WO2019140909A1

WO2019140909A1 - Preparation and application of bio-nano-magnetic bead based on silicon-based peptide

Info

Publication number: WO2019140909A1
Application number: PCT/CN2018/102324
Authority: WO
Inventors: 张金菊; 王红光
Original assignee: 北京国科融智生物技术有限公司
Priority date: 2018-01-22
Filing date: 2018-08-24
Publication date: 2019-07-25
Also published as: CN108165545A; CN108165545B

Abstract

A preparation method of a bio-nano-magnetic bead based on a silicon-based polypeptide comprises the following steps: step S10, constructing a deletion mutant strain of a bacterial magnetic particle membrane protein gene mamC or mamF, i.e., a primary recombinant strain; step S20, constructing a gene fusion expression vector of a silicon-based polypeptide and the bacterial magnetic particle membrane protein MamC or MamF; the obtained expression vector is introduced into the primary recombinant strain and a secondary recombinant strain expressing the silicon-based polypeptide is screened; step S30, fermenting the secondary recombinant strain in order to produce a bio-nano-magnetic bead expressing and exhibiting the silicon-based polypeptide; step S40, using the bio-nano-magnetic bead exhibiting the silicon-based polypeptide as seed material to perform silicon-based modification and silicon oxide precipitation on the surface of the bio-nano-magnetic bead, thereby obtaining a novel bio-nano-magnetic bead having a silicon oxide shell and a surface polypeptide; the silicon-based polypeptide is a silaffins polypeptide.

Description

Preparation and application of bio-nano magnetic beads based on silicon-based peptide

Technical field

The invention belongs to the field of nano materials and biotechnology, and in particular relates to the preparation and application of a bio-nano magnetic bead based on a silicon-based polypeptide.

Background technique

Bio-nano magnetic beads are magnetic nano-materials produced by microbial bacteria, also known as bacterial magnetic particles. The inner core is Fe ₃ O ₄ crystal, which is covered with a layer of phospholipid biofilm coated with a particle size of 30-120 nm. The bio-nanomagnetic beads produced by the same microbial bacteria have very uniform particle size and crystal form, the same magnetic properties, natural biofilm coating, and good water-soluble and colloidal properties. In addition, the bacterial magnetic particles are a source of microbial preparation and therefore have good biocompatibility. The surface of the bio-nanomagnetic beads has a large number of functional groups, which can be linked to different functional macromolecules, such as antibodies, proteins, organic macromolecules, etc. through chemical modification and bifunctional coupling agents, thereby having different special functions. The most unique feature of bacterial magnetic particles is that they can directly express specific protein and polypeptide molecules on the surface membrane by genetic engineering, and directly obtain functional biological nano magnetic beads with special biological activities.

Biomineralization is a process in which an organism converts surrounding inorganic mineral ions into solid minerals under specific conditions and under certain physical and chemical conditions, depending on the control or influence of biological system reactions. This process is dynamic and controlled, and bio-nano magnetic beads are A very obvious example. The research on nano-silica is one of the hotspots of nanomaterial research. The preparation of nano-SiO ₂ silicon-based materials by pure chemical synthesis method requires strict control of reaction conditions and requires certain conditions such as temperature, pressure and pH. Algae, hi-silicon plants, etc. can synthesize refined silicon nanostructures under normal temperature and pressure, and the mechanism is the research focus of bionic silicification. For example, a small molecule of silicon affinity protein (Silaffins) in diatom cell wall is closely related to silicon deposition. In vitro experiments have shown that Silaffin polypeptide fragments can regulate the synthesis of spherical nano-SiO ₂ under normal temperature and pressure in the presence of phosphate.

technical problem

The silicidation modification of the magnetic beads and the deposition of the silicon oxide layer are a very important modification and treatment of the magnetic beads, and are an extension of the application value of the magnetic beads. Conventional silica coating and silication modification are mostly by chemical co-precipitation, which is difficult to control the final morphology of silicon oxide nanomaterials.

Technical solution

In view of the above problems, the present invention utilizes a biomimetic synthesis application based on biomolecules as a template for the biomimetic synthesis of silicon oxide nanomaterials mediated by polypeptide molecules in the design and manufacture of nanomaterials. The bio-nanomagnetic beads with good silicidation properties are obtained by performing siliconization modification and silica shell deposition on the surface of the bio-nanomagnetic beads by biomimetic silicon mineralization in vitro.

