WO2019046610A1 - REACTION OF SYNCHRONIZATION AMPLIFICATION AND (NEAR) EXTENSION OF SYNCYTIAL RESPIRATORY VIRUS SPECIES - Google Patents
REACTION OF SYNCHRONIZATION AMPLIFICATION AND (NEAR) EXTENSION OF SYNCYTIAL RESPIRATORY VIRUS SPECIES Download PDFInfo
- Publication number
- WO2019046610A1 WO2019046610A1 PCT/US2018/048903 US2018048903W WO2019046610A1 WO 2019046610 A1 WO2019046610 A1 WO 2019046610A1 US 2018048903 W US2018048903 W US 2018048903W WO 2019046610 A1 WO2019046610 A1 WO 2019046610A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- rsv
- nicking
- nucleotide sequence
- composition
- template
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/11—Antisense
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2521/00—Reaction characterised by the enzymatic activity
- C12Q2521/50—Other enzymatic activities
- C12Q2521/507—Recombinase
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
Definitions
- This invention relates to methods and compositions for detecting the presence or absence of a target nucleic acid in a biological sample using isothermal nucleic acid amplification. More specifically, the present invention relates to detecting
- Respiratory Syncytial Virus target nucleic acid in a biological sample Respiratory Syncytial Virus target nucleic acid in a biological sample.
- Certain isothermal amplification methods are able to amplify a target nucleic acid from trace levels to very high and detectable levels within a matter of minutes.
- Such isothermal methods e.g., Nicking and Extension Amplification Reaction (NEAR), allow users to detect a particular nucleotide sequence in trace amounts, facilitating point-of-care testing and increasing the accessibility and speed of diagnostics.
- NEAR Nicking and Extension Amplification Reaction
- Respiratory Syncytial Virus is a single-stranded enveloped RNA Paramyxovirus that has at least ten proteins and three surface proteins.
- RSV is the causative agent of the most common pediatric respiratory infections (e.g., bronchiolitis and pneumonia). While a majority of RSV infections affect infants under the age of one, more than 170,000 children under the age of five are hospitalized each year in the United States due to RSV (see, e.g., Stockman et al. (2012) Pediatr. Infect. Dis. J. 31(1): 5-9; Hall et al. (2013) Pediatrics 132(2): e341-348; and Langley et al. (2011) Pediatr. Infect. Dis. J.
- RSV infections are also seen in the elderly and in high-risk adults (i.e., immunocompromised patients). With an incubation period of 3-5 days, RSV infections typically remain undetected for several days. Symptoms associated with RSV infection include those typically associated with cold symptoms (e.g., congestion, cough and fever). These exemplary factors render early detection and diagnosis very challenging.
- NEAR compositions and methods for determining (e.g., detecting) the presence or absence of RSV in a biological sample More particularly, provided herein are NEAR compositions and methods for determining (e.g., detecting) the presence or absence of a RSV target nucleic acid such as, for example, the nonstructural gene NS2 or the RSV nucleocapsid gene N, in a biological sample.
- the compositions provided herein are useful for the detection of RSV nucleic acid in a biological sample, and comprise at least one pair of templates (i.e., a forward and reverse template pair), and optionally a probe, specific for RSV.
- compositions including: i) a first forward template including a nucleic acid sequence including a recognition region at the 3' end that is complementary to the 3' end of a Respiratory Syncytial Virus (RSV) nonstructural NS2 gene antisense strand; a nicking enzyme binding site and a nicking site upstream of the recognition region; and a stabilizing region upstream of the nicking site; and ii) a first reverse template including a nucleic acid sequence including a recognition region at the 3' end that is complementary to the 3' end of a RSV nonstructural NS2 gene sense strand; a nicking enzyme binding site and a nicking site upstream of the recognition region; and a stabilizing region upstream of the nicking site; or iii) a second forward template including a nucleic acid sequence including a recognition region at the 3' end that is complementary to the 3' end of a RSV nucleocapsid gene N antisense strand;
- RSV
- complementary to the 3' end of the RSV nonstructural NS2 gene antisense strand is 8- 30 nucleotides in length, and/or wherein the recognition region at the 3' end that is complementary to the 3' end of the RSV nucleocapsid gene N antisense strand is 8-30 nucleotides in length.
- RSV nonstructural NS2 gene sense strand complementary to the 3' end of the RSV nonstructural NS2 gene sense strand is 8-30 nucleotides in length, and/or wherein the recognition region at the 3' end that is complementary to the 3' end of the RSV nucleocapsid gene N sense strand is 8-30 nucleotides in length.
- the composition including i) and ii) further includes a probe oligonucleotide including a nucleotide sequence complementary to the RSV nonstructural NS2 gene nucleotide sequence. In some embodiments, the composition including iii) and iv) further includes a probe oligonucleotide including a nucleotide sequence complementary to the RSV nucleocapsid gene N nucleotide sequence.
- the nucleic acid sequence of the first forward template includes a nucleotide sequence having at least 80%, at least 85% or at least 95% sequence identity to SEQ ID NO: 1
- nucleic acid sequence of the first reverse template includes a nucleotide sequence having at least 80%, at least 85% or at least 95% sequence identity to SEQ ID NO 2:
- the composition including i) and ii) further includes a probe oligonucleotide including a nucleotide sequence having at least 80%, at least 85% or at least 95% sequence identity to SEQ ID NO: 3 (ACCAGGAATGTAAATGTGGCCTGGT).
- the nucleic acid sequence of the second forward template includes a nucleotide sequence having at least 80%, at least 85% or at least 95% sequence identity to SEQ ID NO: 6
- nucleic acid sequence of the second reverse template includes a nucleotide sequence having at least 80%, at least 85% or at least 95% sequence identity to SEQ ID NO 7:
- composition including iii) and iv) further includes a probe oligonucleotide including a nucleotide sequence having at least 80%, at least 85% or at least 95% sequence identity to SEQ ID NO: 8
- any of the compositions described herein further including one or more of a DNA polymerase, one or more nicking enzymes, dNTPs or a mixture of dNTPs and ddNTPs.
- the DNA polymerase is selected from the group consisting of Geobacillus bogazici DNA polymerase, Bst (large fragment), exo-DNA Polymerase, Manta 1.0 DNA Polymerase (Enzymatics ®).
- the one or more nicking enzymes are selected from the group consisting of Nt. BspQI, Nb. BbvCi, Nb. Bsml, Nb. BsrDI, Nb. Btsl, Nt. Alwl, Nt. BbvCI, Nt. BstNBI, Nt. CviPII, Nb. Bpul OI, Nt. Bpul OI and N. BspD61.
- the composition is lyophilized.
- the probe is conjugated to a detectable label.
- the detectable label is selected from the group consisting of a fluorophore, an enzyme, a quencher, an enzyme inhibitor, a radioactive label, a member of a binding pair, and a combination thereof.
- one or more of the first forward template, the first reverse template, the second forward template or the second reverse template includes one or more modified nucleotides, spacers, or blocking groups.
- At least one modified nucleotide includes a 2 'modification. In some embodiments, at least one modified nucleotide includes a 2'-0-methyl.
- Also provided herein are methods for the detection of the presence or absence of RSV in a biological sample wherein the method includes: contacting the biological sample with a composition comprising i) a first forward template including a nucleotide sequence including a recognition region at the 3' end that is
- a first reverse template including a nucleotide sequence including a recognition region at the 3 ' end that is complementary to the 3' end of RSV nonstructural NS2 gene sense strand; a nicking enzyme binding site and a nicking site upstream of the recognition region; and a stabilizing region upstream of the nicking site; iii) at least one nicking enzyme; and iv) a DNA polymerase; amplifying the target nucleotide sequence in a nucleic amplification reaction to provide an amplification product; and detecting the presence or absence of the amplification product.
- the at least one nicking enzyme includes a first nicking enzyme that is capable of nicking at the nicking site of the first forward template, and does not nick within the RSV nonstructural NS2 gene antisense strand, and/or a second nicking enzyme that is capable of nicking at the nicking site of the first reverse template and does not nick within the RSV nonstructural NS2 gene sense strand, wherein the first nicking enzyme and the second nicking enzyme may be the same or different.
- the composition further includes a probe oligonucleotide including a nucleotide sequence complementary to the RSV nonstructural NS2 gene nucleotide sequence.
- Also provided herein are methods for the detection of the presence or absence of RSV in a biological sample wherein the method includes: contacting the biological sample with a composition including i) a second forward template including a nucleotide sequence including a recognition region at the 3' end that is
- a second reverse template including a nucleotide sequence including a recognition region at the 3' end that is complementary to the 3' end of a RSV nucleocapsid gene N sense strand; a nicking enzyme binding site and a nicking site upstream of the recognition region; and a stabilizing region upstream of the nicking site, iii) at least one nicking enzyme; and iv) a DNA polymerase; amplifying the target nucleotide sequence in a nucleic amplification reaction to provide an amplification product; and detecting the presence or absence of the amplification product.
- the at least one nicking enzyme includes a first nicking enzyme that is capable of nicking at the nicking site of the second forward template, and does not nick within the RSV nucleocapsid gene N antisense strand, and/or a second nicking enzyme that is capable of nicking at the nicking site of the second reverse template and does not nick within the nucleocapsid gene N sense strand, wherein the first nicking enzyme and the second nicking enzyme may be the same or different.
