합된 것인， 종양 세포 살해용 조성물.
【청구항 15】
제 13항에 있어서,
상기 폴리뉴클레오티드는 crRNA 또는 gRNA 인 것인， 종양 세포 살해용 조성물.
【청구항 16】
제 13항에 있어서，
상기 엔도뉴클레아제는 CRISPR 연관 단백질인 것인, 종양 세포 살해용 조성물.
【청구항 17】
제 16항에 있어서,
상기 CRISPR 연관 단백질은 Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, CaslO, Casl2a, Casl2b, Casl2c, Casl2d, Casl2e, Casl2g, Casl2h, Casl2i , Casl3a, Casl3b, Casl3c , Casl3d, Casl4, Csyl, Csy2, Csy3, Csel, Cse2, Cscl, Csc2, Csa5, Csn2, CsMT2 , Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4, CsxlO, Csxl6, CsaX, Csx3, Csxl, Csxl5, Csfl, Csf2, Csf3 및 Csf4로 구성된 군으로부터 선택되는 어느 하나의 뉴클라아제인 것인， 종양 세포 살해용 조성물.
【청구항 18】
제 13항에 있어서,
상기 엑소뉴클레아제는 RecBCD , RecE, RecJ , T5, Exo I, Exo III, Exo VII, Lexo, TREX2, Exoribonuc lease T, TREX1, Mungbean exonuclease 및. Lambda으로 구성된 군으로부터 선택되는 어느 하나의 엑소뉴클레아제인 것인， 종양 세포 살해용 조성물.
【청구항 19】
제 16항에 있어서， 암세포에 특이적으로 존재하는 핵산은 단일염기다형성 (single nuc leot ide polymorphi sm, SNP) , 유전자복제수변이 (copy number var i at ion , CNV) , 구조적 변이 (structural var i at ions , SV) , 유전자의 삽입 ( insert ion) 또는 유전자의 결실 (delet ion)의 특징을 갖는 것인, 종양 세포 살해용 조성물.
【청구항 20]
제 16항에 있어서，
상기 암세포에 특이적으로 존재하는 핵산은 p53 , PTEN, APC, MSH2 , HBV, HCV 및 EGFR로 구성된 군에서 선택되는 어느 하나의 유전자의 돌연변이인 것인 , 종양 세포 살해용조성물.
【청구항 21]
제 13항에 있어서，
상기 융합단백질은 Cas9-RecJ인 것인, 종양 세포 살해용 조성물.
【청구항 22】
제 1항 내지 제 21항의 조성물을포함하는 암 치료용 약학적 조성물.
【청구항 23]
제 22항에 있어서，
상기 암은 방광암, 골암, 혈액암， 유방암， 흑색종양, 갑상선암, 부갑상선암, 골수암, 직장암， 인후암, 후두암， 폐암, 식도암, 췌장암, 대장암, 위암, 설암, 피부암， 뇌종양， 자궁암， 두부 또는 경부암， 담낭암， 구강암， 결장암， 항문 부근암, 중추신경계 종양, 간암 및 대장암으로 구성된 군으로부터 선택되는 어느 하나인 것인, 약학적 조성물.
【청구항 24]
암세포에 특이적으로 존재하는 핵산 서열에 상보적으로 결합하는 폴리뉴클레오티드 및 엔도뉴클레아제를 코딩하는 폴리뉴클레오티드가 적재된 벡터를 유효성분으로 포함하는 종양 세포 살해용 조성물.
【청구항 25】
제 24항에 있어서，
상기 엔도뉴클레아제는 CRISPR 연관 단백질인 것이, 종양 세포 살해용 조성물 .
【청구항 26】 2019/190198 1»（：1^1{2019/003585
제 24항에 있어서，
상기 벡터에 엑소뉴클레아제를 코딩하는 폴리뉴클레오티드가 추가적으로 적재된 것인， 종양세포 살해용 조성물.
【청구항 27】
제 1항 내지 제 21항 및 제 24항 내지 제 26항 중 어느 하나의 조성물을 암에 걸린 개체에 투여하는 단계를포함하는 암을 치료하는 방법.
【청구항 28]
제 27항에 있어서,
상기 투여 경로는 종양내 투여， 정맥내， 근육내, 피내, 피하， 복강내， 소동맥내， 심실내, 병변내， 척추강내， 국소 및 이들의 조합으로 구성된 군으로부터 선택되는 어느 하나인 것을특징으로 하는， 방법.
PCT/KR2019/003585 2018-03-27 2019-03-27 가이드 rna 및 엔도뉴클레아제를 유효성분으로 포함하는 암 치료용 약학적 조성물 WO2019190198A1 (ko)