A first aspect of the present invention provides a method for preparing a bio-nanomagnetic bead based on a silicon-based polypeptide, comprising the following steps:

S10, constructing a deletion mutant strain of a bacterial magnetic particle membrane protein gene mamC or mamF, that is, a primary recombinant strain;

S20, constructing a gene fusion expression vector of a silicon-based polypeptide and a bacterial magnetic particle membrane protein MamC or MamF; the obtained expression vector is introduced into a primary recombinant strain, and a secondary recombinant strain expressing a silicon-based polypeptide is screened;

S30, producing a bio-nano magnetic bead expressing a silicon-based polypeptide by fermenting a secondary recombinant strain;

S40, using a bio-nano magnetic bead exhibiting a silicon-based polypeptide as a seed material, performing silication modification and silicon oxide precipitation on the surface of the bio-nano magnetic bead to obtain a bio-nano magnetic bead modified by silicon deposition or silicidation;

The silicon-based polypeptide is a silaffins polypeptide;

Preferably, the silaffins polypeptide is one or more of YR-SiP1, YR-SiP2, and YR-SiP3.

The sequence of YR-SiP1 is: GAGAGSGAGAGSKKKKRHKKKKRHKKKKRHKKKKK;

The sequence of YR-SiP2 is: GAGAGSGAGAGSEEEETAEEEEDAEEEEDEAKEEEEEEEE;

The sequence of YR-SiP3 is: GAGAGSGAGAGSGAGAGSSSKKSGSYSGSKGSKRRILGAGAGSSSKKSGGSGSKSKRIL.

Preferably, the gene sequence of the YR-SiP1, YR-SiP2 or YR-SiP3 is as follows:

YR-SiP1: 5-GGTGCCGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAAAGAAGAAGAAGCGGCACAAGAAGAAGAAGCGGCACAAGAAAAAGAAGCGGCACAAGAAGAAGAAGAAA-3,

YR-SiP2:5-GGTGCCGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGAGGAGGAAGAAACTGCAGAGGAAGAAGAAGATGCAGAGGAAGAAGAGGACGAGGAAGCTAAGGAGGAGGAGGAAGAGGAAGAAGAA-3

YR-SiP3: one of 5-GGTGCCGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCATCCTCTAAGAAAAGCGGCAGTTACAGCGGCTCTAAGGGCAGTAAAAGGAGGATCCTGGGTGCTGGTGCTGGTTCATCCTCTAAGAAAAGCGGCAGTTACAGCGGCTCTAAGGGCAGTAAAAGGAGGATCCTG-3.

Preferably, the step S10 comprises:

Two pairs of primers were designed to amplify the homologous DNA fragment of about 500bp on both sides of mamC or mamF gene, and a phage-based microcarrier sequence AAV-del-mamC or AAV-del-mamF was constructed by molecular cloning;

AAV-del-mamC or AAV-del-mamF obtains a sufficient amount of nucleic acid sequence product by plasmid extraction and digestion step, and the concentration is adjusted to 2 mg/mL, and is simultaneously transferred into the MSR-I wild-type strain by electroporation. Conversion scheme: square wave electric pulse, voltage 3100V-3200V, electric pulse time is 3.1-3.3ms, electric pulse number is 1-2 times;

After electroporation, the strain was screened for the double-exchange mutant strain by sucrose and antibiotic gentamicin gradient concentration. After verification by sequencing technology, the recombinant strain with mamC or mamC deletion mutation, ie, the primary recombinant strain MSRI-dC or MSRI-dF, was obtained.

Preferably, the 20 steps include:

The YR-SiP1, YR-SiP2 or YR-SiP3 gene sequence is prepared by DNA synthesis, and the expression gene sequence and part of the mamC gene are fused by linker to obtain pmamC-Sip1, pmamC-Sip2 or pmamC-Sip3 Fusion gene fragment;

The pmamC-Sip1, pmamC-Sip2 or pmamC-Sip3 were cloned into the expression vector pBRC, respectively, to obtain the expression plasmid pBRC-pmamC-Sip1, pBRC-pmamC-Sip2 or pBRC-pmamC-Sip3;

Transfer pBRC-pmamC-Sip1, pBRC-pmamC-Sip2 or pBRC-pmamC-Sip3 into the primary recombinant strain MSRI-dC by means of three-parent ligation or electrotransformation, and verify that the recombinant strain expressing the polypeptide is obtained correctly. Recombinant strains.

