WO2019140925A1

WO2019140925A1 - Bio-nano-magnetic bead for directional modification of peptide nucleic acid and mrna extraction application thereof

Info

Publication number: WO2019140925A1
Application number: PCT/CN2018/104208
Authority: WO
Inventors: 张金菊; 王红光
Original assignee: 北京国科融智生物技术有限公司
Priority date: 2018-01-22
Filing date: 2018-09-05
Publication date: 2019-07-25
Also published as: CN108203704A

Abstract

Disclosed is a bio-nano-magnetic bead for directional modification of peptide nucleic acid and an application thereof for enrichment purification and separation extraction of mRNA. The bio-nano-magnetic bead is formed by fusion expression of streptavidin (SA) and a membrane protein of a bacterial magnetic particle through a flexible linker polypeptide chain, in which the streptavidin (SA) is coupled to a biotin-marked peptide nucleic acid PNA probe.

Description

Bio-nanomagnetic bead for directional modification of peptide nucleic acid and its mRNA extraction application

Technical field

The invention relates to the field of functional nano magnetic beads preparation and biotechnology, and particularly relates to a biological nano magnetic beads for directional modification of peptide nucleic acids and an mRNA extraction application thereof.

Background technique

Bio-nanomagnetic beads are magnetic nanoparticles produced by magnetotactic bacteria, also known as bacterial magnetic particles. The inner core is Fe ₃ O ₄ crystal, which is coated with a layer of phospholipid biofilm and has a particle size of 30-120 nm. The bio-nanomagnetic beads produced by the same magnetotactic bacteria have the same particle size and crystal form, uniform magnetic properties, natural biofilm coating, good water solubility, colloidal properties and biocompatibility. . Bio-nanomagnetic beads have a large number of functional groups on the plasma membrane and membrane proteins, which can be linked to different functional macromolecules, such as antibodies, by chemical modification and bifunctional coupling agents, thus having different special functions. The most unique feature of bacterial magnetic particles is that they can express specific protein and polypeptide molecules on the surface membrane by genetic engineering methods, and become functional biological nano-magnetic beads with special biological activity.

Streptavidin (SA), also known as streptavidin, is a secreted protein of Streptomyces that binds specifically to biotin with higher performance and effect than avidin in egg white. The interaction in the affinity protein-biotin system is currently the strongest known non-covalent interaction and is more affinitive than the antigenic antibody. Therefore, the system can be used in the development of new technologies such as micro-detection and marker tracing, especially in immunolabeling, bioreactor cascade amplification, and affinity separation and purification. A streptavidin is a tetrameric protein consisting of four identical peptide chains, each of which binds to a biotin. Although it is a glycoprotein, it does not carry any glycosylation, an affinity protein with egg white. same. Under the action of proteolytic enzymes, the chain-affinity protein can be cleaved between N-terminal 10-12 and C-terminal 19-21, and the core-chain affinity protein formed still retains the ability to bind biotin.

Peptide nucleic acid (PNA), a class of DNA analogs that replace the sugar phosphate backbone with a polypeptide backbone, specifically a peptide chain amide 2-aminoethylglycine bond-substituted phosphodiester bond. Crucially, PNA can recognize and bind DNA or RNA sequences by base pairing to form a stable double helix. Because PNA has many advantages that nucleic acid molecules do not have, many applications have been found in the fields of biotechnology and medicine, such as nucleic acid molecule capture and enrichment, molecular probes, nucleic acid drug carriers, and the like. As the PNA patent protection gradually expires, the synthesis and application of PNA will usher in more opportunities.

technical problem

At present, the prior art discloses that a magnetic coupling is directly connected to a magnetic particle by using a coupling agent or a crosslinking agent, but the functional biological nano magnetic bead formed by the method is not strong enough and has low rigidity. Furthermore, the use of bio-nanomagnetic beads for the modification of peptide nucleic acids to extract mRN has not been disclosed in the prior art.

Technical solution

In order to solve the above problems existing in the prior art, the present invention discloses a method for expressing expression on a bio-nano magnetic bead membrane by genetic engineering using a large amount of functional groups on the surface of the bio-nanomagnetic beads and the membrane protein. A bio-nanomagnetic bead of a directionally modified peptide nucleic acid coupled with a streptavidin protein and a biotin-labeled poly-thymine PNA (poly T-PNA) and its mRNA extraction application.

The specific technical solutions of the present invention are as follows:

The present invention provides a bio-nanomagnetic bead oriented to modify a peptide nucleic acid, wherein the bio-nanomagnetic bead is expressed by a chain affinity protein SA by fusion of a flexible linker polypeptide chain with a membrane protein of a bacterial magnetic particle, wherein the chain The affinity protein SA is coupled to a biotinylated peptide nucleic acid PNA probe.

The bio-nano magnetic beads provided by the invention fuse the chain affinity protein SA through the flexible linker polypeptide chain, and the fusion structure is more firm, and the rigidity is enhanced compared with the existing protein fusion magnetic beads directly by coupling or other means, in addition, the chain The affinity protein SA is coupled with the biotin-labeled peptide nucleic acid PNA probe to efficiently capture and enrich the nucleic acid molecule, molecular probe, nucleic acid drug carrier, etc. through the biotin-labeled peptide nucleic acid PNA probe, so the magnetic beads can be widely used. Applied in the fields of biotechnology and medicine.

Further, the amino acid sequence of the flexible linker polypeptide chain is GASGLYWLGASAGGALSWLL GAASLYWSGL.

The flexible linker polypeptide chain can enhance the rigidity of magnetic beads and protein fusion, stabilize the spatial structure of the chain affinity protein SA and magnetic beads, and effectively overcome the technical problems of interaction between the magnetic bead membrane protein and the chain affinity protein SA.

