CN110387404B

CN110387404B - Magnetic bead-PNA probe compound and application of magnetic bead-PNA probe compound in enrichment of liver cancer circulating tumor DNA

Info

Publication number: CN110387404B
Application number: CN201910570959.1A
Authority: CN
Inventors: 汤佳城; 张占丰; 唐杰
Original assignee: Zhejiang University ZJU
Current assignee: Zhejiang University ZJU
Priority date: 2019-06-28
Filing date: 2019-06-28
Publication date: 2020-07-28
Anticipated expiration: 2039-06-28
Also published as: CN110387404A

Abstract

The invention discloses a magnetic bead-PNA probe compound and application of enriched liver cancer circulating tumor DNA, wherein a sample to be detected and the magnetic bead-PNA probe compound are subjected to hybridization reaction, so that non-mutated genes in the sample to be detected are combined with the magnetic bead-PNA probe compound to form a target DNA-magnetic bead-PNA probe compound, and supernatant containing mutated genes is obtained through magnetic separation; and (3) carrying out PCR (polymerase chain reaction) indiscriminate amplification on the supernatant containing the mutant gene to construct a mutant gene library, purifying the mutant gene library by adopting sorting magnetic beads, carrying out hybridization reaction with a capture probe, adding the hybridization product into the capture magnetic beads, combining the mutant gene into the capture magnetic beads, and carrying out elution and separation to obtain the circulating tumor DNA of the liver cancer. Compared with a group which is not treated by a magnetic bead-PNA probe compound, the detection sensitivity of the invention on the circulating tumor DNA of the liver cancer is improved by more than 10 times.

Description

Magnetic bead-PNA probe compound and application of magnetic bead-PNA probe compound in enrichment of liver cancer circulating tumor DNA

(I) technical field

The invention relates to a method for enriching P53 gene mutation in circulating tumor DNA of liver cancer.

(II) background of the invention

Liver cancer is the second leading cause of death of the second cancer in China, the early diagnosis and treatment of liver cancer is weak at present, accurate and sensitive early warning and early diagnosis markers are lacked, and the condition causes that more than 60% of liver cancer patients enter the middle and late stages at the time of initial diagnosis, so that the chance of radical operation is lost. More seriously, even early cancer foci can have high metastatic potential for liver cancer, and the high recurrence rate of the liver cancer is related to the size, biological characteristics, collateral circulation and embolism technology, embolism mode and degree and the like of tumors (particularly for massive liver cancer, the periphery is often accompanied by microsatellite foci and microvascular invasion which are difficult to display by imaging, so that the clinical so-called 'liver cancer radical surgery' is primarily palliative resection, and residual cancer cells after the surgery can obtain metastatic potential to cause recurrence, local metastasis or distant organ metastasis). In order to find the residual cancer or recurrence as early as possible and to strive for an appropriate and effective treatment opportunity for the patient, an effective means for accurately monitoring the tumor progression is needed, which is also the main direction of research of scholars at home and abroad at present.

The current development of the circulating tumor DNA detection Technology for liver cancer is very deficient for other common tumors, and faces at least two key obstacles, namely (1) extremely low concentration of circulating tumor DNA in blood of liver cancer and interference of other circulating DNA with higher concentration, (2) complicated information and incomplete information of liver cancer gene variation (including point mutation, deletion, insertion, amplification, DNA modification and the like), and the detection sensitivity and accuracy limit the feasibility of circulating tumor DNA diagnosis [ Jianian L, liver cancer amplifying, and liver cancer cell, Japan, cell of 2016, cell of Japan, cell of 2016.

Disclosure of the invention

The invention aims to provide a magnetic bead-PNA probe compound and application thereof in enriching liver cancer circulating tumor DNA, the method can obviously improve the content of circulating tumor DNA containing P53747G > T mutation (the enrichment effect is more than 10 times), overcomes the technical bottleneck of the prior high-throughput sequencing platform in detecting mutation abundance due to the error rate of the self instrument, effectively reduces the sequencing depth, saves the sequencing cost, ensures that the detection of P53 gene (747G > T) mutation in the circulating tumor DNA is expected to become an auxiliary index for early warning, prevention, early diagnosis and prognosis monitoring of liver cancer patients, and provides a possible reference for the research of targeted drug selection, drug resistance evolution and the like in the treatment process.

The technical scheme adopted by the invention is as follows:

the invention provides a magnetic bead-PNA probe compound, which is formed by combining a magnetic bead and a PNA probe, wherein the magnetic bead is coated with streptavidin; the nucleotide sequence of the PNA probe is as follows: 5'-AAC CGG AGG CCC ATC CT-3', biotin labeling was performed at the 5 ' end. The PNA probe is designed by using P53 gene as a template.

Further, the magnetic beads were added in the form of a suspension of 10mg/ml magnetic bead buffer solution, and the particle size of the magnetic beads was 1.05. mu.m.

Further, the magnetic bead buffer suspension was prepared by placing an EP tube containing a streptavidin-coated magnetic bead solution (Seimearfei, trade name: 65001) on a magnetic separation rack, standing for 1 minute, discarding the supernatant, Washing the magnetic beads three times with 1 × Binding and Washing (B & W) buffer, and then resuspending the washed beads with 2 × B & W buffer, wherein the volume of the 2 × B & W buffer was 50ul/0.5mg based on the weight of the magnetic beads, and the 2 × B & W buffer had a composition of 10mM Tris-HCl, 1mM EDTA, 2M NaCl dissolved in ultrapure water, and pH 7.5.

The magnetic bead-PNA probe compound is further prepared by taking PNA probe aqueous solution to denature at 99 ℃ for 10 minutes, standing at 4 ℃ for 5 minutes, mixing with magnetic bead buffer solution suspension, hybridizing at room temperature for 15 minutes, standing on a magnetic separation frame for 3 minutes, discarding supernatant, washing magnetic beads with 1 × B & W buffer solution (preferably 3 times) to remove unbound probes to obtain the magnetic bead-PNA probe compound, wherein the volume ratio of the PNA probe aqueous solution to the magnetic bead buffer solution suspension is 1:1, the PNA probe aqueous solution is prepared by preparing the PNA probe into 20pmol/ul PNA probe aqueous solution with ultrapure water, the magnetic bead buffer solution suspension is prepared from 2 × B & W buffer solution, the magnetic beads are coated with streptavidin, and the content of the magnetic beads is 10 mg/ml.

The invention also provides an application of the magnetic bead-PNA probe compound in enriching the circulating tumor DNA of the liver cancer, and the application method comprises the following steps: hybridizing a sample to be detected with the magnetic bead-PNA probe compound to enable non-mutated genes in the sample to be detected to be combined with the magnetic bead-PNA probe compound to form a target DNA-magnetic bead-PNA probe compound, and carrying out magnetic separation to obtain a supernatant containing mutated genes; constructing a mutant gene library after PCR indiscriminately amplifying the supernatant containing the mutant gene, purifying the mutant gene library by adopting sorting magnetic beads, carrying out hybridization reaction with a capture probe, adding a hybridization product into the capture magnetic beads, combining the mutant gene into the capture magnetic beads, and carrying out elution separation to obtain the mutant gene, namely the liver cancer circulating tumor DNA; the capture probe nucleotide sequence is: 5'-AAC CGGAGT CCC ATC CT-3', respectively; the mutant gene refers to P53 gene (747G > T) mutation.