Further preferably, the amino acid sequence corresponding to the Linker is (GGASVGALAGSLIGAL) *n , n Preferably 3-5;

Preferably, the step S30 includes:

After the secondary recombinant strain expressing SiP1, SiP2 or SiP3 is transferred and fermented, the magnetic device collects the bacterial cells, washes the phosphate buffer solution, and breaks the bacterial cells to extract and purify the biological nano magnetic beads.

Further preferably, the conditions of the fermentation culture are:

Pre-culture of 200-500 mL medium through a triangular flask, 5%-10% O ₂ content, culture time 16 hours, culture temperature 37 ° C;

Transfer the pre-cultured strain to the fermenter for deep culture, 5%-10% O ₂ , 1%-3% H ₂ , 87%-94% N ₂ , culture time 3-4 days, culture temperature 37 ° C .

Preferably, the step S40 comprises the following steps:

The bio-nano magnetic beads exhibiting the silicon-based polypeptide are dissolved in a phosphate buffer, ultrasonically reacted, and continuously stirred;

Pre-configured a certain amount of TEOS dissolved in hydrochloric acid, stirred and hydrolyzed to prepare fresh ortho silicic acid;

The fresh orthosilicate solution and the APMS solution are added dropwise to the bio-nanomagnetic bead phosphate solution exhibiting the silicon-based polypeptide, and the sample is oscillated;

The magnetic beads are collected and washed with deionized water to remove unreacted silicic acid and phosphate, that is, bio-nanomagnetic beads modified by silicon deposition or silicidation.

A second aspect of the invention provides a magnetic bead prepared by the method of the first aspect.

A third aspect of the invention provides the use of the magnetic beads prepared by the method of the first aspect for adsorbing nucleic acids.

Beneficial effect

The silicon-based deposition bio-nano magnetic beads obtained by preparing the silicon-based polypeptide-based bio-nano magnetic beads of the invention have high deposition of silicon-based reagents, SiO _{2 is} mostly spherical, the shell layer is round and smooth, and the encapsulation rate is high. The surface after coating is smooth, there is no agglomeration, the silicon shell structure is uniform, and the particle size distribution is concentrated. The adsorption amount of total nucleic acid and HBV nucleic acid of Saccharomyces cerevisiae is large and the specificity is strong.

DRAWINGS

1 is a particle size distribution diagram of a silica shell after inductive silicidation deposition in Example 6;

2 is a particle size distribution diagram of a silica shell after inducing silicidation deposition in Example 5;

3 is a particle size distribution diagram of a silica shell after inducing silicidation deposition in Example 1;

4 is a particle size distribution diagram of a silica shell after inducing silicidation deposition in Example 7;

5 is a particle size distribution diagram of a silica shell after inducing silication deposition in Example 8;

6 is a particle size distribution diagram of a silica shell after inducing silication deposition in Example 9;

Embodiments of the invention

The embodiments of the present invention are described in detail below with reference to the accompanying drawings. Those who do not specify the specific conditions in the examples are carried out according to the conventional conditions or the conditions recommended by the manufacturer. The reagents or instruments used are not indicated by the manufacturer, and are conventional products that can be obtained commercially.

Example 1

A method for preparing a bio-nano magnetic bead based on a silicon-based polypeptide, the preparation method comprising the following steps:

S10, constructing a deletion mutant strain of the bacterial magnetic particle membrane protein gene mamC, that is, a primary recombinant strain, and the specific method comprises the following steps:

1. Design two pairs of primers to amplify a homologous DNA fragment of about 500 bp on both sides of the mamC gene, and construct a phage-based microcarrier sequence AAV-del-mamC by molecular cloning;

2. AAV-del-mamC obtains a sufficient amount of nucleic acid sequence product by plasmid extraction and restriction enzyme digestion, and the concentration is adjusted to 2 mg/mL, and is simultaneously transferred into the MSR-I wild type strain by electroporation, and the electroporation scheme is: Square wave electric pulse, voltage 3100V, electric pulse time is 3.1ms, electric pulse number is 1 time;

3. After electroporation, the strain was screened for the double-exchange mutant strain by sucrose and antibiotic gentamicin gradient concentration. After sequencing by other techniques, the recombinant strain with mamC deletion mutation, ie the primary recombinant strain MSRI-dC, was obtained.