Further, the gene sequence of the protein streptavidin and SA is 5-GCAGAAGCAGGCATCACTGGCACGTGGTATAACCAGCTGGGTTCCACGTTCATTGTAACTGCCGGCGCAGACGGTGCACTGACTGGTACGTACGAGTCCGCGGTGGGCAACGCAGAGAGCCGTTATGTTCTGACGGGCCGCTACGACTCTGCACCAGCTACGGATGGTTCCGGTACTGCTCTGGGTTGGACGGTGGCATGGAAGAACAACTACCGTAACGCACATTCTGCGACGACTTGGTCTGGCCAGTACGTAGGTGGTGCAGAGGCACGTATCAACACGCAGTGGCTGCTGACGTCCGGCACGACGGAGGCGAACGCATGGAAATCTACGCTGGTGGGTCACGACACGTTCACTAAGGTGAAGCCATCTGCC-3.

The invention also provides the application of the biological nano magnetic beads of the directional modified peptide nucleic acid in mRNA enrichment purification and separation extraction.

The invention also provides a preparation method of bio-nano magnetic beads for directional modification of peptide nucleic acid, the preparation method comprising the following steps:

S1. A magnetotactic bacterial MSR-1 mutant strain in which a bacterial magnetic particle membrane protein MamC and a MamF gene are deleted is a primary recombinant strain;

S2, constructing a chain affinity protein SA by using a flexible linker polypeptide chain and the deleted bacterial magnetic particle membrane protein MamC or MamF gene fusion expression vector, introducing the fusion expression vector into step S1 to prepare the primary recombinant strain, Screening for expression of secondary recombinant strains;

S3, culturing the secondary recombinant strain to obtain a functional biological nano magnetic bead expressing the display chain affinity protein SA;

S4, culturing the step S3 to obtain the functional bio-nanomagnetic beads by coupling with a biotin-labeled peptide nucleic acid PNA probe to obtain a bio-nanomagnetic bead oriented to modify the peptide nucleic acid.

After a large number of experimental tests, it is shown that the MamC and MamF genes in the magnetic particles of the bacteria simultaneously delete part of the membrane protein, which will not cause the decrease of the yield of the nanomagnetic beads, and the expression levels of these two proteins are similar, and the construction of the double mutant is beneficial to the full play. The protein acts as a backbone for the expression of the new fusion protein, and the magnetic bead structure after fusion construction is more stable.

Further, the step S1 includes the following steps:

S1.1: a 500 bp homologous DNA fragment flanking the missing bacterial magnetic particle membrane proteins MamC and MamF genes, respectively, and constructing two microcarriers by molecular cloning;

S1.2: transferring the two microcarriers into the MSR-I wild type strain simultaneously by electroporation;

S1.3: screening and identifying the MSR-I wild-type strain after electroporation, obtaining a magnetotactic bacterial MSR-1 mutant strain lacking the bacterial magnetic particle membrane proteins MamC and MamF genes, which is a primary recombination Strain.

Further, the step S2 includes the following steps:

S2.1: performing PCR amplification on the gene sequence of the strand affinity protein SA;

S2.2: The amplification product and the expression vector pBBR-RC were double-digested with EcoRI/BamHI, and the double-digested amplification product and the expression vector pBBR-RC were recovered;

S2.3: the double-digested amplification product is fused to the deleted bacterial magnetic particle membrane protein MamC or MamF gene by a flexible linker polypeptide chain, and ligated to the expression vector which is also double-digested pBBR-RC, the pBRC-SA expression plasmid is obtained, wherein the amino acid sequence of the flexible linker polypeptide chain is GASGLYWLGASAGGALSWLLGAASLYWSGL;

S2.4: transferring the pBRC-SA expression plasmid into the primary recombinant strain by electroporation, and obtaining a secondary recombinant strain after screening and verifying;

Preferably, the specific steps of step S2.4 are as follows:

S2.4.1, using PBS buffer to adjust the concentration of the pBRC-SA expression plasmid to 2 mg/mL, to be used;

S2.4.2, the glycerol buffer with a concentration of 15% is used as a washing buffer, and after being configured, it is sterilized and placed at -20 °C for freezing;

S2.4.3, the primary recombinant strain is cultured overnight, the cells are collected by centrifugation, and the bacterial sludge is resuspended in PBS buffer for 2 times;

S2.4.4, after collecting the cells again by centrifugation, resuspend the bacterial sludge with 15% glycerol buffer at a ratio of 1 g of slime sludge with 150-200 mL of glycerol buffer, and then place in a -20 ° C freezer for 30 min. Shake or slightly vortex for 1-2 times to keep the cells in a resuspended state;

S2.4.5, centrifuge at 4000g for 4min at 4000g, gently pour off the supernatant buffer, keep about 2ml of supernatant, gently resuspend the slime with a pipette, and dispense according to 100μL per EP tube. , that is, obtaining an electrotransformation competent strain;

S2.4.6, the prepared electrotransformation competent strain is rapidly frozen in liquid nitrogen, and then stored in a -80 ° C refrigerator;

S2.4.7, during electrotransformation, the electrotransformed competent strain is taken out and placed on ice to be dissolved;

S2.4.8, adding 1-2 μL of the pBRC-SA expression plasmid at a concentration of 2 mg/mL, gently mixing, and placing the mixture in a 1 mm electrotransformation cup for electrotransformation;

S2.4.9, after the end of electrotransformation, quickly add 100 μL of serum medium to the electrotransformation cup, mix well, pipette and transfer to EP tube, and incubate at 37 °C for 1-2 h;

S2.4.10, applying the culture product to a culture medium plate containing gentamicin and kanamycin antibiotics for screening culture, transferring cultured single colony bacteria, and verifying whether the pBRC-SA is to be The expression plasmid was successfully transformed into the primary recombinant strain, and the strain which successfully transformed and correctly expressed the streptavidin SA was a secondary recombinant strain.

S3.1: pre-incubation for 16 hours using 200-500 mL medium in a culture condition of an oxygen content of 5-10%, a nitrogen content of 90-95%, and a culture temperature of 37 °C;

S3.2: transferring the pre-cultured strain to the fermenter, and culturing for 3 to 4 days in a culture condition at a culture temperature of 37 ° C, an oxygen content of 5%, a hydrogen content of 1%, and a nitrogen content of 94%;

S3.3: treating the deep culture by homogenizing equipment, pulverizing the bacteria, adsorbing the magnetic particles of the bacteria through a magnetic device, and washing with the phosphate buffer for 2 to 3 times;

S3.4: Gradient treatment with ultrasonic and protease buffer to finally obtain purified functional biological nano magnetic beads;

The culture step provided by the invention not only can enhance the amplification ability of the magnetic resonance bacteria MSR-1 recombinant strain, but also can enhance the expression ability of the bacterial magnetic particles to the streptavidin SA.