- the composition further includes a probe
- oligonucleotide including a nucleotide sequence complementary to the RSV nucleocapsid gene N nucleotide sequence.
- amplification is performed under essentially isothermal conditions.
- the nucleic acid sequence of the first forward template includes a nucleotide sequence having at least 80%, at least 85% or at least 95% sequence identity to SEQ ID NO: 1 ; and the nucleic acid sequence of the first reverse template includes a nucleotide sequence having at least 80%, at least 85% or at least 95% sequence identity to SEQ ID NO 2.
- the probe oligonucleotide includes a nucleotide sequence having at least 80%, at least 85% or at least 95% sequence identity to SEQ ID NO: 3.
- the nucleic acid sequence of the second forward template includes a nucleotide sequence having at least 80%, at least 85% or at least 95% sequence identity to SEQ ID NO: 6; and the nucleic acid sequence of the second reverse template includes a nucleotide sequence having at least 80%, at least 85% or at least 95% sequence identity to SEQ ID NO 7.
- the probe oligonucleotide includes a nucleotide sequence having at least 80%, at least 85% or at least 95% sequence identity to SEQ ID NO: 8.
- the composition further includes dNTPs or a mixture of dNTPs and ddNTPs.
- the DNA polymerase is selected from the group consisting of Geobacillus bogazici DNA polymerase, Bst (large fragment), exo-DNA Polymerase, Manta 1.0 DNA Polymerase (Enzymatics ®).
- the first forward and first reverse templates the second forward and second reverse templates comprise nicking enzyme binding sites recognized by the same at least one nicking enzyme.
- the at least one nicking enzyme is selected from the group consisting of Nt. BspQI, Nb. BbvCi, Nb. Bsml, Nb. BsrDI, Nb. Btsl, Nt. Alwl, Nt. BbvCI, Nt. BstNBI, Nt. CviPII, Nb. BpulOI, Nt. BpulOI and N.
- the probe is conjugated to a detectable label.
- the detectable label is selected from the group consisting of a fluorophore, an enzyme, a quencher, an enzyme inhibitor, a radioactive label, a member of a binding pair, and a combination thereof.
- the at least one nicking enzyme nicks downstream of the nicking enzyme binding site.
- the method optionally includes extracting/isolating a nucleic acid from the biological sample prior to amplifying.
- the biological sample is selected from feces, swabs of the oral cavity/throat, saliva, pus, sputum, blood, and urine, or wherein the biological sample is from infected or non-infected tissues.
- one or more of the first forward template, the first reverse template, the second forward template or the second reverse template includes one or more modified nucleotides, spacers, or blocking groups.
- kits that include a template oligonucleotide selected from the group consisting of: (a) a first forward template including a nucleotide sequence having at least 80%, at least 85% or at least 95% sequence identity to SEQ ID NO: l ; and
- a first reverse template including a nucleotide sequence having at least 80%, at least 85% or at least 95% sequence identity to SEQ ID NO 2; or (b) a second forward template including a nucleotide sequence having at least 80%, at least 85% or at least 95% sequence identity to SEQ ID NO: 6; and a second reverse including a nucleotide sequence having at least 80%, at least 85% or at least 95% sequence identity to SEQ ID NO 7.
- (a) further includes a probe oligonucleotide including a nucleotide sequence having at least 80%, at least 85% or at least 95% sequence identity to SEQ ID NO: 3.
- (b) further includes a probe oligonucleotide including a nucleotide sequence having at least 80%, at least 85% or at least 95% sequence identity to SEQ ID NO: 8.
- the kit further includes a swab.
- the kit further includes instructions to use the kit.
- the kit further includes one or more of dNTPs or a mixture of dNTPs and ddNTPs.
- the kit optionally includes reagent for extracting/isolating a nucleic acid from a biological sample.
- the template oligonucleotide includes one or more modified nucleotides, spacers, or blocking groups.
- At least one modified nucleotide includes a
- At least one modified nucleotide includes a 2'-0- methyl.
- the kit further includes a polymerase.
- the invention provides a highly sensitive and rapid qualitative assay for the detection and diagnosis of a RSV infection in a subject.
- template or “primer” refers to an oligonucleotide that is capable of acting as a point of initiation for the 5' to 3' synthesis of a primer extension product that is complementary to a nucleic acid strand.
- primer extension product is synthesized in the presence of appropriate nucleotides and an agent for
- polymerization such as a DNA polymerase, in an appropriate buffer and at a suitable temperature.
- probe refers to an oligonucleotide that forms a hybrid structure with the product generated by amplification of the target nucleic acid sequence in a sample undergoing analysis, due to complementarity of at least one sequence in the probe with the target sequence.
- the nucleotides of any particular probe may be deoxyribonucleotides, ribonucleotides, and/or synthetic nucleotide analogs.
- the target nucleic acid sequence is a nucleic acid sequence of RSV.
- the target nucleic acid sequence can be the nucleic acid sequence of the RSV nonstructural gene NS2 or the nucleic acid sequence of RSV the nucleocapsid gene N.
- first”, “second”, “third”, and “fourth”, etc. are used in this disclosure in their relative sense only. It will be understood that, unless otherwise noted, those terms are used merely as a matter of convenience in the description of one or more of the embodiments. The terms “first”, “second”, “third”, and “fourth”, etc. are only used to distinguish one element from another element, and the scope of the rights of the disclosed technology should not be limited by these terms. For example, a first element may be designated as a second element, and similarly the second element may be designated as the first element.
- the terms “increased”, “increase” or “up-regulated” are all used herein to generally mean an increase by a statistically significant amount; for the avoidance of any doubt, the terms “increased” or “increase” means an increase of at least 10% as compared to a reference level, for example an increase of at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90% or up to and including a 100% increase or any increase between 10-100% as compared to a reference level, or at least about a 0.5-fold, or at least about a 1.0-fold, or at least about a 1.2-fold, or at least about a 1.5-fold, or at least about a 2-fold, or at least about a 3-fold, or at least about a 4-fold, or at least about a 5-fold or at least about a 10-fold increase, or any increase between 1.0-fold and 10-fold or greater as compared to
- “decrease”, “decreased”, “reduced”, “reduction” or 'down- regulated” are all used herein generally to mean a decrease by a statistically significant amount.
- “reduced”, “reduction”, “decreased” or “decrease” means a decrease by at least 10% as compared to a reference level, for example a decrease by at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90% or up to and including a 100% decrease (i.e.
- any decrease between 10-100% as compared to a reference level or at least about a 0.5-fold, or at least about a 1.0-fold, or at least about a 1.2-fold, or at least about a 1.5-fold, or at least about a 2-fold, or at least about a 3-fold, or at least about a 4-fold, or at least about a 5-fold or at least about a 10-fold decrease, or any decrease between 1.0-fold and 10-fold or greater as compared to a reference level.
- FIG. 1 is a graph showing the results of a limit of detection (LOD) study using an exemplary assay to detect RSV nonstructural gene NS2 ("RSV A assay”) as described herein.
- LOD limit of detection
- FIG. 2 is a graph showing the results of a LOD study performed using an exemplary assay to detect RSV nucleocapsid gene N (“RSV B assay”) as described herein.
- FIG. 3A-D are graphs showing the results of an exemplary RSV A assay performed in the presence of 0 copies (no target copies "NTC") (FIG. 3 A), 50 copies (FIG. 3B), 250 copies (FIG. 3C), or 500 copies FIG. (3D) of the target nucleic acid and increasing amounts of background human genomic DNA (10 ng, 100 ng, and 1000 ng).
- FIG. 4A-D are graphs showing the results of an exemplary RSV B assay performed in the presence of 0 copies ( "NTC") (FIG. 4A), 50 copies (FIG. 4B), 250 copies (FIG. 4C) or 500 copies (FIG. 4D) of the target nucleic acid and increasing amounts of background human genomic DNA (10 ng, 100 ng, and 1000 ng).
- FIG. 5 is a graph showing the results of an exemplary RSV B assay performed with 0 copies of target nucleic acid in the presence of increasing amounts of background human gDNA (0, 10 ng, 100 ng, 1000 ng).
- FIG. 6 and FIG. 7 are graphs showing the results of an exemplary RSV A assay to determine the assay's reactivity with purified RNA (FIG. 6) and purified virus (FIG. 7).
- X-axis - cycles (1 cycle 10 seconds); Y-axis - mV.
- FIG. 8 is a graph showing an exemplary RSV A performed to determine a limit of detection (LOD) with purified virus.
- LOD limit of detection
- FIG. 9 and FIG. 10 are graphs showing an exemplary RSV B assay showing the assay's reactivity with purified RNA (FIG. 9) and purified virus (FIG. 10).
- X-axis - cycles (1 cycle 10 seconds); Y-axis - mV.
- FIG. 11 and FIG. 12 are graphs showing the results of an exemplary RSV B + IC assay performed to determine the assay's reactivity with purified RNA (FIG. 11) and purified virus (FIG. 12).
- FIG. 13 and FIG. 14 are graphs showing the results of an exemplary assay performed to determine a limit of detection (LOD) with purified virus of RSV B performance (FIG. 13) and RSV B + IC performance (FIG. 14).
- LOD limit of detection
- FIG. 15-17 are graphs showing the results of a "no target copies" (NTC) replicate study of RSV A assay (FIG. 15), RSV B assay (FIG. 16), and RSV B + IC assay (FIG. 17) to determine whether the assays would generate false positive results when no target was present in the reaction.