S20, a gene fusion expression vector for constructing a silicon-based polypeptide YP-SiP1 and a bacterial magnetic particle membrane protein MamC:

1. The expression gene sequence of the silicon-based polypeptide is prepared by DNA synthesis, and the expression gene sequence and part of the mamC gene are fused by a linker to obtain a pmamC-Sip1 fusion gene fragment;

2, the amino acid sequence corresponding to Linker is (GGASVGALAGSLIGAL)*n, n=3;

3, pmamC-Sip1 was cloned into the expression vector pBRC to obtain the expression plasmid pBRC-pmamC-Sip1;

4. Transfer pBRC-pmamC-Sip1 into the primary recombinant strain MSRI-dC by means of three-parent ligation or electrotransformation, and verify that the recombinant strain expressing the polypeptide, ie the secondary recombinant strain, is obtained, and is named: MSRI-dC /Sip1;

1. Pre-culture through a triangular flask, the culture condition is micro-aerobic, 5%% O ₂ content, culture time 16 hours, culture temperature 37 ° C;

The O ₂ content used in this example was 5%. The O ₂ content can also be between 5% and 10%.

2. Transfer the pre-cultured strain to the fermenter for deep culture. The culture conditions are micro-aerobic plus hydrogen, 5% O ₂ +1% H ₂ +94% N ₂ , culture time 3-4 days, culture temperature 37 ° C;

3. The deep culture directly pulverizes the bacteria through a homogeneous homogenization stirring device, and the functionalized magnetic particles are adsorbed by a magnetic device;

The preculture medium is LB medium, and the basal medium for deep culture is Chad medium;

S40, using a bio-nano magnetic bead exhibiting a silicon-based polypeptide as a seed, grafting with tetraethyl orthosilicate (TEOS) and 3-aminopropyltrimethoxysilane (APMS) to form a silicon oxide shell structure, and obtaining a novel silicon Base bio-nano beads:

1. Bio-nano magnetic beads based on silicon-based polypeptides, as nano-material seeds, 150 mg magnetic particles are dissolved in a phosphate buffer solution of 1 mM concentration, preferably 2 mM; ultrasonic treatment for 10 min, ultrasonic power is preferably 35 W, working time is 4s, working interval 10s, then stirring at room temperature for 6 hours;

The concentration selected in this embodiment is preferably 2 mM. It can also be 1-5 mM. The ultrasonic power of this embodiment is preferably 35 W, the working time is 4 s, and the working interval is 10 s. It is also possible that the ultrasonic power is preferably 35-50 W, the working time is 4-6 s, and the working interval is 10-12 s.

2. Magnetic adsorption, washing, purification of magnetic beads, resuspension in 250 mL phosphate buffer solution, stirring reaction;

3. Prepare TEOS with a concentration of 600 mM, take 20 mL, add 200 mL of hydrochloric acid with a concentration of 1-3 Mm dropwise, stir for 30 minutes, and prepare fresh orthosilicate by hydrolysis reaction.

4. Prepare an APMS solution with a concentration of 100 Mm, take 25 mL of APMS solution and 75 mL of fresh orthosilicate solution, and add dropwise to a reaction flask containing 250 ml of phosphate buffer to resuspend the bio-nano magnetic beads, shake at 200 rpm for 48 hours;

5, magnetic separation and purification of magnetic beads, washed with deionized water 3 times, remove unreacted silicic acid and phosphate, that is, silicon deposition bio-nano magnetic beads, prepared silicon-based bio-nano magnetic beads stored in 20% ethanol solution in.

Example 2

The difference from Example 1 is that S10 constructs a deletion mutant strain of the bacterial magnetic particle membrane protein gene mamF.