Further, the application method comprises (1) performing targeted combination of the compound with the non-mutant gene, namely, denaturing a sample to be detected at 99 ℃ for 10 minutes, standing at 4 ℃ for 5 minutes, adding a magnetic bead-PNA probe compound and a hybridization solution to form a reaction system, performing hybridization at 50 ℃ for 1 hour, standing for magnetic separation for 2 minutes to obtain a target DNA-magnetic bead-PNA probe compound and a supernatant containing the mutant gene, and realizing capture of the non-mutant gene, wherein the volume ratio of the sample to be detected to the magnetic bead-PNA probe compound is 1:1, the hybridization solution is supplemented to the reaction system of 100 mu L, and the hybridization solution comprises 150mM NaCl, 15mM sodium citrate and 0.02% Tween-20, is dissolved in ultrapure water, and has the pH value of 7.0;

(2) construction of mutant Gene library: taking the supernatant containing the mutant gene in the step (1) as a template, taking P53-F and P53-R as primers to perform PCR reaction, and adopting an all-round DNA library construction kit (Shanghai assist in san Yang Biotechnology Co., Ltd., product number: 12200ES08) to construct a library of the PCR product, thereby obtaining a mutant gene library;

P53-F：TTTTCGACATAGTGTGGT；

P53-R：GTCCCAGTAGATTACCACT；

(3) capture of mutant genes: purifying the mutant gene library in the step (2) by sorting magnetic beads, adding a capture probe (sequence: 5'-AAC CGG AGT CCC ATC CT-3'), uniformly mixing by vortex oscillation, incubating at 95 ℃ for 5 minutes in a hybridization furnace, incubating at 47 ℃ for 16-20 hours, and obtaining a hybridization product by using an oligonucleotide molecular hybridization technology; and capturing the mutant gene by using the magnetic bead, and purifying to obtain the circulating tumor DNA of the liver cancer.

Furthermore, the Capture method of the mutant gene in the step (3) comprises the steps of firstly purifying the mutant gene library by using the sorted magnetic Beads in the kit, preferably by using a targeted Enrichment (HyperCap Target Enrichment) kit, carrying out the specific experimental operation process strictly according to the official specification SeqCap EZ HyperCap Workflow User's Guide, v 2.3: taking 1 μ g of the mutant gene library and 5 μ l of HyperCap Universal blocking oligo (HyperCap Universal blocking oligonucleotides) and 5 μ g of COT Human DNA (COT Human DNA) which are provided in the Roche incubation commercial kit, wherein after mixing, the mixture is added with a Buffer solution containing 200 μ g of the above mentioned strain cDNA (HyperCap incubation cDNA) (No. 08286370001), after mixing, adding a Buffer solution containing 190 μ% of the volume of the pre-mixed sorted magnetic Beads (AMPureBeads) (Roche, No. 08286418001) which is added after mixing for 10 seconds, after mixing, after adding 190 μ g of the supernatant of the mixture, 80% of the mixture, after mixing, adding a supernatant of the mixture, after mixing, the mixture is added with a Buffer solution containing 200 μ g of the mixture, after mixing, the mixture is stirred for 5 μ g of the mixture (Buffe PCR cDNA, the mixture), adding a supernatant of the mixture is added with a supernatant of the mixture, after mixing, the mixture is stirred for 5 μ g of the mixture is added with a supernatant of the mixture, the mixture is stirred for 5 μ g of the mixture (Buffe PCR), after stirring, the mixture is stirred for mixing, the mixture is stirred for 2. sub-Wash Buffer solution containing 200 μ g of the mixture is added, the mixture is added with a supernatant of the mixture is stirred for 5 μ l PCR incubation commercial incubation PCR 2, the mixture (No. 5), after the mixture is added, the mixture is separated, the mixture is added, the mixture is separated, the mixture is stirred for 10 min, the mixture is added, the mixture is stirred for 10 min, the mixture is added, the mixture is stirred for 10 min, the mixture is stirred for 10.

Further, the mutant gene purification method in the step (3) is (1) adding 25. mu.l of 2 × Super to 20. mu.l (containing 15. mu.l of ultrapure water) of the magnetic bead aqueous suspension containing the mutant gene after washing

II high Fidelity enzyme premix (Super)

IIhigh-Fidelity Mix) (Shanghai assist Sheng Biotechnology Limited company, trade mark: 12200ES08) and P53-F, P53-R primer (10 muM) each 2.5 muL, after completing Capture, L M-PCR reaction (Post-Capture L M-PCR) to obtain amplification product, (2) adding 90 muL of sorted magnetic bead AMPure XPBeads (Roche, trade mark: 08286418001) into the 50 muL amplification product, shaking, mixing, standing for 5min, separating magnetically to supernatant, discarding supernatant, slowly adding 200 muL of freshly prepared ethanol ultrapure water solution with concentration of 80% twice, standing for 5min at room temperature until the surface of the magnetic bead appears lusterless, adding 53 muL of ultrapure water, blowing, mixing, standing for 2min at room temperature, separating magnetically to supernatant, and taking supernatant, namely the enriched liver cancer mutant gene, namely the circulating tumor DNA.

The invention effectively reduces the interference of background DNA (changes direction and increases the concentration of tumor DNA) by adding a process of capturing the target (non-mutated) DNA before detecting the circulating tumor DNA of the liver cancer, thereby improving the detection sensitivity of the circulating tumor DNA of the liver cancer (namely mutated DNA). By the method, the mutation of P53 gene 747G > T in free DNA in plasma of a detected person is detected 1 month after operation (a window is moved backwards by 3-6 months by a conventional inspection method), which indicates that the liver cancer patient has potential recurrence, and the conjecture is verified in later imaging review. The detection result after the hepatic artery chemoembolization (TACE) shows that the peripheral blood of the patient still has higher mutation coefficient of the circulating tumor DNA P53 gene 747G > T, which indicates that the long-term curative effect of the patient is easy to repeat and is consistent with the disease course description of the follow-up in later period.

Through the innovation, the blood can be detected by blood drawing: (1) the method is used for screening the liver cancer sensitively, quickly, accurately, non-invasively and low-cost in the common population, and helps to finish early warning, prevention and early diagnosis of the liver cancer; (2) the method can sensitively, quickly, accurately and non-invasively carry out postoperative prognostic analysis on the P53747G T mutant liver cancer patients at low cost, and provides a basis for perfecting the treatment of the tumor patients.

Compared with the prior art, the invention has the following beneficial effects:

the invention provides a magnetic bead-PNA probe compound, which is used for adsorbing and removing non-mutated DNA in a sample to be detected, carrying out PCR reaction to construct a mutant gene library, and capturing by a directional capture probe, thereby reducing the interference of normal circulating DNA, obviously increasing the relative content of circulating tumor DNA containing P53747G > T mutation, improving the detection sensitivity of the circulating tumor DNA of liver cancer by more than 10 times compared with a group which is not treated by the magnetic bead-PNA probe compound, and enabling the detection aiming at the circulating tumor DNA of liver cancer to be possible.

(IV) description of the drawings

FIG. 1 is a schematic diagram of the two-step enrichment and detection method of mutation of P53 gene in circulating tumor DNA of hepatocarcinoma in example 2, in which PNA probe is used to capture control (non-mutated) sequence, and capture sequencing is used to detect P53 mutated sequence (747G > T).