- NTC no target copies
- FIG. 18 and FIG. 19 are graphs showing the results of an exemplary inclusivity study of RSV A assay (FIG. 18) and RSV B assay (FIG. 19) to determine whether the assays provide a similar level of performance across multiple strains (A2 was used as the development strain, shown are the results with A long).
- the strain A Long was screened at either 5 copies (determined to be the LOD for development strain A2) or 10 copies of purified RNA per reaction, in triplicate. (Rox - target detection; Fam - internal control detection).
- FIG. 20A-B are graphs showing the results of an exemplary cross-reactivity study to determine whether the RSV A assay (FIG. 20A) and RSV B (FIG. 20B) would provide specificity against non-RSV species.
- FIG. 21A-B are graphs showing the results of an exemplary cross-reactivity study to determine whether the assay would provide specificity against opposite RSV subtypes.
- the RSV A assay was screened against RSV B target (FIG. 21A), and the RSV B assay was screened against RSV A target (FIG. 21B).
- FIG. 22 and FIG. 23 are graphs showing BLAST analyses performed using the RSV A product 1 sequence against RSV B sequences (FIG. 22), and RSV B product 1 sequence against RSV A sequences (FIG. 23).
- top hits are shown aligned to the RSV A template, molecular beacon and product sequences, along with representative RSV A strain sequences and representative “top hits” are shown aligned to the RSV B template, molecular beacon and product sequences, along with representative RSV B strain sequences, respectively.
- BLAST analyses were carried out at blast.ncbi.nlm.nih.gov/Blast.cgi, using the Basic BLAST 'nucleotide blast' program (BLASTN 2.2.30+), the Nucleotide collection (nr/nt) database, specifically targeting RSV type B (taxid: 208895), and RSV type A (taxid: 208893 & 1439707), respectively, with standard BLAST parameters adjusted to searching short input sequences.
- FIG. 24 and FIG. 25 are graphs showing the results of an exemplary experiment performed to assess the performance of RSV A lyophilized reagents (FIG. 24) and RSV B lyophilized reagents (FIG. 25) in the presence of clinical matrix. Both assays were screened with anonymous donor swab pool C.
- FIG. 26-28 are graphs showing the summary results of a RSV A NEAR assay (FIG. 26), a RSV B NEAR assay (FIG. 27), and a RSV B+ IC NEAR assay (FIG. 28) of 50 clinical swab samples.
- FIG. 29 shows exemplary results depicting the real time fluorescence curves for the subset of clinical swab samples that were called positive using the RSV A & B NEAR assays.
- FIG. 30-32 shows exemplary results depicting the real time fluorescence curves for the 50 clinical UTM samples that were screened using the RSV A NEAR assay (FIG. 30), RSV B NEAR assay (FIG. 31), and RSV B + IC NEAR assay (FIG. 32).
- FIG. 33 shows exemplary results depicting the real time fluorescence curves for the subset of clinical UTM samples that were called positive using the RSV A & B NEAR assays.
- NEAR Nicking Enzyme Amplification Reaction
- DNA or RNA targets short products
- geometric amplification mechanism provide an ultra-rapid amplification method.
- the ability to provide robust performance in the presence of clinical matrix sets NEAR apart from most other molecular tests as there is no need for a lengthy or cumbersome sample preparation/nucleic acid purification.
- These key attributes make NEAR an ideal technology for POC integration, where a rapid and reliable result is essential.
- a NEAR test has been developed to detect the presence or absence of RSV in a sample.
- the test consists of two assays, to detect nonstructural gene NS2 and/or nucleocapsid gene N, using clinical patient samples, e.g., nasal swab samples.
- the present application discloses a composition for detecting the presence or absence of RSV in a biological sample by amplifying and detecting a target nucleotide sequence using NEAR.
- the target nucleotide sequence can be detected using real-time or end-point detection approaches, for example utilizing fluorescence labeled probes.
- target sequence may refer to either the sense or antisense strand of the sequence, and also refers to the sequences as they exist on target nucleic acids, amplified copies, or amplification products, of the original target sequence.
- the amplification product may be a larger molecule that comprises the target sequence, as well as at least one other sequence, or other nucleotides.
- Methods of this invention can be used to identify nucleic acid from specimens for diagnosis of RSV infection.
- the specific primers and probes of the invention that are used in these methods allow for the amplification of and monitoring the development of specific amplification products.
- the increased sensitivity of NEAR for detection of RSV e.g., nonstructural gene NS2, nucleocapsid gene N
- Certain isothermal amplification methods are able to amplify target nucleic acid from trace levels to very high and detectable levels within a matter of minutes.
- Such isothermal methods e.g., NEAR and RPA can allow users to detect a particular sequence in trace amounts, facilitating point-of-care testing and increasing the accessibility and speed of diagnostics.
- the time that the amplification reaction is run may vary from, for example, within about I minute, or within about 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 1 .5, 16, 17, 18. 19 or 20 minutes. Longer reaction times may produce acceptable results where speed is not an issue.
- the reaction is between 1-20 minutes, 1 - 15 minutes or 1-10, 1-8, 1-5, 1 -2.5, 2.5-5, 2.5-8, 2.5-10, or 2.5-20 minutes.
- the amplification processes described herein are efficient, and in some embodiments, there is about 1 x 10 6 -fold or more amplification, about 1 x 10 7 -fold or more
- amplification about 1 x 10 8 -fold or more amplification, about 1 x 10 9 fold or more amplification, or about 1 x 10 10 -fold or more amplification in the time frame of the reaction, for example, in 5, 10 or twelve minutes.
- the reaction is highly sensitive, and is able to detect, for example, as low as about 1. 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 copies, or more, in a sample, as many as 200, 500, 1,000.
- a target that is present at a concentration of, for example, about 3.32E-13 micromolar to about 3.32E--8 micromolar, about 1.66E-12 micromolar to about 3.32E-8 micromolar, about 3.32E-13 micromolar to about 3.32E-7 micromolar, or about 3.32E-13 micromolar to about 3.32E-6 micromolar.
- NEAR methods are disclosed, e.g., in U.S. 9,617,586 and U.S. 9,689,031 each of which are incorporated herein by reference.
- Nucleic acids suitable for amplification in connection with the present methods include double-stranded and single-stranded nucleic acid molecules, such as DNA and RNA molecules.
- the polynucleotides may be of genomic, chromosomal, plasmid, mitochondrial, cellular, and viral nucleic acid origin.
- the amplification may be of either one or both strands.
- RPA can allow users to detect a particular sequence in trace amounts, facilitating point-of-care testing and increasing the accessibility and speed of diagnostics.
- RPA employs enzymes, known as recombinases, that are capable of pairing oligonucleotide primers with homologous sequences in template double-stranded nucleic acid. In this way, DNA synthesis is directed to defined points in a template double-stranded nucleic acid.
- sequence-specific primers an exponential amplification reaction is initiated if the template nucleic acid is present.
- the reaction progresses rapidly and results in specific amplification of a sequence present within the template double- stranded nucleic acid from just a few copies of the template nucleic acid to detectable levels of the amplified products within minutes.
- RPA methods are disclosed, e.g., in US 7,270,981 ; US 7,399,590; US 7,666,598; US 7,435,561 ; US 8,071,308; and WO 2010/141940, all of which are incorporated herein by reference.
- templates and “primers” are used interchangeably and refer generally to an oligonucleotide sequence that serves as a starting point for nucleotide amplification of a target sequence using a polymerase. Templates are defined as oligonucleotides that bind to a recognition region of a target sequence and also contain a nicking enzyme binding region upstream of the recognition region and a stabilizing region upstream to the nicking enzyme binding region.
- the compositions disclosed herein can contain a set of templates that amplify the target nucleic acid sequence.
- the templates can comprise sequences that are complementary to the target nucleic acid sequence or that differ from the target nucleic acid sequence at one or more positions. Design of templates suitable for NEAR amplification methods disclosed herein are provided in, for example, U.S. 9,617,586 and U.S. 9,689,031, each of which are incorporated herein by reference.
- the templates of the present methods may include, for example, spacers, blocking groups, and modified nucleotides.
- Modified nucleotides are nucleotides or nucleotide triphosphates that differ in composition and/or structure from natural nucleotides and nucleotide triphosphates. Modifications include those naturally occurring or that result from modification by enzymes that modify nucleotides, such as methyltransferases. Modified nucleotides also include synthetic or non-naturally occurring nucleotides. For example, modified nucleotides include those with 2' modifications, such as 2'-0-methyl and 2'-fluoro. Other 2' -modified nucleotides are known in the art and are described in, for example U.S.
- Modified nucleotides or nucleotide triphosphates used herein may, for example, be modified in such a way that, when the modifications are present on one strand of a double-stranded nucleic acid where there is a restriction endonuclease recognition site, the modified nucleotide or nucleotide triphosphates protect the modified strand against cleavage by restriction enzymes.
- Blocking groups are chemical moieties that can be added to the template to inhibit target sequence-independent nucleic acid polymerization by the polymerase.
- Blocking groups are usually located at the 3' end of the template.
- blocking groups include, for example, alkyl groups, non-nucleotide linkers, phosphorothioate, alkane-diol residues, peptide nucleic acid, and nucleotide derivatives lacking a 3'-OH, including, for example, cordycepin.