The results show that the prepared silicon-based bio-nanomagnetic beads SiO _{2 are} mostly spherical, the shell layer is round and smooth, the encapsulation rate is high, the surface after coating is smooth, there is no agglomeration phenomenon, the silicon shell structure is uniform, and the particle size distribution is concentrated.

Example 3

The difference from Example 1 is that the expression polypeptide is YR-SiP2.

Example 4

The difference from Example 1 is that the expression polypeptide is YR-SiP3.

The results show that the prepared silicon-based bio-nanomagnetic beads SiO2 are mostly spherical, the shell layer is round and smooth, the encapsulation rate is high, the surface after coating is smooth, there is no agglomeration phenomenon, the silicon shell structure is uniform, and the particle size distribution is concentrated.

Example 5

The difference from Embodiment 1 is that

In the amino acid sequence (GGASVGALAGSLIGAL)*n corresponding to Linker, n=2.

Example 6

The difference from Embodiment 1 is that

In the amino acid sequence (GGASVGALAGSLIGAL)*n corresponding to Linker, n=1.

Example 7

The difference from Embodiment 1 is that

In the amino acid sequence (GGASVGALAGSLIGAL)*n corresponding to Linker, n=4.

Example 8

The difference from Embodiment 1 is that

In the amino acid sequence (GGASVGALAGSLIGAL)*n corresponding to Linker, n=5.

Example 9

The difference from Embodiment 1 is that

In the amino acid sequence (GGASVGALAGSLIGAL)*n corresponding to Linker, n=6.

Example 10

The difference from Embodiment 1 is that in the electrotransformation scheme, the voltage is 3200 V, the electric pulse time is 3.3 ms, and the number of electric pulses is 2 times.

Example 11

The difference from Example 1 is that in the deep culture of S30, the culture condition is 10% O ₂ + 3% H ₂ + 87% N ₂ , the culture time is 3-4 days, and the culture temperature is 37 °C.

Comparative Example 1

The difference from Example 1 is that in the deep culture of S30, the culture conditions are 15% O ₂ + 85% N ₂ , the culture time is 3-4 days, and the culture temperature is 37 °C.

Comparative Example 2

The difference from Example 1 is that in the deep culture of S30, the culture conditions are 5% O ₂ + 95% N ₂ , the culture time is 3-4 days, and the culture temperature is 37 °C.

Comparative Example 3

The difference from Example 1 is that the electrotransformation scheme in the deletion mutant strain of S10 constructing the bacterial magnetic particle membrane protein gene mamC is: square wave electric pulse, voltage 3000V, electric pulse time is 5.1 ms, electric pulse number is 4 times.

Comparative Example 4

The difference from Example 1 is that the electrotransformation scheme in the mutant strain of S10 constructing the bacterial magnetic particle membrane protein gene mamC is: square wave electric pulse, voltage 3300V, electric pulse time is 3.0ms, electric pulse number is 2 times.

Experimental example 1

This experimental example examines the effect of the electrotransformation protocol in Example 1, Example 10 and Comparative Example 3-4 on the efficiency of the S10 constructing mutant mutant strain of the bacterial magnetic particle membrane protein gene mamC.

The number of bacteria was converted into 107 bacteria per time, and 1 μg of DNA (about 5 kbp in size) was transformed as a standard experiment, and the bacterial survival rate, DNA transformation expression success rate and the electroporation expression in Example 1 and Comparative Example 3-5 were examined. The CFU of the plate was coated with the dilution solution, and the results are shown in Table 1.

Table 1 Effect of electroporation protocol on the efficiency of constructing mutant strains of mamC

Electric conversion scheme	Bacterial survival rate%	DNA conversion expression success rate%	CFU of 10-fold dilution coated plate
Example 1	62	35	320
Example 10	65	31	310
Comparative Example 3	39	27	140
Comparative Example 4	47	twenty three	175

The results showed that the bacterial survival rate, the DNA transformation expression success rate, and the CFU of the 10-fold dilution coated plate of Example 1 and Example 10 were significantly better than those of Comparative Example 3-4 (P < 0.05).

Experimental Example 2

This example examines the influence of the gas introduced into the deep culture of S30 in Example 1, Example 11 and Comparative Example 1-2 on the bead yield. The deep culture directly pulverizes the cells through a homogenized homogenate agitation device, and the functionalized magnetic particles are adsorbed by a magnetic device. Then weigh. The relative value of the magnetic bead yield was calculated by taking the yield of Example 1 as 1. The results are shown in Table 2.

