WO2019115090A1 - Vaccin félin multivalent - Google Patents

Vaccin félin multivalent Download PDF

Info

Publication number
WO2019115090A1
WO2019115090A1 PCT/EP2018/080106 EP2018080106W WO2019115090A1 WO 2019115090 A1 WO2019115090 A1 WO 2019115090A1 EP 2018080106 W EP2018080106 W EP 2018080106W WO 2019115090 A1 WO2019115090 A1 WO 2019115090A1
Authority
WO
WIPO (PCT)
Prior art keywords
fcv
feline
capsid protein
rna replicon
antigenic fragment
Prior art date
Application number
PCT/EP2018/080106
Other languages
English (en)
Inventor
Zhichang Xu
Rhonda Lafleur
Ian Tarpey
Original Assignee
Intervet International B.V.
Intervet Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Intervet International B.V., Intervet Inc. filed Critical Intervet International B.V.
Priority to US16/760,160 priority Critical patent/US11167027B2/en
Priority to CA3080087A priority patent/CA3080087A1/fr
Priority to AU2018383915A priority patent/AU2018383915B9/en
Priority to JP2020524411A priority patent/JP7427585B2/ja
Priority to EP18803574.5A priority patent/EP3706790A1/fr
Priority to RU2020122007A priority patent/RU2797538C2/ru
Priority to BR112020008955-9A priority patent/BR112020008955A2/pt
Publication of WO2019115090A1 publication Critical patent/WO2019115090A1/fr
Priority to US17/488,961 priority patent/US11730809B2/en
Priority to AU2022209359A priority patent/AU2022209359A1/en
Priority to JP2023158724A priority patent/JP2023179547A/ja

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/118—Chlamydiaceae, e.g. Chlamydia trachomatis or Chlamydia psittaci
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A61K39/295—Polyvalent viral antigens; Mixtures of viral and bacterial antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/70—Multivalent vaccine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/16011—Herpesviridae
    • C12N2710/16611—Simplexvirus, e.g. human herpesvirus 1, 2
    • C12N2710/16634—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011—Details
    • C12N2750/14011—Parvoviridae
    • C12N2750/14034—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011—Details
    • C12N2770/16011—Caliciviridae
    • C12N2770/16034—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011—Details
    • C12N2770/36011—Togaviridae
    • C12N2770/36111—Alphavirus, e.g. Sindbis virus, VEE, EEE, WEE, Semliki
    • C12N2770/36141—Use of virus, viral particle or viral elements as a vector
    • C12N2770/36143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector

