WO2019083086A1 - 자성입자를 이용한 핵산 정제용 멀티-웰 자성입자 파이펫터 - Google Patents

자성입자를 이용한 핵산 정제용 멀티-웰 자성입자 파이펫터

Info

Publication number
WO2019083086A1
WO2019083086A1 PCT/KR2017/014198 KR2017014198W WO2019083086A1 WO 2019083086 A1 WO2019083086 A1 WO 2019083086A1 KR 2017014198 W KR2017014198 W KR 2017014198W WO 2019083086 A1 WO2019083086 A1 WO 2019083086A1
Authority
WO
WIPO (PCT)
Prior art keywords
magnetic
plate
pipettor
lower plate
well
Prior art date
Application number
PCT/KR2017/014198
Other languages
English (en)
French (fr)
Inventor
문성은
오명석
오지숙
Original Assignee
주식회사 바이오팩트
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 바이오팩트 filed Critical 주식회사 바이오팩트
Publication of WO2019083086A1 publication Critical patent/WO2019083086A1/ko

Links

Images

Classifications

    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01L—CHEMICAL OR PHYSICAL LABORATORY APPARATUS FOR GENERAL USE
    • B01L3/00—Containers or dishes for laboratory use, e.g. laboratory glassware; Droppers
    • B01L3/02—Burettes; Pipettes
    • B01L3/021—Pipettes, i.e. with only one conduit for withdrawing and redistributing liquids
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01L—CHEMICAL OR PHYSICAL LABORATORY APPARATUS FOR GENERAL USE
    • B01L3/00—Containers or dishes for laboratory use, e.g. laboratory glassware; Droppers
    • B01L3/02—Burettes; Pipettes
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01L—CHEMICAL OR PHYSICAL LABORATORY APPARATUS FOR GENERAL USE
    • B01L9/00—Supporting devices; Holding devices
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01L—CHEMICAL OR PHYSICAL LABORATORY APPARATUS FOR GENERAL USE
    • B01L9/00—Supporting devices; Holding devices
    • B01L9/54—Supports specially adapted for pipettes and burettes
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N35/00—Automatic analysis not limited to methods or materials provided for in any single one of groups G01N1/00 - G01N33/00; Handling materials therefor
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N35/00—Automatic analysis not limited to methods or materials provided for in any single one of groups G01N1/00 - G01N33/00; Handling materials therefor
    • G01N35/0098—Automatic analysis not limited to methods or materials provided for in any single one of groups G01N1/00 - G01N33/00; Handling materials therefor involving analyte bound to insoluble magnetic carrier, e.g. using magnetic separation
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01L—CHEMICAL OR PHYSICAL LABORATORY APPARATUS FOR GENERAL USE
    • B01L2200/00—Solutions for specific problems relating to chemical or physical laboratory apparatus
    • B01L2200/06—Fluid handling related problems
    • B01L2200/0631—Purification arrangements, e.g. solid phase extraction [SPE]
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01L—CHEMICAL OR PHYSICAL LABORATORY APPARATUS FOR GENERAL USE
    • B01L2200/00—Solutions for specific problems relating to chemical or physical laboratory apparatus
    • B01L2200/06—Fluid handling related problems
    • B01L2200/0647—Handling flowable solids, e.g. microscopic beads, cells, particles
    • B01L2200/0652—Sorting or classification of particles or molecules
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01L—CHEMICAL OR PHYSICAL LABORATORY APPARATUS FOR GENERAL USE
    • B01L2300/00—Additional constructional details
    • B01L2300/12—Specific details about materials
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N35/00—Automatic analysis not limited to methods or materials provided for in any single one of groups G01N1/00 - G01N33/00; Handling materials therefor
    • G01N2035/00465—Separating and mixing arrangements
    • G01N2035/00564—Handling or washing solid phase elements, e.g. beads