Table 2 Effect of ventilation scheme on the production of magnetic beads

Ventilation plan	Magnetic beads relative production
Example 1	1.0
Example 11	1.1
Comparative Example 1	0.68
Comparative Example 2	0.53

The results showed that the effect of ventilation protocol on the yield of magnetic beads was statistically significant (P<0.05). The aeration culture protocol of Example 1 was significantly improved over the control bead yield.

Experimental Example 3

The bio-nanomagnetic beads showing the polypeptide YR-SiP1 obtained in Example 1 and Examples 5-9 were used as experimental groups, and the nano-magnetic beads of the same size and size which did not express the polypeptide YR-SiP1 were used as the control one to express the polypeptide YR. -BiP1 bio-nanomagnetic beads The same concentration of the same size and size of the nano-magnetic beads and the free polypeptide YR-SiP1 which do not express the polypeptide YR-SiP1 are the control two, and the silicon-based deposition is induced by the method of S40 in the first embodiment. .

The prepared silicon-based bio-nanomagnetic beads were sample, dispersed in ethanol, and then dropped on a copper mesh covering the carbon film, and dried at room temperature, and the size of the sample was observed under a transmission electron microscope. The sample was dispersed in ethanol, then dropped on a silicon wafer, dried at room temperature, and the morphology was observed by a field emission scanning electron microscope after gold spraying. The results are shown in Table 3. The morphology of the product was observed and the particle size distribution of the silica shell was counted. The results are shown in Figures 1-5.

The results show that the control 1 directly uses nano-magnetic beads as the core to carry out SiO ₂ precipitation. SiO _{2 is} mostly non-spherical indefinite shape, the encapsulation rate of nano-magnetic beads is very low, the surface after coating is rough, and there is agglomeration between particles. Phenomenon, the size distribution is not uniform, and the particle size distribution is very dispersed. The free polypeptide YR-SiP1 in Control 2 can help SiO2 precipitation, but many SiO ₂ shells do not have nano-magnetic beads. The product has lower specific saturation magnetization, SiO ₂ shell thickness is not uniform, and the size is not easy to control.

The condensation of ethyl tetrasilicate in the alcohol-water system by the sol-gel method is the most common method for preparing SiO ₂ particles (Stöber method), but since the conventional magnetic liquid is basically oil-soluble, the Stöber method is difficult to use. The silicon dioxide is coated on the outside of the magnetic material.

Table 3 morphological observation

	Granule	surface	Reunion phenomenon
Example 6	Amorphous	Rough	Have
Example 5	Amorphous	Rough	Have
Example 1	spherical	smooth	no
Example 7	spherical	smooth	no
Example 8	spherical	smooth	no
Example 9	spherical	smooth	no
Control one	Amorphous	Rough	Have
Control two	Amorphous	Rough	Have

Experimental example four magnetic properties

The bio-nanomagnetic beads showing the polypeptide YR-SiP1 obtained in Example 1 and Examples 5-9 were used as experimental groups, and the nano-magnetic beads of the same size and size which did not express the polypeptide YR-SiP1 were used as the control one to display the polypeptide YR. -BiP1 bio-nanomagnetic beads The same concentration of the same size and size of the nano-magnetic beads and the free polypeptide YR-SiP1 which do not express the polypeptide YR-SiP1 are the control two, and the silicon-based deposition is induced by the method of S40 in the first embodiment. .

U.S. Quantum's model6000 vibrating sample magnetometer (VSM) measures the magnetic properties of the sample at a temperature of 300K. Draw a saturation magnetization curve and calculate the specific saturation magnetization.