Preferably, the medium used in the pre-cultivation comprises the following parts by weight:

8-15 parts peptone, 1-5 parts fatty acid lactoyl ester, 2-6 parts lichenin, 3-8 parts glycosylated protein, 0.5-1.2 parts potassium alginate, 1-2 parts cellulose acetate;

The medium used in the deep culture includes the following parts by weight: 15-20 parts of beef extract, 1-8 parts of peptidoglycan, 2-6 parts of lichenin, 1-3 parts of bisphosphatidylglycerol, 1- 2 parts of hydrogenated soybean phospholipid, 0.5-1.8 parts of ammonium alginate, 0.5-0.8 parts of sodium citrate.

By the above-mentioned definition of the medium in the pre-culture, the activity of the bacteria can be effectively increased, thereby improving the proliferation ability and the viability in the subsequent culture; further, the present invention uses the above-mentioned medium pair by defining the medium in the deep culture. The secondary culture of the pre-cultured secondary recombinant strain can effectively improve the resistance of the bacteria and the carrying capacity of the fusion protein of the streptavidin SA, and promote the proliferation of the bacteria and the simultaneous expression of the streptavidin SA.

Further, the step S4 includes the following steps:

S4.1: The synthesized peptide nucleic acid PNA dry powder is dissolved in water having a pH of 8.0, and an equal volume of labeling buffer is added to a final concentration of 10 mM;

S4.2: Add 20 μL of 100 mM NH2-Biotin, mix gently by pipetting, incubate in an incubator at 37 ° C for 30 minutes in the dark, transfer to 12000 g of filter tube and centrifuge for 15 min, add appropriate amount of marker buffer. Liquid, after mixing, centrifuge at 12000g for 15min;

S4.3: adding an appropriate amount of labeling buffer, inverting the filter element in the filter tube, transferring it into a new centrifuge tube, and centrifuging at 6000 g for 10 min, collecting the biotin-labeled peptide nucleic acid PNA probe;

S4.4: culturing the step S3 to obtain the functional biological nano magnetic beads washed twice with a phosphate buffer, dissolved in MES buffer, and adding the biotin-labeled peptide nucleic acid PNA probe obtained in step S4.3. After reacting for 1 h at room temperature, the magnetic beads were adsorbed by a magnetic stand, washed twice with a phosphate buffer, and dissolved in a TBS buffer of pH 7.5 to obtain a bio-nanomagnetic bead which is oriented to modify the peptide nucleic acid.

The bio-nanomagnetic beads fused with the strept-affinity protein SA can be efficiently coupled with the biotin-labeled peptide nucleic acid PNA by the above method.

Further, the specific method of the electrical conversion is as follows:

Using square wave electric pulse, the electric pulse is 3.1~3.3ms in 1~2 times under the condition of 3100~3200V.

The present invention overcomes the lack of transfer genes caused by the existing manner of parental engagement by means of electroporation, particularly plasmids for large fragment genes. The method of electroporation transformation is a hole formed on the cell by instantaneous current, so that the DNA gene fragment in the solution can enter the cell through the hole to complete the transformation. The biggest difficulty in electroporation is that each cell has different adaptability to current. If the current is too small, pores cannot be formed, or the time for forming pores is short, which is not conducive to gene transfer. If the current is too long, it will easily cause irreversible damage to the cells. Or cause cell death. Therefore, for each different bacteria or cells, it is necessary to explore suitable conditions. The present invention has been verified by a large number of experiments. For MSR-I bacteria, a square wave electric pulse is used, and the temperature is 1 to 2 times at 3100 to 3200V. The electrical pulse of 3.1~3.3ms can make DNA conversion power and bacteria survival rate higher.

Beneficial effect

The beneficial effects of the present invention are as follows: the bio-nanomagnetic beads of the directional modified peptide nucleic acid provided by the present invention bind the chain affinity protein SA through the flexible linker polypeptide chain, thereby enabling the structure of the binding protein to be stronger, the rigidity is enhanced, and the magnetic particle is highly expressed. Affinity protein SA, chain affinity protein SA utilizes magnetic particles of bacteria as magnetic modification, and the affinity protein SA coupled with biotin-labeled peptide nucleic acid PNA probe can be effectively used for specific enrichment capture of mRNA, achieving specialization The effect of separating and extracting mRNA, since PNA has many advantages that nucleic acid molecules do not have, many applications have been found in the fields of biotechnology and medicine, such as nucleic acid molecule capture and enrichment, molecular probes, nucleic acid drug carriers, etc., and further, provided by the present invention The magnetic beads prepared by the preparation method have high yield, and at the same time, the culture medium provided by the invention can effectively improve the activity and stress resistance of the bacteria, enhance the carrying capacity of the bacteria on the expression plasmid of the chain affinity protein SA, and promote the bacteria. Value-added and expression of the chain-affinity protein SA.

DRAWINGS

Figure 1 is a graph showing the fluorescence intensity decay curves of each group of bio-nanomagnetic beads in Experiment 1.

BEST MODE FOR CARRYING OUT THE INVENTION

The invention will now be further described in detail in conjunction with the following examples.

Example 1

Embodiment 1 of the present invention provides a bio-nanomagnetic bead which is oriented to modify a peptide nucleic acid, wherein the bio-nanomagnetic bead is expressed by a chain affinity protein SA and a membrane protein of a bacterial magnetic particle by a flexible linker polypeptide chain, wherein The strand affinity protein SA is coupled to a biotinylated peptide nucleic acid PNA probe.

Example 2

Embodiment 2 of the present invention provides a bio-nanomagnetic bead which is oriented to modify a peptide nucleic acid, wherein the bio-nanomagnetic bead is expressed by a chain-affinity protein SA through a flexible linker polypeptide chain and a membrane protein of a bacterial magnetic particle, wherein The strand affinity protein SA is coupled to a biotinylated peptide nucleic acid PNA probe.