Definitions

  • the present invention relates to new multivalent vaccines for felines.
  • Feline respiratory disease includes those illnesses typified by rhinosinusitis, conjunctivitis, lacrimation, salivation, and oral ulcerations.
  • the two most common pathogens associated with upper respiratory disease in cats are feline calicivirus (FCV) and feline viral rhinotracheitis virus (FVR), which is also known as feline herpesvirus type 1 virus (FHV-1 ). These two feline viruses are considered responsible for approximately 80% of all feline respiratory disease, worldwide.
  • a bacterium, Chlamydophila felis is a third pathogen that also can play a role in feline respiratory disease. Accordingly, vaccines against these three pathogens are now commercially available.
  • FVR is an alphaherpesvirus that is related to canine herpesvirus- 1 and is perhaps the most important of the cat respiratory pathogens.
  • FVR is a large, enveloped DNA virus that is extremely contagious and can lead to severe disease in kittens, as well as cats. Accordingly, most cats are exposed to FVR during their lifetime.
  • the commercially available Nobivac ® Feline-1 vaccine contains a modified live feline viral rhinotracheitis virus. The most common characteristic and clinical signs of FCV infection are the development of vesicles (ulcers) on the tongue and oral mucosa, which begin as small, individual, ulcers but can spread and affect a large part of the tongue. Fever often also is observed in infected cats.
  • FCV Certain strains of FCV also cause a disease in cats known as limping syndrome, which is characterized by fever, joint and muscle soreness (limping), and occasional lingual/oral ulceration.
  • some strains of FCV have been associated with chronic stomatitis in infected cats. Cats infected with FCV may become persistently infected, and may shed infectious virus for long periods of time.
  • FCV isolates are antigenically highly variable, and antibodies from cats vaccinated with older vaccine strains of FCV, such as FCV F9, do not efficiently neutralize all current field isolates. Moreover, new FCV strains associated with systemic disease and high mortality have been identified [see e.g., U.S. 7,449,323 B2] These“virulent systemic” (VS-FCV) isolates are responsible for localized outbreaks, and current vaccines also do not appear to protect cats from disease caused by these strains.
  • VS-FCV virulent systemic
  • FCV comprises a single-stranded, positive-sense RNA genome consisting of three open reading frames (ORFs).
  • ORFs open reading frames
  • the genome is polyadenylated at the 3’ end and bound by a virally-encoded protein at the 5’-end.
  • the first open reading frame encodes a viral protease and an RNA-dependent RNA polymerase, which are expressed on a single polypeptide. This polypeptide then is post-translationally cleaved by the viral protease.
  • the second open reading frame encodes the major capsid protein (i.e., the FCV capsid protein), which has six regions denoted as A-F [Scott et al., 60 Am. J. Vet. Res. ⁇ 652-658 (1999)].
  • Region A is cleaved to produce the mature capsid protein.
  • regions B, D, and F of ORF2 are relatively conserved between FCV isolates, regions C and E are variable, with region E of ORF2 containing the major B-cell epitopes [see, Radford et al., 38(2) Vet Res. ⁇ 319- 335 (2007)].
  • ORF 3 encodes a minor structural protein [Sosnovtsev and Green, 277 Virology. 193-203 (2000)].
  • Chlamydophila felis is a bacterium that is endemic among domestic cats worldwide. C. felis can lead to inflammation of conjunctiva, rhinitis, and respiratory problems in the infected cat C.
  • felis has a relatively small genome that encodes only about a thousand proteins. This bacterium also contains a plasmid comprising 75,000 base pairs.
  • the commercially available Nobivac ® Feline-1 vaccine contains a modified live Chlamydophila felis.
  • feline leukemia virus FeLV
  • feline panleukopenia FPV or FPLV
  • rabies virus rabies virus
  • Feline leukemia virus is a retrovirus that infects domestic cats, resulting in significant morbidity and mortality worldwide. Though predominantly transmitted through saliva, FeLV has been reported also to be spread through contact with body fluids [Pacitti et ai, Vet Rec 118:381-384 (1986) doi:10.1136/vr.118.14.381 ; Levy et ai, J Feline Med Surg 10:300-316 (2008) doi:10.1016/j.jfms.2008.03.002].
  • the clinical signs in cats observed during FeLV infections include: cytoproliferative disorders (lymphoid or myeloid tumors), cytosuppressive disorders (infectious diseases associated with immunosuppression, anemia, myelosuppression), inflammatory disorders, neurological disorders, abortions, and enteritis [Hoover et ai., J Am Vet Med Assoc 199:1287-1297 (1991 ); Levy and Crawford, Textbook of Veterinary Internal Medicine, 6th ed (Ettinger SJ, Feldman EC., eds.) WB Saunders,
  • FeLV frequently establishes a lasting infection with a concomitant persistent viremia, often leading to the death of the host cat.
  • the single stranded RNA genome of FeLV encodes only three genes: (i) an ENV gene, which encodes the envelope glycoprotein, (ii) a GAG gene, which encodes the major structural components of the virus, and (iii) a POL gene, which encodes the RNA polymerase [Thomsen et al., Journal of General Virology
  • the FeLV envelope (ENV) gene encodes a gp85 precursor protein which is proteolytically processed by one or more cellular enzymes to yield the major envelope glycoprotein gp70 and the associated transmembrane protein p15E [DeNoronha, et al., Virology 85:617-621 (1978); Nunberg et al., PNAS
  • the transmembrane protein p15E contains a sequence conserved among gammaretroviruses with immunosuppressive properties [Mathes et al., Nature 274:687-689 (1978)]. Recently, The European Medicines Agency's Committee for Medicinal Products for Veterinary Use (CVMP) has adopted a positive opinion for a vaccine comprising a recombinant p45 FeLV-envelope antigen derived from the gp70 surface glycoprotein of the FeLV subgroup A that is expressed in Escherichia coli as active substance.
  • CVMP European Medicines Agency's Committee for Medicinal Products for Veterinary Use
  • the FeLV envelope glycoprotein is the target of FeLV-specific cytotoxic T cell responses, as well as neutralizing antibodies and accordingly, one of the major immunogens of FeLV [Flynn et al., J. Virol. 76(5): 2306-2315 (2002)].
  • Feline panleukopenia is a highly contagious viral disease of cats that is often fatal.
  • the name panleukopenia derives from the low white blood cell count (leucocytes) exhibited by affected animals.
  • FPLV infects and destroys actively dividing cells in lymphoid tissues, bone marrow, intestinal epithelium, and in very young kittens, the retina and cerebellum.
  • the virus also may spread in pregnant cats transplacentally to cause embryonic resorption, fetal mummification, stillbirth, or abortion.
  • Infected cats shed the virus in their urine, stool, and nasal secretions resulting in infection in susceptible cats when they come in contact with these secretions or fleas from infected cats.
  • the clinical signs due to an FPLV infection have also been labeled as feline distemper or feline parvo.
  • Feline panleukopenia virus is a member of the genus Parvovirus, in the family Parvoviridae. Accordingly, FPLV is closely related to mink enteritis virus and canine Type 2 parvovirus (CPV-2). FPLV has a single stranded DNA genome that has been sequenced [see, Liu et al., Genome Announc. Mar-Apr; 3(2) (2015):
  • the commercially available Nobivac ® Feline-1 vaccine contains a modified live feline panleukopenia virus.
  • Rabies is a preventable zoonotic disease that leads to inflammation of the brain in humans and other mammals.
  • Clinical rabies is an acute, progressive encephalitis that is typically classified as either furious or paralytic rabies.
  • Furious rabies is characterized by restlessness, irritability and aggression.
  • Paralytic rabies is characterized by excessive salivation, deep, labored breathing, paralysis, and eventually coma.
  • the causative agent of rabies is the rabies virus, which is capable of infecting most mammals, including felines, and maintains a reservoir of disease in wild and susceptible domestic animals.
  • the rabies virus is an enveloped, RNA virus that encodes five structural proteins: a nucleoprotein (N), a phosphoprotein (P), a matrix protein (M), a glycoprotein (G), and an RNA-dependent RNA polymerase [Dietzschold et al. , Crit Rev Immunol 10:427-439 (1991 )].
  • the glycoprotein (G) is considered the protective antigen which induces virus neutralizing antibodies [Cox et al., Infect Immun 16:754- 759 (1977)].
  • Several types of rabies vaccines have been produced to combat this disease. Inactivated cell culture derived whole-virus killed rabies virus vaccines are the most commonly used vaccines in the United States.
  • RP alphavirus-derived replicon RNA particles
  • VEE Venezuelan equine encephalitis virus
  • SIN Sindbis
  • SFV Semliki Forest virus
  • RP vaccines deliver propagation-defective alphavirus RNA replicons into host cells and result in the expression of the desired antigenic transgene(s) in vivo [Pushko et ai, Virology 239(2):389-401 (1997)]. RPs have an attractive safety and efficacy profile when compared to some traditional vaccine formulations [Vander Veen, et al. Anim Health Res Rev. 13(1 ): 1 -9. (2012) ]. The RP platform has been used to encode pathogenic antigens and is the basis for several USDA-licensed vaccines for swine and poultry.
  • alphavirus RNA replicon particles and in particular Venezuelan Equine Encephalitis (VEE) alphavirus RNA replicon particles, have been reported to catalyze a systemic antiviral state and protect against lethal virus challenge
  • the present invention includes immunogenic compositions that comprise alphavirus RNA replicon particles that encode one or more antigens from one or more feline pathogens along with one or more modified live feline pathogens. All of the immunogenic compositions of the present invention also may be used in multivalent vaccines. In a particular embodiment of this type, the vaccinated subject is a feline. In a more particular embodiment, the vaccinated subject is a domestic cat. Methods of making and using the immunogenic compositions and vaccines of the present invention are also provided. In particular embodiments, the immunogenic compositions comprise alphavirus RNA replicon particles that encode one or more feline calicivirus (FCV) antigens and a modified live feline pathogen. In other embodiments, the
  • immunogenic compositions comprise alphavirus RNA replicon particles that encode one or more feline leukemia virus (FeLV) antigens and a modified live feline pathogen.