Definitions

  • the present invention relates to a multi-well magnetic particle pipettor for purifying nucleic acid using magnetic particles.
  • nucleic acid purification is performed using a magnetic stand type product such as DynaMag TM -2 Magnet of Thermo fisher and 12-tube magnet of Qiagne for a small quantity of samples.
  • a magnetic stand type product such as DynaMag TM -2 Magnet of Thermo fisher and 12-tube magnet of Qiagne for a small quantity of samples.
  • the present inventors have made extensive efforts to improve the limitations of the conventional magnetic particle separation process. As a result, the present inventors have completed the present invention by developing a multi well magnetic particle pipettor, which is a pipette magnetic particle separator having eight channels and 96 channels.
  • the present invention provides a multi-well magnetic particle pipettor (multi) for extracting a nucleic acid or protein from a multi-well plate using magnetic beads, -well magnetic bead pipettor:
  • the magnetic immobilizing bar 500 includes a tube groove rubbing part 520 at the lower end and an 8-strip PCR tube or a 96-well PCR plate 96- well PCR plate) can be attached and detached.
  • the present invention is a pipette type magnetic particle separating device comprising a handle portion (H), an upper plate (300), and a lower plate (200) pipet tip portion (I).
  • the handle portion H is coupled to the upper plate 300, and the lower plate can be moved up and down by using the lower plate operation switch 120 interlocked with the lower plate operation spring 130 inside the handle, Is designed to separate the PCR tubes and plates coupled by frictional force with the tube hole rubbing portion 520 located below the magnetic material immobilizing rods 500 of the tip portion I.
  • the magnetic substance 100 is coupled to the tube hole rubbing-magnetic-substance fixing groove 510 of the magnetic substance fixing rod.
  • the present invention is a pipette-type magnetic particle separating apparatus using adhesion and separation of magnetic particles, and is a multi-well magnetic particle pie (hereinafter referred to as " pellet ") which extracts nucleic acid or protein from a multi-well plate using magnetic beads
  • &quot multi-well magnetic particle pie
  • the inventors of the present invention have made extensive efforts to improve the limitations of the conventional magnetic particle separation process, and as a result, the inventors of the present invention have found that a magnetic particle separator of a pipette type having 8 to 96 induction magnet fixing portions, multi -well) developed a multi-well magnetic bead pipettor.
  • the handle portion H may have a rod shape, for example, in the shape of a cylinder or a square column, but is not limited thereto.
  • the handle portion (H) is engageable with the top plate (300).
  • the handle portion includes a support pipe 110, a lower plate operation switch 120, a lower plate operation spring 130, and a support pipe fixing portion 140 (see FIG. 1) , And the support tube fixing part 140 is fixed to the upper plate by a fixing screw T1 (see FIG. 3).
  • the lower plate operation switch 120 and the lower plate operation spring are used to manipulate the lower plate 200 to move up and down.
  • the fixed cap 1 is a lower plate operation switch fixing cap and may be made of a material such as plastic, steel, stainless steel, or aluminum.
  • the material of the support pipe 110 in the handle portion may be plastic, steel, stainless steel, aluminum, and preferably aluminum.
  • the upper plate 300 serves as a support for fixing and connecting the handle portion H and the lower plate.
  • the top plate is provided with a fixing screw T1 for fixing the supporting tube fixing part 140 and the fixing screw T1 and is provided with a fixing screw T2, (t2 / 220) are formed (see Figs. 3 and 5).
  • the upper plate 300 and the lower plate 200 are provided in parallel, and the upper plate is engageable with the lower portion of the handle portion H and the upper portion of the lower plate 200.
  • the upper plate is formed with a fitting groove (t2 / 220) for fixing the upper plate and the lower plate (see FIGS. 3 and 5).
  • the multi-well magnetic particle pipettor may include a pipet tip fixing plate 400 disposed between the upper plate 300 and the lower plate 200 and attached to the lower plate and having a plurality of magnetic substance fixing rods arranged and combined, . ≪ / RTI >
  • the pipet tip fixing plate 400 may be fixed to the lower plate through a fixing screw T3 (see Fig. 5).
  • the pipet tip fixing plate is provided with a pipet tip fixing groove 410 for coupling a magnetic body through a fixing screw T3 (see Fig. 5A).
  • the pipet tip fixing plate 400 is magnetically detachably attachable to the bar magnet 3 mounted on the upper plate.
  • the upper plate is generally plate-shaped, but in the case of a pipettor in which two rows of PCR tubes are coupled, the upper plate may be formed into an H-shape as shown in FIG.
  • the lower plate 200 is engageable with the lower portion of the upper plate 300 and the upper portion of the magnetic material fixing rods 500 in the pipet tip portion I as a portion for fixing the pipet tip portion I,
  • the lower plate 200 is formed with the magnetic material fixing bar passage grooves 210 so that the magnetic material fixing rods 500 can be engaged.
  • the magnetic substance fixing rod 500 can be directly coupled to the lower plate through the fixing screw T3.
  • the lower plate 200 can be coupled with the magnetic substance fixing rods 500 using the pipet tip fixing plate 400.
  • the magnetic substance fixing rod 500 is formed with the fixing screw T3 coupling groove t3 so that the fixing screw T3 can be coupled.
  • the ferrule tip fixing plate 400 is mounted on the lower plate through the ferrule fixing rod passing groove 210 in a state where the ferrule fixing rods 500 are coupled to the piet tip fixing plate 400 (see Fig. 5).
  • the pipette tip portion I includes (i) a plurality of magnetic bodies 100, and (ii) a plurality of magnetic body fixing rods 500 to which the magnetic bodies 100 are coupled.
  • the number of the magnetic bodies 100 may be plural, for example, 8 to 100 or 8 to 96.
  • the magnetic body 100 is an induction magnet.
  • the number of the magnetic substance fixing rods 500 may be plural.
  • the number of the magnetic material fixing rods 500 is 8 (1 row) to 96 (12 rows); Or 12 (1 row) to 96 (8 rows).
  • the number of magnetic immobilizing rods can be induced to eight magnetic particle separations by mounting only one row; Two rows can be attached to the sixteen magnetic particle separators; One row of magnetic immobilizing rods can be mounted to be led to twelve magnetic particle separators; Two rows of magnetic immobilizing rods could be mounted and guided to the 24 magnetic particle separators; It can be deformed according to the number of 1 to 96 magnetically fixed rods.
  • the magnetic substance 100 and the magnetic substance immobilizing bar 500 may have a columnar shape, and may be a columnar or polygonal columnar shape.
  • a magnetic substance fixing groove 510 to which a magnetic substance can be coupled is formed.
  • the lower end of the magnetic immobilizing rod 500 is formed with a tube hole rubbing part 520 so that the PCR tube can be inserted and fitted, and has a smaller diameter than the upper end of the magnetic substance fixing rod.
  • the tube hole rubbing portion 520 at the lower end of the magnetic substance fixing rod 500 is inserted into an 8-strip or 12-strip PCR tube or a 96-well PCR plate and a frictional force (Interference fit).
  • the tube hole rubbing portion 520 at the lower end of the magnetic substance fixing rod 500 is fabricated by a mold process and is fitted into the interior of the 8-strip / 12-strip PCR tube or the well / tube of the 96 well / tube plate .
  • the length, form size, and number of the magnetic substance fixing rods of the pipette tip portion (I) of the magnetic pipettor are not limited and can be designed and used depending on the container type and purification method of the purified sample.
  • the magnetic substance fixing rods are combined with the magnetic substance by the magnetic substance fixing grooves 510 to which the magnetic substance 100 is coupled (refer to FIG. 5).
  • a top plate 300 is provided with a 96 rod- )
  • a 96 rod- Were combined in a form of 8 rows and 12 columns, and the magnetic substance fixing rods were combined with the magnetic substance bodies with the magnetic substance fixing grooves 510 to which the magnetic bodies 100 were coupled.
  • a 96-well PCR plate was designed to be able to mount and detach a 96-well PCR plate to a magnetic fixation rod so that magnetic material and magnetic particles can be adsorbed and desorbed during the purification of the sample.
  • the 96-well PCR plate is designed to be mounted under the lower plate using the frictional force of the tube hole rubbing part 520 in the magnetic substance fixing rod.
  • the lower plate operation switch 120 is used to move the lower plate 200 downward
  • the 96 well PCR plate can be pushed out (see FIG. 11). That is, the pipettor of the present invention can detach an 8-strip PCR tube or a 96-well PCR plate using the lower plate manipulation switch.
  • the arrangement of the magnetic immobilizing rods 500 in the case of the 96-well type can be subdivided as follows.
  • the arrangement and shape of the magnetic immobilizing rods can be arranged as described above, and the magnetic body and the magnetic particle binding can be masked directly by using 8-strip PCR tubes, 12-strip PCR tubes,
  • the masking tube is manufactured in various shapes using a mold, the size and length arrangement of the magnetic substance fixing rods are not limited to the shape of 96 wells.
  • the magnetic particle separator 10 is a multi-pipette magnetic particle separator in which a magnetic substance 100 is mounted on 96 magnetic substance fixing rods 500.
  • the magnetic particle separator includes a tube hole friction portion A lower plate 200 for removing the plate, a switch 120 for moving the lower plate, a lower plate operating spring 130, a support tube 110 for supporting the switch and the spring, A support pipe fixing part 140 for fixing the support pipe 140, and fixing screws T1 and T2.
  • the support pipe fixing portion has a ring shape and a fixing screw groove t1 is formed.
  • the basic coupling relationship of the magnetic particle pipettor configuration of FIG. 10 is the same as that of the FIG. 3 pipettor.
  • the material of the handle portion H, the upper plate 300, the lower plate 200, and the pipet tip portion I which are components of the multi-well magnetic particle pipettor is made of plastic, metal (for example, iron, stainless steel, ), And may preferably be made of aluminum.
  • the present invention relates to a multi-well magnetic bead pipettor for extracting a nucleic acid or a protein.