FIG. 2 shows the two-step enrichment and detection technique used in example 3 to detect different template copy number ratios (WT: MT 10)⁷：10⁵；10⁷：10⁴；10⁷：10³；10⁷：10²) P53 gene 747G in mixture>A mutated sequence of T; a is a histogram of sequencing data quality assessment, filtering and yield statistics; and B, comparing the filtered sequencing data to a genome database to determine the SNP sites and mutation coefficients in the sample.

FIG. 3 is a graph of the liver image and the sequencing result of the p53 gene in the liver cancer tissue of the patient in example 4 at different periods; a1 is CT picture before operation of patient, A2 is MR picture before operation of patient; b1 is a CT image of half-year postoperative review of the patient, B2 is an MR image of half-year postoperative review of the patient; c is hepatic arteriogram when patients are treated with TACE; d is a p53 gene sequencing result diagram of a tumor specimen reserved in the operation of a liver cancer patient.

FIG. 4 is a graph showing the correlation between circulating tumor DNA and the number of tumor cells in a patient with liver cancer in example 4.

(V) detailed description of the preferred embodiments

The invention will be further described with reference to specific examples, but the scope of the invention is not limited thereto:

the L B culture medium comprises 10 g/L10 g/L of tryptone, 5 g/L of yeast extract and deionized water as a solvent, has natural pH and is sterilized by high-pressure steam.

The room temperature is 25-30 ℃, and the ultrapure water is water with the resistivity of 18M omega cm (25 ℃).

Example 1: selection of P53 gene mutation site and primer design

1. Design of PNA probes and IDT Capture probes

From The DNA sequencing data (The Cancer Genome Atlas and The Cancer Of biological Mutations In Cancer database) Of The liver Cancer patients which are published at present, The clear Cancer activation-driven Mutations are selected and ranked according to The mutation frequency, wherein The representative Mutations: p53: 747G > T; TERT: 124C > T; CTNNB 1: 121A > G, etc. Because the mutation frequency of the 747 th basic group of the P53 gene (the nucleotide sequence is shown in SEQ ID NO. 1) in liver cancer is more than 10 percent in liver cancer patients, and more than 80 percent of the P53 mutation of the liver cancer patients in China and is far higher than the mutation frequency of other genes, a PNA probe (the probe sequence is SEQ ID NO.2) is designed aiming at the P53 gene: 5'-AAC CGG AGG CCC ATCCT-3', biotin labeling at the 5 ' end) and a capture probe (nucleotide sequence SEQ ID No. 3): 5'-AAC CGG AGTCCC ATC CT-3'), see fig. 1.

2. P53 wild type plasmid (WT) was purchased from orignee, inc, under trade designation: RC 200003.

3. P53747G construction of mutant T plasmid (MT):

the wild type plasmid P53 in step 2 was used as a template, primers (Table 1) were designed according to the mutation site P53747G > T and synthesized by Hangzhou Kangxi Biotechnology Ltd, and a site-directed mutagenesis kit (Shanghai Kangshi Biotechnology Ltd, product No. 11003ES10) was used to construct a mutant plasmid P53 gene 747G > T, i.e., the 747 of the P53 gene shown in SEQ ID NO.1 was mutated from G to T.

TABLE 1 primers for construction of P53747G > T mutant plasmids

The primers were diluted to 10 μ M, and the following reagents (all provided in the kit) were sequentially added to perform the PCR amplification reaction:

TABLE 2 PCR reaction System

TABLE 3 PCR reaction conditions

Since the original template plasmid is contained in the amplification product, DpnI digestion must be performed before recombinant cyclization is performed in order to prevent the formation of false positive transformants after transformation, 1 mu L DpnI enzyme is added to the amplified product, and the product is reacted at 37 ℃ for 2 hours to obtain the DpnI digested product.

A fresh sterile 1.5ml Eppendorf tube was placed in an ice-water bath, and the following components (Table 4) were added in sequence and carefully mixed.

TABLE 4 recombination reaction System

After 20min of reaction at 50 ℃ the reaction tube was immediately cooled in an ice-water bath, 100. mu.l of E.coli DH5 α competent cells (Shanghai assist in san-Sheng Biotech Co., Ltd., product No.: 11802ES80) were added, mixed well under the number of flick tube walls, placed on ice for 30 minutes, heat-shocked at 42 ℃ for 45-90 seconds, incubated in an ice-water bath for 2 minutes, added with 900. mu.l of L B medium, incubated at 37 ℃ for 10 minutes for sufficient resuscitation, shaken at 37 ℃ for 45 minutes at 200-250 rpm, 100. mu.l of the bacterial solution was spread evenly on a L B plate containing 100ng/ml ampicillin, the plate was inverted and incubated overnight at 37 ℃.

Selecting a single clone, amplifying the single clone in L B culture medium containing 100ng/ml ampicillin overnight, extracting plasmid DNA by using a high-purity plasmid miniextraction kit (Tiangen Biochemical technology (Beijing) Co., Ltd., product number: DP104-02), sequencing by using P53-SEQF and P53-SEQR as primers to identify mutation sites, and determining that the sequencing result shows that the P53 gene 747G>The T mutant plasmid was successfully constructed so that 1ng of the above plasmid contained about 5.5 × 10⁸Copy number scaling relationship copy numbers were calculated for subsequent experiments.

p53-SEQF(5’→3’)：AAACCTACCAGGGCAGCTACG；

p53-SEQR(5’→3’)：CCCAGCCTGGGCATCCTT。

Example 2: evaluation of threshold value of deep sequencing technology in detection of P53 gene 747G > T mutation frequency

1. Because the mutation frequency of 0.1% or less in the sequencing result is not reliable by the current mainstream sequencing platforms such as Agilent, Illumina and the like, the wild-type plasmids (WT) and 747G of P53 are used>T mutant plasmids (MT) were prepared at the following template copy number ratios (WT: MT 10)⁷：10⁵；10⁷：10⁴；10⁷：10³；10⁷：10²) Mix and simulate a mutation frequency of 1% to 0.001%. Since the length of most circulating tumor DNA of hepatocarcinoma cell is 120-220bp, and the peak value of expression is about 166bp, the control (wild type) and mutant fragments with 167bp length will be amplified in this example.

The method for amplifying the control fragment and the mutant fragment is as follows: wild Type (WT) plasmid and Mutant (MT) plasmid were proportioned (WT: MT ═ 10)⁷：10⁵；10⁷：10⁴；10⁷：10³；10⁷：10²) After mixing, the high fidelity PCR reaction, the primers, the reaction solution and the reaction conditions are shown in tables 5, 6 and 7, wherein the template is prepared by diluting the wild type plasmid and the mutant type plasmid to 1 mul respectively and mixing.

TABLE 5 primers for PCR reaction

TABLE 6 preparation of PCR reaction solution (Nanjing NuoWeizan Biotech Co., Ltd., product number: P503-d1)

TABLE 7 PCR reaction conditions

The PCR amplification products of all proportions are electrophoresed and recovered by tapping (167bp position), and the specific method is described in a gel recovery kit (Qiagen company, commercial product number: 28704). The concentration of the amplification product was determined using a Nanodrop spectrophotometer.