The amino acid sequence of the flexible linker polypeptide chain is GASGLYWLGASAGGALSWLLGAASLYWSGL.

Example 3

Embodiment 3 of the present invention provides a bio-nanomagnetic bead which is oriented to modify a peptide nucleic acid, and the bio-nanomagnetic bead is expressed by a chain-affinity protein SA by a flexible linker polypeptide chain and a membrane protein of a bacterial magnetic particle, wherein The strand affinity protein SA is coupled to a biotinylated peptide nucleic acid PNA probe.

The amino acid sequence of the flexible linker polypeptide chain is GASGLYWLGA AGGALSWLLGAASLYWSGL.

The gene sequence of the protein streptavidin and SA is 5-GCAGAAGCAGGCATCACTGGCACGTGGTATAACCAGCTGGGTTCCACGTTCATTGTAACTGCCGGCGCAGACGGTGCACTGACTGGTACGTACGAGTCCGCGGTGGGCAACGCAGAGAGCCGTTATGTTCTGACGGGCCGCTACGACTCTGCACCAGCTACGGATGGTTCCGGTACTGCTCTGGGTTGGACGGTGGCATGGAAGAACAACTACCGTAACGCACATTCTGCGACGACTTGGTCTGGCCAGTACGTAGGTGGTGCAGAGGCACGTATCAACACGCAGTGGCTGCTGACGTCCGGCACGACGGAGGCGAACGCATGGAAATCTACGCTGGTGGGTCACGACACGTTCACTAAGGTGAAGCCATCTGCC-3.

Example 4

Embodiment 4 of the present invention provides the use of the bio-nanomagnetic beads of the directional modified peptide nucleic acid provided in any one of Examples 1-3 for mRNA enrichment, purification and separation extraction.

Example 5

Embodiment 5 of the present invention provides a bio-nanomagnetic bead which is oriented to modify a peptide nucleic acid, wherein the bio-nanomagnetic bead is expressed by a chain-affinity protein SA by a flexible linker polypeptide chain and a membrane protein of a bacterial magnetic particle, wherein The strand affinity protein SA is coupled to a biotinylated peptide nucleic acid PNA probe.

The method for preparing a bio-nanomagnetic bead of the directional modified peptide nucleic acid provided above, the preparation method comprising the steps of:

Example 6

Embodiment 6 of the present invention provides a method for preparing a bio-nanomagnetic bead of a directional modified peptide nucleic acid, and the preparation method comprises the following steps:

The step S1 includes the following steps:

Example 7

Embodiment 7 of the present invention provides a method for preparing bio-nanomagnetic beads for directional modification of peptide nucleic acid, and the preparation method comprises the following steps:

The step S1 includes the following steps:

S1.3: screening and identifying the MSR-I wild-type strain after electroporation, obtaining a magnetotactic bacterial MSR-1 mutant strain lacking the bacterial magnetic particle membrane proteins MamC and MamF genes, which is a primary recombination Strain

The specific method of the electrical conversion is as follows:

Using square wave electric pulse, under the condition of 3100V, one time is 3.1ms electric pulse;

Example 8

Embodiment 8 of the present invention provides a method for preparing a bio-nanomagnetic bead of a directional modified peptide nucleic acid, and the preparation method comprises the following steps:

The step S2 includes the following steps:

Example 9

Embodiment 9 of the present invention provides a method for preparing a bio-nanomagnetic bead of a directional modified peptide nucleic acid, and the preparation method comprises the following steps:

The step S2 includes the following steps:

The specific steps of step S2.4 are as follows:

S2.4.10, applying the culture product to a culture medium plate containing gentamicin and kanamycin antibiotics for screening culture, transferring cultured single colony bacteria, and verifying whether the pBRC-SA is to be The expression plasmid is successfully transformed into the primary recombinant strain, and the strain which successfully transforms and can correctly express the streptavidin SA is a secondary recombinant strain;

The specific method of the electrical conversion is as follows:

Using square wave electric pulse, under the condition of 3200V, perform 2 times of 3.3ms electric pulse;

Example 10

Embodiment 10 of the present invention provides a method for preparing bio-nanomagnetic beads for directional modification of peptide nucleic acid, and the preparation method comprises the following steps:

The step S3 includes the following steps:

S3.1: pre-incubation for 16 hours in a culture condition of 5% oxygen content, nitrogen content 95%, culture temperature 37 ° C using 200 mL medium;

Example 11

Embodiment 11 of the present invention provides a method for preparing a bio-nanomagnetic bead of a directional modified peptide nucleic acid, the preparation method comprising the following steps:

The step S3 includes the following steps:

S3.1: Pre-incubation for 16 hours using a culture medium of an oxygen content of 10%, a nitrogen content of 90%, and a culture temperature of 37 ° C using 500 mL of the medium; the medium used in the pre-culture includes the following parts by weight:

8 parts peptone, 1 part fatty acid lactoyl ester, 2 parts lichenin, 3 parts glycosylated protein, 0.5 part potassium alginate, 1 part cellulose acetate;

S3.3: treating the deep culture by homogenizing equipment, pulverizing the bacteria, adsorbing the magnetic particles of the bacteria by a magnetic device, and washing with the phosphate buffer for 2 to 3 times; the medium used in the deep culture includes the following weight Parts of the fraction: 15 parts of beef extract, 1 part of peptidoglycan, 2 parts of lichenin, 1 part of bisphosphatidylglycerol, 1 part of hydrogenated soybean phospholipid, 0.5 part of ammonium alginate, 0.5 part of sodium citrate;

Example 12

Embodiment 12 of the present invention provides a method for preparing a bio-nanomagnetic bead of a directional modified peptide nucleic acid, the preparation method comprising the following steps:

The step S3 includes the following steps:

S3.1: Pre-incubation for 16 hours using a culture medium of an oxygen content of 8%, a nitrogen content of 92%, and a culture temperature of 37 ° C using 300 mL of the medium; the medium used in the pre-culture includes the following parts by weight:

15 parts peptone, 5 parts fatty acid lactoyl ester, 6 parts lichenin, 8 parts glycosylated protein, 1.2 parts potassium alginate, 2 parts cellulose acetate;