  • the pipettor of the present invention is a device for separating a nucleic acid or protein from a sample using a multi-well plate (for example, a 96-well plate) and a plurality of magnetic / magnetic immobilizing rods indirectly bonding with magnetic particles.
  • the apparatus of the present invention can replace the existing expensive equipments and devices, and can be easily performed in the purification and analysis of nucleic acids in a large sample. In addition, it is easy to change the composition according to various sample forms, And can be efficiently used for on-site diagnosis with limitations.
  • Figure 1 is a 16-channel perfection of a multi-well magnetic bead pipettor of the present invention.
  • FIG. 2 is a block diagram of a multi-well magnetic particle pipettor according to the present invention.
  • FIG. 3 is a schematic exploded view of a multi-well magnetic bead pipettor of the present invention.
  • FIGS. 4 and 5 are a detailed exploded views of a multi-well magnetic bead pipettor top plate 300 of the present invention.
  • the "bar magnet (3)" mounted on the upper plate and (ii) the magnetic substance immobilizing rod (2) attached to the upper plate, 500 ") to the pipette tip holding plate 400 can be magnetically attached and detached (see FIGS. 4 and 5).
  • the pipette tip fixing plate 400 may be coupled to the pipette tip fitting groove 320.
  • the fixing screw T3 coupled to the pipette tip fixing plate 400 and the bar magnet of the upper plate are magnetically detached.
  • FIG. 5 (a) is a detailed exploded view of a multi-well magnetic bead pipettor pipet tip portion I of the present invention, and FIG. 5 (b) (I) portion and a lower plate (200).
  • FIG. 6 shows an 8-strip PCR tube mounted on a 16-channel magnetic particle pipettor of a multi-well magnetic bead pipettor of the present invention (FIG. 6 (a) and desorption (Fig. 6 (b)).
  • FIG. 7 is a graph showing the results of a 96-deep well plate using 16-channel type magnetic particle pipetters of a multi-well magnetic bead pipettor of the present invention. plate for the purification of 16 samples.
  • FIG. 8 shows the results of purification of the PCR product on a 96-deep well plate using a 16-channel type magnetic particle pipettor of the present invention.
  • FIG. 9 shows the results of purification of bacterial genomic DNA on a 96-deep well plate using a 16-channel type magnetic particle pipettor of the present invention.
  • FIG. 10 is a 96-channel 96-channel magnetic particle pipetting perfomance of a multi-well magnetic bead pipettor of the present invention.
  • FIG. 11 is a schematic diagram of a 96-channel magnetic particle pipettor 96-well PCR plate of the present invention mounted and dismounted.
  • FIG. 11 is a schematic diagram of a 96-channel magnetic particle pipettor 96-well PCR plate of the present invention mounted and dismounted.
  • FIG. 12 is a schematic diagram of a PCR product purification process using a 96-channel magnetic particle pipettor of the present invention.
  • FIGS. 1 and [ Figure 2] are diagrams illustrating the completeness and configuration of a multi-well magnetic particle pipettor according to an embodiment of the present invention
  • Figure 3 is a diagram showing a multi- This shows the overall decomposition of the particle pipettor.
  • the multiwell magnetic particle separation pipette of the present invention has a configuration in which eight to 96 pillar-shaped pellets are formed on a top plate 300 for the purpose of extracting nucleic acid from a large amount of samples in a multi-
  • the magnetic substance fixing rods 500 were coupled in the form of 8 rows and 12 columns and the magnetic substance fixing rods were combined with the magnetic substances by providing the magnetic substance fixing grooves 510 to which the magnetic bodies 100 were coupled.
  • the magnetic fixation rod is made of cylindrical aluminum and the magnetic body is made of commercially available 2 ⁇ x 6 mm cylindrical neodymium magnet [purchased from: Daejeon Magnet].
  • An 8-strip PCR tube or an 8-strip PCR tube may be used depending on the type of the pipettor so that the magnetic material 100 and the magnetic particles can not be directly bonded to each other so that the magnetic material and the magnetic particles are desorbed from time to time in the purification process of the sample.
  • a 96-well PCR plate was used and designed to associate with magnetic particles in a form coupled with PCR tubes or PCR plates. The attachment of the multi-well magnetic intrusion pipettor and the plate is designed to be combined with a portion of the tube hole friction portion 520, which is a portion formed by fitting the magnetic substance fixing rod 500 into the inside of the tube, by friction force without an additional fixing device.
  • the detachment of the plate is performed by pushing down the lower plate 200 using the lower plate operation switch 120 and the lower plate operation spring 130 and separating the PCR tube or the PCR plate coupled to the tube hole rubbing part 520 . That is, when the 96-well PCR plate is dissociated, it is a multipipette type in which the magnetic substance and the magnetic particles are separated.
  • the piezot tip portion I for determining the shape of the magnetic substance fixing rod in the multi-well magnetic particle pipettor is formed by fixing the rod magnet 3 and the magnetic substance fixing rod 500 coupled to the upper plate to the pipet tip fixing plate 400
  • FIG. 4 and FIG. 5 show an exploded view of the upper plate and an exploded view of the pipet tip portion.
  • FIG. 6 is a representative view of a 16-channel type magnetic particle pipetter in a multi-well magnetic particle pipettor, and shows an 8 column PCR tube and a mounting and desorption type.
  • Figure 7 is a schematic diagram of a PCR product purification process on a 96-deep well plate using a 16-channel magnetic particle pipettor.
  • the position of the pipet tip of the 16-channel magnetic particle pipettor is ideally located in columns 1 and 7 out of 12 columns on a 96-well plate, and the process of purifying nucleic acid using the same is as follows .
  • the solution of 96 deep-well plate is constructed as follows.
  • Step of attaching magnetic particles by mounting 8-strip PCR tubes on a 16-channel magnetic particle pipettor, placing the pipet tip portions on columns 1 and 7
  • the magnetic particles attached to the magnetic particle pipettor were transferred to columns 2 and 8, and the 8-strip PCR tubes were separated using a lower plate separator of the pipettor to remove the washing buffer 1 ( washing bffer1) solution (left for 1 minute)
  • the magnetic particles dispersed in the washing buffer 1 are put back into the 8-strip PCR tube and the magnetic particles are collected on the tip portion (left for 1 minute)
  • step 4 The magnetic particles collected in step 4 are moved to the third and the 9th columns of the pipettor tip, dispersed in the washing buffer 2 as in step 3, and collected as in step 4
  • step 5 The magnetic particles collected in step 5 are moved to the fourth and tenth rows of the pipettor tip, dispersed in the washing buffer 2 as in step 3, and collected as in step 4
  • step 7 the dried magnetic particles attached to the pipettor are transferred to columns 5 and 10, the 8-strip PCR tubes are separated, dispersed in the elution buffer, left for 5 minutes,
  • the PCR product was purified using the HiGene (TM) PCR Purification Kit (Magnetic Bead Type) manufactured by Biofact Co., Ltd. as shown in FIG. (5 '- agagtttgatcctggctcag - 3') primer, which is a primer for 16S ribosomal DNA (16S rDNA) amplification, used for identification of microorganisms from E. coli strain DH5 ⁇ , and 1492R '-tacggytaccttgttacgactt-3') primer to obtain a 1275 bp PCR product.
  • a solution of HiGene TM PCR Purification Kit (Magnetic Bead Type) from Biofact Co., Ltd. was dispensed into a 96-well plate as follows .
  • FIG. 8 is a graph showing the relationship between the amount of the 16S rDNA PCR product amplified from E. coli strain DH5 ⁇ and 20 ⁇ l of the magnetic particles contained in the HiGene TM PCR Purification Kit (Magnetic Bead Type) And then mixed with a binding buffer. Then, the nucleic acid was purified on a 96-well plate prepared in the above procedure using a 16-channel magnetic particle pipettor, and electrophoresed. Repeating the same procedure using the same wash buffer for columns 2 and 3 or columns 8 and 9 is a common method of increasing the purity when purifying nucleic acids and using 100% ethanol as the wash buffer for columns 4 and 10, To evaporate the remaining ethanol rapidly.
  • a solution of the kit phase (Bacterium, cultured cell) as shown in Fig. 7 was prepared by using the Multi Bead (TM) Genomic DNA Prep Kit Was subjected to nucleic acid purification after being dispensed into a 96-well-well plate as follows per well.
  • TM Multi Bead
  • FIG. 9 shows that DH5 ⁇ strain was cultured in LB culture for 16 hours. Then, 200 ⁇ l of the culture solution was mixed with the buffer in columns 1 and 7 with lysis and binding buffer, and then 16-channel This is the result of electrophoresis after purification of bacterial genomic DNA using a magnetic particle pipettor.
  • a nucleic acid purification process using a multi-well magnetic particle pipettor on a 96-well plate with a small amount of 20 or less samples is shown.
  • the multi-well magnetic particle pipettor can be applied to nucleic acid and protein purification even in a large amount of samples.
  • a 96-channel magnetic particle pipettor as shown in FIG. To purify nucleic acids and proteins.
  • the 8-strip PCR tube can be used to induce coupling and dissociation between the magnetic particle pipettor and the magnetic particles.
  • 96-channel (96-channel) magnetic particle pipetters can also induce coupling and dissociation between magnetic particles and pipetters using desorption and attachment of 96-well PCR plates.
  • washing buffer 1 washing buffer 1
  • FIG. 12 is a schematic diagram of a PCR product purification process using a 96-channel magnetic particle pipettor.
  • a buffer of HiGene (TM) PCR Purification Kit Magnetic Bead Type manufactured by Biopharmaceutical Co., Ltd. per well was dispensed in the following manner Respectively.
  • FIG. 13 is a graph showing the results obtained when 20 ⁇ l of the magnetic particles contained in 50 ⁇ l of the 16S rDNA PCR product amplified from the E. coli strain DH5 ⁇ and the HiGene TM PCR Purification Kit (Magnetic Bead Type) Buffer, and electrophoresis after purification of the nucleic acid on a 96-well plate prepared in the above procedure using a 96-channel magnetic particle pipettor.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Clinical Laboratory Science (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Immunology (AREA)
  • Analytical Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • General Physics & Mathematics (AREA)
  • Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Apparatus Associated With Microorganisms And Enzymes (AREA)