  • the immunogenic compositions comprise alphavirus RNA replicon particles that encode one or more rabies virus antigens and a modified live feline pathogen.
  • the modified live feline pathogen is a feline viral rhinotracheitis virus (FVR).
  • the modified live feline pathogen is a feline panleukopenia virus (FPLV).
  • the modified live feline pathogen is a modified live Chlamydophila felis.
  • the modified live feline pathogen is a modified live F9-like feline calicivirus (FCV F9-Like).
  • the modified live feline pathogen is a modified live Bordetella bronchiseptica.
  • the present invention further provides immunogenic compositions that comprise any combination of these alphavirus RNA replicon particles and modified live feline pathogens.
  • the immunogenic composition comprises alphavirus RNA replicon particles encoding an FCV antigen, alphavirus RNA replicon particles encoding an FeLV antigen, a modified live FVR, a modified live FPLV, and a modified live Chlamydophila felis.
  • the immunogenic compositions comprise alphavirus RNA replicon particles that encode an FCV capsid protein.
  • the FCV capsid protein is an FCV F9-Like capsid protein.
  • the alphavirus RNA replicon particle encodes an antigenic fragment of an FCV F9-Like capsid protein.
  • the FCV capsid protein is a virulent systemic FCV (VS-FCV) capsid protein.
  • the alphavirus RNA replicon particle encodes an antigenic fragment of a VS-FCV capsid protein.
  • the alphavirus RNA replicon particle encodes both an FCV F9-Like capsid protein or antigenic fragment thereof, and an VS-FCV capsid protein or antigenic fragment thereof.
  • the immunogenic compositions comprise alphavirus RNA replicon particles that encode a VS-FCV capsid protein or antigenic fragment thereof in which the VS-FCV capsid protein comprises an amino acid sequence comprising 95% identity or more with the amino acid sequence of SEQ ID NO: 2.
  • the VS-FCV capsid protein comprises the amino acid sequence of SEQ ID NO: 2.
  • the VS-FCV capsid protein is encoded by the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 12.
  • an alphavirus RNA replicon particle of the present invention encodes a FCV F9-Like capsid protein or antigenic fragment thereof.
  • the FCV F9-Like capsid protein comprises an amino acid sequence comprising 95% identity or more with the amino acid sequence of SEQ ID NO: 4. In more specific embodiments, the FCV F9-Like capsid protein comprises the amino acid sequence of SEQ ID NO: 4. In even more specific embodiments of this type, the FCV F9-Like capsid protein is encoded by the nucleotide sequence of SEQ ID NO: 3 or SEQ ID NO: 13.
  • the immunogenic compositions comprise alphavirus RNA replicon particles that encode one or more feline leukemia virus (FeLV) antigens.
  • the FeLV antigen is a FeLV glycoprotein ⁇ e.g., gp85).
  • the alphavirus RNA replicon particle encodes an antigenic fragment of the FeLV gp85.
  • the antigenic fragment of the FeLV glycoprotein is FeLV gp70.
  • the antigenic fragment of the FeLV glycoprotein is FeLV gp45.
  • the FeLV gp85 comprises an amino acid sequence comprising 95% identity or more with the amino acid sequence of SEQ ID NO: 6.
  • the FeLV gp85 comprises the amino acid sequence of SEQ ID NO: 6. In even more specific embodiments of this type, the FeLV gp85 is encoded by the nucleotide sequence of SEQ ID NO: 5 or SEQ ID NO: 14. In related embodiments, the FeLV gp70 comprises an amino acid sequence comprising 95% identity or more with the amino acid sequence of SEQ ID NO: 8. In more specific embodiments of this type, the FeLV gp70 comprises the amino acid sequence of SEQ ID NO: 8. In even more specific embodiments of this type, the FeLV gp70 is encoded by the nucleotide sequence of SEQ ID NO: 7 or SEQ ID NO: 15.
  • the alphavirus RNA replicon particles that encode a rabies virus glycoprotein (G).
  • the alphavirus RNA replicon particles encode an antigenic fragment of the rabies virus G.
  • the rabies virus G comprises an amino acid sequence comprising 95% identity or more with the amino acid sequence of SEQ ID NO: 10.
  • the rabies virus G comprises the amino acid sequence of SEQ ID NO: 10.
  • the rabies virus G is encoded by the nucleotide sequence of SEQ ID NO: 9 or SEQ ID NO: 16.
  • the alphavirus RNA replicon particle is a
  • Venezuelan Equine Encephalitis (VEE) alphavirus RNA replicon particle is a TC- 83 VEE alphavirus RNA replicon particle.
  • the alphavirus RNA replicon particle is a Sindbis (SIN) alphavirus RNA replicon particle.
  • the alphavirus RNA replicon particle is a Semliki Forest virus (SFV) alphavirus RNA replicon particle.
  • a naked DNA vector encodes one or more antigens that originate from one or more feline pathogens.
  • the naked DNA vectors encode an FCV capsid protein or antigenic fragment thereof.
  • the naked DNA vectors encode an VS-FCV capsid protein or antigenic fragment thereof.
  • the naked DNA vectors encode an FeLV gp85, or antigenic fragment thereof.
  • the immunogenic compositions can include at least one modified live feline pathogen and alphavirus RNA replicon particles that encode one or more FCV capsid proteins or antigenic fragments thereof, one or more FeLV glycoproteins or antigenic fragments thereof, and/or one or more rabies virus G proteins or antigenic fragments thereof.
  • the alphavirus RNA replicon particles encode both a VS-FCV capsid protein or an antigenic fragment thereof, and an FCV F9-Like capsid protein or an antigenic fragment thereof.
  • the alphavirus RNA replicon particles encode both a VS-FCV capsid protein or an antigenic fragment thereof, and an FeLV gp85 or an antigenic fragment thereof. In other embodiments, the alphavirus RNA replicon particles encode both a FCV F9-Like capsid protein or an antigenic fragment thereof, and an FeLV gp85 or an antigenic fragment thereof. In alternative embodiments, the alphavirus RNA replicon particles encode both a VS-FCV capsid protein or an antigenic fragment thereof, and a rabies virus G protein or an antigenic fragment thereof.
  • the alphavirus RNA replicon particles encode both a FCV F9-Like capsid protein or an antigenic fragment thereof, and a rabies virus G protein or an antigenic fragment thereof. In still other embodiments, the alphavirus RNA replicon particles encode a VS-FCV capsid protein or an antigenic fragment thereof, an FeLV gp85 or an antigenic fragment thereof, and a rabies virus G protein or an antigenic fragment thereof. In alternative embodiments, the alphavirus RNA replicon particles encode a VS-FCV capsid protein or an antigenic fragment thereof, a FCV F9-Like capsid protein or an antigenic fragment thereof, and an FeLV gp85 or an antigenic fragment thereof. In yet other
  • the alphavirus RNA replicon particles encode a VS-FCV capsid protein or an antigenic fragment thereof, an FeLV gp85 or an antigenic fragment thereof, a rabies virus G protein or an antigenic fragment thereof, and an FCV F9-Like capsid protein or an antigenic fragment thereof.
  • the alphavirus RNA replicon particles encode an FeLV gp85 or an antigenic fragment thereof, and a rabies virus G protein or an antigenic fragment thereof.
  • the alphavirus RNA replicon particles encode an FeLV gp85 or an antigenic fragment thereof, an FCV F9-Like capsid protein or an antigenic fragment thereof, and a rabies virus G protein or an antigenic fragment thereof.
  • the present invention provides immunogenic compositions that include at least one modified live feline pathogen and any one or more of the alphavirus RNA replicon particles of the present invention that encode multiple feline pathogen antigens, and/or any one or more alphavirus RNA replicon particles of the present invention that encode a single feline pathogen antigen.
  • the modified live feline pathogen is a modified live FVR.
  • the modified live feline pathogen is a modified live FPLV.
  • the modified live feline pathogen is a modified live Chlamydophila felis.
  • the modified live feline pathogen is a modified live FCV F9-Like.
  • the modified live feline pathogen is a modified live Bordetella bronchiseptica.
  • two or more modified live feline pathogens are included in the immunogenic composition.
  • the immunogenic composition comprises a modified live FVR and a modified live Chlamydophila.
  • three or more modified live feline pathogens are included in the immunogenic
  • the immunogenic composition comprises a modified live FVR, a modified live Chlamydophila, and a modified live feline pathogen is an FPLV. In still other embodiments, four or more modified live feline pathogens are included in the immunogenic composition. In specific embodiments of this type, the immunogenic composition comprises a modified live FVR, a modified live Chlamydophila, a modified live FPLV, and a modified live F9-Like FCV.
  • all of the alphavirus RNA replicon particles in the immunogenic composition are Venezuelan Equine Encephalitis (VEE) alphavirus RNA replicon particles. In yet more specific embodiments, all of VEE alphavirus RNA replicon particles in the immunogenic compositions are TC-83 VEE alphavirus RNA replicon particles.
  • alphavirus RNA replicon particles can encode protein antigens (or antigenic fragments thereof) that originate from other feline pathogens.
  • the protein antigen originates from a feline pneumovirus (FPN).
  • the protein antigen originates from feline parvovirus (FPV).
  • the protein antigen originates from feline infectious peritonitis virus (FIPV).
  • the protein antigen originates from feline immunodeficiency virus.
  • the protein antigen originates from borna disease virus (BDV).
  • the protein antigen originates from feline influenza virus.
  • the protein antigen originates from feline coronavirus (FCoV).
  • FCoV feline coronavirus
  • the present invention further provides immunogenic compositions and/or vaccines (multivalent vaccines) that include the alphavirus RNA replicon particles of the present invention together with one or more modified live ⁇ e.g., attenuated) feline pathogens of the present invention, together with a killed feline pathogen.
  • the immunogenic compositions can further comprise a killed Chlamydophila felis, and/or killed FVR, and/or killed F9-like FCV, and/or killed VS-FCV, and/or killed FeLV, and/or killed FPLV.
  • vaccines comprise an immunologically effective amount of one or more of these immunogenic compositions.
  • the present invention further comprises vaccines and multivalent vaccines that comprise the immunogenic compositions of the present invention.
  • the multivalent vaccines are nonadjuvanted vaccines.
  • the vaccine aids in the prevention of disease due to FCV, and/or FeLV, and/or FVR, and/or FPLV, and/or rabies virus, and/or Chlamydophila felis.
  • antibodies are induced in a feline subject when the feline is immunized with the vaccine.