S3.3: treating the deep culture by homogenizing equipment, pulverizing the bacteria, adsorbing the magnetic particles of the bacteria by a magnetic device, and washing with the phosphate buffer for 2 to 3 times; the medium used in the deep culture includes the following weight Parts of the ingredients: 20 parts of beef extract, 8 parts of peptidoglycan, 6 parts of lichenin, 3 parts of diphosphatidylglycerol, 2 parts of hydrogenated soybean phospholipid, 1.8 parts of ammonium alginate, 0.8 parts of sodium citrate;

Example 13

Embodiment 13 of the present invention provides a method for preparing a bio-nanomagnetic bead of a directional modified peptide nucleic acid, the preparation method comprising the following steps:

The step S3 includes the following steps:

S3.1: Pre-incubation for 16 hours using a culture medium of an oxygen content of 7%, a nitrogen content of 93%, and a culture temperature of 37 ° C using 400 mL of the medium; the medium used in the pre-culture includes the following parts by weight:

10 parts peptone, 3 parts fatty acid lactoyl ester, 4 parts lichenin, 5 parts glycosylated protein, 0.8 part potassium alginate, 1.5 parts cellulose acetate;

S3.3: treating the deep culture by homogenizing equipment, pulverizing the bacteria, adsorbing the magnetic particles of the bacteria by a magnetic device, and washing with the phosphate buffer for 2 to 3 times; the medium used in the deep culture includes the following weight Parts of the ingredients: 18 parts of beef extract, 6 parts of peptidoglycan, 5 parts of lichenin, 2 parts of diphosphatidylglycerol, 1.5 parts of hydrogenated soybean phospholipid, 1 part of ammonium alginate, 0.7 parts of sodium citrate;

Example 14

Embodiment 14 of the present invention provides a method for preparing a bio-nanomagnetic bead of a directional modified peptide nucleic acid, the preparation method comprising the following steps:

S4, culturing the step S3 to obtain the functional biological nano magnetic beads by coupling with a biotin-labeled peptide nucleic acid PNA probe, thereby obtaining a bio-nano magnetic bead oriented to modify the peptide nucleic acid;

The step S4 includes the following steps:

Comparative Example 1

Comparative Example 1 provides a bio-nanomagnetic bead, wherein the bio-nanomagnetic bead flexible linker polypeptide chain is expressed by fusion with a membrane protein of a bacterial magnetic particle, wherein the streptavidin-protein SA and the biotin-labeled peptide nucleic acid PNA probe coupling.

The amino acid sequence of the flexible linker polypeptide chain is GASSGLYLLASAWLALSGALLASSLYWSGL.

Comparative Example 2

Comparative Example 2 was compared with Example 5, and the difference from Example 5 was that, in step S1, the mutant magnetic strain MSR-1 mutant in which the bacterial magnetic particle membrane protein was only deleted by the MamC gene was constructed as a primary recombinant strain.

Comparative Example 3

Comparative Example 3 was compared with Example 5, and the difference from Example 5 was that, in step S1, the mutant strain of the magnetotactic bacteria MSR-1 in which the bacterial magnetic particle membrane protein MamC+MamD gene was deleted was constructed as a primary recombinant strain.

Comparative Example 4

Comparative Example 4 was compared with Example 8, and the difference from Example 8 was that, in step S2.4, the pBRC-SA expression plasmid was transferred into the primary recombinant strain by parental ligation, and screened. A secondary recombinant strain was obtained.

Comparative Example 5

Comparative Example 5 was compared with Example 9, and the difference from Example 9 was that the specific method of the electrotransformation was as follows:

Using a square wave electric pulse, the electric pulse of 3.3 ms is performed twice under the condition of 3500V.

Comparative Example 6

Comparative Example 6 was compared with Example 9, and the difference from Example 9 was that the specific method of the electrotransformation was as follows:

A square wave electric pulse was used to perform an electrical pulse of 3.3 ms twice at 3000 V.

Comparative Example 7

Comparative Example 7 was compared with Example 9, and the difference from Example 9 was that the specific method of the electrotransformation was as follows:

Using a square wave electric pulse, the electric pulse of 3.3 ms is performed twice at 3050V.

Comparative Example 8

Comparative Example 8 was compared with Example 9, and the difference from Example 9 was that the specific method of the electrotransformation was as follows:

Using a square wave electric pulse, the electric pulse of 3.3 ms is performed twice at 3300V.

Comparative Example 9

Comparative Example 9 is in contrast to Example 10, which differs from Example 9 in that the step S3 includes the following steps:

S3.1: pre-incubation for 16 hours in a culture condition of an oxygen content of 25%, a nitrogen content of 75%, and a culture temperature of 37 ° C using 200 mL of the medium;

S3.2: Transfer the pre-cultured strain to the fermenter, and culture in a deep culture for 3 to 4 days under the culture conditions of a culture temperature of 37 ° C, an oxygen content of 25%, a hydrogen content of 1%, and a nitrogen content of 74%;

Comparative Example 10

Comparative Example 10 was compared with Example 11, and was different from Example 11 in that the medium used in the pre-culture described in the step S3.1 included the following parts by weight:

8 parts peptone, 2 parts lichenin, 0.5 part potassium alginate, 1 part cellulose acetate;

In step S3.3, the medium used in the deep culture includes the following parts by weight: 15 parts of beef extract, 2 parts of lichenin, 0.5 part of ammonium alginate, and 0.5 part of sodium citrate.

Experiment 1: High temperature accelerated experiment

The bio-nanomagnetic beads provided in Examples 1, 2 and 5 were used as the experimental group, and the bio-nanomagnetic beads provided in Comparative Example 1 were used as the control group, and 12 sets of parallel experiments were performed for each group of samples, according to the FITC-labeled lgG antibody and the organism. Nano magnetic beads were combined, and the combined bio-nano magnetic beads were placed at 37 ° C. Each sample was taken out on the 1st to 12th day, washed with PBS buffer, magnetically adsorbed and resuspended, and the fluorescence intensity of FITC was adjusted. The detection is performed, each time compared with the fluorescence intensity of the normally stored reagent, and finally the attenuation curve of the fluorescence intensity of the nano magnetic bead reagent is obtained (as shown in FIG. 1 , the horizontal axis is time (day) in the attenuation curve, and the vertical axis is attenuation. Rate (%)) and compared to reagents normally stored at 4 °C.