- spacers include, for example, C3 spacers. Spacers may be used, for example, within the template, and also, for example, at the 5' end to attach other groups, such as, for example, labels.
- a method for detection of RSV in a sample comprising the steps of obtaining a sample from a subject; extracting nucleic acids from the sample; and amplifying the nucleic acid; wherein the nucleic acid is amplified and detected with templates and probes as described herein.
- the present invention further comprises detecting the amplification product, for example, by a method selected from the group consisting of gel electrophoresis, mass spectrometry, SYBR I fluorescence, SYBR II fluorescence, SYBR Gold, Pico Green, TOTO-3, intercalating dye detection, FRET, molecular beacon detection, surface capture, capillary electrophoresis, incorporation of labeled nucleotides to allow detection by capture, fluorescence polarization, and lateral flow capture.
- a method selected from the group consisting of gel electrophoresis, mass spectrometry, SYBR I fluorescence, SYBR II fluorescence, SYBR Gold, Pico Green, TOTO-3, intercalating dye detection, FRET, molecular beacon detection, surface capture, capillary electrophoresis, incorporation of labeled nucleotides to allow detection by capture, fluorescence polarization, and lateral flow capture.
- Amplification products can be detected, for example, by chemical moieties that intercalate into double-stranded DNA.
- SYBR Green® binds double- stranded DNA and upon excitation emit light; thus as product accumulates, fluorescence increases.
- the amplification products may be, for example, detected using a solid surface method, for example, where at least one capture probe is immobilized on the solid surface that binds to the amplified sequence. In some embodiments of all aspects, detecting the amplified product is performed using "realtime fluorescence.”
- real-time fluorescence refers to the detection of nucleic acid amplification products via a fluorescent signal generated by the coupling of a fluorogenic dye molecule and a quencher moiety to the same or different
- TAQMAN® probes examples include TAQMAN® probes, Molecular Beacon probes, and SCORPION® probes. Briefly, TAQMAN® probes, Molecular Beacons, and SCORPION® probes each have a fluorescent reporter dye (also called a "fluor”) and a quencher moiety attached in close proximity to one another.
- fluorescent reporter dye also called a "fluor”
- the proximity of the fluor and the quencher molecules prevents the detection of fluorescent signal from the probe; in the case of TAQMAN® probes, during amplification, when the polymerase replicates a template on which a probe is bound, the 5 '-nuclease activity of the polymerase cleaves the probe thus, increasing fluorescence with each replication cycle as the fluor and quencher are separated from one another.
- Molecular beacons probes emit fluorescence following annealing of a homologous product, as this event induces a conformational change in the structure of the beacon, thereby separating the fluor and quencher.
- TAQMAN® probes and SCORPION® probes similar to Molecular beacons, will release fluorescence signal when a specific product anneals to the probe and is extended, which leads to separation of the fluor and quencher.
- lateral flow devices are well known. These devices generally include a solid phase fluid permeable flow path through which fluid flows through by capillary force. Examples include, but are not limited to, dipstick assays and thin layer chromatographic plates with various appropriate coatings. Immobilized on the flow path are various binding reagents for the sample, binding partners or conjugates involving binding partners for the sample and signal producing systems. Detection of samples can be achieved in several manners; enzymatic detection, nanoparticle detection, colorimetric detection, and fluorescence detection, for example.
- Enzymatic detection may involve enzyme- labeled probes that are hybridized to complementary or substantially complementary nucleic acid targets on the surface of the lateral flow device.
- the resulting complex can be treated with appropriate markers to develop a readable signal.
- Nanoparticle detection involves bead technology that may use colloidal gold, latex and
- beads may be conjugated to an anti- biotin antibody.
- Target sequences may be directly biotinylated, or target sequences may be hybridized to sequence specific biotinylated probes.
- Gold and latex give rise to colorimetric signals visible to the naked eye and paramagnetic particles give rise to a non- visual signal when excited in a magnetic field and can be interpreted by a specialized reader.
- Nucleic acids can also be captured on lateral flow devices.
- Means of capture may include antibody dependent and antibody independent methods.
- Antibody- dependent capture generally comprises an antibody capture line and a labeled probe that is complementary or substantially complementary sequence to the target.
- Antibody-independent capture generally uses non-covalent interactions between two binding partners, for example, the high affinity and irreversible linkage between a biotinylated probe and a Streptavidin line. Capture probes may be immobilized directly on lateral flow membranes. Both antibody dependent and antibody independent methods may be used in multiplexing.
- target nucleic acids and nucleic acid sequences may also be detected and monitored by multiplex DNA sequencing.
- Multiplex DNA sequencing is a means of identifying target DNA sequences from a pool of DNA. The technique allows for the simultaneous processing of many sequencing templates. Pooled multiple templates can be resolved into individual sequences at the completion of process.
- complementary and substantially complementary refer to base pairing between nucleotides or nucleic acids, such as, for instance, between the two strands of a double-stranded DNA molecule or between an oligonucleotide primer and a primer binding site on a single-stranded nucleic acid to be sequenced or amplified.
- Complementary nucleotides are, generally, A and T (or A and U), and G and C.
- sequence lengths listed are illustrative and not limiting and that sequences covering the same map positions, but having slightly fewer or greater numbers of bases are deemed to be equivalents of the sequences and fall within the scope of the invention, provided they will hybridize to the same positions on the target as the listed sequences.
- the probe and primer sequences disclosed herein may be modified to some extent without loss of utility as specific primers and probes. Generally, sequences having homology of 80%, 90%, 95%, 97%, 98%, 99% fall within the scope of the present invention.
- hybridization of complementary and partially complementary nucleic acid sequences may be obtained by adjustment of the hybridization conditions to increase or decrease stringency, i.e., by adjustment of hybridization temperature or salt content of the buffer.
- the template and probes can be labeled with (e.g., conjugated to) a detectable label.
- detectable label and “label” as used herein refers to any chemical moiety that can be used to provide a detectable (preferably quantifiable) signal, and that can be attached to a nucleic acid or protein via a covalent bond or noncovalent interaction (e.g., through ionic or hydrogen bonding, or via immobilization, adsorption, or the like).
- Labels generally provide signals detectable by fluorescence, chemiluminescence, radioactivity, colorimetry, mass spectrometry, X-ray diffraction or absorption, magnetism, enzymatic activity, or the like.
- labels include haptens, enzymes, enzyme substrates, coenzymes, enzyme inhibitors, fluorophores, quenchers, chromophores, magnetic particles or beads, redox sensitive moieties (e.g., electrochemically active moieties), luminescent markers, radioisotopes (including radionucleotides), and members of binding pairs. More specific examples include fluorescein, phycobiliprotein, tetraethyl rhodamine, and beta-galactosidase. Binding pairs may include
- biotin/Streptavidin biotin/avidin, biotin/neutravidin, biotin/captavidin,
- epitope/antibody protein A/immunoglobulin, protein G/immunoglobulin, protein L/immunoglobulin, GST/glutathione, His-tag/Metal ion (e.g., nickel, cobalt or copper), antigen/antibody, FLAG/MI antibody, maltose binding protein/maltose, calmodulin binding protein/calmodulin, enzyme-enzyme substrate, receptor-ligand binding pairs, and analogs and mutants of the binding pairs.
- His-tag/Metal ion e.g., nickel, cobalt or copper
- fluorescence label and “fluorophore” are used interchangeably and refer to any substance that emits electromagnetic energy at a certain wavelength (emission wavelength) when the substance is illuminated by radiation of a different wavelength (excitation wavelength) and is intended to encompass a chemical or biochemical molecule or fragments thereof that is capable of interacting or reacting specifically with an analyte of interest in a sample to provide one or more optical signals.
- fluorophores for use in the methods provided herein include, for example, FAM, (tetramethylrhodamine) Texas RedTM, green fluorescent protein, blue fluorescent protein, red fluorescent protein, fluorescein, fluorescein 5- isothiocyanate (FITC), cyanine dyes (Cy3, Cy3.5, Cy5, Cy5.5, Cy7), Bodipy dyes (Invitrogen) and/or Alexa Fluor dyes (Invitrogen), dansyl, dansyl Chloride (DNS- Cl), 5-(iodoacetamida)fluorescein (5-IAF, 6- acryloyl-2-dimethylaminonaphthalene (acrylodan), 7-nitrobenzo-2-oxa-l,3,-diazol-4-yl chloride (NBD-C1), ethidium bromide, Lucifer Yellow, rhodamine dyes (5-carboxyrhodamine 6G hydrochloride, Lissamine rhodamine B
- Phthalocyanine Oxaxine 1, 4', 6-diamidino-2-phenylindole.
- DAP I Hoechst 33342, TOTO, Acridine Orange, Ethidium Homodimer, N(ethoxycarbonylmethyl)-6- methoxyquinolinium (MQAE), Fura-2, Calcium Green, Carboxy SNARF-6, BAPTA, coumarin, phytofiuors, Coronene, and metal-ligand complexes.
- a fluorescence quencher is also considered a detectable label.
- the fluorescence quencher may be contacted to a fluorescent dye and the amount of quenching may be detected.
- Haptens for use in the methods provided herein include, for example, digoxigenin, glutathione and biotin.
- Enzymes for use in the methods provided herein include, for example, alkaline phosphatase (AP), beta-galactosidase, horse radish peroxidase (HRP), soy bean peroxidase (SBP), urease, beta-lactamase and glucose oxidase.