Abstract

본 발명은 8개에서 96개의 자성체를 포함하는 파이펫 형태의 자성입자 분리장치에 관한 것이다. 상기와 같은 본 발명에 따르면, 8-스트립 PCR 튜브(8-strip PCR tube) 또는 96 웰 PCR 플레이트 (96-well PCR plate)를 탈 부착 하여, 자성체와 자성입자가 직접적으로 결합을 방지하도록 제작된 파이펫 형태의 자성입자 분리장치 이다. 상기 자성입자 분리장치를 이용하여, 8개에서 96개의 시료로부터 핵산 및 단백질을 자성입자를 이용하여 동시에 분리 정제할 수 있어 대량의 시료에서 효과적으로 유전체 물질을 매우 용이하게 분리 정제할 수 있다.

Description

자성입자를 이용한 핵산 정제용 멀티-웰 자성입자 파이펫터
본 특허출원은 2017년 10월 24일에 대한민국 특허청에 제출된 대한민국 특허출원 제 10-2017-0138550 호에 대하여 우선권을 주장하며, 상기 특허출원의 개시 사항은 본 명세서에 참조로서 삽입된다.
본 발명은 자성입자를 이용한 핵산 정제용 멀티-웰 자성입자 파이펫터에 관한 것이다.
자성입자를 이용한 시료의 정제의 목적은 다량의 시료를 효율적인 고속 처리 (high throughput)방법에 있으며, 핵산 및 단백질 정제, 시료 농축 및 검출등 다양한 분야에 많이 이용되고 있다. 대부분의 자성입자를 이용한 핵산 정제에서 적은 수량의 시료에 대해서는 Thermo fisher사의 DynaMag™-2 Magnet과 Qiagne 사의 12-Tube Magnet과 같은 magnetic stand 형태의 제품으을 이용하여 핵산정제를 수행하고 있으며, 대량의 시료에 대해서는 Thermo fisher사의 MagMAX™ Express Particle Processor 장비, KingFisher Purification System 자동화 장비, 또는 Promega 사의 maxwell® 16 series, Biomek® FX series등과 같은 고가의 자동화 장비를 이용한 정제 방법 등을 제공하고 있다.
한편, 대한민국 등록특허 제10-1655233호 (발명의명칭: 멀티 타입의 자성 입자 분리 스탠드)에서 개시하고 있는 자성입자 분리장치의 경우, 고속 처리 (high throughput)방법으로 핵산 및 단백질 정제작업에 제한이 있다. 이와 같이 현재 개발된 자성입자 분리장치는 대부분 스탠드 형태로 제공되고 있어 대량 처리에 한계를 가지며, 자동화 장비를 이용한 분리장치는 가격적인 부담뿐만 아니라, 현장진단과 같이 운반이 용이하고 비전력(非電力) 상태의 핵산 검출이 요구되어 부피, 무게 및 전력공급과 같은 제약을 가진다.
본 발명자들은 종래의 자성입자 분리 과정에 대량처리공정에 대한 한계를 개선하고자 예의 연구 노력하였다. 그 결과, 본 발명자들은 8 채널에서 96채널을 가지는 파이펫 자성입자 분리 장치인 멀티 웰 (multi well) 자성입자 파이펫터(multi well magnetic bead pipettor)을 개발하여 본 발명을 완성하게 되었다.
따라서, 본 발명의 목적은 멀티웰 자성입자 파이펫터(multi-well magnetic bead pipettor)를 제공하는 데 있다.
본 발명의 일 양태에 따르면, 본 발명은 다음의 구성을 포함하며, 자성입자(magnetic bead)를 이용하여 멀티웰(multi-well) 플레이트로부터 핵산 또는 단백질을 추출하는 멀티웰 자성입자 파이펫터(multi-well magnetic bead pipettor)를 제공한다:
(a) 상판(300)과 결합가능하고, 하판 조작 스위치 (120) 및 하판 조작 스프링(130)을 포함하며, 상기 하판 조작 스위치 (120) 및 하판 조작 스프링을 이용하여 하판(200)의 상하이동을 조작하는 손잡이 부분(H);
(b) 손잡이 부분(H) 및 하판 (200)의 상부와 결합가능한 상판 (300);
(c) 상판 (300)의 하부 및 자성체 고정봉(400)의 상부와 결합가능한 하판 (200); 및
(d) 하판의 하부와 결합가능하고, (i) 복수 개의 자성체(100), 및 (ii) 상기 자성체(100)가 결합되는 복수 개의 자성체 고정봉(500) 을 포함하는 파이펫 팁 부분(I);
을 포함하는 피펫(pipette) 형태의 자성입자 분리장치로서,
상기 자성체 고정봉(500)은 하단에 튜브 홈 마찰부(520)를 포함하고, 상기 튜브 홈 마찰부(520)에는 8-스트립 PCR 튜브(8-strip PCR tube) 또는 96 웰 PCR 플레이트 (96-well PCR plate)가 부착 및 탈착 가능하다.
본 발명은 손잡이부분(H), 상판(300), 하판(200) 파이펫 팁부분(I)로 이루어진 파이펫 형태의 자성입자 분리장치이다. 본 발명에서 손잡이 부분(H)은 상판(300)과 결합되며, 손잡이 내부의 하판조작 스프링(130)과 연동되는 하판조작 스위치(120)를 이용하여 하판을 상하로 움직일 수 있으며, 이에 따라 파이펫 팁 부분(I)의 자성체 고정봉(500) 하부에 위치하는 튜브홀 마찰부(520)와 마찰력에 의해 결합된 PCR 튜브 및 플레이트를 분리시킬 수 있도록 고안되었다. 자성체 고정봉의 튜브홀 마찰부 자성체 고정홈(510)에 자성체(100)가 결합된다. PCR 튜브 및 플레이트를 장착 후 자성입자와 결합되도록 하여, PCR 튜브 및 플레이트 외벽에 자성입자가 결합되며, 하판 조작 스위치를 이용하여 PCR 튜브 및 플레이트가 탈착될 경우 외벽에 붙어있던 자성입자는 분리된다. 본 발병은 자성입자의 부착 및 분리를 이용한 파이펫 형태의 자성입자 분리장치로서, 자성입자(magnetic bead)를 이용하여 멀티웰(multi-well) 플레이트로부터 핵산 또는 단백질을 추출하는 멀티웰 자성입자 파이펫터(multi-well magnetic bead pipettor)를 제공한다.
본 발명자들은 종래의 자성입자 분리 과정에 대량처리공정에 대한 한계를 개선하고자 예의 연구 노력한 결과, 본 발명자들은 8개에서96개의 유도자석 고정부를 가지는 피펫형태의 자성입자 분리 장치인 멀티 웰 (multi-well) 자성입자 파이펫터(multi- well magnetic bead pipettor)을 개발하였다.
이하, 본 발명의 구성에 대하여 상세히 설명한다:
구성 (a): 손잡이 부분(H)
손잡이 부분(H)은 막대 형상으로서 예컨대 원기둥 또는 사각기둥 형상일 수 있으며, 이에 한정되는 것은 아니다.
상기 손잡이 부분(H)은 상판(300)과 결합가능하다. 손잡이 부분은 구체적으로 지지관(110), 하판 조작 스위치(120), 하판 조작 스프링(130) 및 지지관 고정부(140)로 구성된다(도 1. 참조) 손잡이 부분은 지지관 고정부(140)를 통하여 상판에 고정될 수 있으며, 지지관 고정부(140)는 고정나사 (T1)로 상판에 고정된다(도 3 참조). 상기 하판 조작 스위치 (120) 및 하판 조작 스프링을 이용하여 하판(200)의 상하이동을 조작한다.
고정캡(1)은 하판 조작 스위치 고정 캡이고, 플라스틱, 철재, 스테인리스, 알루미늄 등의 재질로 이루어질 수 있다.
손잡이 부분에서 지지관(110)의 재질은 플라스틱, 철재, 스테인리스, 알루미늄일 수 있고, 바람직하게는 알루미늄 재질로 이루어지는 것일 수 있다.
구성 (b): 상판(300)
상판(300)은 손잡이 부분(H) 및 하판을 고정 및 연결하는 지지체 역할을 한다. 상판에는 상술한 지지관 고정부(140) 및 고정나사 (T1)가 결합될 수 있도록 고정나사 (T1) 결합 홈(t1)이 형성되어 있으며, 하판이 결합될 수 있도록 고정나사 (T2) 결합 홈(t2/220)이 형성되어 있다(도 3 및 도 5 참조).
본 발명의 일 구현예에 따르면, 상기 상판(300) 및 하판(200)은 평행하게 구비되는 것을 특징으로 하며, 상판은 손잡이 부분(H)의 하부 및 하판 (200)의 상부와 결합가능하다.
한편, 상판에는 상판과 하판이 결합될 수 있도록 고정나사 (T2) 결합 홈(t2/220)이 형성되어 있다(도 3 및 도 5 참조).
본 발명의 멀티웰 자성입자 파이펫터는 상기 구성 이외에, 상판(300)과 하판(200) 사이에 위치하고, 상기 하판에 부착가능하며, 복수 개의 자성체 고정봉이 배열 및 결합되는 파이펫 팁 고정판 (400)을 추가적으로 포함할 수 있다. 파이펫 팁 고정판 (400)은 고정나사 (T3)를 통하여 하판에 고정될 수 있다(도 5 참조). 파이펫 팁 고정판에는 고정나사 (T3)를 통하여 자성체를 결합시킬 수 있는 파이펫 팁 고정 홈(410)이 형성되어 있다(도 5a 참조).
본 발명의 일 구현예에 따르면, 상기 파이펫 팁 고정판 (400)은 상판에 장착된 막대자석(3)에 자기적으로 탈부착가능하다.
본 발명에서 상판은 전체적으로 플레이트 형상이지만, 2열의 PCR 튜브가 결합되는 파이펫터인 경우, 도 1에서와 같이 H 형상으로 제작될 수 있다.
구성 (c): 하판(200)
하판(200)은 파이펫 팁 부분(I)을 고정하는 부분으로서, 상판 (300)의 하부, 및 파이펫 팁 부분(I) 중 자성체 고정봉(500)의 상부와 결합가능하다.
본 발명의 일 구현예에 따르면, 하판(200)은 자성체 고정봉(500)이 결합할 수 있도록 자성체 고정봉 통과 홈(210)이 형성된다. 자성체 고정봉(500)은 고정나사 (T3)를 통하여 하판에 직접적으로 결합될 수 있다.
본 발명의 다른 구현예에 따르면, 하판(200)은 파이펫 팁 고정판 (400)을 이용하여 자성체 고정봉(500)과 결합될 수 있다. 이 경우, 자성체 고정봉(500)에는 고정나사 (T3)가 결합될 수 있도록 고정나사 (T3) 결합 홈(t3)이 형성되어 있다. 파이펫 팁 고정판 (400)에 자성체 고정봉(500)이 결합된 상태로, 자성체 고정봉 통과 홈(210)을 통하여 하판에 장착된다(도 5 참조).
구성 (d): 파이펫 팁 부분(I)
파이펫 팁 부분(I)은 (i) 복수 개의 자성체(100), 및 (ii) 상기 자성체(100)가 결합되는 복수 개의 자성체 고정봉(500)을 포함한다.
본 발명에서 자성체(100)는 복수 개일 수 있으며, 예컨대, 8개 내지 100개 또는 8개 내지 96개 일 수 있다. 본 발명의 일 구현예에 따르면, 상기 자성체(100)는 유도자석이다.
본 발명에서 자성체 고정봉(500)은 복수 개일 수 있다. 본 발명의 일 구현예에 따르면, 상기 자성체 고정봉(500)의 개수는 8개 (1열) 내지 96개 (12열); 또는 12개(1행) 내지 96개 (8 행)이다. 예컨대, 자성체 고정봉의 개수를 1열만을 장착하여 8개의 자성입자 분리에 유도될 수 있으며; 2개 열을 장착하여 16개의 자성입자 분리장치에 유도될 수 있으며; 1개 행의 자성체 고정봉을 장착하여 12개의 자성입자 분리 장치에 유도될 수 있으며; 2개 행의 자성체 고정봉을 장착하여 24개의 자성입자 분리 장치에 유도될 수 있어; 1개부터 96개의 자성체 고정봉의 개수에 따라 변형이 가능하다.
본 발명에서 자성체(100) 및 자성체 고정봉(500)은 기둥 형상으로서, 원기둥 또는 다각형 기둥형상일 수 있다. 자성체 고정봉(500)의 하단에는 자성체가 결합 가능한 자성체 고정 홈(510)이 형성되어 있다.