Priority Applications (2)

Application Number Priority Date Filing Date Title
US17/041,670 US11865164B2 (en) 2018-03-27 2019-03-27 Pharmaceutical composition for treating cancer, containing guide RNA and endonuclease as active ingredients
CN201980023354.9A CN111989113B (zh) 2018-03-27 2019-03-27 用于治疗癌症的包含向导rna和核酸内切酶作活性成分的药物组合物

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR20180035298 2018-03-27
KR10-2018-0035298 2018-03-27

Publications (1)

Publication Number Publication Date
WO2019190198A1 true WO2019190198A1 (ko) 2019-10-03

Family

ID=68058413

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2019/003585 WO2019190198A1 (ko) 2018-03-27 2019-03-27 가이드 rna 및 엔도뉴클레아제를 유효성분으로 포함하는 암 치료용 약학적 조성물

Country Status (5)

Country Link
US (1) US11865164B2 (ko)
KR (3) KR102023577B1 (ko)
CN (1) CN111989113B (ko)
TW (2) TWI723363B (ko)
WO (1) WO2019190198A1 (ko)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11491208B2 (en) 2018-03-27 2022-11-08 Gflas Life Sciences, Inc. Sequence-specific in vivo cell targeting
JP2023517992A (ja) * 2020-03-12 2023-04-27 インスティチュート フォー ベーシック サイエンス ゲノム配列変異を有する細胞死滅誘導用組成物及び該組成物を用いた細胞死滅誘導方法

Families Citing this family (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11865164B2 (en) * 2018-03-27 2024-01-09 G+Flas Life Sciences Pharmaceutical composition for treating cancer, containing guide RNA and endonuclease as active ingredients
KR102200330B1 (ko) 2020-02-20 2021-01-08 한국생명공학연구원 Cas10/Csm4 서브 복합체를 이용한 사이클릭 뉴클레오타이드 제조방법
KR20220059913A (ko) 2020-11-03 2022-05-10 한국생명공학연구원 유전자 교정을 이용한 조로증 및 자연노화의 예방 또는 치료용 조성물
KR102616916B1 (ko) * 2021-05-11 2023-12-21 주식회사 애이마 발암성 돌연변이 유전자 검출용 가이드 rna 내지 이의 용도
WO2023086670A2 (en) * 2021-11-15 2023-05-19 The Trustees Of Princeton University Screening of cas nucleases for altered nuclease activity

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20160186152A1 (en) * 2011-12-30 2016-06-30 Caribou Biosciences, Inc. Modified cascade ribonucleoproteins and uses thereof
US20170114413A1 (en) * 2015-10-27 2017-04-27 The Broad Institute Inc. Compositions and methods for targeting cancer-specific sequence variations
US20170145405A1 (en) * 2015-11-25 2017-05-25 The Board Of Trustees Of The Leland Stanford Junior University Crispr/cas-mediated genome editing to treat egfr-mutant lung cancer
WO2018009525A1 (en) * 2016-07-05 2018-01-11 The Johnson Hopkins University Crispr/cas9-based compositions and methods for treating cancer

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN115537396A (zh) 2015-03-27 2022-12-30 哈佛学院校长同事会 经过修饰的t细胞及其制备和使用方法
US20170247690A1 (en) 2016-02-25 2017-08-31 Agenovir Corporation Oncoviral treatment with nuclease and chemotherapeutic
WO2018034554A1 (ko) 2016-08-19 2018-02-22 주식회사 툴젠 인위적으로 조작된 신생혈관형성 조절 시스템
US11865164B2 (en) * 2018-03-27 2024-01-09 G+Flas Life Sciences Pharmaceutical composition for treating cancer, containing guide RNA and endonuclease as active ingredients