- AP alkaline phosphatase
- beta-galactosidase beta-galactosidase
- HRP horse radish peroxidase
- SBP soy bean peroxidase
- urease beta-lactamase and glucose oxidase.
- compositions for detecting the presence or absence of RSV in a biological sample described herein can include a DNA polymerase.
- the DNA polymerase disclosed herein may be a eukaryotic or prokaryotic polymerase.
- the polymerase may be selected from, for example, Geobacillus bogazici DNA polymerase, Bst DNA polymerase, Bst DNA polymerase (Large fragment), 9°Nm DNA polymerase, Phi29 DNA polymerase, DNA polymerase I (E.
- DNA polymerase I Large, (Klenow) fragment, Klenow fragment (3 '-5' exo-), T4 DNA polymerase, T7 DNA polymerase, Deep VentRTM (exo-) DNA Polymerase, Deep VentRTM DNA Polymerase, DyNAzymeTM EXT DNA, DyNAzymeTM II Hot Start DNA Polymerase, PhusionTM High-Fidelity DNA Polymerase, TherminatorTM DNA Polymerase, TherminatorTM II DNA Polymerase, VentR ® DNA Polymerase, VentR ® (exo-) DNA Polymerase, RepliPHITM Phi29 DNA Polymerase, rBst DNA Polymerase, rBst DNA Polymerase, Large Fragment (IsoThermTM DNA Polymerase), MasterAmpTM AmpliThermTM DNA Polymerase, Taq DNA polymerase, Tth DNA polymerase, Tfl DNA polymerase, Tgo DNA polymerase, SP6 DNA polymerase, Tbr DNA polymerase, T
- compositions for detecting the presence or absence of RSV in a biological sample described herein can include an antimicrobial agent or preservative.
- An antimicrobial agent can inhibit the growth of microorganisms and increase the shelf life of a reagent mixture or buffer solution.
- the antimicrobial agent can include benzalkonium chloride, 5-chloro-2-methyl-4- isothiazolin-3-one, 2-methyl-4-isothiazolin-3-one, ProClin® (e.g., ProClin 300®, ProClin® 950, etc.), azides, merthiolates, and/or antibiotics.
- the antimicrobial agent includes 5-chloro-2-methyl-4-isothiazolin-3-one and 2- methyl-4-isothiazolin-3-one.
- constant temperature By “constant temperature,” “isothermal conditions,” “essentially isothermal,” or “isothermally” is meant a set of reaction conditions where the temperature of the reaction is kept essentially or substantially constant during the course of the amplification reaction.
- An advantage of the amplification method of the present methods is that the temperature does not need to be cycled between an upper temperature and a lower temperature. The nicking and the extension reaction will work at the same temperature or within the same narrow temperature range.
- the temperature it is not necessary that the temperature be maintained at precisely one temperature. If the equipment used to maintain an elevated temperature allows the temperature of the reaction mixture to vary by a few degrees, or few tenths of a degree, such as, for example, less than 1 degree, 0.8 degrees, 0.6 degrees, 0.4 degrees, or 0.2 degrees, this is not detrimental to the amplification reaction, and may still be considered to be an isothermal reaction.
- the present invention may be used for multiplex amplification.
- at least two target sequences are capable of being amplified.
- multiplex amplification refers to the amplification of more than one nucleic acid of interest.
- the amplification reaction comprises the appropriate templates and enzymes to amplify at least two target sequences.
- the amplification reaction may be prepared to detect at least two target sequences, but only one of the target sequences may actually be present in the sample being tested, such that both sequences are capable of being amplified, even though only one sequence may actually be amplified.
- the amplification reaction may result in the amplification of both of the target sequences.
- the multiplex amplification reaction may result in the amplification of one, some, or all, of the target sequences for which it comprises the appropriate templates and enzymes.
- biological sample refers to a sample obtained or derived from a subject (i.e., a patient).
- the biological sample may be a tissue fluid obtained from a subject, which may be selected from the group consisting of blood, plasma, serum, lymphatic fluid, synovial fluid, cerebrospinal fluid, amniotic fluid, amniotic cord blood, tears, saliva, mucus secretions, urine and nasopharyngeal washes.
- Representative biological samples from the respiratory tract include wound and throat swabs, throat washings, nasal swabs, and specimens from the lower respiratory tract.
- obtain or “obtaining” can be any means whereby one comes into possession of the sample by “direct” or “indirect” means.
- Directly obtaining a sample means performing a process (e.g., performing a physical method such as extraction) to obtain the sample.
- Indirectly obtaining a sample refers to receiving the sample from another party or source (e.g., a third party laboratory that directly acquired the sample).
- Directly obtaining a sample includes performing a process that includes a physical change in a physical substance, e.g., a starting material, such as a blood, e.g., blood that was previously isolated from a patient.
- obtain is used to mean collection and/or removal of the sample from the subject.
- "obtain” is also used to mean where one receives the sample from another who was in possession of the sample previously.
- Target sequences present within target nucleic acids in a sample can be amplified with the methods of the invention without first purifying the target nucleic acids after the sample is obtained.
- purify can mean, for example, substantially separating target nucleic acids from inhibitors and background materials present in a sample.
- obtained samples may be diluted, for example with a buffer suitable to lyse cells in the sample, without concentrating the target nucleic acid or substantially removing any inhibitors and background materials present in the sample.
- subject refers to an animal or human, or to one or more cells derived from an animal or human.
- the subject is a human.
- Subjects can also include non-human primates.
- Cells may be in any form, including but not limited to cells retained in tissue, cell clusters, immortalized, transfected or transformed cells, and cells derived from an animal that has been physically or phenotypically altered.
- a human subject can be known as a patient.
- a kit for following the methods of the present invention for nucleic acid amplification, comprising a DNA polymerase; a first template for nucleic acid amplification, comprising a recognition region at the 3' end that is complementary or substantially complementary to the 3' end of a target sequence antisense strand; a nicking enzyme binding site and a nicking site upstream of the recognition region; and a stabilizing region upstream of the nicking enzyme binding site and the nicking site; a second template for nucleic acid amplification, comprising a recognition region at the 3' end that is complementary or substantially complementary to the 3' end of a target sequence sense strand; nicking enzyme binding site and a nicking site upstream of the recognition region; and a stabilizing region upstream of the nicking enzyme binding site and the nicking site; one or more nicking enzymes, wherein either one enzyme is capable of nicking at the nicking site of the first and said second templates, or a first enzyme is
- kits used for the present methods may also comprise one or more of the components in any number of separate containers, packets, tubes, vials, microtiter plates and the like, or the components may be combined in various combinations in such containers.
- the components of the kit may, for example, be present in one or more containers, for example, all of the components may be in one container, or, for example, the enzymes may be in a separate container from the templates.
- the components may, for example, be lyophilized, freeze dried, or in a stable buffer.
- the polymerase and nicking enzymes are in lyophilized form in a single container, and the templates are either lyophilized, freeze dried, or in buffer, in a different container.
- the polymerase, nicking enzymes, and the templates are, in lyophilized form, in a single container.
- the polymerase and the nicking enzyme may be separated into different containers.
- Kits may further comprise, for example, dNTPs used in the reaction, or modified nucleotides, cuvettes or other containers used for the reaction, or a vial of water or buffer for re-hydrating lyophilized components.
- the buffer used may, for example, be appropriate for both polymerase and nicking enzyme activity.
- kits used for the present methods may also comprise instructions for performing one or more methods described herein and/or a description of one or more compositions or reagents described herein. Instructions and/or descriptions may be in printed form and may be included in a kit insert. A kit also may include a written description of an Internet location that provides such instructions or descriptions.
- Kits may further comprise reagents used for detection methods, such as, for example, reagents used for FRET, lateral flow devices, dipsticks, fluorescent dye, colloidal gold particles, latex particles, a molecular beacon, or polystyrene beads.
- reagents used for detection methods such as, for example, reagents used for FRET, lateral flow devices, dipsticks, fluorescent dye, colloidal gold particles, latex particles, a molecular beacon, or polystyrene beads.
- thermocyclers incubation ovens, water baths, and heat blocks.
- Methods using capture probes for detection include, for example, the use of a nucleic acid molecule (the capture probe) comprising a sequence that is
- the probe may be linked to a detectable label in certain embodiments, and amplification product may be detected based on the detectable label of the probe specifically hybridized to the amplification product.
- the reaction may, for example, further comprise an antibody directed against a molecule incorporated into or attached to the capture probe.
- the capture probe or a molecule that binds to the capture probe, may incorporate, for example, an enzyme label, for example, peroxidase, alkaline phosphatase, or beta-galactosidase, a fluorescent label, such as, for example, fluorescein or rhodamine, or, for example, other molecules having chemiluminescent or bioluminescent activity.
- an enzyme label for example, peroxidase, alkaline phosphatase, or beta-galactosidase
- a fluorescent label such as, for example, fluorescein or rhodamine
- the probe is linked to a solid support, and amplification product strands may be specifically immobilized to the capture probe linked to the solid support under conditions known and selected by the person of ordinary skill in the art.
- a solid support- immobilized amplification product may be subjected to processing steps, such as washing, ion exchange, release from the solid support, or other processing steps.
- An amplification product may be detected when immobilized to a solid support in some embodiments.
- the embodiments of the present invention also comprise combinations of these detection and analysis methods.