한편, 자성체 고정봉(500)의 하단은 PCR 튜브가 끼움 결합될 수 있도록 튜브 홀 마찰부(520)가 형성되어 있으며, 자성체 고정봉 상단부 보다 작은 직경으로 이루어져 있다. 본 발명에서 자성체 고정봉(500) 하단의 튜브홀 마찰부(520)는 8-스트립 또는 12-스트립 PCR튜브(8 strip or 12 strip PCR tube)나 96웰 PCR 플레이트 (96 well PCR plate)와 마찰력에 의해 부착(끼움결합)되도록 고안되었다. 자성체 고정봉(500) 하단의 튜브홀 마찰부(520)는 금형가공에 의해 제작되며, 8-스트립/12-스트립 PCR튜브의 내부, 또는 96웰/튜브 플레이트의 웰/튜브 내부와 끼움 결합된다.
본 발명에서 마그네틱 파이펫터의 파이펫 팁 부분(I)의 자성체 고정봉의 길이, 형태 크기, 개수는 한정되지 않으며, 정제 시료의 용기 형태와 정제 방식에 따라 달리 고안하여 사용될 수 있다.
본 발명의 일 구현예에 따르면, 8-스트립 또는 12-스트립 PCR튜브(8 strip or 12 strip PCR tube)를 이용하여 다량의 시료에 대해 핵산을 추출할 수 있도록 하기 위하여, 하판(200)에 8개 또는 12개 기둥형태의 자성체 고정봉(500)을 2열 형태로 결합하였으며, 자성체 고정봉에는 자성체(100)가 결합되는 자성체 고정 홈(510)을 두어 자성체와 결합시켰다(도 5 참조).
본 발명의 다른 구현예에 따르면, 기존 96웰 (96- well) 형태의 플레이트에서 다량의 시료에 대해 핵산을 추출할 수 있도록 하기 위하여, 상판 (300)에 96개 기둥형태의 자성체 고정봉(500)을 8행 12열 형태로 결합하였으며, 자성체 고정봉에는 자성체(100)가 결합되는 자성체 고정 홈(510)을 두어 자성체와 결합시켰다.
특히, 시료의 정제 과정에서 자성체와 자성입자가 흡착및 탈착 할 수 있도록하기 위하여 96웰 PCR 플레이트를 자성체 고정봉에 장착 및 탈착할 수 있도록 고안되었다. 이에 자성체 고정봉에 있는 튜브 홀 마찰부(520)의 마찰력을 이용하여 96웰 PCR 플레이트가 하판의 아래에 장착될 수 있게 고안되었으며, 하판조작 스위치(120)을 이용하여 하판(200)을 아래로 밀어내어 96웰 PCR 플레이트를 탈착시킬 수 있다(도 11 참조). 즉, 본 발명의 파이펫터는 상기 하판 조작 스위치를 이용하여, 8-스트립 PCR 튜브 (8-strip PCR tube) 또는 96 웰 PCR 플레이트 (96-well PCR plate)를 탈착할 수 있다.
본 발명의 멀티 웰 자성입자의 파이펫터에서 시료의 개수와 핵산 및 단백질의 정제 방식에 따라, 96웰 형태의 경우 자성체 고정봉(500)의 배열이 다음과 같이 세분화 될 수 있다.
8열 x 1행 = 8개 자성체 고정봉,
8열 x 2행 = 16개 자성체 고정봉,
8열 x 3행 = 24개 자성체 고정봉,
8열 x 4행 = 32개 자성체 고정봉,
…
8열 x 11행 = 88개 자성체 고정봉,
8열 x 12행 = 96개 자성체 고정봉.
또는
12열 x 1행 = 12개 자성체 고정봉,
12열 x 2행 = 24개 자성체 고정봉,
12열 x 3행 = 36개 자성체 고정봉,
12열 x 4행 = 48개 자성체 고정봉,
...
12열 x 7행 = 84개 자성체 고정봉,
12열 x 8행 = 96개 자성체 고정봉.
96웰 형태의 경우 자성체 고정봉의 배열 및 형태는 상기와 같이 배열될 수 있고, 자성체와 자성입자 결합을 8-스트립 PCR 튜브, 12-스트립 PCR 튜브, 96 웰 PCR 플레이트를 이용하여 직접 결합을 못하게 마스킹(masking) 하고있으나, 금형을 이용하여 여러 형태로 마스킹 튜브를 제작할 경우 자성체 고정봉의 크기, 길이 배열형태가 96웰 형태에 한정되지 않는다.
자성체 고정봉의 배열을 결정하는 파이펫 팁 부분(I)은, (i) 상판에 장착된 “막대자석(3)”과 (ii) 자성체 고정 봉(500)을 하판(200) 또는 파이펫 팁 고정 판(400)에 고정하는 “고정나사 (T3)”가 자기적으로 부착 및 탈착 가능하도록 제작될 수 있다(도 4 및 도 5 참조). 즉, 상기 파이펫 팁 부분(I)은 상판(300)에 장착된 막대자석의 자기력에 의해 상판에 탈착 및 부착이 가능하다
본 발명에 따른 도 10의 자성입자 파이펫터는 96개의 자성체 고정봉(500)에 자성체(100)를 장착시킨 멀티 피펫 형태의 자성입자 분리장치로, 96 웰 플레이트에 접합할 수 있는 튜브 홀 마찰부(520)를 포함하고 있으며, 플레이트를 탈착할 수 있는 하판(200), 하판을 움직이는 스위치(120), 하판 조작 스프링(130), 스위치와 스프링을 지지하는 지지관 (110), 지지관과 상판을 고정하는 지지관 고정부(140)와 고정나사 (T1, T2)으로 이루어진 파이펫 형태의 자성입자 분리장치이다. 지지관 고정부는 링(ring) 형상으로서, 고정나사홈(t1)이 형성되어 있다. 도 10의 자성입자 파이펫터 구성의 기본적인 결합관계는 도 3의 파이펫터와 동일하다.
본 발명에서 멀티 웰 자성입자 파이펫터의 구성부분인 손잡이부분(H), 상판(300), 하판(200) 및 파이펫 팁부분(I)의 재질은 플라스틱, 금속 (예컨대 철재, 스테인리스, 알루미늄 등)일 수 있고, 바람직하게는 알루미늄 재질로 이루어지는 것일 수 있다.
본 발명의 특징 및 이점을 요약하면 다음과 같다:
(a) 본 발명은 핵산 또는 단백질을 추출하는 멀티웰 자성입자 파이펫터(multi-well magnetic bead pipettor)에 관한 것이다.
(b) 본 발명의 파이펫터는 멀티웰 플레이트(예컨대, 96 웰 플레이트) 및 자성입자와 간접적으로 결합하는 복수 개의 자성체/자성체 고정봉을 이용하여 시료로부터 핵산 또는 단백질을 분리하는 장치이다.
(c) 본 발명의 장치는 기존 고가의 장비 및 기기를 대체하여 대량 시료에서 핵산 정제 및 분석에 매우 용이하게 수행 할 수 있을 뿐만 아니라, 다양한 시료의 형태에 따라서 조성변경이 용이하고 공간 및 전력적 한계가 있는 현장진단용에 효율적으로 이용될 수 있다.
도 1은 본 발명의 멀티 웰 (multi-well) 자성입자 파이펫터(multi-well magnetic bead pipettor)중 16 채널 (16-channel) 형태의 완성도 이다.
도 2는 본 발명의 멀티 웰 (multi-well) 자성입자 파이펫터(multi-well magnetic bead pipettor)의 구성도 이다.
도 3은 본 발명의 멀티 웰 (multi-well) 자성입자 파이펫터(multi-well magnetic bead pipettor)의 개괄 분해도면 이다.
도 4는 본 발명의 멀티 웰 (multi-well) 자성입자 파이펫터(multi-well magnetic bead pipettor) 상판(300)의 상세 분해도면이다. 본 발명의 멀티 웰 자성입자의 파이펫터에서 자성체 고정봉의 배열 형태를 결정하는 파이펫 팁 부분(I)은, (i) 상판에 장착된 “막대자석(3)”과 (ii) 자성체 고정 봉(500)을 파이펫 팁 고정 판(400)에 고정하는 “고정나사 (T3)”가 자기적으로 부착 및 탈착 가능하도록 제작될 수 있다(도 4 및 도 5 참조). 파이펫 팁 고정 판(400)은 파이펫 팁 결합 홈(320)에 결합될 수 있다. 이 때, 파이펫 팁 고정 판(400)에 결합된 고정나사 (T3)와 상판의 막대자석이 자기적으로 탈착된다.
도 5(a)는 본 발명의 멀티 웰 (multi-well) 자성입자 파이펫터(multi-well magnetic bead pipettor) 파이펫 팁부분 (I)의 상세 분해도면이며, 도5(b)는 파이펫 팁부분 (I)부분과 하판(200)과의 조립도 이다.
도 6는 본 발명의 멀티 웰 (multi-well) 자성입자 파이펫터(multi-well magnetic bead pipettor)중 16 채널 (16-channel) 형태의 자성입자 파이펫터에 8-스트립 PCR 튜브를 장착[도 6(a)] 및 탈착[도 6(b)]을 나타낸 모식도이다.
도 7은 본 발명의 멀티 웰 (multi-well) 자성입자 파이펫터(multi-well magnetic bead pipettor)중 16 채널 (16-channel) 형태 자성입자 파이펫터를 이용하여 96 딥 웰 플레이트 (96-deep well plate) 상에서 16가지의 시료를 정제하는 모식도를 나타낸 것이다.
도 8은 본 발명의 16 채널 (16-channel) 형태 자성입자 파이펫터를 이용하여 96 딥 웰 플레이트 (96-deep well plate) 상에서 PCR 산물을 정제한 결과를 나타낸 것이다.
도 9는 본 발명의 16 채널 (16-channel) 형태 자성입자 파이펫터를 이용하여 96 딥 웰 플레이트 (96-deep well plate) 상에서 박테리아 게놈 DNA (bacterial genomic DNA)을 정제한 결과를 나타낸 것이다.
도 10은 본 발명의 멀티 웰 (multi-well) 자성입자 파이펫터(multi-well magnetic bead pipettor)중 96 채널 (96-channel) 형태의 자성입자 파이펫터 완성도 이다.
도 11은 본 발명의 96 채널 (96-channel) 형태의 자성입자 파이펫터 96웰 PCR 플레이트와 장착 및 탈착된 모식도 이다.
도 12는 본 발명의 96 채널 (96-channel) 형태의 자성입자 파이펫터를 이용한 PCR 산물 정제과정에 대한 모식도 이다.
도 13은 PCR 산물 정제 결과에 대한 실시예를 나타낸 것이다.
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 본 발명을 보다 구체적으로 설명하기 위한 것으로, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에 있어서 자명하다.
실시예
[도 1] 및 [도 2]는 본 발명의 실시예에 따른 멀티 웰 (multi-well) 자성입자 파이펫터 완성도와 구성도이고, [도 3]은 본 발명의 멀티 웰 (multi-well) 자성입자 파이펫터의 총괄적인 분해도를 나타낸다.
도 1, 2 및 3을 참조하면, 본 발명의 멀티 웰 자성입자 분리 피펫은 멀티웰 플레이트에서 다량의 시료에 대해 핵산을 추출을 목적으로, 상판 (300)에 8개에서96개 의 기둥형태의 자성체 고정봉(500)을 8행 X 12열 형태로 결합하였으며, 자성체 고정봉에는 자성체(100)가 결합되는 자성체 고정 홈(510)을 두어 자성체와 결합시켜 두었다. 자성체 고정봉은 원통형의 알루미늄 재질이며, 자성체는 상용화 된2∮x6mm의 원통형 네오디움 자석 [구입처 : 대화공단 대전자석]을 사용하였다.