As shown in Fig. 1, compared with the control group 1, the bio-nanomagnetic beads of each group in the experimental group can maintain more than 70% of the original activity at 12 days, and it is generally considered that the placement at 37 ° C for one day is equivalent to about 4 ° C. It was considered to be in compliance with performance standards when placed under 40 days and the fluorescence intensity of the bio-nanomagnetic beads was attenuated by 35% or less. Therefore, it can be considered that the bio-nano magnetic beads provided by the present invention can satisfy the performance standard by being placed at 4 ° C for one year through the flexible linker polypeptide chain fusion protein, indicating that it has good stability and can meet the use requirements. Compared with the first embodiment, the flexible linker polypeptide chain provided in the embodiment 2 can reduce the degree of attenuation of the magnetic beads, and the stability is better. In addition, the magnetic beads prepared by the production method provided in the embodiment 5 are compared with the first embodiment. The degree of attenuation of the magnetic beads is lowered. Therefore, the stability of the magnetic bead structure can be effectively improved by the method provided in the embodiment 5, so that the structure of the streptavidin SA and the membrane protein of the bacterial magnetic particles is more rigid.

Experiment 2: Comparative experiment of extracting mRNA from biological nano magnetic beads

The bio-nanomagnetic beads provided in Examples 1 and 5 were used as the experimental groups 1 to 2, and the bio-nano magnetic beads provided in the control example 1 were used as the control group 1, and the above-mentioned respective groups of bio-nanomagnetic beads were used for the extraction of mRNA according to the following methods. .

a) Take 1-3mg of total RNA extracted from the sample, take out 3 portions separately, dilute and mix with 0.5xSSC binding buffer, and let the water bath at 65 °C for 5 minutes;

b) For each total RNA, add 20 μL of the bio-nano magnetic beads provided in Examples 1 and 5 and Comparative Examples 1 and 2, mix gently by pipetting, and mix at room temperature for 30 minutes at 200 rpm, every 5 - Oscillation 1 time with 10 minutes;

c) adsorb the magnetic beads with a magnetic stand, wash the magnetic beads twice with 0.1xSSC buffer, then wash once with 75% ethanol to absorb the liquid;

d) Add mRNA elution buffer, shake for 30 seconds, place in a water bath at 70 ° C for 5 minutes, quickly adsorb the magnetic beads with a magnetic stand, and take the supernatant as the extracted mRNA.

Based on the extracted mRNA, the mRNA load of each group of nanomagnetic beads was calculated. The experimental results are shown in Table 1.

Table 1 mRNA loading of each group of nanomagnetic beads

组别Group	mRNA载量（μg/mg）mRNA load (μg/mg)
实验组1Experimental group 1	135135
实验组2Experimental group 2	142142
对照组1Control group 1	7979

It can be seen from Table 1 that the mRNA load of the bio-nanomagnetic beads in each group of the experimental group was significantly higher than that of the control group. It is indicated that the recombinant expression of the recombinant protein on the bio-nanomagnetic bead membrane protein through the flexible linker polypeptide chain can effectively increase the mRNA load and improve the reliability of the experimental analysis results.

Experiment 3: Comparative experiment of membrane protein gene deletion

The method provided in Example 5 was used as the experimental group, and the methods provided in Comparative Examples 2 and 3 were used as the control groups 1 and 2, and the magnetotactic bacteria MSR-I was cultured by the above method, respectively, and the wild type strain was used as a positive control, The magnetic bead yield of each group of bacteria was measured and compared. The experimental results are shown in Table 2.

Table 2 Production of nanomagnetic beads per liter of culture medium in each group of cultures

组别Group	纳米磁珠含量（mg）Nano magnetic beads content (mg)	占比（%）Proportion (%)
阳性对照Positive control	256.2256.2	11
实验组test group	229.4229.4	89.589.5
对照组1Control group 1	105.3105.3	41.141.1
对照组2Control group 2	125.3125.3	48.148.1

It can be seen from Table 2 that the magnetic bead yield of each group in the experimental group can reach more than 85% of the wild type, and the decrease is not obvious; while the magnetic bead yield of each group in the control group is significantly lower than that of the wild type strain, indicating that the membrane is constructed. The magnetic bead yield of the protein double gene-deficient magnetotactic bacteria was higher than that of the single gene-deficient magnetotactic bacteria. In addition, the experimental group compared with the control group 2, the magnetic beads of the MamC+MamF double gene-deficient magnetotactic bacteria The yield is higher and the reduction is small.

Experiment 4: Comparative experiment of electrotransformation conditions

The methods provided in Examples 8 and 9 were used as the experimental groups 1 and 2, and the methods provided in the comparative examples 4-8 were used as the control group 1-5, and the magnetotactic bacteria MSR-I were cultured by the above methods, respectively, and the bacteria of each group were used. The number is 107, two 1 μg of the transforming DNA (about 5 kbp in size), and the survival rate of the electrotransformed bacteria and the success rate of gene expression expression are measured and compared. The experimental results are shown in Table 3.

Table 3 Survival rate and conversion success rate of each group of bacteria after electrotransformation

组别Group	细菌成活率（%）Bacterial survival rate (%)	转化成功率（%）Conversion success rate (%)
实验组1Experimental group 1	7575	38.338.3
实验组2Experimental group 2	8989	5353
对照组1Control group 1	71.471.4	17.217.2
对照组2Control group 2	7474	19.519.5
对照组3Control group 3	6060	22twenty two
对照组4Control group 4	5959	1818
对照组5Control group 5	6262	2020

As can be seen from Table 3, compared with the control group 1, the survival rate and the gene conversion success rate of the experimental group 1 were significantly higher than those of the control group 1, which indicated that the electrophoresis can effectively improve the bacterial survival rate and gene transformation. The success rate, compared with the experimental group 2, the experimental group 1 can improve the success rate of the transformation under the premise of ensuring the survival rate of the bacteria under the special electrotransformation conditions. The experimental group 1 and the experimental group 2 are compared with the control group 2-5 respectively. The survival rate and gene conversion success rate of experimental groups 1 and 2 were significantly higher than those of the control group 2-5, which indicated that the electrophoresis can effectively increase the survival rate of bacteria and the success rate of gene conversion. The survival rate of the control group 2 was high. However, the conversion success rate is low, indicating that the current is too low or the time is too short will reduce the success rate of the conversion. If the current is too large or too long, the bacterial mortality will increase, which will also affect the success rate of the conversion; It is indicated that the electrotransformation conditions provided by the present invention can increase the success rate of transformation under the premise of ensuring the survival rate of bacteria.