  • the present invention further includes all of the alphavirus RNA replicon particles and the naked DNA vectors of the present invention.
  • the present invention also provides methods of immunizing a feline against a feline pathogen, e.g., FCV, comprising administering to the feline an immunologically effective amount of a vaccine or multivalent vaccine of the present invention.
  • the vaccine is administered via intramuscular injection.
  • the vaccine is administered via subcutaneous injection.
  • the vaccine is administered via intravenous injection.
  • the vaccine is administered via intradermal injection.
  • the vaccine is administered via transdermal injection.
  • the vaccine is administered via oral administration.
  • the vaccine is administered via intranasal administration.
  • the feline is a domestic cat.
  • the vaccines and multivalent vaccines of the present invention can be administered as a primer vaccine and/or as a booster vaccine.
  • a vaccine of the present invention is administered as a one shot vaccine (one dose), without requiring subsequent administrations.
  • the primer vaccine and the booster vaccine can be administered by the identical route.
  • the primer vaccine and the booster vaccine are both administered by subcutaneous injection.
  • the administration of the primer vaccine can be performed by one route and the booster vaccine by another route.
  • the primer vaccine can be administered by subcutaneous injection and the booster vaccine can be administered orally.
  • the invention further provides for a method of immunizing a feline against FCV comprising injecting the feline with an immunologically effective amount of the above described inventive vaccines.
  • the vaccines can include from about 1 x 10 4 to about 1 x 10 10 RPs or higher, for example.
  • the vaccines can include from about 1 x 10 5 to about 1 x 10 9 RPs.
  • the vaccines can include from about 1 x 10 6 to about 1 x 10 8 RPs.
  • the feline is a domestic cat.
  • the vaccines of the present invention are administered in 0.05 ml_ to 3 ml_ doses.
  • the dose administered is 0.1 ml_ to 2 ml_s.
  • the dose administered is 0.2 ml_ to 1 .5 ml_s.
  • the dose administered is 0.3 to 1 .0 ml_s.
  • the dose administered is 0.4 ml_ to 0.8 ml_s.
  • the present invention provides safe and efficacious multivalent vaccines.
  • the vaccine is nonadjuvanted.
  • the vaccines do not induce feline injection-site sarcomas, yet still aid in the protection of the vaccinates from disease caused by infections by feline calicivirus (FCV) and/or feline leukemia virus (FeLV), and infections by feline viral rhinotracheitis virus (FVR), and/or feline panleukopenia virus (FPLV), and/or live Chlamydophila felis.
  • FCV feline calicivirus
  • FeLV feline leukemia virus
  • FVR feline viral rhinotracheitis virus
  • FPLV feline panleukopenia virus
  • the multivalent vaccines of the present invention which comprise both alphavirus RNA replicon particles and modified live viruses, are unexpectedly safe and efficacious, without the alphavirus RNA replicon particles significantly interfering with the immunological effect of the modified live viruses.
  • alphavirus RNA replicon particles and in particular Venezuelan Equine Encephalitis (VEE) alphavirus RNA replicon particles, have previously been shown to catalyze a systemic antiviral state and protect against lethal virus challenge
  • VEE alphavirus RNA replicon particles have been reported to induce rapid protection against foot- and-mouth disease virus [Segundo et ai, J. Virol., 87 (10):5447-5460 (2013)].
  • vaccines comprising both alphavirus RNA replicon particles and modified live viruses would lead to a substantial inhibition of the immunological effect of the modified live viruses.
  • the enhancement of the innate immune response due to the presence of the alphavirus RNA replicon particles surprisingly proved not to be detrimental to the immune response induced by the accompanying modified live viruses.
  • the present invention provides vaccines that comprise alphavirus RNA replicon particles that encode an FCV capsid protein or antigenic fragment thereof and/or an FeLV gp85 or antigentic fragment thereof, along with a modified live feline FVR, and/or a modified live FPLV, and/or a modified live Chlamydophila felis.
  • the vaccines comprise naked DNA vectors that encode an FCV capsid protein or antigenic fragment thereof and/or an FeLV gp85 or antigentic fragment thereof, along with a modified live feline FVR, and/or a modified live FPLV, and/or a modified live Chlamydophila felis.
  • the vaccines of the present invention can be administered to a feline in the absence of an adjuvant and still effectively aid in the protection of the vaccinated feline against FCV.
  • a polypeptide includes reference to one or more of such polypeptides.
  • reference to an "alphavirus RNA replicon particle” includes reference to a plurality of such alphavirus RNA replicon particles, unless otherwise indicated.
  • a composition containing "approximately” 1 x 10 8 alphavirus RNA replicon particles per milliliter contains from 0.5 x 10 8 to 1 .5 x 10 8 alphavirus RNA replicon particles per milliliter.
  • feline refers to any member of the Felidae family. Domestic cats, pure-bred and/or mongrel companion cats, and wild or feral cats are all felines.
  • replicon refers to a modified RNA viral genome that lacks one or more elements ⁇ e.g., coding sequences for structural proteins) that if they were present, would enable the successful propagation of the parental virus in cell cultures or animal hosts. In suitable cellular contexts, the replicon will amplify itself and may produce one or more sub-genomic RNA species.
  • RP alphavirus RNA replicon particle
  • structural proteins e.g., the capsid and glycoproteins, which also are derived from an alphavirus, e.g., as described by Pushko et al., [Virology 239(2):389-401 (1997)].
  • An RP cannot propagate in cell cultures or animal hosts (without a helper plasmid or analogous component), because the replicon does not encode the alphavirus structural components (e.g., capsid and glycoproteins).
  • FCV F9-Like and“F9-Like FCV” are used interchangeably with each other and with the term“classical FCV” and as used herein is an FCV that can be characterized as an older and formerly, universal vaccine strain of FCV, for which the FCV F9 strain is considered a typical representative.
  • FCV termed virulent systemic“VS-FCV” or as used herein interchangeably“(VS) FCV” is a newer class of FCV, which is unusually virulent, and cannot be
  • the terms“originate from”,“originates from” and“originating from” are used interchangeably with respect to a given protein antigen and the pathogen or strain of that pathogen that naturally encodes it, and as used herein signify that the unmodified and/or truncated amino acid sequence of that given protein antigen is encoded by that pathogen or strain of that pathogen.
  • the coding sequence, within a nucleic acid construct of the present invention for a protein antigen originating from a pathogen may have been genetically manipulated so as to result in a modification and/or truncation of the amino acid sequence of the expressed protein antigen relative to the corresponding sequence of that protein antigen in the pathogen or strain of pathogen (including naturally attenuated strains) it originates from.
  • the terms“protecting”, or“providing protection to”, or “eliciting protective immunity to”,“aids in prevention of disease”, and “aids in the protection” do not require complete protection from any indication of infection.
  • “aids in the protection” can mean that the protection is sufficient such that, after challenge, symptoms of the underlying infection are at least reduced, and/or that one or more of the underlying cellular, physiological, or biochemical causes or mechanisms causing the symptoms are reduced and/or eliminated.
  • “reduced,” as used in this context means relative to the state of the infection, including the molecular state of the infection, not just the physiological state of the infection.
  • a "vaccine” is a composition that is suitable for application to an animal, e.g., feline (including, in certain embodiments, humans, while in other embodiments being specifically not for humans) comprising one or more antigens typically combined with a pharmaceutically acceptable carrier such as a liquid containing water, which upon administration to the animal induces an immune response strong enough to minimally aid in the protection from a disease arising from an infection with a wild-type micro-organism, i.e., strong enough for aiding in the prevention of the disease, and/or preventing, ameliorating or curing the disease.
  • feline including, in certain embodiments, humans, while in other embodiments being specifically not for humans
  • a pharmaceutically acceptable carrier such as a liquid containing water
  • a multivalent vaccine is a vaccine that comprises two or more different antigens.
  • the multivalent vaccine stimulates the immune system of the recipient against two or more different pathogens.
  • adjuvant and “immune stimulant” are used interchangeably herein, and are defined as one or more substances that cause stimulation of the immune system.
  • an adjuvant is used to enhance an immune response to one or more vaccine antigens/isolates.
  • adjuvants are agents that nonspecifically increase an immune response to a particular antigen, thus reducing the quantity of antigen necessary in any given vaccine, and/or the frequency of injection necessary in order to generate an adequate immune response to the antigen of interest.
  • an adjuvant is used to enhance an immune response to one or more vaccine antigens/isolates.
  • the American Association of Feline Practitioners Feline Vaccination Guidelines suggest the use of nonadjuvanted FeLV vaccines [AAFP Feline Advisory Panel, 15: 785-808 (2013)].
  • a“nonadjuvanted vaccine” is a vaccine or a multivalent vaccine that does not contain an adjuvant.
  • pharmaceutically acceptable is used adjectivally to mean that the modified noun is appropriate for use in a pharmaceutical product.
  • an excipient in a pharmaceutical vaccine it characterizes the excipient as being compatible with the other ingredients of the composition and not disadvantageously deleterious to the intended recipient animal, e.g., feline.
  • Parenteral administration includes subcutaneous injections, submucosal injections, intravenous injections, intramuscular injections, intradermal injections, and infusion.
  • an antigenic fragment in regard to a particular protein ⁇ e.g., a protein antigen
  • a protein antigen is a fragment of that protein that is antigenic, i.e., capable of specifically interacting with an antigen recognition molecule of the immune system, such as an immunoglobulin (antibody) or T cell antigen receptor.