Table 4 Magnetic properties

	Specific saturation magnetization A• m2/kg
Example 6	15
Example 5	20
Example 1	40
Example 7	45
Example 8	39
Example 9	30
Control one	10
Control two	10

It is further proved that the control SiO _{2 is} mostly non-spherical indefinite morphology, and the encapsulation rate of the nano magnetic beads is very low. The free polypeptide YR-SiP1 in the control two can help the SiO ₂ precipitation, but many SiO ₂ shells do not have nanometers. Magnetic beads, the product has a lower specific saturation magnetization. The SiO ₂ precipitates of Examples 6 and 5 were spherical but the encapsulation ratio of the nanomagnetic beads was also low; the SiO ₂ precipitate of Example 9 was excessively precipitated, and the proportion of the magnetic substance was decreased, resulting in a lower specific saturation magnetization. In the present invention, the linker fuses a silicon-based polypeptide, and the effect thereof is to efficiently induce deposition or grafting of a silicon-based reagent.

Experimental Example 5 Adsorption of Nucleic Acids

The bio-nanomagnetic beads exhibiting the polypeptide YR-SiP1 obtained in Example 7 were used as an experimental group, and the nano-magnetic beads of the same size and size not expressing the polypeptide YR-SiP1 were obtained in the same concentration ratio as the bio-nano magnetic beads exhibiting the polypeptide YR-SiP1. For the control three, the silicon-based deposition was induced by referring to the method of S40 in Example 1, and the obtained magnetic beads were used to adsorb the total nucleic acid of the Saccharomyces cerevisiae, and the concentration purity of the nucleic acid after adsorption and desorption was measured by an ultraviolet spectrophotometer. The amount of nucleic acid saturated adsorption was as shown in Table 5.

Table 5 adsorption of S. cerevisiae nucleic acid properties

	Nucleic acid saturation adsorption amount ug/mg	Adsorbed nucleic acid purity%
Example 7	25	95
Control three	16	70

The amount, purity and washing effect of the combined nucleic acid are better than those of ordinary silicon-based magnetic beads. The results of extraction nucleic acid electrophoresis show that the nucleic acid extracted by the bio-nano magnetic beads has better integrity and less degradation.

The same method was used to adsorb HBV nucleic acid, and the serum of hepatitis B patients was used as experimental materials. The results are shown in Table 6.

Table 6 adsorption of HBV nucleic acid properties

	Positive rate%
Example 7	95
Control three	65

Although specific embodiments of the invention have been described in detail, those skilled in the art will understand. Various modifications and alterations of the details are possible in light of the teachings of the invention. The full scope of the invention is given by the appended claims and any equivalents thereof.

Claims

A method for preparing a biological nano magnetic bead based on a silicon-based polypeptide, comprising the steps of:

S10, constructing a deletion mutant strain of a bacterial magnetic particle membrane protein gene mamC or mamF, that is, a primary recombinant strain;

S20, constructing a gene fusion expression vector of a silicon-based polypeptide and a bacterial magnetic particle membrane protein MamC or MamF; the obtained expression vector is introduced into a primary recombinant strain, and a secondary recombinant strain expressing a silicon-based polypeptide is screened;

S30, producing a bio-nano magnetic bead expressing a silicon-based polypeptide by fermenting a secondary recombinant strain;

S40, using a bio-nano magnetic bead exhibiting a silicon-based polypeptide as a seed material, performing silication modification and silicon oxide precipitation on the surface of the bio-nano magnetic bead to obtain a bio-nano magnetic bead modified by silicon deposition or silicidation;

The silicon-based polypeptide is a silaffins polypeptide.
The preparation method according to claim 1, wherein the silaffins polypeptide is one of YR-SiP1, YR-SiP2, and YR-SiP3;

The sequence of YR-SiP1 is: GAGAGSGAGAGSKKKKRHKKKKRHKKKKRHKKKKK;

The sequence of YR-SiP2 is: GAGAGSGAGAGSEEEETAEEEEDAEEEEDEAKEEEEEEEE;

The sequence of YR-SiP3 is: GAGAGSGAGAGSGAGAGSSSKKSGSYSGSKGSKRRILGAGAGSSSKKSGGSGSKSKRIL.
The preparation method according to claim 1, wherein the gene sequence of the YR-SiP1, YR-SiP2 or YR-SiP3 is as follows:

YR-SiP1: 5-GGTGCCGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAAAGAAGAAGAAGCGGCACAAGAAGAAGAAGCGGCACAAGAAAAAGAAGCGGCACAAGAAGAAGAAGAAA-3,