2. The recovered product was pooled according to the instructions of the Universal DNA pooling kit (Shanghai assist san Biotech Co., Ltd., product No.: 12200ES08) in the following steps:

(1) 50 μ l of the recovered product of tapping was put into a PCR tube, 10 μ l of Endprep Mix (provided in the kit) was added, and vortexed and mixed well. Incubate at 30 ℃ for 20 minutes and 72 ℃ for 20 minutes. After completion of the reaction, the reaction mixture was stored on ice.

(2) To the product of step (1) were added 30. mu.l of L alignment Enhancer, 5. mu.l of Fast T4DNA L igase and 5. mu.l of DNA Adapter (all provided in the kit), vortexed and mixed, wherein the final concentration of DNA Adapter was adjusted as shown in Table 8 and made up to a total volume of 100. mu.l with ultra pure water.

TABLE 8 conversion of the final concentration of Adapter to the amount of template DNA

Amount of template DNA/ng	Final concentration of Adapter/. mu.M
		1000	15
500	15
		250	15
100	15
		50	15
25	7.5
		10	3
5	1.5
		2.5	0.75
1	0.3

(3) After incubation at 20 ℃ for 15 minutes, 80. mu.l of sorting beads (b.sub.m) were added at room temperature

DNAselectionBeads, 0.8 ×, Beads: DNA 0.8:1, provided in the kit), mixed well, left to stand at room temperature for 5 minutes, the PCR tube was centrifuged briefly and placed in a magnetic stand to separate magnetic Beads and liquid, the solution was clarified and then removedAnd (5) clearing.

(4) The PCR tube was kept in a magnetic frame, 200. mu.l of a freshly prepared ultrapure aqueous solution of 80% ethanol in volume concentration was slowly added, and after incubation at room temperature for 30 seconds, the supernatant was aspirated off with a pipette. Repeating the step (4) once to obtain the sorted magnetic beads combined with the DNA.

(5) Standing for 5 minutes at room temperature until the surfaces of the sorted magnetic beads are matt. Adding 21 mul of ultrapure water, blowing and uniformly mixing by using a pipette, standing for 5 minutes at room temperature to obtain a purified DNA solution, namely the gene library.

(6) The gene library was quality checked using an Agilent bioanalyzer (see Agilent 2100 bioanalyzer instructions). After the library detection is qualified (namely, the library peak patterns are single, no dispersion, tailing and the like), the Illumina HiSeq sequencing is carried out on the library according to the requirement pooling of effective concentration and target off-machine data quantity.

(7) And (3) analyzing the sequencing result by using bioinformatics software. After sequencing is finished, a sequencer can generate an original gene sequence file, the most common format of the file is FASTQ, bioinformatics analysis and processing are required to be carried out on the original sequence file, invalid data are filtered, sequence information of a sequencing sample is obtained, mutation sites are reported, and allele mutation frequency is calculated. The above process needs to be completed by means of biological information analysis software, namely Picardtools is used for data filtering to generate sam files, Samtools (version 1.3) is used for re-sequencing, and finally, call SNP processing is carried out on the sam files of all samples to obtain single nucleotide variation information. After the above treatment, the ratio of WT: MT 10⁷：10⁵In the experimental group, the total number of reads for the statistical sequence was 20237485, the number of effective reads was 19932219, in which the P53 gene 747G was present>The number of reads for the T mutation site was 175571 (in later analysis we normalized all sequencing results and quantified P53747G collectively as the mutation coefficient SNP Ratio ‰)>Mutation frequency of T, WT: MT 10⁷：10⁵The SNP Ratio value in the experimental group is 8.8139). And in WT: MT 10⁷：10⁴The total sequence reads in the experimental group of (1) were 17010310, the effective reads were 16820607, but for the P53 gene 747G>Reading value of T mutationThe result was considered to be unreliable because the SNP Ratio was small and smaller than the error rate (1 ‰) of the sequencer itself.

In conclusion, the lowest value of the ratio of the mutant fragment to the wild-type fragment detected by Illumina Hiseq routine sequencing was finally determined as: WT: MT 10⁷：10⁵(i.e., 1% mutation frequency).

Example 3: two-step method for enriching and detecting sensitivity test of P53 gene 747G > T mutation

The same mutant-to-wild-type plasmid ratio (i.e., WT: MT ═ 10) was used as in example 2⁷：10⁵；10⁷：10⁴；10⁷：10³；10⁷：10²) The sensitivity detection of P53 gene mutation was carried out after enrichment by the two-step method. Firstly, a streptavidin-coated magnetic bead is utilized to enrich a P53 gene normal sequence (namely, target DNA) hybridized with a PNA probe, and then a capture probe is utilized to capture a mutant gene (namely, liver cancer circulating tumor DNA), and the specific operation steps are as follows:

1. prepare 20 pmol/. mu.l PNA probe aqueous solution: the PNA probe (probe sequence: 5'-AACCGG AGG CCC ATC CT-3', biotin labeling at 5 ' end) of example 1 was dissolved in 100. mu.l of ultrapure water in an EP tube, and the solution was accelerated by heating at 50 ℃. Then diluted with ultrapure water to a concentration of 20 pmol/. mu.l measured by a Nanodrop spectrophotometer.

20 pmol/. mu.l aqueous capture probe solution: the capture probe (5'-AAC CGG AGT CCC ATC CT-3') was dissolved in 100. mu.l of ultrapure water in an EP tube and heated at 50 ℃ to facilitate dissolution. Then diluted with ultrapure water to a concentration of 20 pmol/. mu.l measured by a Nanodrop spectrophotometer.

2. A suspension of magnetic beads in buffer was prepared by placing 50. mu.l (0.5mg) of an EP tube containing streptavidin magnetic beads (Seimearfei, trade name: 65001) on a magnetic separation rack, leaving the supernatant, washing the magnetic beads three times with 1 × Binding and washing (B & W) buffer, and then resuspending the washed beads in 2 × B & W buffer at 50ul to obtain a suspension of 10mg/ml magnetic beads in buffer 2 × B & W, wherein the buffer consists of 10mM Tris-HCl, 1mM EDTA, and 2M NaCl dissolved in ultrapure water, and the pH was 7.5.

3. Preparing a magnetic bead-PNA probe compound, namely taking 50ul of 20pmol/ul PNA probe buffer solution prepared in the step 1, denaturing at 99 ℃ for 10 minutes, standing at 4 ℃ for 5 minutes, mixing with 50ul of 0.01mg/ul magnetic bead buffer solution suspension in the step 2, hybridizing at room temperature for 15 minutes, standing on a magnetic separation frame for 3 minutes, discarding supernatant, washing magnetic beads with 1 × B & W buffer solution for 3 times to remove unbound probes, and adding 50ul 2 × B & W buffer solution for re-suspension to obtain the magnetic bead-PNA probe compound suspension.