시료의 정제 과정에서 자성체와 자성입자가 수시로 흡착 탈착 되도록 하기 위하여 자성체(100)과 자성입자가 직접적으로 결합하지 못하도록 하기 위하여 파이펫터의 형태에 따라 8-스트립 PCR 튜브 (8-strip PCR tube) 또는96웰 PCR 플레이트를 이용하였으며, PCR 튜브 또는 PCR 플레이트와 결합된 형태에서 자성입자와 결합되도록 고안되었다. 멀티웰 자성입차 파이펫터와 플레이트의 부착은 추가적인 고정장치 없이 자성체 고정봉(500)을 튜브 내부에 맞게 가공한 부분인 튜브홀 마찰부(520) 부위와 마찰력에 의해 결합되는 형태로 고안되었다.
플레이트의 탈착은 하판조작 스위치(120)와 하판 조작 스프링(130)을 이용하여 하판(200)을 아래로 밀어내어 튜브홀 마찰부(520)에 결합된 PCR 튜브 또는 PCR 플레이트를 분리시키는 과정으로 이루어진다. 즉 96웰 PCR 플레이트를 해리시키면 자성체와 자성입자가 분리되는 형태의 멀티 피펫 형태이다.
멀티 웰 자성입자의 파이펫터에서 자성체 고정봉의 형태를 결정하는 파이펫 팁 부분(I)은 상판에 결합된 막대자석 (3)과 자성체 고정 봉(500)을 파이펫 팁 고정 판(400)에 고정하는 고정나사 (T3)와 자기적으로 부착 및 탈착 가능하도록 제작되는 것을 특징으로 하며, 상판의 분해도와 파이펫 팁부분의 분해도를 [도 4]와 [도5]에 나타내었다.
[도 6]은 멀티 웰 자성입자의 파이펫터중 16 채널 (16-channel)형태의 자성입자 파이펫터 형태의 대표도를 나타내며, 8 열 PCR 튜브와 장착 및 탈착 형태를 나타낸 도면이다.
[도 7]은 16 채널 (16-channel)형태의 자성입자 파이펫터를 이용하여 96 딥 웰 플레이트 (96-deep well plate)상에서 PCR 산물 정제과정에 대한 모식도이다. 자세하게는 16 채널 (16-channel) 자성입자 파이펫터의 파이펫 팁 위치는, 96웰 플레이트 상의 12열 중에서 1열과 7열에 위치하는 것을 이상적으로 하며, 이를 이용한 핵산의 정제과정을 상술하면 다음과 같다.
우선적으로 96 딥 웰 플레이트의 용액 아래와 같이 구성한다.
1열 및 7열 : 결합 버퍼 (binding buffer, B)
2열 및 8열 : 세척 버퍼 1번 (washing buffer, W1)
3열 및 9열: 세척 버퍼 2번 (washing buffer, W2)
4열 및 10열 : 세척 버퍼 3번 (washing buffer, W3)
5열 및 11열 : 용출 버퍼(elution buffer, E)
6열 및 12열: Blank
상기와 같이 96 딥 웰 플레이트에 용액을 준비한 후 핵산을 정제하는 과정은 다음과 같다:
1. 1열에 증폭된 PCR 산물과 자성입자를 혼합 하여 자성 입자에 핵산을 결합 시키는 단계
2. 16 채널 (16-channel)형태의 자성입자 파이펫터에 8-스트립 PCR 튜브를 장착 후 파이펫 팁 부분이 1열과 7열에 놓이게 하여 자성입자를 부착하는 단계
3. 자성입자 파이펫터에 부착된 자성입자를 2열 및 8열로 옮긴 다음 파이펫터의 하판 분리 스위치를 이용하여 8-스트립 PCR 튜브를 분리 시켜 자성입자가 2열 및 8열에 존재하는 세척 버퍼 1(washing bffer1) 용액에 분산 시키는 단계 (1분간 방치)
4. 세척버퍼 1에 분산된 자성입자를 자성입자 파이펫터를 8-스트립 PCR 튜브에 다시 장착하여 자성입자를 팁 부분에 모으는 단계 (1분간 방치)
5. 4번 과정에서 모인 자성입자는 파이펫터 팁을 3열과 9열로 이동시킨 후, 3번 과정과 같이 세척버퍼 2에 분산 및 4번 과정에서와 같이 모으는 단계
6. 5번 과정에서 모인 자성입자는 파이펫터 팁을 4열과 10열로 이동시킨 후, 3번 과정과 같이 세척버퍼 2에 분산 및 4번 과정에서와 같이 모으는 단계
7. 6번 과정에서 모인 자성입자를 상온에서 5분간 두어 용액을 증발시키는 단계
8. 7번과정에서 파이펫터에 부착된 말려진 자성입자를 5열과 10열로 옮겨 8-스트립 PCR 튜브를 분리시켜 용출 버퍼에 분산시켜 5분간 방치 후 다시 자성입자만 모으는 단계
상기 과정을 이용한 PCR 산물을 정제하기 위하여 (주)바이오팩트사의 HiGene™ PCR Purification Kit(Magnetic Bead Type) 를 이용하여 [도 7]에서 도식화 한 바와 같이 PCR 산물을 정제 수행하였다. PCR 산물을 정제를 수행하기 위하여, 대장균 균주인 DH5α 균주로 부터 미생물 동정에 이용되는 16S ribosomal DNA(16S rDNA) 증폭용 프라이머 (primer) 인 27F ( 5' - agagtttgatcctggctcag - 3') 프라이머 와 1492R ( 5' - tacggytaccttgttacgactt - 3') 프라이머를 이용하여 1275 bp의 PCR 산물을 얻었으며, (주)바이오팩트사의 HiGene™ PCR Purification Kit(Magnetic Bead Type)의 용액을 96 딥-웰 플레이트에 다음과 같이 분주하였다.
1열 및 7열 : 250 μl 결합 버퍼 (binding buffer)
2열 및 8열 : 700 μl 세척 버퍼 1(washing buffer)
3열 및 9열 : 700 μl 세척 버퍼 1(washing buffer) - 2열 및 8열과 동일 용액 사용
4열 및 10열 : 700 μl 세척 버퍼 2(washing buffer 2) - 100% 에탄올 사용
5열 및 11열 : 50 μl 용출 버퍼 (elution buffer)
6열 및 12열: Blank
[도 8]은 대장균 균주인 DH5α 균주로부터 증폭된 상기 16S rDNA PCR 산물 50 μl와 (주)바이오팩트사의 HiGene™ PCR Purification Kit(Magnetic Bead Type)에 포함된 자성입자 20 μl를 1열 및 7열에 넣어 결합버퍼와 혼합한 다음, 16 채널 (16-channel)형태의 자성입자 파이펫터를 이용하여 위 과정에서 준비된 96 딥-웰 플레이트상에서 핵산을 정제 후 전기영동한 결과이다. 2열과 3열 또는 8열과 9열에 동일한 세척버퍼를 사용하여 같은 과정을 반복하는 것은 핵산 정제시 순도를 높이는 통상적인 방법이며, 4열과 10열의 세척 버퍼로 100% 에탄올을 사용한 것은 자성입자 표면상에 남아있는 에탄올을 빠르게 증발 시키기 위함이다.
상기 과정을 이용한 박테리아 게놈 DNA (bacterial genomic DNA)를 추출하기 위하여 (주)바이오팩트사의 多Bead™ Genomic DNA Prep Kit (Bacterium, cultured cell)를 이용하여 [도 7]에서 도식화 한 바와 같이 키트상의 용액을 96 딥-웰 플레이트에 웰(well) 당 다음과 같이 분주한 후 핵산 정제를 수행하였다.
1열 및 7열 : 600 μl 용해 및 결합 버퍼 (lysis and binding buffer) -> 키트상의 MC1(-)버퍼 200 μl, MC2버퍼 200 μl, 이소프로판올 200 μl을 혼합
2열 및 8열 : 700 μl 세척 버퍼 1(washing buffer) -> 키트상의 MPW2 버퍼 700 μl
3열 및 9열 : 700 μl 세척 버퍼 1(washing buffer) -> 키트상의 MPW2 버퍼 700 μl
4열 및 10열 : 700 μl 세척 버퍼 2(washing buffer 2) - 100% 에탄올 사용
5열 및 11열 : 100 μl 용출 버퍼 (elution buffer)
[도 9]는 DH5α 균주를 LB 배양액에 16시간 배양 후 배양액 200 μl를 용해 및 결합버퍼(lysis and binding buffer)가 있는 1열과 7열에 넣어 버퍼와 혼합한 후 16 채널 (16-channel)형태의 자성입자 파이펫터를 이용하여 박테리아 게놈 DNA를 정제한 다음 전기영동한 결과이다.
상기 형태에서는 20개 이하의 소량의 시료로부터 96 딥-웰 플레이트 상에서 멀티웰 자성입자 파이펫터를 이용한 핵산 정제과정을 나타낸 것이다. 본 발명에서는 멀티웰 자성입자 파이펫터는 대량의 시료에서도 핵산 및 단백질 정제에 적용 가능하며, 실예로 [도 10]과 같이 96 채널 (96-channel) 형태의 자성입자 파이펫터를 이용하여 다량의 시료로부터 핵산 및 단백질 정제가 가능하다. 상기 언급한 16채널 (16-channel) 형태의 자성입자 파이펫터의 경우 8-스트립 PCR 튜브 (8-striip PCR tube)를 이용하여 자성입자 파이펫터와 자성입자간의 결합 및 해리를 유도할 수 있는 바와 같이, 96 채널 (96-channel) 형태의 자성입자 파이펫터 또한 96웰 PCR 플레이트를 탈착 및 부착을 이용하여 자성입자와 파이펫터 간의 결합 및 해리를 유도할 수 있다. [도 11]
다량의 시료로부터 핵산을 정제하기 위하여 다음과 같은 형태의 용액준비가 필요하다.
1 번 플레이트 : 결합 버퍼(binding buffer)
2번 플레이트 : 세척 버퍼1 (washing buffer 1)
3번 플레이트 : 세척 버퍼2 (washing buffer 2)
4번 플레이트 : 세척 버퍼3 (washing buffer 3)
5번 플레이트 : 용출 버퍼 (elution buffer)
[도 12]는 96 채널 (96-channel) 형태의 자성입자 파이펫터를 이용하여 PCR 산물 정제 과정에 대한 모식도이다. 96 채널 (96-channel) 형태의 자성입자 파이펫터를 이용한 PCR 산물 정제를 수행하기 위하여 웰(well) 당 (주)바이오팩트사의 HiGene™ PCR Purification Kit(Magnetic Bead Type)의 버퍼를 다음과 같이 분주하였다.
1번 플레이트 : 250 μl 결합 버퍼 (binding buffer)
2번 플레이트 : 700 μl 세척 버퍼 1(washing buffer)
3번 플레이트 : 700 μl 세척 버퍼 1(washing buffer) - 2열 및 8열과 동일 용액 사용
4번 플레이트 : 700 μl 세척 버퍼 2(washing buffer 2) - 100% 에탄올 사용
5번 플레이트 : 50 μl 용출 버퍼 (elution buffer)
[도 13]은 대장균 균주인 DH5α 균주로부터 증폭된 16S rDNA PCR 산물 50 μl와 (주)바이오팩트사의 HiGene™ PCR Purification Kit(Magnetic Bead Type)에 포함된 자성입자 20 μl를 1번 플레이트에 넣어 결합버퍼와 혼합한 다음, 96 채널 (96-channel)형태의 자성입자 파이펫터를 이용하여 위 과정에서 준비된 96웰 플레이트상에서 핵산을 정제 후 전기영동 결과이다.
[부호의 설명]
H : 손잡이 부분
I : 파이펫 팁 부분
N : 너트
T1, T2, T3 : 고정나사
t1, t2, t3 : 나사 고정 홈
1 : 하판 조작 스위치 고정 캡
2 : 하판 고정 나사 홈
3 : 막대자석
100 : 자성체
110 : 지지관
120 : 하판 조작 스위치
130 : 하판 조작 스프링
140 : 지지 관 고정부
150 : 지지 관 고정 나사 홈
200 : 하판
210 : 자성체 고정봉 통과 홈
220 : 하판 조작 스위치 결합 홈
300 : 상판
310 : 막대자석 부착 홈
320 : 파이펫 팁 결합 홈
400 : 파이펫 팁 고정 판
410 : 파이펫 팁 고정 홈
500 : 자성체 고정 봉
510 : 자성체 고정홈
520 : 튜브 홀 마찰부

