WO2019035901A1 - Compositions et méthodes pour la modulation de la protéine sting - Google Patents

Compositions et méthodes pour la modulation de la protéine sting Download PDF

Info

Publication number
WO2019035901A1
WO2019035901A1 PCT/US2018/000169 US2018000169W WO2019035901A1 WO 2019035901 A1 WO2019035901 A1 WO 2019035901A1 US 2018000169 W US2018000169 W US 2018000169W WO 2019035901 A1 WO2019035901 A1 WO 2019035901A1
Authority
WO
WIPO (PCT)
Prior art keywords
sting
mutation
composition
vaccine
variant
Prior art date
Application number
PCT/US2018/000169
Other languages
English (en)
Other versions
WO2019035901A9 (fr
Inventor
Glen N. Barber
Original Assignee
University Of Miami
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University Of Miami filed Critical University Of Miami
Publication of WO2019035901A1 publication Critical patent/WO2019035901A1/fr
Publication of WO2019035901A9 publication Critical patent/WO2019035901A9/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/335—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
    • A61K31/34—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having five-membered rings with one oxygen as the only ring hetero atom, e.g. isosorbide
    • A61K31/341—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having five-membered rings with one oxygen as the only ring hetero atom, e.g. isosorbide not condensed with another ring, e.g. ranitidine, furosemide, bufetolol, muscarine
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/44—Non condensed pyridines; Hydrogenated derivatives thereof
    • A61K31/445—Non condensed piperidines, e.g. piperocaine
    • A61K31/4523—Non condensed piperidines, e.g. piperocaine containing further heterocyclic ring systems
    • A61K31/4545—Non condensed piperidines, e.g. piperocaine containing further heterocyclic ring systems containing a six-membered ring with nitrogen as a ring hetero atom, e.g. pipamperone, anabasine
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/505—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
    • A61K31/519—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with heterocyclic rings
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7028—Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages
    • A61K31/7034—Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages attached to a carbocyclic compound, e.g. phloridzin
    • A61K31/704—Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages attached to a carbocyclic compound, e.g. phloridzin attached to a condensed carbocyclic ring system, e.g. sennosides, thiocolchicosides, escin, daunorubicin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/39—Medicinal preparations containing antigens or antibodies characterised by the immunostimulating additives, e.g. chemical adjuvants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/02—Immunomodulators
    • A61P37/04—Immunostimulants
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4702—Regulators; Modulating activity
    • C07K14/4705—Regulators; Modulating activity stimulating, promoting or activating activity

Definitions

  • the present disclosure relates, in general, to modulating signaling activity of STING (STimulator of INterferon Genes) in a subject having an ongoing immune response.
  • STING STimulator of INterferon Genes
  • the disclosure describes use of constitutively active variants of STING as therapy to stimulate STING activity and increase activity of immune cells.
  • inhibitors of AMPK to increase STING activity in a subject in need thereof.
  • the cellular sensor STING resides in the endoplasmic reticulum (ER) and is activated by cyclic dinucleotides (CDN's) such as c-GMP and c-AMP secreted by intracellular bacteria after infection 5 .
  • CDN's cyclic dinucleotides
  • STING can be activated by cGAMP generated by a cellular synthase cGAS (MB21 D1 ) following the latter's association with aberrant cytosolic dsDNA species, which can include microbial DNA, self-DNA leaked from the nucleus or even mitochondria DNA 6,7
  • a conformational change causes STING to traffic through the golgi, with tank binding kinase 1 (TBK1) to activate the transcription factors IRF3 and NF- ⁇ which stimulate the production of type I interferon (IFN) and pro-inflammatory cytokines which facilitate adaptive immunity 8,9 .
  • TNK1 tank binding kinase 1
  • IFN type I interferon
  • pro-inflammatory cytokines which facilitate adaptive immunity 8,9 .
  • chronic activation of STING signaling has been shown to be cause lethal inflammatory disease.
  • loss of function mutation in the DNase TREX1 has been found to cause severe SLE referred to as Aicardi-Goutieres Syndrome (AGS) in human patients 1 .