4. Removing non-mutated DNA, namely, taking 50 mu l of each PCR amplification product recovered in the step 1 of the embodiment 2, denaturing at 99 ℃ for 10 minutes, standing at 4 ℃ for 5 minutes, adding 50 mu l of the suspension of the magnetic bead-PNA probe complex prepared in the step 3, supplementing the total volume to 100 mu l by using 1 × SSC-Tween hybrid solution (150mM NaCl, 15mM sodium citrate, 0.02% Tween-20 dissolved in ultrapure water and having the pH value of 7.0), placing the suspension in a hybridization furnace (purchased from U.S. UVP company, model HB1000) for hybridization at 50 ℃ for 1 hour, replacing the magnetic bead-PNA probe complex with the same amount of ultrapure water in a control tube, finishing the hybridization with the experiment tube, placing each system on a magnetic separation frame for standing for 2 minutes to perform magnetic separation, obtaining a target DNA-magnetic bead-PNA probe complex, realizing the removal of the non-mutated gene, and leaving a supernatant containing the mutated gene for later use.

5. Construction of mutant DNA libraries: 50. mu.l of the supernatant containing the mutant gene retained above was transferred to a sterile PCR tube and amplified, and the primers (P53-F and P53-R) and conditions for the PCR reaction were as shown in Table 5-Table 7 in example 2, wherein the specific number of cycles is shown in Table 9.

TABLE 9 conversion of PCR template DNA amounts to PCR cycle numbers

Amount of PCR template DNA/ng	Number of cycles
		0.5	12-13
1	11-12
		5	8-9
10	7-8
		50	5-6
100	3-4
		500	1-2

A mutant gene library (obtained) was constructed from the PCR product using a Universal DNA library construction kit (Shanghai assist in san Biotech Co., Ltd., product No. 12200ES08), and the procedure was the same as in step 2 of example 2. Quantification of the step 6 mutant Gene library by Qubit (see

Description of fluorometer operation).

6. Capture of mutant genes:

the experimental procedure was carried out by mixing 1. mu.g of the mutant gene library with 5. mu.l of HyperCap Universal blocking oligo and 5. mu.g of COT Human DNA (both provided in the Roche kit) exactly according to the official specification of the Roche company, v2.3, adding the selected magnetic bead AMPure beads (Roche, trade name: 08286418001) pre-mixed at room temperature in a volume twice the total volume of the mixture, incubating for 10 minutes after vortexing and mixing for 10 seconds, binding the mutant DNA (i.e., 747G > T mutant gene of P53 gene) to the selected magnetic bead AMPXP beads, removing the supernatant after vortexing and slowly adding 190. mu.l of ethanol aqueous solution with a volume concentration of 80% for washing once, obtaining the selected magnetic bead bound with the mutant DNA, adding 7.5. mu.5. mu.l of XP magnetic bead to the selected magnetic bead bound with the mutant DNA, incubating for once, and mixing with the amplified magnetic bead DNA (AMPXP) mixed solution containing the mutant DNA, separating the amplified DNA, cell binding the mutant DNA, dissociating from the selected magnetic bead beads, cell binding the amplified XPBeads, dissociating for 83, and dissociating the amplified DNA after vortexing for 10 minutes, and dissociating the cell DNA (cell).

Adding 10.5 mul of supernatant containing mutant DNA into 4.5 mul of 0.67 pmol/mul of Capture probe aqueous solution (nucleotide sequence is SEQ ID NO.3), performing vortex oscillation mixing, incubating in a hybridization furnace at 95 ℃ for 5 minutes, incubating at 47 ℃ for 16 to 20 hours, adding 50 mul of Capture magnetic Beads Capture Beads (Roche, trade name: 08286418001), performing vortex oscillation mixing at 47 ℃ for 15 minutes in the hybridization furnace, binding mutant genes onto Capture Beads through the Capture probes, adding 100 mul of 1 × Bead Buffer (Roche, trade name: 05634261001), performing vortex oscillation mixing, placing a centrifuge tube on a magnetic shelf, discarding supernatant after supernatant, obtaining Capture Beads bound with mutant genes, adding 200 mul of 1 sh × Buffer (Roche, trade name: 05634261001), performing vortex mixing at 47 ℃ for 5 minutes, placing the centrifuge tube on a magnetic shelf, adding supernatant 1, adding 3578 Buffer, performing vortex mixing, adding supernatant fluid, adding 3578 Buffer, performing vortex mixing, adding 351 Buffer, adding supernatant fluid Buffer, and performing vortex mixing, adding 3510. mu.5. mu.1. Buffer, and finally, adding supernatant, performing vortex oscillation mixing, adding vortex mixing, and adding vortex Wash, and adding supernatant fluid Buffer after vortex mixing.

7. Purification of mutant genes:

(1) to the mutant gene-containing Capture Beads of step 6 (containing 15. mu.l of ultrapure water, total volume of about 20. mu.l) was added 25. mu.l of 2 × Super

II High-Fidelity Mix (Shanghai assist in Sheng Biotechnology Co., Ltd., product number: 12200ES08) and P53-F, P53-R primer (10. mu.M) were mixed by shaking 2.5. mu.l each to complete Post-Capture L M-PCR amplification (see Table 10 for reaction conditions).

TABLE 10 Post-Capture L M-PCR reaction conditions

(2) Mu.l of sorted magnetic beads AMPure XPBeads (Roche, trade name: 08286418001) was added to 50. mu.l of the PCR product, mixed by shaking, and allowed to stand for 5min to bind to the PCR product.

(3) The centrifuge tube was placed on a magnetic stand until the supernatant was clarified and discarded. 200. mu.l of 80% ethanol ultrapure water solution (operation time. gtoreq.30 seconds) was slowly added thereto, and the supernatant was aspirated by a pipette. Repeating the step (3) once.

(4) Standing at room temperature for 5min until the surface of the magnetic beads shows no luster. Adding 53 μ l of ultrapure water, mixing by pipetting, and standing at room temperature for 2 min. The centrifuge tube was placed on a magnetic rack, and after the supernatant was clarified, the supernatant was transferred to a new centrifuge tube. The purified mutant gene was in the supernatant at this time.

(5) And (3) performing quality inspection on the mutant gene by using an Agilent bioanalyzer (see the operational instructions of Agilent 2100 bioanalyzer), and performing Illumina HiSeq sequencing on the mutant gene after the mutant gene is qualified (namely, the library peak pattern is single in peak type, no dispersion, tailing and the like) according to the requirement pooling of effective concentration and target off-machine data quantity.

As shown in FIG. 2, clean reads were obtained by quality pre-processing the raw data with BWA software, inaccurate bases were removed by 3' end sequencing by windowing, trim length was set to 50bp (reads below this length would be discarded) and the results are shown in FIG. 2A. Clean reads were aligned to the p53 genome after two reads for each set of samples to determine the location of the reads on the genome and identify SNP sites in the samples, as shown in FIG. 2B.

After enrichment by the two-step method, the mutant fragment was proportioned to the wild-type fragment (i.e., WT: MT: 10 ═ m⁷：10⁵；10⁷：10⁴；10⁷：10³；10⁷：10²) Mixing, and culturing the P53 gene 747G by the method of example 2>T mutation sensitivity test shows that the lowest value of the ratio of the mutation fragment to the wild type fragment which can be detected is determined as follows: WT: MT 10⁷：10³(0.01%) which is 10 times higher than the control group without enrichment treatment of magnetic bead-PNA probe complex. The technology effectively enriches the mutation to be detected by using a two-step method, solves the technical bottleneck of the current capture sequencing platform in detecting the abundance of the mutation, saves the sequencing cost by reducing the sequencing depth, and has certain social and economic benefits.