- the methods further comprise modifying the subject's clinical record to identify the subj ect as being diagnosed as having a RSV infection.
- the clinical record is stored in a computer readable medium.
- NEAR assays targeting nonstructural gene NS2 and gene N were developed that are unique to RSV while showing strong conservation across multiple RSV strains.
- templates were generated in part by using an in-house automated software tool. In silico filtering was then applied to finalize the selection of template sets to screen in the laboratory. In general, these filtering criteria involved analyzing the template sets for potential interactions that could reduce assay performance, including several parameters identified in-house that might specifically impact NEAR performance as well as parameters that are common to most nucleic acid
- the screening process resulted in the development of the following assay for detecting RSV.
- the assay amplifies at least one RSV target nucleic acid, the nonstructural gene NS2 located at nucleotide position 780-817 of reference strain NC_001803.1; and/or the nucleocapsid gene N located at position 1220-1261 of reference strain N2 KF893260.1.
- the NS2 gene encodes for the nonstructural 2 protein (NS2), which is responsible for inhibiting host type I interferon activity (to help evade the immune system).
- the N gene encodes for the nucleocapsid protein, which aids in viral replication and transcription.
- the "RSV A” assay targets nucleotide position 780-817 of the RSV reference strain NC_001803.1 (within the NS2 gene) and the “RSV B” assay targets nucleotide position 1220-1261 of the RSV reference strain N2 KF893260.1.
- the assay templates, probe (molecular beacon) and product sequences are provided in Tables 1 and 2 below.
- the RSV NEAR assays were developed to run on the AlereTM i platform.
- the AlereTM i platform consists of the AlereTM i instrument which provides heating, mixing and fluorescence detection with automated result output, and a set of disposables, consisting of the sample receiver (where the elution/lysis buffer is stored), a test base (containing two tubes of lyophilized NEAR reagents) and a transfer cassette (designed to transfer 100 ⁇ l aliquots of eluted sample from the sample receiver to each of the two tubes containing lyophilized NEAR reagents located in the test base).
- the RSV assay is a two tube assay - a RSV A target specific assay in one tube, and a RSV B/internal control (IC) duplex assay in a second tube (tested side by side on the AlereTM i instrument in the test base).
- IC internal control
- the elution/lysis buffer (stored in the sample receiver) was designed to allow for the rapid release of RSV organisms from clinical sample nasal/nasopharyngeal swabs as well as to provide rapid and efficient lysis (strong acid), while also including the necessary salts for driving the NEAR assay (both MgS04 and (NH4)2S04).
- FIG. 1 and FIG. 2 show the results of a LOD study performed using the RSV A and RSV B assays using purified viral RNA, respectively.
- Purified RNA stock was diluted to appropriate concentrations so that 5 ⁇ l volumes added to 100 ⁇ l of rehydration buffer provided the appropriate copy number of target.
- Reactions were performed on the Stratagene Mx3005P thermal cycler using a standard 'hot start' approach.
- the LOD study was performed using a standard NEAR 'hot start' approach where the sample and lyophilized mix were both pre-heated at 56°C for 3 minutes and then combined. From FIG. 1, it was concluded that the LOD is 5 copies of purified viral RNA of RSV A, when a standard 'hot start' approach is used. From FIG. 2, it was concluded that the LOD is 50 copies of purified viral RNA of RSV B, when a standard 'hot start' approach is used.
- an internal control is a required component of a POC diagnostic device.
- the internal control provides verification that the assay reagents are functioning properly and have not been inactivated or inhibited during a test. This is particularly important when a clinical sample has been called 'negative'. To ensure that the 'negative' call is not due to assay failure, but rather due to the fact that the target organism is not present, an IC is essential.
- the RSV test is a two tube test, with RSV A detection occurring in one tube and RSV B detection in a second tube. Instead of incorporating controls into each tube, a single IC was incorporated into the tube containing the RSV B assay.
- the IC system consists of a set of templates, which are shared by the RSV B assay, a unique short RNA oligonucleotide target and an IC product-specific molecular beacon (Table 2).
- Table 2 The RNA
- oligonucleotide contains 5' and 3' ends that are complementary to the target template set's recognition regions but with a spacer region that differs from the target's spacer region. Simply put, the same template set is used to amplify both target and IC.
- the reagents used for RSV detection need to be stable for an extended period (e.g., six months to thirty-six months) of time at ambient temperature (up to 30°C), or at minimum, when stored at 2-8°C.
- the NEAR assay reagents need to be lyophilized and subsequently packaged to minimize reagent exposure to both moisture and oxygen.
- NEAR assay reagents were combined in a mix containing the excipients dextrose and trehalose and subjected to freeze drying.
- the final lyophilization mix composition and freeze drying method selected to move forward with are shown below, in Tables 3 and 4, respectively.
- the RSV test format provides for two tubes, one tube providing the RSV A target assay and a second tube providing both the RSV B and IC assays. These reagents are freeze dried using the same lyophilization method and contain essentially the same set of reagents (excluding the fact that each tube contains a unique set of oligonucleotides for target and/or IC specific amplification and detection).
- Both mixes are lyophilized at 3X (33.3 ⁇ l), meaning that the mixes are dried down at a 3X concentration and subsequently re-suspended in a 100 ⁇ l volume to provide a final IX concentration of each reagent.
- This approach effectively reduces the concentration of the two excipients added to each mix (dextran and trehalose) by three-fold, vs. if a IX mix was used for freeze drying.
- the final step in the process of maximizing the stability of lyophilized NEAR material is packaging. Once the lyophilization process is completed, the dried reagents are exposed to an atmosphere of less than 10% relative humidity, whereupon they are pouched in a moisture- resistant and oxygen-resistant foil pouch containing a desiccant. The reagents can then be stored for an extended period of time without an obvious loss in performance.
- the elution/lysis buffer is pre-heated for 3 minutes on the AlereTM i instrument, reaching a temperature of approximately 42°C - 45°C. At this time, either a 200 ⁇ l aliquot of UTM is added to the elution/lysis buffer and mixed, or a swab is briefly swirled (10 seconds) and expressed in the elution/lysis buffer. As will be described in later sections of this document, the elution/lysis buffer has been shown to effectively elute/lyse RSV from swabs and lyse RSV transferred from UTM, enabling sensitive NEAR amplification and detection following re-suspension of NEAR lyophilized material.
- Example 2 Impact of human genomic DNA on RSV A/B NEAR Assay
- human gDNA One potential inhibitor of the NEAR technology is human gDNA.
- human gDNA When a nasal swab sample is collected from a patient symptomatic for RSV infection, it is possible that human gDNA is also collected on the swab (from immune cells such as white blood cells or from local epithelial cells).
- immune cells such as white blood cells or from local epithelial cells.
- the RSV B + IC assay was performed in the presence of 0 copies of target (NTC reactions) and increasing amounts of human gDNA.
- the IC assay showed very good performance when stressed by the presence of 100 ng of human gDNA.
- the assay was able to detect 0.005 pfu of purified virus, while at 0.002 pfu, most replicates were detected above background fluorescence levels (FIG. 7). These data suggest a sensitivity of 0.005 pfu of purified virus for the RSV A assay.
- a limit of detection (LOD) study was performed. The study was initiated at 0.005 pfu per reaction (the sensitivity limit as determined during analytical reactivity testing, see section h). The LOD is defined as the lowest target concentration at which 95% of replicates can be detected.
- the RSV A study began at 0.005 pfu per reaction, but during the 20 replicate study, 2 replicates were not detected as positive so the target concentration was increased to 0.01 pfu (a two-fold increase). At 0.01 pfu, all replicates were detected as positive (FIG. 8), therefore the LOD is 0.01 pfu/reaction of purified viral RNA (strain A2).
- LOD limit of detection
- the RSV A and RSV B assays were developed using the RSV strains A2 and Bl, respectively. These strains are commercially available as purified virus or purified RNA, making them suitable and convenient for development work. To ensure that the RSV A and RSV B assays worked on strains other than the development strains, additional RSV strains were purchased and tested. For RSV A, the LOD was determined to be 5 copies of purified RNA when using the development strain A2. The strain A Long was also tested at 5 copies of purified RNA, confirming that detection at this target copy number is robust, suggesting that the RSV A assay can work across RSV A strains (FIG. 18).
- the LOD was determined to be 0.5 pfu of purified virus when using the development strain Bl .
- the strains B 9320 and B 18537 were also screened at 0.5 pfu of purified virus, and the data confirm that detection at this target copy number is robust, suggesting that the RSV B assay can work across multiple RSV B strains (FIG. 19).
- the concentration of each target used was purposefully high to mimic a worst case scenario, and the final concentration per reaction was determined based on adding 2 ⁇ l of the stock material to each reaction.
- Each target was tested in triplicate reactions, and the results are shown in FIGs. 20A-B.
- the RSV A or RSV B assays did not detect Influenza A, Influenza B or Strep A, indicating that these assays provide good specificity against non-RSV species.
- RSV A one replicate of Strep A showed a saturated fluorescence signal.
- This sample was subsequently analyzed by ESI-MS which confirmed the reaction was contaminated with RSV target/amplicon as the product generated was the expected product generated from amplification off of the RSV genome (this sequence does not exist in the Strep A genome).
- the RSV A assay was screened against RSV B target, and the RSV B assay was screened against RSV A target.