  • an antigenic fragment of an FCV capsid protein is a fragment of the capsid protein that is antigenic.
  • an antigenic fragment of the present invention is
  • an antigenic fragment with respect to a given protein antigen is a fragment of that protein that retains at least 25% of the antigenicity of the full length protein. In preferred embodiments, an antigenic fragment retains at least 50% of the antigenicity of the full length protein. In more preferred embodiments, an antigenic fragment retains at least 75% of the antigenicity of the full length protein.
  • Antigenic fragments can be as small as 20 amino acids or at the other extreme, be large fragments that are missing as little as a single amino acid from the full-length protein. In particular embodiments, the antigenic fragment comprises 25 to 150 amino acid residues. In other embodiments, the antigenic fragment comprises 50 to 250 amino acid residues.
  • the FeLV gp45 glycoprotein and the FeLV gp70 glycoprotein are antigenic fragments of the FeLV gp85 glycoprotein
  • one antigenic fragment of an FCV capsid protein comprises region E of the ORF2.
  • one amino acid sequence is 100% "identical” or has 100% “identity” to a second amino acid sequence when the amino acid residues of both sequences are identical. Accordingly, an amino acid sequence is 50% "identical” to a second amino acid sequence when 50% of the amino acid residues of the two amino acid sequences are identical.
  • sequence comparison is performed over a contiguous block of amino acid residues comprised by a given protein, e.g., a protein, or a portion of the polypeptide being compared.
  • a given protein e.g., a protein
  • selected deletions or insertions that could otherwise alter the correspondence between the two amino acid sequences are taken into account.
  • nucleotide and amino acid sequence percent identity can be determined using C, MacVector (MacVector, Inc. Cary, NC 27519), Vector NTI (Informax, Inc. MD), Oxford Molecular Group PLC (1996) and the Clustal W algorithm with the alignment default parameters and default parameters for identity. These commercially available programs can also be used to determine sequence similarity using the same or analogous default parameters. Alternatively, an
  • Advanced Blast search under the default filter conditions can be used, e.g., using the GCG (Genetics Computer Group, Program Manual for the GCG Package, Version 7, Madison, Wisconsin) pileup program using the default parameters.
  • GCG Genetics Computer Group, Program Manual for the GCG Package, Version 7, Madison, Wisconsin
  • inactivated microorganism is an organism which is capable of eliciting an immune response in an animal, but is not capable of infecting the animal.
  • An antigen of the present invention ⁇ e.g., an inactivated feline calicivirus
  • an agent selected from the group consisting of binary ethyleneimine, formalin, beta- propiolactone, thimerosal, or heat.
  • inactivated feline calicivirus isolates combined with an RP of the present invention are inactivated by binary ethyleneimine.
  • the alphavirus RNA replicon particles of the present invention may be lyophilized and rehydrated with a sterile water diluent.
  • the alphavirus RNA replicon particles when stored separately, but intended to be mixed with other vaccine components prior to administration, the alphavirus RNA replicon particles can be stored in the stabilizing solution of those components, e.g., a high sucrose solution.
  • a vaccine of the present invention can be readily administered by any standard route including intravenous, intramuscular, subcutaneous, oral, intranasal, intradermal, and/or intraperitoneal vaccination.
  • the skilled artisan will appreciate that the vaccine composition is preferably formulated appropriately for each type of recipient animal and route of administration.
  • the present invention also provides methods of immunizing a feline against feline pathogens.
  • One such method comprises injecting a feline with an immunologically effective amount of a vaccine of the present invention, so that the feline produces appropriate anti-pathogen antibodies.
  • the present invention provides multivalent vaccines comprising at least one modified live feline pathogen and one or more alphavirus RNA replicon particles.
  • the coding sequence of a protein antigen or antigenic fragment thereof, or combination of such coding sequences of protein antigens useful in a feline vaccine can be added to an alphavirus RNA replicon particle (RP) or combined in the same RP as one that encodes e.g., an FCV capsid protein and/or the FeLV glycoprotein (gp85) in the multivalent vaccine.
  • RP alphavirus RNA replicon particle
  • vaccines comprise at least one modified live feline pathogen and an alphavirus RNA replicon particle that encodes an FCV F9-Like capsid protein or an antigenic fragment thereof, and/or a VS-FCV capsid protein or an antigenic fragment thereof, with another alphavirus RNA replicon particle that encodes an FeLV gp85 or an antigenic fragment thereof.
  • vaccines comprise at least one modified live feline pathogen and one alphavirus RNA replicon particle that encodes a VS-FCV capsid protein or an antigenic fragment thereof, another alphavirus RNA replicon particle that encodes an FeLV gp85 or an antigenic fragment thereof, and still a third alphavirus RNA replicon particle that encodes an FCV F9-Like capsid protein or an antigenic fragment thereof.
  • vaccines comprise at least one modified live feline pathogen and an alphavirus RNA replicon particle that encodes an FCV F9-Like capsid protein or an antigenic fragment thereof, a VS-FCV capsid protein or an antigenic fragment thereof, and an FeLV gp85 or an antigenic fragment thereof.
  • pathogens examples include feline viral rhinotracheitis Virus (FVR), feline leukemia virus (FeLV), feline panleukopenia Virus (FPL) feline herpesvirus (FHV), other FCV strains, feline parvovirus (FPV), feline infectious peritonitis virus (FIPV), feline immunodeficiency virus, borna disease virus (BDV), rabies virus, feline influenza virus, canine influenza virus, avian influenza, canine pneumovirus, feline
  • FVR feline viral rhinotracheitis Virus
  • FeLV feline leukemia virus
  • FPL feline panleukopenia Virus
  • FHV feline herpesvirus
  • FPV feline parvovirus
  • FFPV feline infectious peritonitis virus
  • BDV borna disease virus
  • rabies virus feline influenza virus
  • canine influenza virus canine influenza virus
  • avian influenza canine pneumovirus
  • feline pneumovirus feline
  • a coding sequence for a capsid protein or analogous protein from one or more of these feline or canine pathogens can be inserted into the same RP as the FCV antigen.
  • a coding sequence for a capsid protein or analogous protein from one or more of these feline or canine pathogens can be inserted into one or more other RPs, which can be combined in a vaccine with an RP that encodes the FCV F9-Like capsid protein or an antigenic fragment thereof and/or the VS-FCV capsid protein or an antigenic fragment thereof.
  • the present invention provides vaccines comprising one or more alphavirus RNA replicon particles (RP) of the present invention [e.g., a VS-FCV capsid protein or an antigenic fragment thereof] along with one or more modified live (attenuated) virus isolates, e.g., a live attenuated older vaccine strain of FCV, such as a live attenuated FCV F9, and/or a live attenuated feline herpesvirus and/or a live attenuated feline parvovirus and/or a live, attenuated feline leukemia virus, and/or a live, attenuated feline infectious peritonitis virus and/or a live, attenuated feline immunodeficiency virus and/or a live, attenuated borna disease virus and/or a live, attenuated rabies virus, and/or a live, attenuated feline influenza virus and/or a live, attenuated canine influenza virus
  • Bordetella bronchiseptica and/or a live, attenuated Bartonella spp. e.g., B.
  • the vaccines of the present invention comprising one or more alphavirus RNA replicon particles of the present invention [e.g., encoding a VS-FCV capsid protein or an antigenic fragment thereof] with one or more modified live, virus isolates, further can comprise one or more killed virus isolates such as a killed FCV strain, and/or a killed feline herpesvirus and/or a killed feline parvovirus and/or a killed feline leukemia virus, and/or a killed feline infectious peritonitis virus and/or a killed feline immunodeficiency virus and/or a killed borna disease virus and/or a killed rabies virus, and/or a killed feline influenza virus and/or a killed canine influenza virus, and/or a killed avian influenza virus, and/or a killed canine pneumovirus, and/or a killed feline pneumovirus.
  • bacterins of the present invention comprising one or more alphavirus RNA replicon particles of
  • Chlamydophila felis, and/or Bordetella bronchiseptica and/or Bartonella spp. e.g., Chlamydophila felis, and/or Bordetella bronchiseptica and/or Bartonella spp.
  • B. henselae can also be included in such multivalent vaccines.
  • Feline Calicivirus (F9-like) capsid SEQ ID NO: 4
  • Feline Calicivirus (F9-like) capsid SEQ ID NO: 13
  • Feline Leukemia Virus envelope glycoprotein SEQ ID NO: 5 atggagtcaccaacacaccctaaaccttctaaagacaaaaccctctcgtggaatctcgccttccttgt gggcatcctgttcacaatcgacatcggcatggccaacccttcgccgcatcagatctacaatgtgacat gggtcattactaatgtgcagacaaacacccaggcaaatgctacttctatgcttggtactctgactgat gcttatccaaccctgcacgtcgacctttgcgatctcgtcggtgacacatgggagcccatcgtgtgaa tccaactaatgtcaaacatggtgccaggtgccaggtattctctagcaaatacgggtgtaagaccactgatcggggt
  • RNA viruses have been used as vector-vehicles for introducing vaccine antigens, which have been genetically engineered into their genomes. However, their use to date has been limited primarily to incorporating viral antigens into the RNA virus and then introducing the virus into a recipient host. The result is the induction of protective antibodies against the incorporated viral antigens.
  • Alphavirus RNA replicon particles have been used to encode pathogenic antigens. Such alphavirus replicon platforms have been developed from several different
  • alphaviruses including Venezuelan equine encephalitis virus (VEE) [Pushko et al., Virology 239:389-401 (1997)], Sindbis (SIN) [Bredenbeek et al., Journal of Virology 67:6439-6446 (1993) the contents of which are hereby incorporated herein in their entireties], and Semliki Forest virus (SFV) [Liljestrom and Garoff, Biotechnology (NY) 9:1356- 1361 (1991 ), the contents of which are hereby incorporated herein in their entireties].
  • VEE Venezuelan equine encephalitis virus
  • SIN Sindbis
  • SFV Semliki Forest virus
  • alphavirus RNA replicon particles are the basis for several USDA-licensed vaccines for swine and poultry.
  • RNA Particle Product Code 19U5.P1
  • Swine Influenza Vaccine RNA