Example 4:

1. case description: for patients with clinical diagnosis of liver cancer, the patients were informed to collect tumor tissue and tissue specimens beside cancer in the surgery after consent. Male patients 57 years old, confirmed liver left excisions after 7 months in 2017 as secondary differentiated hepatocellular carcinoma (preoperative liver CT and MR images see a1 and a2 in fig. 3). And (4) postoperative periodic review, which is considered as a liver cancer focus after 4-month hospital admission review in 2018 (liver CT and MR images in the review are shown as B1 and B2 in figure 3), and intestinal adhesion release and complex left liver cancer resection. When the patient was subjected to chemoembolization of hepatic artery in 7 months in 2018 (TACE treatment, a hepatic artery angiography chart shown in C in FIG. 3), the patient was repeatedly examined after discharge, and the condition was not relieved.

2. Two-step method for detecting mutation frequency of P53 gene 747G > T in peripheral blood circulation tumor DNA

We enriched and tested the mutation frequency of P53 gene 747G > T in peripheral blood circulation tumor DNA of patients at different periods (1 month, 3 months, 6 months after hepatic left lobe excision (i.e. 9 months, 11 months and 4 months of 2018) and 1 month after TACE (i.e. 8 months of 2018)) respectively by using the two-step method in example 3, and the specific experimental procedures are as follows:

(1) collecting peripheral blood samples: 10ml of peripheral blood of a patient at different periods is collected by a 2% EDTA anticoagulation tube, a whole blood sample is centrifuged for 30 minutes at 6000g, and upper plasma is taken as a peripheral blood sample.

(2) Extraction of free DNA from peripheral blood samples: using MagMAX^TMA free DNA extraction kit (Saimerfi, trade name: A29319), 1250ml of free DNA binding solution, 15 mu l of Dynal magnetic beads and 1ml of plasma obtained in the step (1) are sequentially added into a centrifuge tube, the mixture is shaken at room temperature for 10 minutes to bind DNA and the magnetic beads, the centrifuge tube is placed on a magnetic frame, the supernatant is discarded after the magnetic beads are completely settled, 500ul of free DNA washing solution is added, the mixture is uniformly mixed by vortex shaking, the centrifuge tube is placed on the magnetic frame, the supernatant is discarded after the magnetic beads are completely settled, 500u L80% ethanol ultrapure water solution is added again, the mixture is uniformly mixed by vortex shaking, the centrifuge tube is placed on the magnetic frame, the supernatant is discarded after the magnetic beads are completely settled, 50 mu l of free DNA eluent is added after the magnetic beads in the centrifuge tube are dried, the centrifuge tube is placed on the magnetic frame, the supernatant is transferred into a new centrifuge tube after the magnetic beads are completely settled, and the free DNA in the plasma is at the.

(3) Capture of non-mutated DNA: the normal P53 gene in the supernatant was adsorbed by using a magnetic bead-PNA probe complex, and the operation was performed in the same manner as in example 3, step 1 to step 4, to obtain a supernatant containing a mutant gene.

(4) Amplification and quantification of mutant DNA: the supernatant containing the mutant gene in step (3) was subjected to PCR amplification using P53-F and P53-R as primers in the same manner as in example 3-step 5. Quantification of the DNA of step (3) using the Qubit (see

Description of fluorometer operation).

(5) Constructing a mutant gene library: the mutant gene library was constructed from the amplified product of step (4) by means of the full-featured DNA library construction kit (product No. 12200ES08) of san-Xiin-sea Biotech Co., Ltd. the procedure was as in step 5 of example 3.

(6) Capture and detection of mutant gene libraries: and (3) carrying out sorting, magnetic bead purification, capture, purification and deep sequencing on the obtained mutant gene library, wherein the operation method is the same as the step 6-step 7 of the embodiment 3.

Circulating DNA (including trace liver cancer circulating tumor DNA) is prepared and purified by carrying out two-step method enrichment and detection on peripheral blood samples of the liver cancer patients in each time period of 1 month, 3 months and 6 months (namely, 9 months, 11 months and 4 months in 2017 and 2018 months) after liver left lobe resection and 1 month (namely, 8 months in 2018) after TACE, wherein P53 gene 747G > T mutation is enriched and detected, after the sequencing result is normalized, the fact that the patients detect the P53 gene 747G > T mutation in the peripheral blood circulating tumor DNA in each time period during postoperative follow-up period is shown, and the mutation coefficient values are sequentially: 11.07; 19.73; 27.02; 65.79, the overall trend is ascending (the mutation coefficient is increased by about 2.5 times in 6 months after the operation compared with that in 1 month after the operation), and the potential recurrence of the tumor is indicated.

By taking the imaging data of the liver cancer patient at 6 months after the operation (the result is shown in B in figure 3, liver cancer is considered by nodules in section IV of the liver, suspicious nodule cancer in section VIII is to be eliminated and confirmed in the pathology after the operation), the assumption that the prognosis of the liver cancer is monitored based on the change of the P53 gene 747G > T mutation coefficient is feasible. Meanwhile, the trace P53 gene 747G > T mutation (mutation coefficient is 11.07) in the plasma free DNA of the tested person is detected at 1 month after the operation, which reveals that the invention has the significance of early diagnosis of residual cancer or relapse and strives for treatment opportunity for patients.

TACE treatment has objective defects, such as missed diagnosis or delayed diagnosis of residual cancer, incomplete embolism, angiogenesis, chemotherapy resistance and the like, so that the long-term curative effect is poor. Even if imaging shows that interventional embolization is relatively complete, it does not mean complete inactivation of tumor cells. In addition, because liver cancer (especially high differentiation, low grade malignant nodule) has the possibility of dual blood supply of hepatic artery and portal vein, the focus of residual cancer is inevitable after TACE operation, especially the focus of blood supply of liver cancer marginal part by portal vein is the main source of residual cancer or recurrence after interventional operation. In this example, we still detected a higher mutation coefficient of the circulating tumor DNA P53 gene 747G > T in the peripheral blood 1 month after TACE treatment (see the result in fig. 3C), suggesting that the patient has improved disease condition in a short period after TACE treatment, but the long-term treatment effect is easy to repeat, and the follow-up in the later period shows that the patient has repeated visits to multiple hospitals after TACE treatment discharge, and the disease condition has not been relieved due to yellow staining of skin and sclera.

In FIG. 3, A1 is the CT image of the preoperative liver of the patient, the left liver shown by the arrow shows a visible circular low-density image with a long diameter of 32mm and obvious reinforcement after enhancement, A2 is the MR image of the preoperative liver of the patient, the left extrahepatic lobe shown by the arrow shows a lump image with a length of about 3.1 × 2.6.6 cm, the boundary is clear and neat, DWI presents a high signal, and a process reinforcement focus at the arterial stage of about 7mm after the hepatic mid-vein is considered liver cancer at the left extrahepatic lobe.

In FIG. 3, B1 is a CT image of half-year after operation, and the low-density nodes near the septal crest of the left intrahepatic lobe are saved by 1.5cm and the reinforcement is observed in the arterial stage, as shown in the dotted circle. B2 is a MR image of half-year after operation, which shows two abnormal signal nodules at the front and back parts of the hepatic vena cava, the greater is about 20mm, DWI shows high signal, and the focus of liver and gall bladder stage shows low signal shadow. Considered as a liver cancer lesion.