- the RSV A and B target sequences are similar to one another, and some level of cross-reactivity was expected.
- FIG. 21A when the RSV A assay is challenged with RSV B virus, the assay does detect it, although the sensitivity is greatly diminished as compared to detection of RSV A virus.
- the RSV A assay has an LOD of 0.01 pfu/reaction for RSV A target, while in this study the RSV A assay could only detect down to between 400 - 4,000 pfu/reaction of RSV B target.
- the assay detects it, but once again, at a diminished sensitivity as compared to RSV B virus (FIG. 2 IB).
- the RSV B assay has a LOD of 0.5 pfu/reaction for RSV B target, but was only able to detect between 10 - 100 pfu/reaction of RSV A target.
- FIGs. 22 and 23 Shown in FIGs. 22 and 23 are alignments between the template and molecular beacon components of the RSV A assay and RSV A and RSV B targets (FIG. 22), as well as the RSV B assay components against RSV B and RSV A targets (FIG. 23).
- the alignments there is significant homology between the RSV A target sequence and genomic sequence from a subset of RSV B strains. Shown are several strains with significant homology to the RSV A target sequence (E values ⁇ le-04, representing the top 24 hits from the top 200 list). From BLAST analysis, no other RSV B strains showed significant homology to RSV A target sequence (the remaining top 200 hits (25 through 200) all generated E values of > 1).
- the top RSV B hits certainly provide enough homology to generate some level of amplification and detection of RSV B when using RSV A reagents.
- RSV A assay and RSV B target there is significant homology between the RSV B assay and the genomic sequence of RSV A.
- FIG. 23 Shown in FIG. 23 is a representative RSV A strain aligned with the RSV B assay templates, molecular beacon and product sequences.
- This RSV A strain is identical to the top 200 RSV A BLAST hits (all hits have an E value of 3e-08), indicating that the RSV A genomic sequence has very high homology for the RSV B assay target sequence, suggesting amplification off of the RSV B genome will occur to some extent.
- RSV A and B assay performance were tested as pooled samples. Three pools were generated, A, B & C, each consisting of 4 individual anonymous donor swabs, respectively. Each swab was eluted in 2.5 ml of pre-heated (3 minutes) eluti on/lysis buffer, by swirling the swab for 10 seconds and expressing prior to removing from the buffer. The swab eluates were then combined to make pools of 10 ml each. The RSV A and B assays were first initially screened using LOD virus concentrations, and virus concentrations were increased until 3/3 replicates generated 'positive' results.
- the RSV A assay was unable to detect 0.01 pfu/reaction (the assay's LOD without clinical matrix present) when challenged with pool A, but a doubling of the pfu/reaction to 0.02 generated good amplification and detection in a reproducible fashion.
- Matrix pool B provided the least inhibition, as the RSV A assay readily detected all replicates at 0.01 pfu/reaction.
- RSV A assay screened with anonymous donor swab pool C was the most inhibitory pool and required the addition of 0.05 pfu/reaction (5-fold above the assay's LOD) to generate consistent positive results.
- a RNaseP qPCR assay was used to quantitate the amount of human gDNA present in each matrix pool.
- the qPCR data suggest that per 100 ⁇ l sample of matrix A, B & C contain 4.6 ng, 5.0 ng and 4.9 ng of human gDNA, respectively. These concentrations should not be inhibitory to the RSV A, B or IC assays, as the assays were shown to work well when challenged with concentrations similar to those in the pools in Example 2.
- the RNase and DNase levels of each pool were also determined, qualitatively, using IDT's RNase Alert and DNase Alert kits. The three pools showed very low DNase levels but all three pools retained significant RNase activity, with pool B showing the greatest activity (data not shown).
- RNase/DNase nuclease testing to determine the levels of RNase and DNase activity.
- the RSV A & B NEAR assays were screened by first either eluting each swab sample in 2.5 ml of pre-heated elution/lysis buffer by dipping the swab into the buffer, swirling for approximately 10 seconds, expressing the swab and then removing the swab. The eluates were then immediately transferred to lyophilized reactions already present on the instrument to initiate amplification and detection. Samples in UTM were screened by adding 200 ⁇ l of UTM into 2.5 ml of pre-heated elution/lysis buffer and mixing briefly (by pipetting up and down). The eluates were then immediately transferred to lyophilized reactions already present on the instrument to initiate amplification and detection. All clinical samples were thawed and allowed to reach ambient temperature prior to their use.
- RSV A ranged from 497 copies/reaction to 1 ,881,600 copies/reaction.
- RSV B titers ranged from 26 copies/reaction to 5,388,009 copies/reaction.
- the RSV A/B NEAR assays performed. The RSV A & B assays were able to detect all qPCR positive samples as NEAR positive except for the lowest RSV B sample (26 copies/reaction), which is below the assay's LOD.
- Example 6 the RSV A & B NEAR assays are cross-reactive with one another, and this can be seen in the clinical sample testing. Of the 9 qPCR confirmed RSV A positive samples, 1 was detected as positive by the RSV B NEAR assay. Of the 29 qPCR confirmed RSV B positive samples, 12 were detected as positive by the RSV A NEAR assay.
- the RNase activity also varied greatly, as measured using the qualitative RNase Alert assay.
- the level of RNase activity was subj ectively segregated into four levels, high (4 stars), moderate (3 stars), low (2 stars) and very low (1 star).
- a call of high RNase activity was the result of saturating signal in the RNase Alert assay.
- a level of very low was the result of a signal slightly above the baseline level (negative control) of RNase activity in the RNase Alert assay (Table 9).
- Table 9 The majority of clinical samples possessed large amounts of RNase activity, which could potentially lead to assay inhibition when the target is an RNA species, such as in the RSV test.
- Finally, of the 100 clinical samples tested only 7 had measureable DNase activity, and all 7 samples possessed very low levels of DNase, suggesting that this potential inhibitor does not play a significant role in nasal swab inhibition of the RSV test.
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Analytical Chemistry (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Virology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Enzymes And Modification Thereof (AREA)
Priority Applications (8)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP18849601.2A EP3676394A4 (en) | 2017-08-31 | 2018-08-30 | SYNCYTIAL SYNCHRONIZATION AND EXTENSION AMPLIFICATION REACTION (NEAR) OF RESPIRATORY VIRUS SPECIES |
| AU2018326627A AU2018326627C1 (en) | 2017-08-31 | 2018-08-30 | Nicking and extension amplification reaction (near) of respiratory syncytial virus species |
| CN201880055127.XA CN111406118B (zh) | 2017-08-31 | 2018-08-30 | 呼吸道合胞病毒种属的切口产生和延伸扩增反应(near) |
| RU2020100221A RU2020100221A (ru) | 2017-08-31 | 2018-08-30 | Реакция амплификации с разрывом и удлинением (near) разновидностей респираторно-синцитиального вируса |
| JP2020512607A JP2020533974A (ja) | 2017-08-31 | 2018-08-30 | 呼吸器合胞体ウイルス種のニッキング及び伸長増幅反応(near) |
| BR112020004071-1A BR112020004071A2 (pt) | 2017-08-31 | 2018-08-30 | reação de amplificação por nicking e extensão (near) de espécies do vírus sincicial respiratório |
| KR1020207009252A KR20200083444A (ko) | 2017-08-31 | 2018-08-30 | 호흡기 세포융합 바이러스 종의 니킹 및 연장 증폭 반응(near) |
| CA3073954A CA3073954A1 (en) | 2017-08-31 | 2018-08-30 | Nicking and extension amplification reaction (near) of respiratory syncytial virus species |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201762552546P | 2017-08-31 | 2017-08-31 | |
| US62/552,546 | 2017-08-31 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2019046610A1 true WO2019046610A1 (en) | 2019-03-07 |
Family
ID=65526105
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2018/048903 Ceased WO2019046610A1 (en) | 2017-08-31 | 2018-08-30 | REACTION OF SYNCHRONIZATION AMPLIFICATION AND (NEAR) EXTENSION OF SYNCYTIAL RESPIRATORY VIRUS SPECIES |
Country Status (10)
| Country | Link |
|---|---|
| US (1) | US11634770B2 (cg-RX-API-DMAC7.html) |
| EP (1) | EP3676394A4 (cg-RX-API-DMAC7.html) |
| JP (1) | JP2020533974A (cg-RX-API-DMAC7.html) |
| KR (1) | KR20200083444A (cg-RX-API-DMAC7.html) |
| CN (1) | CN111406118B (cg-RX-API-DMAC7.html) |
| AU (1) | AU2018326627C1 (cg-RX-API-DMAC7.html) |
| BR (1) | BR112020004071A2 (cg-RX-API-DMAC7.html) |
| CA (1) | CA3073954A1 (cg-RX-API-DMAC7.html) |
| RU (1) | RU2020100221A (cg-RX-API-DMAC7.html) |