YR-SiP2: 5-GGTGCCGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGAGGAGGAAGAAACTGCAGAGGAAGAAGAAGATGCAGAGGAAGAAGAGGACGAGGAAGCTAAGGAGGAGGAGGAAGAGGAAGAAGAA-3,

YR-SiP3: one of 5-GGTGCCGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCATCCTCTAAGAAAAGCGGCAGTTACAGCGGCTCTAAGGGCAGTAAAAGGAGGATCCTGGGTGCTGGTGCTGGTTCATCCTCTAAGAAAAGCGGCAGTTACAGCGGCTCTAAGGGCAGTAAAAGGAGGATCCTG-3.
The preparation method according to claim 1, wherein the step S10 comprises:

Two pairs of primers were designed; the primers amplify a homologous DNA fragment of about 500 bp on both sides of the mamC or mamF gene, and construct a phage-based microcarrier sequence AAV-del-mamC or AAV-del-mamF by molecular cloning;

AAV-del-mamC or AAV-del-mamF obtains a sufficient amount of nucleic acid sequence product by plasmid extraction and digestion step, and the concentration is adjusted to 2 mg/mL, and is simultaneously transferred into the MSR-I wild-type strain by electroporation. Conversion scheme: square wave electric pulse, voltage 3100V-3200V, electric pulse time is 3.1-3.3ms, electric pulse number is 1-2 times;

After electroporation, the strain was screened for the double-exchange mutant strain by sucrose and antibiotic gentamicin gradient concentration. After verification by sequencing technology, the recombinant strain with mamC or mamF deletion mutation, ie, the primary recombinant strain MSRI-dC or MSRI-dF, was obtained.
The preparation method according to claim 1, wherein the 20 steps comprise:

The YR-SiP1, YR-SiP2 or YR-SiP3 gene sequence is prepared by DNA synthesis, and the expression gene sequence and part of the mamC gene are fused by linker to obtain pmamC-Sip1, pmamC-Sip2 or pmamC-Sip3 Fusion gene fragment;

The pmamC-Sip1, pmamC-Sip2 or pmamC-Sip3 were cloned into the expression vector pBRC, respectively, to obtain the expression plasmid pBRC-pmamC-Sip1, pBRC-pmamC-Sip2 or pBRC-pmamC-Sip3;

pBRC-pmamC-Sip1, pBRC-pmamC-Sip2 or pBRC- by means of triple parental ligation or electrotransformation pmamC-Sip3 was transferred into the primary recombinant strain MSRI-dC, and the recombinant strain expressing the polypeptide, ie, the secondary recombinant strain, was obtained after verification.
The preparation method according to claim 5, wherein the amino acid sequence corresponding to the Linker is (GGASVGALAGSLIGAL)*n, and n is preferably 3-5;
The preparation method according to claim 1, wherein the step S30 comprises:

After the secondary recombinant strain expressing YR-SiP1, YR-SiP1 or YR-SiP1 is transferred and fermented, the magnetic device collects the bacterial cells, washes the phosphate buffer solution, and breaks the bacterial cells to extract and purify the biological nano magnetic beads.
The preparation method according to claim 7, wherein the conditions of the fermentation culture are:

Pre-culture through a triangular flask, 5%-10% O2 content, culture time 16 hours, culture temperature 37 ° C;

The precultured strain was transferred to a fermenter for deep culture, 5%-10% O2, 1%-3% H2, 87%-94% N2, culture time 3-4 days, and culture temperature 37 °C.
The preparation method according to claim 1, wherein the step S40 comprises the following steps:

The bio-nano magnetic beads exhibiting the silicon-based polypeptide are dissolved in a phosphate buffer, ultrasonically reacted, and continuously stirred;

Pre-configuring a certain amount of TEOS dissolved in hydrochloric acid, stirring and hydrolyzing to prepare fresh ortho silicic acid;

The fresh orthosilicate solution and the APMS solution are added dropwise to the bio-nanomagnetic bead phosphate solution exhibiting the silicon-based polypeptide, and the sample is oscillated;

The magnetic beads are collected and washed with deionized water to remove unreacted silicic acid and phosphate, that is, bio-nanomagnetic beads modified by silicon deposition or silicidation.
Magnetic beads prepared by the method of any of claims 1-9 and their use in adsorbing nucleic acids.