Fig. 3C is a photograph of hepatic artery angiography taken by patients in supine position for TACE treatment, after 2% lidocaine local anesthesia, using modified seldinger method, using 18G puncture needle to puncture through right femoral artery, placing in 5F catheter sheath, using 5F RH catheter to perform abdominal artery angiography.

In FIG. 3, D is the tumor specimen left after the liver left outer lobe resection of the liver cancer patient, the tumor specimen is frozen rapidly by liquid nitrogen, RNA is extracted by Trizol method (Saimeishefei company, trade name: 15596026), then the RNA is reverse transcribed into cDNA (Berle company, trade name: 1708891), the P53 full-length fragment is amplified by conventional PCR and sequenced, it can be seen that the CDS region of the P53 gene has 747G > T mutation sites, which is the SNP site enriched and detected by the two-step method.

Compared with the traditional detection method, the method is expected to predict the prognosis of the liver cancer patients earlier than imaging (CT/MRI) by detecting the change of the mutation frequency of the P53 gene 747G > T in the circulating tumor DNA before and after treatment of the liver cancer patients, and the schematic diagram is shown in FIG. 4: the graph shows that the circulating tumor DNA content released into peripheral blood by tumor cells with necrosis, apoptosis, micrometastasis or vigorous proliferation of liver cancer cells is always positively correlated with the number of tumor cells in a patient body no matter in the early-stage lesion or late-stage progression process of liver cancer, and the circulating tumor DNA content can be reflected in time after the patient is treated by operations, chemoradiotherapy and the like.

Sequence listing

<110> Zhejiang university

<120> magnetic bead-PNA probe compound and application of magnetic bead-PNA probe compound in enrichment of circulating tumor DNA of liver cancer

<160>3

<170>SIPOSequenceListing 1.0

<210>1

<211>2591

<212>DNA

<213> Unknown (Unknown)

<400>1

gatgggattg gggttttccc ctcccatgtg ctcaagactg gcgctaaaag ttttgagctt 60

ctcaaaagtc tagagccacc gtccagggag caggtagctg ctgggctccg gggacacttt 120

gcgttcgggc tgggagcgtg ctttccacga cggtgacacg cttccctgga ttggcagcca 180

gactgccttc cgggtcactg ccatggagga gccgcagtca gatcctagcg tcgagccccc 240

tctgagtcag gaaacatttt cagacctatg gaaactactt cctgaaaaca acgttctgtc 300

ccccttgccg tcccaagcaa tggatgattt gatgctgtcc ccggacgata ttgaacaatg 360

gttcactgaa gacccaggtc cagatgaagc tcccagaatg ccagaggctg ctccccccgt 420

ggcccctgca ccagcagctc ctacaccggc ggcccctgca ccagccccct cctggcccct 480

gtcatcttct gtcccttccc agaaaaccta ccagggcagc tacggtttcc gtctgggctt 540

cttgcattct gggacagcca agtctgtgac ttgcacgtac tcccctgccc tcaacaagat 600

gttttgccaa ctggccaaga cctgccctgt gcagctgtgg gttgattcca cacccccgcc 660

cggcacccgc gtccgcgcca tggccatcta caagcagtca cagcacatga cggaggttgt 720

gaggcgctgc ccccaccatg agcgctgctc agatagcgat ggtctggccc ctcctcagca 780

tcttatccga gtggaaggaa atttgcgtgt ggagtatttg gatgacagaa acacttttcg 840

acatagtgtg gtggtgccct atgagccgcc tgaggttggc tctgactgta ccaccatcca 900

ctacaactac atgtgtaaca gttcctgcat gggcggcatg aaccggaggc ccatcctcac 960

catcatcaca ctggaagact ccagtggtaa tctactggga cggaacagct ttgaggtgcg 1020

tgtttgtgcc tgtcctggga gagaccggcg cacagaggaa gagaatctcc gcaagaaagg 1080

ggagcctcac cacgagctgc ccccagggag cactaagcga gcactgccca acaacaccag 1140

ctcctctccc cagccaaaga agaaaccact ggatggagaa tatttcaccc ttcagatccg 1200

tgggcgtgag cgcttcgaga tgttccgaga gctgaatgag gccttggaac tcaaggatgc 1260

ccaggctggg aaggagccag gggggagcag ggctcactcc agccacctga agtccaaaaa 1320

gggtcagtct acctcccgcc ataaaaaact catgttcaag acagaagggc ctgactcaga 1380

ctgacattct ccacttcttg ttccccactg acagcctccc acccccatct ctccctcccc 1440

tgccattttg ggttttgggt ctttgaaccc ttgcttgcaa taggtgtgcg tcagaagcac 1500

ccaggacttc catttgcttt gtcccggggc tccactgaac aagttggcct gcactggtgt 1560

tttgttgtgg ggaggaggat ggggagtagg acataccagc ttagatttta aggtttttac 1620

tgtgagggat gtttgggaga tgtaagaaat gttcttgcag ttaagggtta gtttacaatc 1680

agccacattc taggtagggg cccacttcac cgtactaacc agggaagctg tccctcactg 1740

ttgaattttc tctaacttca aggcccatat ctgtgaaatg ctggcatttg cacctacctc 1800

acagagtgca ttgtgagggt taatgaaata atgtacatct ggccttgaaa ccacctttta 1860

ttacatgggg tctagaactt gacccccttg agggtgcttg ttccctctcc ctgttggtcg 1920

gtgggttggt agtttctaca gttgggcagc tggttaggta gagggagttg tcaagtctct 1980

gctggcccag ccaaaccctg tctgacaacc tcttggtgaa ccttagtacc taaaaggaaa 2040

tctcacccca tcccacaccc tggaggattt catctcttgt atatgatgat ctggatccac 2100

caagacttgt tttatgctca gggtcaattt cttttttctt tttttttttt ttttttcttt 2160

ttctttgaga ctgggtctcg ctttgttgcc caggctggag tggagtggcg tgatcttggc 2220

ttactgcagc ctttgcctcc ccggctcgag cagtcctgcc tcagcctccg gagtagctgg 2280

gaccacaggt tcatgccacc atggccagcc aacttttgca tgttttgtag agatggggtc 2340

tcacagtgtt gcccaggctg gtctcaaact cctgggctca ggcgatccac ctgtctcagc 2400

ctcccagagt gctgggatta caattgtgag ccaccacgtc cagctggaag ggtcaacatc 2460

ttttacattc tgcaagcaca tctgcatttt caccccaccc ttcccctcct tctccctttt 2520

tatatcccat ttttatatcg atctcttatt ttacaataaa actttgctgc cacctgtgtg 2580

tctgaggggt g 2591

<210>2

<211>17

<212>DNA

<213> Unknown (Unknown)

<400>2

aaccggaggc ccatcct 17

<210>3

<211>17

<212>DNA

<213> Unknown (Unknown)

<400>3

aaccggagtc ccatcct 17

Claims

1. An application of a magnetic bead-PNA probe compound in enriching liver cancer circulating tumor DNA is characterized in that the application method comprises the following steps: hybridizing a sample to be detected with the magnetic bead-PNA probe compound to enable non-mutated genes in the sample to be detected to be combined with the magnetic bead-PNA probe compound to form a target DNA-magnetic bead-PNA probe compound, and carrying out magnetic separation to obtain a supernatant containing mutated genes; constructing a mutant gene library after PCR indiscriminately amplifying the supernatant containing the mutant gene, purifying the mutant gene library by adopting sorting magnetic beads, carrying out hybridization reaction with a capture probe, adding a hybridization product into the capture magnetic beads, combining the mutant gene into the capture magnetic beads, and carrying out elution separation to obtain the mutant gene, namely the liver cancer circulating tumor DNA; the capture probe nucleotide sequence is: 5'-AAC CGG AGTCCC ATC CT-3', respectively; the magnetic bead-PNA probe compound is formed by combining magnetic beads and PNA probes, wherein the magnetic beads are coated with streptavidin; the nucleotide sequence of the PNA probe is as follows: 5'-AAC CGG AGG CCC ATC CT-3', biotin labeling was performed at the 5 ' end.