  • Aicardi-Goutieres Syndrome Aicardi-Goutieres Syndrome
  • loss of DNasell causes lethal pre-natal inflammatory disease in mice through comparable STING-dependent pathways 11 .
  • Inflammatory disease caused by STING overactivity has also been shown to occur in patients with mutations in the ADAR and Ribonuclease H2 enzyme complex 12,13 .
  • STING germ-line missense mutations in the coding region of the STING gene itself (V147L/M, N154S, V155M, C206Y, R281Q, R284G, and S102P/F279L), which exert a gain-of-function phenotype referred to as SAVI (STING-associated vasculopathy with onset in infancy) 14"19 .
  • SAVI STING-associated vasculopathy with onset in infancy
  • the present disclosure shows that gain of function mutants of the human STING protein may be useful to stimulate an immune response and may be useful as vaccines to treat indications in which an immune response is needed.
  • the disclosure also shows that certain kinase inhibitors suppress STING-dependent IRF3 activation may be useful for the treatment of a wide-range of autoinflammatory disorders.
  • the disclosure provides a vector comprising a variant of a human STimulator of INterferon Genes (STING) polynucleotide encoding a STING protein having a mutation that makes the STING protein constitutively active.
  • the mutation is at residue 154 or 284 of the STING protein of SEQ ID NO: 1.
  • the mutation is N154S or R284S of SEQ ID NO: 1.
  • a composition comprising the vector described herein.
  • the disclosure also contemplates a vaccine comprising a variant of a human
  • STimulator of INterferon Genes polynucleotide encoding a STING protein having a mutation that makes the STING protein constitutively active, wherein the variant induces STING signaling.
  • the mutation is at residue 154 or 284 of the STING protein of SEQ ID NO: 1.
  • the mutation is N154S or R284S of SEQ ID NO: 1.
  • the polynucleotide is in a vector.
  • vector is a viral vector or a plasmid vector.
  • the viral vector is selected from the group consisting of vesicular stomatitis virus (VSV), a lentivirus, an adenovirus, an adeno-associated virus, a vaccinia virus and a modified vaccinia Ankara (MVA) virus.
  • VSV vesicular stomatitis virus
  • a lentivirus lentivirus
  • an adenovirus adeno-associated virus
  • vaccinia virus a modified vaccinia Ankara
  • MVA modified vaccinia Ankara
  • composition comprising the vaccine described herein.
  • the disclosure provides a method of activating STimulator of INterferon Genes (STING) in a subject in need thereof comprising administering a composition comprising a variant of a human STING protein having a mutation that makes the STING protein constitutively active, wherein the composition induces STING signaling.
  • STING STimulator of INterferon Genes
  • a method of stimulating an immune response in a subject in need thereof comprising administering a composition comprising a STING variant having a mutation that makes the STING protein constitutively active, wherein the composition induces STING signaling.
  • the subject is suffering from cancer or a microbial infection.
  • the disclosure contemplates a method of decreasing the size of a tumor in a subject comprising administering a composition a STimulator of INterferon Genes (STING) variant having a mutation that makes the STING protein constitutively active, wherein the composition induces STING signaling.
  • the disclosure provides a method of treating cancer in a subject comprising administering a composition comprising an activator of STING (STimulator of INterferon Genes) comprising a STING variant having a mutation that makes the STING protein constitutively active, wherein the composition induces STING signaling.
  • the cancer is ovarian cancer, colon cancer, melanoma, breast cancer or lung cancer.
  • the tumor size in the subject is decreased by about 25-50%, about 40-70% or about 50-90% or more.
  • the composition is administered intratumorally, intravenously, intra-arterially, intraperitoneally, intranasally, intramuscularly, intradermally or subcutaneously.
  • the composition induces infiltration of immune cells into the tumor.
  • the immune cells are macrophages or other phagocytes.
  • the composition administered is a vector or a vaccine described herein.
  • the disclosure contemplates a method of inhibiting STING signaling in a subject in need thereof comprising administering to the subject a therapeutically effective amount of an inhibitor of 5' adenosine monophosphate-activated protein kinase (AMPK).