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20160186152A1 (en) * 2011-12-30 2016-06-30 Caribou Biosciences, Inc. Modified cascade ribonucleoproteins and uses thereof
US20170114413A1 (en) * 2015-10-27 2017-04-27 The Broad Institute Inc. Compositions and methods for targeting cancer-specific sequence variations
US20170145405A1 (en) * 2015-11-25 2017-05-25 The Board Of Trustees Of The Leland Stanford Junior University Crispr/cas-mediated genome editing to treat egfr-mutant lung cancer
WO2018009525A1 (en) * 2016-07-05 2018-01-11 The Johnson Hopkins University Crispr/cas9-based compositions and methods for treating cancer

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
KOO, TAEYOUNG ET AL.: "Selective disruption of an oncogenic mutant allele by CRISPR/Cas9 induces efficient tumor regression", NUCLEIC ACIDS RESEARCH, vol. 45, no. 13, 31 May 2017 (2017-05-31) - 27 July 2017 (2017-07-27), pages 7897 - 7908, XP055639539 *
LEE, EUNA: "G+FLAS Challenges Anti-Cancer Drug Based on 'CRISPR PLUS' Technology", BIOSPECTATOR, 16 August 2018 (2018-08-16), pages 1 - 4, XP055639578, Retrieved from the Internet <URL:http://www.biospectator.com/view/news_view.php?varAtcId=6019> *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11491208B2 (en) 2018-03-27 2022-11-08 Gflas Life Sciences, Inc. Sequence-specific in vivo cell targeting
JP2023517992A (ja) * 2020-03-12 2023-04-27 インスティチュート フォー ベーシック サイエンス ゲノム配列変異を有する細胞死滅誘導用組成物及び該組成物を用いた細胞死滅誘導方法

Also Published As

Publication number Publication date
CN111989113B (zh) 2024-07-12
TWI723363B (zh) 2021-04-01
CN111989113A (zh) 2020-11-24
TW201946648A (zh) 2019-12-16
TW202126325A (zh) 2021-07-16
KR102302679B1 (ko) 2021-09-16
KR20210114904A (ko) 2021-09-24
KR20190113687A (ko) 2019-10-08
KR102023577B1 (ko) 2019-09-24
US20210128697A1 (en) 2021-05-06
US11865164B2 (en) 2024-01-09

Similar Documents

Publication Publication Date Title
WO2019190198A1 (ko) 가이드 rna 및 엔도뉴클레아제를 유효성분으로 포함하는 암 치료용 약학적 조성물
EP3464323B1 (en) Peptides and nanoparticles for intracellular delivery of genome-editing molecules
EP3781196B1 (en) Sequence-specific in vivo cell targeting
CA3039733A1 (en) Compositions and methods for the treatment of myotonic dystrophy
US11939575B2 (en) Modified tracrRNAs gRNAs, and uses thereof
WO2020146290A1 (en) A non-toxic cas9 enzyme and application thereof
KR20240040112A (ko) 방법
CN110577969B (zh) CRISPR/Sa-SlugCas9基因编辑系统及其应用
KR20200135225A (ko) 단일염기 치환 단백질 및 이를 포함하는 조성물
WO2019181305A1 (ja) ｓｎｏＲＮＡの発現抑制剤を有効成分とするがん増殖抑制剤
CN110551763B (zh) CRISPR/SlutCas9基因编辑系统及其应用
Reza et al. Triplex-mediated genome targeting and editing
EP2739738B1 (en) Use of integrase for targeted gene expression
WO2022152266A1 (zh) 用于基因编辑的组合物及其应用
JP7422128B2 (ja) 配列特異的なインビボ細胞標的化
US20240158793A1 (en) Repressor proteins for gene regulation and crispr interference
CA3211564A1 (en) Strategies for knock-ins at c3 safe harbor sites
CN113521310A (zh) 一种杀伤基因突变肿瘤细胞药物及其制备方法和应用
WO2023245010A2 (en) Crispr-transposon systems for dna modification
Glode The molecular bridge to gene therapy

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 19777055

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 19777055

Country of ref document: EP

Kind code of ref document: A1