2. The use of claim 1, wherein the magnetic beads are added as a 10mg/ml buffer suspension of magnetic beads.

3. The use of claim 2, wherein the bead buffer suspension is prepared by resuspending streptavidin-coated beads in 2 × B & W buffer to obtain a bead buffer suspension, wherein the volume of 2 × B & W buffer is 50 μ l/0.5mg based on the weight of the beads, and the 2 × B & W buffer is composed of 10mM Tris-HCl, 1mM EDTA, and 2M NaCl dissolved in ultrapure water at pH 7.5.

4. The application of claim 1, wherein the magnetic bead-PNA probe complex is prepared by denaturing an aqueous PNA probe solution at 99 ℃ for 10 minutes, standing at 4 ℃ for 5 minutes, mixing with a magnetic bead buffer solution suspension, hybridizing at room temperature for 15 minutes, standing on a magnetic separation rack for 3 minutes, discarding the supernatant, washing the magnetic beads with 1 × B & W buffer solution to remove unbound probes to obtain the magnetic bead-PNA probe complex, wherein the volume ratio of the aqueous PNA probe solution to the magnetic bead buffer solution suspension is 1:1, the aqueous PNA probe solution is prepared by preparing 20pmol/ul of aqueous PNA probe solution from the PNA probe with ultrapure water, the magnetic beads in the magnetic bead buffer solution suspension are coated with streptavidin, and the content of the magnetic beads is 10 mg/ml.

5. The application of claim 1, wherein the method comprises (1) performing targeted binding of the complex to the non-mutated gene by denaturing a sample to be tested at 99 ℃ for 10 minutes, standing at 4 ℃ for 5 minutes, adding the magnetic bead-PNA probe complex and a hybridization solution to form a reaction system, performing hybridization at 50 ℃ for 1 hour, standing for magnetic separation for 2 minutes to obtain a target DNA-magnetic bead-PNA probe complex and a supernatant containing the mutated gene, and capturing the non-mutated gene, wherein the volume ratio of the sample to be tested to the magnetic bead-PNA probe complex is 1:1, the hybridization solution is supplemented to 100 μ L of the reaction system, and the hybridization solution comprises 150mM NaCl, 15mM sodium citrate, 0.02% Tween-20 and is dissolved in ultrapure water, wherein the pH value is 7.0;

(2) construction of mutant Gene library: taking the supernatant containing the mutant gene in the step (1) as a template, taking P53-F and P53-R as primers to perform PCR reaction, and building a library of the PCR product by adopting a totipotent DNA library building kit to obtain a mutant gene library;

P53-F：TTTTCGACATAGTGTGGT；

P53-R：GTCCCAGTAGATTACCACT；

(3) capture of mutant genes: purifying the mutant gene library obtained in the step (2) by sorting magnetic beads, adding a capture probe, performing vortex oscillation and uniform mixing, incubating at 95 ℃ for 5 minutes in a hybridization furnace, incubating at 47 ℃ for 16-20 hours, and obtaining a hybridization product by using an oligonucleotide molecular hybridization technology; capturing the mutant gene by the hybridized product by using capture magnetic beads, and purifying to obtain the mutant gene, namely liver cancer circulating tumor DNA; the capture probe nucleotide sequence is: 5'-AAC CGG AGT CCC ATC CT-3' are provided.

6. The application of claim 5, wherein the mutant gene is captured by using a targeted enrichment kit in the step (3), 1 μ g of a mutant gene library is uniformly mixed with 5 μ l of HyperCap Universal blocking oligonucleotide and 5 μ g of COT human DNA, room-temperature pre-mixed sorting magnetic Beads with a volume twice of the total volume of the mixture are added, vortex shaking and uniform mixing is carried out for 10 seconds, the mutant gene is bound to the sorting magnetic Beads, after magnetic separation, the supernatant is removed and slowly added with 190 μ l of 80% ethanol ultrapure aqueous solution with a volume concentration, the sorting magnetic Beads bound with the mutant gene are obtained, 7.5 μ l of 2 × hybrid Buffer solution and 3 μ l of hybrid component A mixed solution are added to the sorting magnetic Beads, vortex shaking and uniform mixing is carried out for 2 minutes at room temperature, the mutant gene and the sorting magnetic Beads are dissociated for obtaining supernatant containing the mutant gene, 4.5 μ l of 0.6780 μ l/μ l of Capture probe aqueous solution is added to each 10.5 μ l of mutant gene-containing supernatant, vortex shaking and uniform mixing is carried out for 2 minutes at room temperature, the mutant gene is dissociated from the sorting magnetic Beads, the mutant gene and the magnetic Beads are added to the sorting magnetic Beads, after vortex washing, the supernatant is obtained, after vortex washing, the supernatant is carried out for 2 minutes, after vortex mixing, the vortex washing, the supernatant is carried out for 2 minutes, the supernatant is added to 50 μ l of 5 μ l of the supernatant, after vortex washing Buffer solution, the supernatant is added to the supernatant, the supernatant is added to 200 μ l of the supernatant, after vortex washing Buffer solution, the supernatant is added to 200 μ l of the supernatant, the supernatant is added to the supernatant, after vortex washing Buffer 5 μ l of the supernatant is added to the supernatant, the supernatant is added to the supernatant, after vortex washing Buffer 5 μ l of the supernatant is added to the supernatant, the supernatant is added to the supernatant.

7. The use according to claim 5, wherein the mutant gene is purified in step (3) by adding 25. mu.l of 2 × Super to 20. mu.l of an aqueous suspension of magnetic beads containing the mutant gene

II, preparing a high-fidelity enzyme premix, 2.5 mul of 10 mu MP53-F primer and 2.5 mul of 10 mu M P53-R primer, after the capture, L M-PCR reaction is carried out, amplification products are obtained, (2) 90 mul of sorting magnetic beads are added into 50 mul of amplification products, the mixture is shaken and mixed evenly, the mixture is kept stand for 5min, magnetic separation is carried out, after the supernatant is clarified, the supernatant is discarded, 200 mul of freshly prepared 80% ethanol ultrapure water solution with the concentration is slowly added, the mixture is washed twice, the mixture is kept stand for 5min at room temperature until the surfaces of the magnetic beads are matt, and 53 mu of the mixture is addedl, blowing and uniformly mixing ultrapure water by using a pipettor, standing for 2min at room temperature, performing magnetic separation to obtain supernatant, and taking the supernatant, namely the liver cancer circulating tumor DNA; the sorting magnetic Beads are AMPure XP Beads.