  • AMPK 5' adenosine monophosphate-activated protein kinase
  • Also contemplated is a method of treating an inflammatory disease in which STING signaling is upregulated comprising administering to a subject in need thereof a therapeutically effective amount of an inhibitor of 5' adenosine monophosphate-activated protein kinase (AMPK).
  • AMPK 5' adenosine monophosphate-activated protein kinase
  • the disease is an autoimmune disease.
  • the autoimmune disease is selected from the group consisting of inflammatory bowel disease, ulcerative colitis, Crohn's disease, a peripheral vascular disease, a disorder characterized by lesions having inflammatory cell infiltration, a disorder where amyloid plaques are present in the brain, Alzheimer's disease, Aicardi-Goutieres syndrome, juvenile arthritis, rheumatoid arthritis, osteoporosis, amyotrophic lateral sclerosis, systemic lupus erythmatosis and multiple sclerosis.
  • the subject expresses a mutation in STING that makes the STING protein constitutively active.
  • the STING mutation is selected from the group consisting of N154S and R284S of SEQ ID NO: 1.
  • the AMPK inhibitor is selected from the group consisting of dorsomorphin, doxorubicin hydrochloride, GSK690693, BML-275, STO-609, a fasudil salt, gamma-D-glutamylaminomethylsulfonic acid, WZ4003 and HTH-01-015.
  • an adjuvant comprising a STimulator of INterferon Genes (STING) variant having a mutation that makes the STING protein constitutively active.
  • the STING variant is a polynucleotide and an adjuvant for a nucleic acid vaccine.
  • the STING variant is a polypeptide.
  • the STING mutation is selected from the group consisting of N154S and R284S of SEQ ID NO: 1.
  • the disclosure further provides a method of enhancing an immune response to a vaccine in a subject receiving said vaccine comprising administering an adjuvant comprising a STimulator of INterferon Genes (STING) variant having a mutation that makes the STING protein constitutively active in conjunction with the vaccine.
  • STING STimulator of INterferon Genes
  • Figures 1 A-1 E show the characterization of the Ecuador mutant (R284S) as hyperactive.
  • Figure 1A The patient had a missense heterozygous mutation in STING
  • FIG. 1 B R284S mutation is on the a-helix loop 5 in STING C-terminus.
  • the crystal structure of apo-STING dimer indicates that R284 may not be involved in STING dimerization or cGAMP-binding. R284 is highly conserved among different species.
  • Figure 1 C HEK293T cells were transfected with plasmid encoding human STING (hSTING) or its mutants (N154S, R284S) and the indicated reporter plasmids. Human cGAS (hcGAS) was expressed to generate cGAMP.
  • FIG. 1 D The indicated plasmids were transfected into HEK293T cells.
  • the cell lysates were incubated with biotin-labeled cGAMP for 30 min at 4 °C and then irradiated with UV for 10 min at 1 J/cm 2 for crosslinking. After precipitation with streptavidin-beads, the precipitants were washed and then boiled in SDS-sample buffer. Western blots were performed with the indicated antibodies.
  • Figures 2A-2F describe that the Ecuador mutant (R284S) constitutively moves and induces inflammation.
  • Figure 2A Primary Sting '1' EF cells were reconstituted with wild-type
  • Figure 2A ( Figure 2C) Total RNA was purified from the reconstituted cells after treated with dsDNA as described in Figure 2A and then examined for gene expression using Affymetrix
  • FIGS 3A-3F show IFN is transiently produced during trafficking.
  • A Realtime PCR was performed for Ifnbl expression in the reconstituted primary Sting '1' MEF cells.
  • B and C Wild-type STING or its mutants (N154S, R284S) were expressed in primary Sting * ' * and Sting '1' MEF cells using retrovirus. The cells were treated with dsDNA (4 ⁇ g/ml) using lipofectamine 2000 for 15 h. The amounts of IFNp (B) or CXCL 0 (C) in the supernatants were measured by ELISA.
  • Figures 4A-4F show that AMPK inhibitors are potential therapeutic drugs for STING- induced inflammatory diseases.
  • Figure 4A The reconstituted primary Sting '1' MEF cells were treated with tofacitinib (5 ⁇ ) or BFA (5 ⁇ g/ml) for 9 h and then CXCL10 in the supernatants was measured by ELISA.