Experiment 5: Comparative experiment of fermentation culture conditions

Using the method provided in Example 10 as the experimental group 1, and the method provided in the control example 9 as the control group 1, the magnetotactic bacteria MSR-I was cultured by the above method, and the wild type strain was used as a positive control for each group of bacteria. The magnetic bead yield was measured and compared. The experimental results are shown in Table 4.

Table 4 Production of nanomagnetic beads per liter of culture medium in each group of cultures

组别Group	纳米磁珠含量（mg）Nano magnetic beads content (mg)	对照组减产比例（%）Reduced production ratio of the control group (%)
实验组1Experimental group 1	232.5232.5	—-
对照组1Control group 1	177.2177.2	23.823.8

As can be seen from Table 4, the magnetic bead yield of the experimental group was significantly higher than that of the control group, indicating that the microaerobic + small amount of hydrogen culture conditions provided by the present invention can significantly increase the magnetic bead yield of the magnetotactic bacteria MSR-I.

Experiment 6: Comparison test of medium performance

Under the same conditions of inoculum, the method provided in Example 11 was used as the experimental group, and the method provided in Comparative Example 10 was used as the control group, and the magnetotactic bacteria MSR-1 was cultured separately, and the viability and quantity of the bacteria after the culture were carried out. Determine and compare. The experimental results are shown in Table 5.

Table 5 Vigor and quantity of bacteria in each group

组别Group	细菌活力Bacterial vigor	细菌数量Number of bacteria
实验组test group	0.8420.842	6.1×10 ⁹ 6.1×10 ⁹
对照组Control group	0.5850.585	3.7×10 ⁸ 3.7×10 ⁸

It can be seen from Table 5 that the bacterial viability and the number of bacteria in the experimental group are significantly higher than those in the control group, indicating that the culture method provided by the present invention can effectively improve the viability and proliferation ability of the magnetotactic bacteria, and demonstrate the preculture used in the culture method provided by the present invention. Both the medium and the deep culture medium can effectively improve the viability and proliferation ability of the bacteria. Any one of the pre-culture medium and the deep culture medium is missing or replaced, which is likely to cause bacterial death.

The present invention is not limited to the above-described preferred embodiments, and any other form of product can be derived by anyone of the present invention, but without any change in shape or structure, it is the same as or equivalent to the present application. Approximate technical solutions are all within the scope of the present invention.

Claims

A bio-nanomagnetic bead directed to a modified peptide nucleic acid, characterized in that the bio-nanomagnetic bead is expressed by a chain-affinity protein SA by fusion of a flexible linker polypeptide chain with a membrane protein of a bacterial magnetic particle, wherein the chain The affinity protein SA is coupled to a biotinylated peptide nucleic acid PNA probe.
The bio-nanomagnetic bead of the oriented modified peptide nucleic acid according to claim 1, wherein the amino acid sequence of the flexible linker polypeptide chain is GASGLYWLGASAGGALSWLLGAASLYWSGL.
The orientation of the modified organism as claimed in claim 2 Magnetic Bead peptide nucleic acids, characterized in that said streptavidin protein and gene sequences SA is 5-GCAGAAGCAGGCATCACTGGCACGTGGTATAACCAGCTGGGTTCCACGTTCATTGTAACTGCCGGCGCAGACGGTGCACTGACTGGTACGTACGAGTCCGCGGTGGGCAACGCAGAGAGCCGTTATGTTCTGACGGGCCGCTACGACTCTGCACCAGCTACGGATGGTTCCGGTACTGCTCTGGGTTGGACGGTGGCATGGAAGAACAACTACCGTAACGCACATTCTGCGACGACTTGGTCTGGCCAGTACGTAGGTGGTGCAGAGGCACGTATCAACACGCAGTGGCTGCTGACGTCCGGCACGACGGAGGCGAACGCATGGAAATCTACGCTGGTGGGTCACGACACGTTCACTAAGGTGAAGCCATCTGCC-3.
The use of the bio-nanomagnetic beads of the directional modified peptide nucleic acid according to any one of claims 1 to 3 for mRNA enrichment, purification and separation extraction.
A method for preparing a bio-nanomagnetic bead of the directional modified peptide nucleic acid according to any one of claims 1 to 3, wherein the preparation method comprises the following steps:

S1. A magnetotactic bacterial MSR-1 mutant strain in which a bacterial magnetic particle membrane protein MamC and a MamF gene are deleted is a primary recombinant strain;

S2, constructing a chain affinity protein SA by using a flexible linker polypeptide chain and the deleted bacterial magnetic particle membrane protein MamC or MamF gene fusion expression vector, introducing the fusion expression vector into step S1 to prepare the primary recombinant strain, Screening for expression of secondary recombinant strains;

S3, culturing the secondary recombinant strain to obtain a functional biological nano magnetic bead expressing the display chain affinity protein SA;

S4, culturing the step S3 to obtain the functional bio-nanomagnetic beads by coupling with a biotin-labeled peptide nucleic acid PNA probe to obtain a bio-nanomagnetic bead oriented to modify the peptide nucleic acid.
The preparation method according to claim 5, wherein the step S1 comprises the following steps:

S1.1: a 500 bp homologous DNA fragment flanking the missing bacterial magnetic particle membrane proteins MamC and MamF genes, respectively, and constructing two microcarriers by molecular cloning;

S1.2: transferring the two microcarriers into the MSR-I wild type strain simultaneously by electroporation;