| WO (1) | WO2019046610A1 (cg-RX-API-DMAC7.html) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20240124945A1 (en) * | 2021-02-16 | 2024-04-18 | Massachusetts Institute Of Technology | Systems and methods for detecting microorganism or viral loaded aerosols |
| WO2025030178A1 (en) * | 2023-08-03 | 2025-02-06 | Abbott Laboratories | Isothermal amplification of nucleic acids |
| RU2843904C2 (ru) * | 2022-09-09 | 2025-07-21 | Саншуэр Биотек Инк. | Композиции, наборы, способы выявления и идентификации патогенов, которые вызывают инфекции респираторного тракта, и их применение |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9689031B2 (en) * | 2007-07-14 | 2017-06-27 | Ionian Technologies, Inc. | Nicking and extension amplification reaction for the exponential amplification of nucleic acids |
| GB201611469D0 (en) | 2016-06-30 | 2016-08-17 | Lumiradx Tech Ltd | Improvements in or relating to nucleic acid amplification processes |
| GB2569965A (en) | 2018-01-04 | 2019-07-10 | Lumiradx Uk Ltd | Improvements in or relating to amplification of nucleic acids |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6881835B2 (en) * | 2002-01-04 | 2005-04-19 | Dr. Chip Biotechnology Inc. | Detection of respiratory viruses |
| US20060287267A1 (en) * | 2001-05-18 | 2006-12-21 | Sirna Therapeutics, Inc. | RNA interference mediated inhibition of respiratory syncytial virus (RSV) expression using short interfering nucleic acid (siNA) |
| US20170183714A1 (en) * | 2015-12-28 | 2017-06-29 | Ionian Technologies, Inc. | Nicking and extension amplification reaction (near) of streptococcus species |
Family Cites Families (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20030138800A1 (en) * | 2001-07-15 | 2003-07-24 | Keck Graduate Institute | Exponential amplification of nucleic acids using nicking agents |
| US7399590B2 (en) | 2002-02-21 | 2008-07-15 | Asm Scientific, Inc. | Recombinase polymerase amplification |
| US7270981B2 (en) | 2002-02-21 | 2007-09-18 | Asm Scientific, Inc. | Recombinase polymerase amplification |
| WO2007096702A2 (en) * | 2005-07-25 | 2007-08-30 | Asm Scientific, Inc. | Methods for multiplexing recombinase polymerase amplification |
| US8071308B2 (en) | 2006-05-04 | 2011-12-06 | Alere San Diego, Inc. | Recombinase polymerase amplification |
| US9689031B2 (en) * | 2007-07-14 | 2017-06-27 | Ionian Technologies, Inc. | Nicking and extension amplification reaction for the exponential amplification of nucleic acids |
| EP2438196B1 (en) | 2009-06-05 | 2016-12-21 | Alere San Diego, Inc. | Recombinase polymerase amplification reagents and kits |
| RU2601129C2 (ru) * | 2012-04-09 | 2016-10-27 | Инвайролоджикс Инк. | Композиции и способы для количественного определения последовательности нуклеиновой кислоты в образце |
-
2018
- 2018-08-30 KR KR1020207009252A patent/KR20200083444A/ko not_active Ceased
- 2018-08-30 WO PCT/US2018/048903 patent/WO2019046610A1/en not_active Ceased
- 2018-08-30 AU AU2018326627A patent/AU2018326627C1/en active Active
- 2018-08-30 JP JP2020512607A patent/JP2020533974A/ja active Pending
- 2018-08-30 BR BR112020004071-1A patent/BR112020004071A2/pt not_active Application Discontinuation
- 2018-08-30 EP EP18849601.2A patent/EP3676394A4/en active Pending
- 2018-08-30 RU RU2020100221A patent/RU2020100221A/ru unknown
- 2018-08-30 CN CN201880055127.XA patent/CN111406118B/zh active Active
- 2018-08-30 CA CA3073954A patent/CA3073954A1/en active Pending
- 2018-08-30 US US16/118,081 patent/US11634770B2/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20060287267A1 (en) * | 2001-05-18 | 2006-12-21 | Sirna Therapeutics, Inc. | RNA interference mediated inhibition of respiratory syncytial virus (RSV) expression using short interfering nucleic acid (siNA) |
| US6881835B2 (en) * | 2002-01-04 | 2005-04-19 | Dr. Chip Biotechnology Inc. | Detection of respiratory viruses |
| US20170183714A1 (en) * | 2015-12-28 | 2017-06-29 | Ionian Technologies, Inc. | Nicking and extension amplification reaction (near) of streptococcus species |
Non-Patent Citations (2)
| Title |
|---|
| "To establish substantial equivalence to a predicate device and to obtain clearance for a new assay: the Alere i RSV Test", FDA CURH, 501(K) REPORT K161375, 18 August 2016 (2016-08-18), pages 1 - 21, XP055578697, Retrieved from the Internet <URL:https://www.accessdata.fda.gov/cdrh_docs/reviews/K161375.pdf> [retrieved on 20181021] * |
| See also references of EP3676394A4 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20240124945A1 (en) * | 2021-02-16 | 2024-04-18 | Massachusetts Institute Of Technology | Systems and methods for detecting microorganism or viral loaded aerosols |
| RU2843904C2 (ru) * | 2022-09-09 | 2025-07-21 | Саншуэр Биотек Инк. | Композиции, наборы, способы выявления и идентификации патогенов, которые вызывают инфекции респираторного тракта, и их применение |
| WO2025030178A1 (en) * | 2023-08-03 | 2025-02-06 | Abbott Laboratories | Isothermal amplification of nucleic acids |
Also Published As
| Publication number | Publication date |
|---|---|
| RU2020100221A (ru) | 2021-09-30 |
| JP2020533974A (ja) | 2020-11-26 |
| KR20200083444A (ko) | 2020-07-08 |
| EP3676394A4 (en) | 2021-06-02 |
| EP3676394A1 (en) | 2020-07-08 |
| CN111406118B (zh) | 2024-07-12 |
| AU2018326627B2 (en) | 2024-08-22 |
| AU2018326627C1 (en) | 2024-12-12 |
| US11634770B2 (en) | 2023-04-25 |
| BR112020004071A2 (pt) | 2020-09-24 |
| AU2018326627A1 (en) | 2020-01-30 |
| CA3073954A1 (en) | 2019-03-07 |
| RU2020100221A3 (cg-RX-API-DMAC7.html) | 2022-03-11 |
| CN111406118A (zh) | 2020-07-10 |
| US20190194747A1 (en) | 2019-06-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11186864B2 (en) | Nicking and extension amplification reaction (near) of Streptococcus species | |
| US11634770B2 (en) | Nicking and extension amplification reaction (NEAR) of respiratory syncytial virus species | |
| Wang et al. | Loop-mediated isothermal amplification using self-avoiding molecular recognition systems and antarctic thermal sensitive uracil-DNA-glycosylase for detection of nucleic acid with prevention of carryover contamination | |
| JP2007508824A (ja) | 核酸のプライマーに基づく増幅のための方法及びキット | |
| US20120045751A1 (en) | Generic Sample Preparation | |
| US6867021B2 (en) | Multiplex RT-PCR/PCR for simultaneous detection of bovine coronavirus, bovine rotavirus, Cryptosporidium parvum, and Escherichia coli | |
| CA2802548C (en) | Qualitative and quantitative detection of microbial nucleic acids | |
| US8877464B2 (en) | Qualitative and quantitative detection of microbial nucleic acids | |
| JP2006087438A (ja) | 試験サンプル中のMycoplasmagenitaliumの存在を決定するための組成物、方法およびキット | |
| JP2025072582A (ja) | 標的核酸を検出するためのループプライマー及びループ・デ・ループ方法 | |
| JP6181742B2 (ja) | Hevアッセイ | |
| EP4163397A1 (en) | Specimen transport kit for detecting respiratory pathogens and methods for detecting respiratory pathogens using same | |
| Zhuang et al. | Research progress of loop-mediated isothermal amplification in the detection of Salmonella for food safety applications | |
| CN105385684A (zh) | 用于为核酸扩增作对照的寡核苷酸 | |
| Jia et al. | Multiple cross displacement amplification combined with nanoparticle-based lateral flow biosensor for rapid and sensitive detection of Epstein-Barr virus | |
| Wang et al. | Nanoparticles-based lateral flow biosensor coupled with multiple cross displacement amplification Plus for simultaneous detection of nucleic acid and prevention of carryover contamination | |
| Forsyth et al. | Rinderpest virus lineage differentiation using RT-PCR and SNAP-ELISA | |
| CN105606574A (zh) | T-2毒素的检测方法及检测试剂盒 | |
| CN117757985A (zh) | 用于冠状病毒检测的组合物及其制备和使用方法 | |
| Jang et al. | Primer generation-rolling circle amplification method optimized for the detection of pathogenic bacteria | |
| HK40025966A (en) | Nicking and extension amplification reaction (near) of respiratory syncytial virus species | |
| WO2006073449A2 (en) | Multiplex systems, methods, and kits for detecting and identifying nucleic acids | |
| Zhuang et al. | Discover Nano | |
| EP4547873A1 (en) | Compositions and methods for detecting lymphogranuloma venereum (lgv) serovars of chlamydia trachomatis | |
| US20230220499A1 (en) | Methods and compositions for detecting sars-cov-2 nucleic acid |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 18849601 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 2018326627 Country of ref document: AU Date of ref document: 20180830 Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 3073954 Country of ref document: CA |
|
| ENP | Entry into the national phase |
Ref document number: 2020512607 Country of ref document: JP Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112020004071 Country of ref document: BR |
|
| ENP | Entry into the national phase |
Ref document number: 2018849601 Country of ref document: EP Effective date: 20200331 |
|
| ENP | Entry into the national phase |
Ref document number: 112020004071 Country of ref document: BR Kind code of ref document: A2 Effective date: 20200228 |