  • RNA Product Code 19A5.D0
  • Avian Influenza Vaccine RNA
  • RNA Product Code 1905. DO
  • Prescription Product RNA Particle (Product Code 9PP0.00).
  • FCV capsid proteins were used to generate codon-optimized (feline codon usage) nucleotide sequences in silico.
  • Optimized sequences were prepared as synthetic DNA by a commercial vendor (ATUM, Newark, CA). Accordingly, synthetic genes were designed based on the amino acid sequences of a VS-FCV capsid protein and an FCV F9-like capsid protein, respectively.
  • constructs encoded amino acid sequence [SEQ ID NO: 2] for the VS-FCV capsid protein, or [SEQ ID NO: 4] for the FCV F9-like capsid protein, were codon-optimized for feline, with flanking sequence appropriate for cloning into the alphavirus replicon plasmid.
  • VEE replicon vectors designed to express FCV capsid proteins were constructed as previously described [see, U.S. 9,441 ,247 B2; the contents of which are hereby incorporated herein by reference], with the following modifications.
  • the TC-83-derived replicon vector“pVEK” [disclosed and described in
  • U.S. 9,441 ,247 B2] was digested with restriction enzymes Ascl and Pad.
  • a DNA plasmid containing the codon-optimized open reading frame nucleotide sequence of the FCV capsid genes, with 5’ flanking sequence (5’-GGCGCGCCGCACC-3’) [SEQ ID NO: 11] and 3’ flanking sequence (5’-TTAATTAA-3’) were similarly digested with restriction enzymes Ascl and Pa .
  • the synthetic gene cassette was then ligated into the digested pVEK vector.
  • RNA replicon particles Production of TC-83 RNA replicon particles (RP) was conducted according to methods previously described [U.S. 9,441 ,247 B2 and U.S. 8,460,913 B2; the contents of which are hereby incorporated herein by reference]. Briefly, pVHV replicon vector DNA and helper DNA plasmids were linearized with Not! restriction enzyme prior to in vitro transcription using MegaScript T7 RNA polymerase and cap analog (Promega, Madison, Wl). Importantly, the helper RNAs used in the production lack the VEE subgenomic promoter sequence, as previously described [Kamrud et al., J Gen Virol. 91 (Pt 7):1723-1727 (2010)].
  • RNA for the replicon and helper components were combined and mixed with a suspension of Vero cells, electroporated in 4 mm cuvettes, and returned to OptiPro ® SFM cell culture media (Thermo Fisher, Waltham MA). Following overnight incubation, alphavirus RNA replicon particles were purified from the cells and media by passing the suspension through a ZetaPlus BioCap depth filter (3M, Maplewood, MN), washing with phosphate buffered saline containing 5% sucrose (w/v), and finally eluting the retained RP with 400 mM NaCI buffer.
  • ZetaPlus BioCap depth filter 3M, Maplewood, MN
  • Eluted RP were formulated to a final 5% sucrose (w/v), passed through a 0.22 micron membrane filter, and dispensed into aliquots for storage. Titer of functional RP was determined by immunofluorescence assay on infected Vero cell monolayers.
  • gp85_wt wild-type amino acid sequence [SEQ ID NO: 2], codon-optimized for feline, with flanking sequence appropriate for cloning into the alphavirus replicon plasmid.
  • VEE replicon vectors designed to express FeLV gp85 were constructed as previously described [see, U.S. 9,441 ,247 B2; the contents of which are hereby incorporated herein by reference in their entireties], with the following modifications.
  • the TC-83-derived replicon vector“pVEK” [disclosed and described in U.S. 9,441 ,247 B2] was digested with restriction enzymes Asd and Pad.
  • the synthetic gene cassette was then ligated into the digested pVEK vector, and the resulting clone was re-named“pVHV- FeLV gp85”.
  • The“pVHV” vector nomenclature was chosen to refer to pVEK-derived replicon vectors containing transgene cassettes cloned via the Asd and Pad sites in the multiple cloning site of pVEK.
  • RNA replicon particles Production of TC-83 RNA replicon particles (RP) was conducted according to methods previously described [U.S. 9,441 ,247 B2 and U.S. 8,460,913 B2; the contents of which are hereby incorporated herein by reference in their entireties]. Briefly, pVHV replicon vector DNA and helper DNA plasmids were linearized with Not! restriction enzyme prior to in vitro transcription using MegaScript T7 RNA polymerase and cap analog (Promega, Madison, Wl). Importantly, the helper RNAs used in the production lack the VEE subgenomic promoter sequence, as previously described [Kamrud et al., J Gen Virol. 91 (Pt 7):1723-1727 (2010)].
  • RNA for the replicon and helper components were combined and mixed with a suspension of Vero cells, electroporated in 4 mm cuvettes, and returned to OptiPro ® SFM cell culture media (Thermo Fisher, Waltham MA). Following overnight incubation, alphavirus RNA replicon particles were purified from the cells and media by passing the suspension through a ZetaPlus BioCap depth filter (3M, Maplewood, MN), washing with phosphate buffered saline containing 5% sucrose (w/v), and finally eluting the retained RP with 400 mM NaCI buffer.
  • ZetaPlus BioCap depth filter 3M, Maplewood, MN
  • Eluted RP were formulated to a final 5% sucrose (w/v), passed through a 0.22 micron membrane filter, and dispensed into aliquots for storage. Titer of functional RP was determined by immunofluorescence assay on infected Vero cell monolayers.
  • a vaccine was prepared comprising an alphavirus RNA replicon particle encoding the rabies virus glycoprotein (G) from rabies virus (RV) packaged with the capsid protein and glycoproteins of the avirulent TC-83 strain of Venezuelan Equine Encephalitis Virus.
  • the nucleotide sequence for the rabies virus G protein was codon-optimized for humans.
  • the resulting sequence has only -85% nucleotide identity to a live rabies virus glycoprotein (G) sequence, despite having 100% amino acid identity.
  • the vaccine can be used as a single dose administered to a mammalian subject, e.g., subcutaneously to cats and dogs aged 12 weeks or older or alternatively, in a multiple dose comprising a primary administration followed by one or more booster administrations.
  • VEE replicon vectors that were designed to express Rabies G were constructed as previously described [see, U.S. 9,441 ,247 B2; the contents of which are hereby incorporated herein by reference], with the following modifications.
  • the TC-83-derived replicon vector“pVEK” [disclosed and described in
  • U.S. 9,441 ,247 B2] was digested with restriction enzymes Ascl and Pad.
  • a DNA plasmid containing the codon-optimized open reading frame nucleotide sequence of the Rabies G gene, with 5’ flanking sequence (5’-GGCGCGCCGCACC-3’) [SEQ ID NO: 11] and 3’ flanking sequence (5’-TTAATTAA-3’) was similarly digested with restriction enzymes As and Pad.
  • the synthetic gene cassette was then ligated into the digested pVEK vector, and the resulting clone was re-named“pVHV- RABV- G”.
  • The“pVHV” vector nomenclature was chosen to refer to pVEK-derived replicon vectors containing transgene cassettes cloned via the Asd and Pad sites in the multiple cloning site of pVEK.
  • RNA replicon particles Production of TC-83 RNA replicon particles (RP) was conducted according to methods previously described [U.S. 9,441 ,247 B2 and U.S. 8,460,913 B2; the contents of which are hereby incorporated herein by reference in their entireties]. Briefly, pVHV replicon vector DNA and helper DNA plasmids were linearized with Not! restriction enzyme prior to in vitro transcription using MegaScript T7 RNA polymerase and cap analog (Promega, Madison, Wl). Importantly, the helper RNAs used in the production lack the VEE subgenomic promoter sequence, as previously described [Kamrud et al., J Gen Virol. 91 (Pt 7):1723-1727 (2010)].
  • RNA for the replicon and helper components were combined and mixed with a suspension of Vero cells, electroporated in 4 mm cuvettes, and returned to OptiPro ® SFM cell culture media (Thermo Fisher, Waltham, MA). Following overnight incubation, alphavirus RNA replicon particles were purified from the cells and media by passing the suspension through a ZetaPlus BioCap ® depth filter (3M, Maplewood, MN), washing with phosphate buffered saline containing 5% sucrose (w/v), and finally eluting the retained RP with 400 mM NaCI buffer.
  • Eluted RP were formulated to a final 5% sucrose (w/v), passed through a 0.22 micron membrane filter, and dispensed into aliquots for storage. Titer of functional RP was determined by immunofluorescence assay on infected Vero cell monolayers.
  • Various formulations and reconstitution methods of a lyophilized pentavalent feline combination vaccine were evaluated in regard to their safety in cats.
  • the desired presentation of the pentavalent vaccine is a 0.5 mL dose
  • the optimal formulation and fill method is a 0.5 mL fill.
  • the stabilizer contained 1.1 % NZ-amine (a casein enzymatic hydrolysate), 1.1 % gelatin, and 7.5% sucrose, with the percentages provided representing the final concentrations. Should the volume and final potency constraints for the addition of the five fractions necessitate a volume greater than 0.5 mL, the product can be formulated and filled to 1.0 mL and reconstituted with 0.5 mL of diluent.
  • RP-FeLV feline calicivirus capsid protein
  • RP-FCV feline calicivirus capsid protein
  • Nobivac ® Feline-1 i.e., a modified live (MLV) feline panleukopenia virus (FPL), a modified live feline viral rhinotracheitis virus (FVR) and a modified live Chlamydophila felis in a stabilizer containing 1.1 % gelatin, 1.1 % NZ- amine and 7.5% sucrose.
  • MLV modified live feline panleukopenia virus
  • FVR modified live feline viral rhinotracheitis virus
  • Chlamydophila felis in a stabilizer containing 1.1 % gelatin, 1.1 % NZ- amine and 7.5% sucrose.
  • the vaccines were formulated to contain the same dose of each antigen (the 0.5 mL cake vaccine was formulated with twice the concentration of each antigen), the stabilizer was used at a constant concentration in all formulations (the 1.0 mL cake vaccine rehydrated with 0.5 mL diluent contained twice the concentration of stabilizer upon rehydration).
  • the experimental cat subjects were vaccinated with the indicated volume of the respective test vaccine at 7-8 weeks of age (typically having a minimum age of vaccination for the feline core vaccine) and again 21 days later.
  • the cats were observed for a period of 15 minutes immediately after each vaccination for reactions to the test vaccine, which might indicate pain or discomfort, such as vocalization, stinging, itching, biting, sudden movement upon the injection of the vaccine, or any unusual reaction (see Tables 2 and 3 below).
  • a clinical assessment was performed by a veterinarian 4 to 6 hours after the vaccination and each day for three days post-vaccination.
  • the clinical assessment included palpation of the injection site and