S1.3: screening and identifying the MSR-I wild-type strain after electroporation, obtaining a magnetotactic bacterial MSR-1 mutant strain lacking the bacterial magnetic particle membrane proteins MamC and MamF genes, which is a primary recombination Strain.
The preparation method according to claim 5, wherein the step S2 comprises the following steps:

S2.1: performing PCR amplification on the gene sequence of the strand affinity protein SA;

S2.2: The amplification product and the expression vector pBBR-RC were double-digested with EcoRI/BamHI, and the double-digested amplification product and the expression vector pBBR-RC were recovered;

S2.3: the double-digested amplification product is fused to the deleted bacterial magnetic particle membrane protein MamC or MamF gene by a flexible linker polypeptide chain, and ligated to the expression vector which is also double-digested pBBR-RC, the pBRC-SA expression plasmid is obtained, wherein the amino acid sequence of the flexible linker polypeptide chain is GASGLYWLGASAGGALSWLLGAASLYWSGL;

S2.4: transferring the pBRC-SA expression plasmid into the primary recombinant strain by electroporation, and obtaining a secondary recombinant strain after screening and verifying;

Preferably, the specific steps of step S2.4 are as follows:

S2.4.1, using PBS buffer to adjust the concentration of the pBRC-SA expression plasmid to 2 mg/mL, to be used;

S2.4.2, the glycerol buffer with a concentration of 15% is used as a washing buffer, and after being configured, it is sterilized and placed at -20 °C for freezing;

S2.4.3, the primary recombinant strain is cultured overnight, the cells are collected by centrifugation, and the bacterial sludge is resuspended in PBS buffer for 2 times;

S2.4.4, after collecting the cells again by centrifugation, resuspend the bacterial sludge with 15% glycerol buffer at a ratio of 1 g of slime sludge with 150-200 mL of glycerol buffer, and then place in a -20 ° C freezer for 30 min. Shake or slightly vortex for 1-2 times to keep the cells in a resuspended state;

S2.4.5, centrifuge at 4000g for 4min at 4000g, gently pour off the supernatant buffer, keep about 2ml of supernatant, gently resuspend the slime with a pipette, and dispense according to 100μL per EP tube. , that is, obtaining an electrotransformation competent strain;

S2.4.6, the prepared electrotransformation competent strain is rapidly frozen in liquid nitrogen, and then stored in a -80 ° C refrigerator;

S2.4.7, during electrotransformation, the electroporation competent strain was taken out and placed on ice to be dissolved; S2.4.8, 1-2 μL of the pBRC-SA expression plasmid at a concentration of 2 mg/mL was added, and gently mixed. Evenly, the mixture was placed in a 1 mm electroconversion cup for electroconversion treatment;

S2.4.9, after the end of electrotransformation, quickly add 100 μL of serum medium to the electrotransformation cup, mix well, pipette and transfer to EP tube, and incubate at 37 °C for 1-2 h;

S2.4.10, applying the culture product to a culture medium plate containing gentamicin and kanamycin antibiotics for screening culture, transferring cultured single colony bacteria, and verifying whether the pBRC-SA is to be The expression plasmid was successfully transformed into the primary recombinant strain, and the strain which successfully transformed and correctly expressed the streptavidin SA was a secondary recombinant strain.
The preparation method according to claim 5, wherein the step S3 comprises the following steps:

S3.1: pre-incubation for 16 hours using 200-500 mL medium in a culture condition of an oxygen content of 5-10%, a nitrogen content of 90-95%, and a culture temperature of 37 °C;

S3.2: transferring the pre-cultured strain to the fermenter, and culturing for 3 to 4 days in a culture condition at a culture temperature of 37 ° C, an oxygen content of 5%, a hydrogen content of 1%, and a nitrogen content of 94%;

S3.3: treating the deep culture by homogenizing equipment, pulverizing the bacteria, adsorbing the magnetic particles of the bacteria through a magnetic device, and washing with the phosphate buffer for 2 to 3 times;

S3.4: Gradient treatment with ultrasonic and protease buffer to finally obtain purified functional biological nano magnetic beads;

Preferably, the medium used in the pre-cultivation comprises the following parts by weight:

8-15 parts peptone, 1-5 parts fatty acid lactoyl ester, 2-6 parts lichenin, 3-8 parts glycosylated protein, 0.5-1.2 parts potassium alginate, 1-2 parts cellulose acetate;

The medium used in the deep culture includes the following parts by weight: 15-20 parts of beef extract, 1-8 parts of peptidoglycan, 2-6 parts of lichenin, 1-3 parts of bisphosphatidylglycerol, 1- 2 parts of hydrogenated soybean phospholipid, 0.5-1.8 parts of ammonium alginate, 0.5-0.8 parts of sodium citrate.
The preparation method according to claim 5, wherein the step S4 comprises the following steps:

S4.1: The synthesized peptide nucleic acid PNA dry powder is dissolved in water having a pH of 8.0, and an equal volume of labeling buffer is added to a final concentration of 10 mM;

S4.2: Add 20 μL of 100 mM NH2-Biotin, mix gently by pipetting, incubate in an incubator at 37 ° C for 30 minutes in the dark, transfer to 12000 g of filter tube and centrifuge for 15 min, add appropriate amount of marker buffer. Liquid, after mixing, centrifuge at 12000g for 15min;

S4.3: adding an appropriate amount of labeling buffer, inverting the filter element in the filter tube, transferring it into a new centrifuge tube, and centrifuging at 6000 g for 10 min, collecting the biotin-labeled peptide nucleic acid PNA probe;

S4.4: culturing the step S3 to obtain the functional biological nano magnetic beads washed twice with a phosphate buffer, dissolved in MES buffer, and adding the biotin-labeled peptide nucleic acid PNA probe obtained in step S4.3. After reacting for 1 h at room temperature, the magnetic beads were adsorbed by a magnetic stand, washed twice with a phosphate buffer, and dissolved in a TBS buffer of pH 7.5 to obtain a bio-nanomagnetic bead which is oriented to modify the peptide nucleic acid.
The preparation method according to claim 6 or 7, wherein the specific method of the electrical conversion is as follows:

Using square wave electric pulse, the electric pulse is 3.1~3.3ms in 1~2 times under the condition of 3100~3200V.