Claims (10)

  1. 다음의 구성을 포함하며, 자성입자(magnetic bead)를 이용하여 멀티웰(multi-well) 플레이트로부터 핵산 또는 단백질을 추출하는 멀티웰 자성입자 파이펫터(multi-well magnetic bead pipettor):
    (a) 상판(300)과 결합가능하고, 하판 조작 스위치 (120) 및 하판 조작 스프링(130)을 포함하며, 상기 하판 조작 스위치 (120) 및 하판 조작 스프링을 이용하여 하판(200)의 상하이동을 조작하는 손잡이 부분(H);
    (b) 손잡이 부분(H) 및 하판 (200)의 상부와 결합가능한 상판 (300);
    (c) 상판 (300)의 하부 및 자성체 고정봉(400)의 상부와 결합가능한 하판 (200); 및
    (d) 하판의 하부와 결합가능하고, (i) 복수 개의 자성체(100), 및 (ii) 상기 자성체(100)가 결합되는 복수 개의 자성체 고정봉(500) 을 포함하는 파이펫 팁 부분(I);
    을 포함하는 피펫(pipette) 형태의 자성입자 분리장치로서,
    상기 자성체 고정봉(500)은 하단에 튜브 홈 마찰부(520)를 포함하고, 상기 튜브 홈 마찰부(520)에는 8-스트립 PCR 튜브 (8-strip PCR tube) 또는 96 웰 PCR 플레이트 (96-well PCR plate)가 부착 및 탈착 가능하다.
  2. 제 1 항에 있어서, 상기 멀티웰 자성입자 파이펫터는 상판(300)과 하판(200) 사이에 위치하고, 복수 개의 자성체 고정봉이 배열 및 결합되는 파이펫 팁 고정판 (400)을 추가적으로 포함하는 것을 특징으로 하는 자성입자 파이펫터.
  3. 제 2 항에 있어서, 파이펫 팁 고정판 (400)은 상판에 장착된 막대자석(3)에 자기적으로 탈부착가능한 것을 특징으로 하는 자성입자 파이펫터.
  4. 제 1 항에 있어서, 상기 자성체(100)는 8개 - 100개인 것을 특징으로 하는 자성입자 파이펫터.
  5. 제 1 항에 있어서, 상기 자성체(100)는 유도자석인 것을 특징으로 하는 자성입자 파이펫터.
  6. 제 1 항에 있어서, 상기 상판(300) 및 하판(200)은 평행하게 구비되며, 상기 하판에는 자성체 고정봉(500)이 결합 가능한 자성체 고정봉 통과 홈(210)이 형성된 것을 특징으로 하는 자성입자 파이펫터.
  7. 제 1 항에 있어서, 상기 파이펫터는 상기 하판 조작 스위치를 이용하여, 8-스트립 PCR 튜브 (8-strip PCR tube) 또는 96 웰 PCR 플레이트 (96-well PCR plate)를 탈착할 수 있는 것을 특징으로 하는 자성입자 파이펫터.
  8. 제 1 항에 있어서, 상기 자성체 고정부, 상판(300) 및 하판(200)은 금속 또는 플라스틱 재질인 것을 특징으로 하는 자성입자 파이펫터.
  9. 제 1 항에 있어서, 상기 자성체 고정봉(500)의 개수는 8개 (1열) 내지 96개 (12열); 또는 12개(1행) 내지 96개 (8 행)인 것을 특징으로 하는 자성입자 파이펫터.
  10. 제 1 항에 있어서, 상기 파이펫 팁 부분(I)은 상판(300)에 장착된 막대자석의 자기력에 의해 탈착 및 부착이 가능한 것을 특징으로 하는 자성입자 파이펫터.
PCT/KR2017/014198 2017-10-24 2017-12-06 자성입자를 이용한 핵산 정제용 멀티-웰 자성입자 파이펫터 WO2019083086A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2017-0138550 2017-10-24
KR1020170138550A KR102011496B1 (ko) 2017-10-24 2017-10-24 자성입자를 이용한 핵산 정제용 멀티-웰 자성입자 파이펫터