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Immunology (AREA)
  • Medicinal Chemistry (AREA)
  • Microbiology (AREA)
  • Mycology (AREA)
  • Virology (AREA)
  • Chemical & Material Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)

Abstract

La présente invention concerne de nouveaux vaccins multivalents pour les félins. La présente invention concerne également des procédés de fabrication et d'utilisation des vaccins multivalents seuls ou en combinaison avec d'autres agents protecteurs.
PCT/EP2018/080106 2017-11-06 2018-11-05 Vaccin félin multivalent WO2019115090A1 (fr)

Priority Applications (10)

Application Number Priority Date Filing Date Title
US16/760,160 US11167027B2 (en) 2017-11-06 2018-11-05 Multivalent feline vaccine
CA3080087A CA3080087A1 (fr) 2017-12-15 2018-11-05 Vaccin felin multivalent
AU2018383915A AU2018383915B9 (en) 2017-12-15 2018-11-05 Multivalent feline vaccine
JP2020524411A JP7427585B2 (ja) 2017-12-15 2018-11-05 多価ネコワクチン
EP18803574.5A EP3706790A1 (fr) 2017-11-06 2018-11-05 Vaccin félin multivalent
RU2020122007A RU2797538C2 (ru) 2017-11-06 2018-11-05 Поливалентная вакцина для животных семейства кошачьих
BR112020008955-9A BR112020008955A2 (pt) 2017-11-06 2018-11-05 vacina felina multivalente
US17/488,961 US11730809B2 (en) 2017-11-06 2021-09-29 Multivalent feline vaccine
AU2022209359A AU2022209359A1 (en) 2017-12-15 2022-07-30 Multivalent feline vaccine
JP2023158724A JP2023179547A (ja) 2017-12-15 2023-09-22 多価ネコワクチン

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201762599401P 2017-12-15 2017-12-15
US62/599,401 2017-12-15

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US16/760,160 A-371-Of-International US11167027B2 (en) 2017-11-06 2018-11-05 Multivalent feline vaccine
US17/488,961 Continuation US11730809B2 (en) 2017-11-06 2021-09-29 Multivalent feline vaccine

Publications (1)

Publication Number Publication Date
WO2019115090A1 true WO2019115090A1 (fr) 2019-06-20

Family

ID=64316488

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2018/080106 WO2019115090A1 (fr) 2017-11-06 2018-11-05 Vaccin félin multivalent

Country Status (4)

Country Link
JP (2) JP7427585B2 (fr)
AU (2) AU2018383915B9 (fr)
CA (1) CA3080087A1 (fr)
WO (1) WO2019115090A1 (fr)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2020277165B2 (en) * 2015-12-23 2021-08-19 Intervet International B.V. Feline calicivirus vaccine
WO2021228731A1 (fr) 2020-05-11 2021-11-18 Intervet International B.V. Vaccin contre le coronavirus 2 du syndrome respiratoire aigu sévère félin
WO2022101307A1 (fr) 2020-11-12 2022-05-19 Intervet International B.V. Vecteurs recombinants codant pour des protéines de spicule de coronavirus chimères et leur utilisation
RU2824661C1 (ru) * 2024-04-05 2024-08-12 Федеральное государственное бюджетное учреждение "Федеральный центр охраны здоровья животных" ФГБУ "ВНИИЗЖ" Способ дифференциации вакцинного штамма "Лавр" возбудителя инфекционного ринотрахеита от других штаммов и полевых изолятов вируса ИРТ кошек с помощью анализа температурного графика плавления продуктов ПЦР V1-гена с применением оранжевого полимерного красителя SuperNova v605

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001066568A2 (fr) * 2000-03-09 2001-09-13 Heska Corporation Utilisation d'antigenes recombines pour determiner l'etat immunitaire d'un animal
US7449323B2 (en) 2003-03-14 2008-11-11 The Regents Of The University Of California Hemorrhagic feline calicivirus
US8460913B2 (en) 2007-06-21 2013-06-11 Alpha Vax, Inc. Promoterless cassettes for expression of alpha virus structural proteins
US9441247B2 (en) 2004-05-18 2016-09-13 Alphavax, Inc. TC-83-derived alphavirus vectors, particles and methods
WO2017109045A1 (fr) * 2015-12-23 2017-06-29 Intervet International B.V. Vaccin contre le calicivirus félin

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
MXPA03001680A (es) 2000-08-29 2004-11-01 Wyeth Corp Empaque de particulas de un replicon del virus de acido ribonucleico (arn) de hebra positiva.
US7306807B2 (en) 2004-09-13 2007-12-11 Wyeth Hemorrhagic feline calicivirus, calicivirus vaccine and method for preventing calicivirus infection or disease
JP7374893B2 (ja) * 2017-12-08 2023-11-07 インターベット インターナショナル ベー． フェー． ネコカリシウイルスワクチン

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001066568A2 (fr) * 2000-03-09 2001-09-13 Heska Corporation Utilisation d'antigenes recombines pour determiner l'etat immunitaire d'un animal
US7449323B2 (en) 2003-03-14 2008-11-11 The Regents Of The University Of California Hemorrhagic feline calicivirus
US9441247B2 (en) 2004-05-18 2016-09-13 Alphavax, Inc. TC-83-derived alphavirus vectors, particles and methods
US8460913B2 (en) 2007-06-21 2013-06-11 Alpha Vax, Inc. Promoterless cassettes for expression of alpha virus structural proteins
WO2017109045A1 (fr) * 2015-12-23 2017-06-29 Intervet International B.V. Vaccin contre le calicivirus félin

Non-Patent Citations (36)

* Cited by examiner, † Cited by third party
Title
AAFP FELINE ADVISORY PANEL, vol. 15, 2013, pages 785 - 808
ARJONA ET AL., JOURNAL OF CLINICAL MICROBIOLOGY, vol. 38, 2000, pages 3448 - 3449
ATKINS GREGORY J ET AL: "Therapeutic and prophylactic applications of alphavirus vectors", EXPERT REVIEWS IN MOLECULAR MEDI, CAMBRIDGE UNIVERSITY PRESS, CAMBRIDGE, vol. 10, no. 1, 1 December 2008 (2008-12-01), pages e33/1 - 18, XP009116159, ISSN: 1462-3994, [retrieved on 20081111], DOI: 10.1017/S1462399408000859 *
BRALEY, FELINE PRACTICE, vol. 22, 1994, pages 25 - 29
BREDENBEEK ET AL., JOURNAL OF VIROLOGY, vol. 67, 1993, pages 6439 - 6446
COX ET AL., INFECT IMMUN, vol. 16, 1977, pages 754 - 759
D. S. REED ET AL: "Combined Alphavirus Replicon Particle Vaccine Induces Durable and Cross-Protective Immune Responses against Equine Encephalitis Viruses", JOURNAL OF VIROLOGY., vol. 88, no. 20, 13 August 2014 (2014-08-13), US, pages 12077 - 12086, XP055427114, ISSN: 0022-538X, DOI: 10.1128/JVI.01406-14 *
DENORONHA ET AL., VIROLOGY, vol. 85, 1978, pages 617 - 621
DIETZSCHOLD ET AL., CRIT REV IMMUNOL, vol. 10, 1991, pages 427 - 439
FLYNN ET AL., J. VIROL., vol. 76, no. 5, 2002, pages 2306 - 2315
GUGLIELMO LUCCHESE ET AL: "How a single amino acid change may alter the immunological information of a peptide", FRONTIERS IN BIOSCIENCE : ELITE EDITION, vol. 4, no. 5, 1 January 2012 (2012-01-01), US, pages 1843 - 1852, XP055467091, ISSN: 1945-0494, DOI: 10.2741/e506 *
HOOVER ET AL., J AM VET MED ASSOC, vol. 199, 1991, pages 1287 - 1297
HOSIE ET AL., VETERINARY RECORDS, vol. 128, 1989, pages 293 - 297
KAMRUD ET AL., J GEN VIROL., vol. 91, 2010, pages 1723 - 1727
KONOPKA ET AL., J. VIROL., vol. 83, no. 29, 2009, pages 12432 - 12442
LEVY ET AL., J FELINE MED SURG, vol. 10, 2008, pages 300 - 316
LEVY; CRAWFORD: "Textbook of Veterinary Internal Medicine", 2005, WB SAUNDERS
LILJESTROM; GAROFF, BIOTECHNOLOGY (NY, vol. 9, 1991, pages 1356 - 1361
LIU ET AL., GENOME ANNOUNC., vol. 3, no. 2, March 2015 (2015-03-01), pages e01556 - 14
LJUNGBERG KARL ET AL: "Self-replicating alphavirus RNA vaccines", EXPERT REVIEW OF VACC, EXPERT REVIEWS LTD, GB, vol. 14, no. 2, 1 February 2015 (2015-02-01), pages 177 - 194, XP008175780, ISSN: 1744-8395, DOI: 10.1586/14760584.2015.965690 *
MAHL ET AL., VET RES, vol. 45, no. 1, 2014, pages 77
MALIK ET AL., AUSTRALIAN VETERINARY JOURNAL, vol. 75, 1997, pages 323 - 327
MATHES ET AL., NATURE, vol. 274, 1978, pages 687 - 689
NUNBERG ET AL., PNAS, vol. 81, 1983, pages 3675 - 3679
PACITTI ET AL., VET REC, vol. 118, 1986, pages 381 - 384
PUSHKO ET AL., VIROLOGY, vol. 239, 1997, pages 389 - 401
PUSHKO ET AL., VIROLOGY, vol. 239, no. 2, 1997, pages 389 - 401
RADFORD ET AL., VET RES., vol. 38, no. 2, 2007, pages 319 - 335
RAYNER J O ET AL: "ALPHAVIRUS VECTORS AND VACCINATION", REVIEWS IN MEDICAL VIRO, CHICHESTER, GB, vol. 12, no. 5, 1 September 2002 (2002-09-01), pages 279 - 296, XP008035758, ISSN: 1052-9276, DOI: 10.1002/RMV.360 *
SCOTT ET AL., AM. J. VET. RES., vol. 60, 1999, pages 652 - 658
SEGUNDO ET AL., J. VIROL., vol. 87, no. 10, 2013, pages 5447 - 5460
SOSNOVTSEV; GREEN, VIROLOGY, vol. 277, 2000, pages 193 - 203
THOMSEN ET AL., JOURNAL OF GENERAL VIROLOGY, vol. 73, 1992, pages 1819 - 1824
VANDER VEEN ET AL., ANIM HEALTH RES REV., vol. 13, no. 1, 2012, pages 1 - 9
VANDER VEEN RYAN L ET AL: "Alphavirus replicon vaccines", ANIMAL HEALTH RESEARCH REV, CAB INTERNATIONAL ; CAMBRIDGE : CAMBRIDGE UNIVERSITY PRESS, UK, vol. 13, no. 1, 1 June 2012 (2012-06-01), pages 1 - 9, XP009166113, ISSN: 1475-2654, DOI: 10.1017/S1466252312000011 *
YASUSHI UEMATSU ET AL: "ABSTRACT", CLINICAL AND VACCINE IMMUNOLOGY, vol. 19, no. 7, 23 May 2012 (2012-05-23), US, pages 991 - 998, XP055552702, ISSN: 1556-6811, DOI: 10.1128/CVI.00031-12 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2020277165B2 (en) * 2015-12-23 2021-08-19 Intervet International B.V. Feline calicivirus vaccine
WO2021228731A1 (fr) 2020-05-11 2021-11-18 Intervet International B.V. Vaccin contre le coronavirus 2 du syndrome respiratoire aigu sévère félin
WO2022101307A1 (fr) 2020-11-12 2022-05-19 Intervet International B.V. Vecteurs recombinants codant pour des protéines de spicule de coronavirus chimères et leur utilisation
RU2824661C1 (ru) * 2024-04-05 2024-08-12 Федеральное государственное бюджетное учреждение "Федеральный центр охраны здоровья животных" ФГБУ "ВНИИЗЖ" Способ дифференциации вакцинного штамма "Лавр" возбудителя инфекционного ринотрахеита от других штаммов и полевых изолятов вируса ИРТ кошек с помощью анализа температурного графика плавления продуктов ПЦР V1-гена с применением оранжевого полимерного красителя SuperNova v605

Also Published As

Publication number Publication date
CA3080087A1 (fr) 2019-06-20
JP2023179547A (ja) 2023-12-19
AU2018383915B9 (en) 2023-06-01
AU2018383915A1 (en) 2020-05-14
AU2018383915B2 (en) 2023-05-25
JP2021506746A (ja) 2021-02-22
AU2022209359A1 (en) 2022-09-29
JP7427585B2 (ja) 2024-02-05

Similar Documents

Publication Publication Date Title
AU2022209359A1 (en) Multivalent feline vaccine
US11992526B2 (en) Rabies virus vaccine
JP7374893B2 (ja) ネコカリシウイルスワクチン
WO2019086646A1 (fr) Vaccin contre le virus de la leucémie féline
US11730809B2 (en) Multivalent feline vaccine
US12076392B2 (en) Feline leukemia virus vaccine
RU2797538C2 (ru) Поливалентная вакцина для животных семейства кошачьих
RU2784533C2 (ru) Вакцина против вируса лейкоза кошачьих
RU2792898C2 (ru) Вакцина против кошачьего калицивируса
US20240269259A1 (en) Rabies virus vaccine

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18803574

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 3080087

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2020524411

Country of ref document: JP

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2018383915

Country of ref document: AU

Date of ref document: 20181105

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2018803574

Country of ref document: EP

Effective date: 20200608

NENP Non-entry into the national phase

Ref country code: DE

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112020008955

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 112020008955

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20200505