Publications (1)

Publication Number Publication Date
WO2019083086A1 true WO2019083086A1 (ko) 2019-05-02

Family

ID=66246578

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2017/014198 WO2019083086A1 (ko) 2017-10-24 2017-12-06 자성입자를 이용한 핵산 정제용 멀티-웰 자성입자 파이펫터

Country Status (2)

Country Link
KR (1) KR102011496B1 (ko)
WO (1) WO2019083086A1 (ko)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114364811A (zh) * 2019-09-20 2022-04-15 美国西门子医学诊断股份有限公司 具有pcr芯片的样品制备设备和多孔板

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20080296157A1 (en) * 2005-09-30 2008-12-04 Perkinelmer Cellular Technologies Germany Gmbh Method and Device for Handling Sedimenting Particles
KR20100080903A (ko) * 2007-09-10 2010-07-13 질송 에스.아.에스. 안내부가 구비된 피스톤 홀더를 포함하는 다채널 피펫
US20170152509A1 (en) * 2014-05-23 2017-06-01 Shimadzu Corporation Method for operating magnetic body particles and device for operating magnetic body particles

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2004177151A (ja) 2002-11-25 2004-06-24 Yaskawa Electric Corp 分注装置
DE102005004664B4 (de) 2005-02-02 2007-06-21 Chemagen Biopolymer-Technologie Aktiengesellschaft Vorrichtung und Verfahren und Verwendung zum Abtrennen von magnetischen oder magnetisierbaren Partikeln aus einer Flüssigkeit sowie deren Verwendungen
CN100402153C (zh) 2005-08-26 2008-07-16 博奥生物有限公司 一种多通道移液装置及其使用方法
KR101025135B1 (ko) * 2008-04-09 2011-03-31 (주)바이오니아 자동정제장치, 멀티 웰 플레이트 키트 및 생물학적 시료로부터 핵산을 추출하는 방법
KR101707987B1 (ko) * 2015-06-16 2017-02-21 휴스텝스 주식회사 자동 정량 분주기 및 상기 분주기를 포함하는 연속식 유전자 추출-증폭 장비와 연속식 유전자 추출-증폭 방법

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20080296157A1 (en) * 2005-09-30 2008-12-04 Perkinelmer Cellular Technologies Germany Gmbh Method and Device for Handling Sedimenting Particles
KR20100080903A (ko) * 2007-09-10 2010-07-13 질송 에스.아.에스. 안내부가 구비된 피스톤 홀더를 포함하는 다채널 피펫
US20170152509A1 (en) * 2014-05-23 2017-06-01 Shimadzu Corporation Method for operating magnetic body particles and device for operating magnetic body particles

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
"BIOFACT, '96well magnetic bead pipettor", 2017 INTERNATIONAL CONFERENCE OF THE KOREAN SOCIETY FOR MOLECULAR AND CELLULAR BIOLOGY, 12 September 2017 (2017-09-12), COEX, SEOUL, KOREA *
"BIOFACT, 'HisolTM magnetic bead pipettor", KMB 2017, 44TH ANNUAL MEETING & INTERNATIONAL SYMPOSIUM, 28 June 2017 (2017-06-28), BEXCO, BUSAN, KOREA *
"Magnetic bead separation stand / pipettor", BIOFACT, 7 October 2017 (2017-10-07), pages 1 - 2, XP055597827, Retrieved from the Internet <URL:http://www.e-bioindustry.or.kr/board/download.php?code=bio&num=542&comm=> *
"PCR Purification 'HiGene PCR Purification KIT(Magnetic Bead Type)", BRIC, 18 October 2017 (2017-10-18), pages 1 - 2, XP055597824, Retrieved from the Internet <URL:http://www.ibric.org/myboard/read.php?Board=new_protech&id=185215&Ksearch=1&FindText=HiGene> *

Also Published As

Publication number Publication date
KR20190045686A (ko) 2019-05-03
KR102011496B1 (ko) 2019-08-16

Similar Documents

Publication Publication Date Title
WO2013119049A1 (ko) 생물학적 시료의 자동 분석 장치 및 방법
Valamehr et al. Platform for induction and maintenance of transgene-free hiPSCs resembling ground state pluripotent stem cells
EP2633328A2 (en) Automatic real-time pcr system for the various analysis of biological smaple
WO2015088201A1 (ko) 자성입자 분리장치 및 이를 이용한 핵산 또는 단백질의 분리 및 정제방법
WO2019083086A1 (ko) 자성입자를 이용한 핵산 정제용 멀티-웰 자성입자 파이펫터
WO2015030485A1 (ko) 입자의 이동에 의해 분석물질을 검출하는 장치 및 방법
WO2015199423A9 (ko) 자성 입자를 이용한 핵산 분리 방법
NO20012700D0 (no) Formuleringer og fremgangsmåter for isolering av nukleinsyrer fra ethvert komplekst utgangsmateriale og etterfölgende kompleksegenetiske analyse
WO2016117726A1 (en) Cartridge
DK1071797T3 (da) Fremgangsmåde til isolering af et polynukleotid af interesse ud fra genomet af en mycobakterie under anvendelse af et BAC-baseret DNA-bibliotek. Anvendelse til påvisning af mycobakterier
WO2020209638A1 (ko) 중합효소 연쇄반응 시스템
WO2010137903A2 (ko) 신개념 신약개발을 위한 타겟 단백질-단백질 상호작용을 저해하는 신약후보물질의 스크리닝 방법
WO2014084672A1 (ko) 전자동 무세포 단백질 제조장비 및 이를 이용한 단백질의 제조방법
WO2016144136A1 (ko) Ffpe 조직에서 핵산의 분리 방법
WO2011071259A2 (ko) 마이코플라즈마 오염이 방지된 세포의 배양방법 및 세포의 마이코플라즈마 오염의 제거방법
WO2016126141A1 (ko) Dna 추출 디스크 장치 및 이를 이용한 dna 추출 방법
WO2022250490A1 (ko) 미소입자 분리장치 및 이를 이용한 미소입자 분리방법
WO2019017726A2 (en) MAGNETIC BALL TRANSFER MODULES, AUTOMATED SYSTEM COMPRISING SAME, AND PROCESS FOR EXTRACTING NUCLEIC ACIDS USING THE SAME
WO2018139826A1 (ko) Dna 메틸화를 이용한 연령 예측 방법
WO2015005692A1 (en) Liquid chromatography apparatus for fast measuring
WO2013119034A1 (en) An apparatus for continuous separation of valine and a method for continuous separation of valine using the same
AU3273200A (en) Ion exchange chromatographic separation of glp-1 and related peptides
WO2019221537A1 (ko) 미토콘드리아 dna를 내부 기준 시료로 사용하는 마이코플라즈마 검출 방법
WO2021011943A3 (en) Methods and devices for single-cell based digital high resolution melt
WO2010074450A2 (ko) Ｌｃ-ｍｆｒ-ｍｓ 기반 신약후보물질 스크리닝 방법 및 신약후보물질 스크리닝 장치

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17929891

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 17929891

Country of ref document: EP

Kind code of ref document: A1