  • Figure 4B The reconstituted cells were treated with tofacitinib or BFA as described in Figure 4A and then realtime PCR was performed with Ifitl probe.
  • Figure 4C Western blots were performed with the indicated antibodies for the cell lysates after the supernatants that were used in Figure 4A were collected.
  • FIG. 4D The reconstituted cells expressing R284S were treated with the indicated drugs (compound C (10 ⁇ ), doxorubicin (10 ⁇ ), GSK 690693 (20 ⁇ ), tofacitinib (5 ⁇ )) for 9 h. Total RNA was purified and then examined for gene expression compared to vehicle as describes in Figure 2C. The scale represents the intensity of gene expression (log2 scale).
  • Figure 4E The reconstituted cells expressing N 54S or R284S were treated with the indicated drugs as described in Figure 4D. Realtime PCR was performed with Ifitl, Oasl1, or Rsad2 probe.
  • Figure 4F The reconstituted cells expressing R284S were treated with the drugs at the indicated concentration for 9 h.
  • STING Reported herein is the identification of an alternate de novo germline missense mutation in exon 5 of STING (R284S). Subsequent examination indicated that STING (R284S) was a constitutively active gain-of-function, dominant-negative mutant that could traffic through the golgi and trigger innate immune signaling in the absence of CDN's. JAK inhibitors such as tofacitinib failed to significantly repress STING (R284S) function, but use of an AMPK/AKT inhibitor GSK 690693, which affected ULK1 activity, robustly inhibited STING-dependent IRF3 activation. This disclosure underscores the growing incidence of deregulated STING signaling in manifesting chronic cytokine related disease and indicates that suppression of STING- dependent IRF3 activation may be useful for the treatment of a wide-range of autoinflammatory disorders.
  • STimulator of INterferon Genes includes, without limitation, nucleic acids, polynucleotides, oligonucleotides, sense and antisense polynucleotide strands, complementary sequences, peptides, polypeptides, proteins, homologous and/or orthologous STING molecules, isoforms, precursors, mutants, variants, derivatives, splice variants, alleles, different species, and active fragments thereof.
  • an "active STING mutant” refers to a mutant of STING protein which results in a gain- of-function mutant in which STING is constitutively active.
  • An active STING mutant is also a STING variant polynucleotide having a mutation in the wild type STING protein.
  • Exemplary constitutively active mutations include, but are not limited to, N154S or R284S of SEQ ID NO: 1.
  • polynucleotide and “nucleic acid”, used interchangeably herein, refer to a polymeric form of nucleotides of any length, either ribonucleotides or deoxyribonucleotides. These terms include a single-, double- or triple-stranded DNA, genomic DNA, cDNA, genomic RNA, mRNA, DNA-RNA hybrid, or a polymer comprising purine and pyrimidine bases, or other natural, chemically, biochemically modified, non-natural or derivatized nucleotide bases.
  • the backbone of the polynucleotide can comprise sugars and phosphate groups (as may typically be found in RNA or DNA), or modified or substituted sugar or phosphate groups.
  • the backbone of the polynucleotide can comprise a polymer of synthetic subunits such as phosphoramidates and thus can be a oligodeoxynucleoside phosphoramidate (P-NH2) or a mixed phosphoramidate-phosphodiester oligomer.
  • P-NH2 oligodeoxynucleoside phosphoramidate
  • Peyrottes et al. (1996) Nucleic Acids Res. 24: 1841-8; Chaturvedi et al. (1996) Nucleic Acids Res. 24: 2318-23; Schultz et al. (1996) Nucleic Acids Res.
  • a double-stranded polynucleotide can be obtained from the single stranded polynucleotide product of chemical synthesis either by synthesizing the complementary strand and annealing the strands under appropriate conditions, or by synthesizing the complementary strand de novo using a DNA polymerase with an appropriate primer.
  • Reference to a polynucleotide sequence (such as referring to a SEQ ID NO) also includes the complement sequence.
  • polynucleotides a gene or gene fragment, exons, introns, genomic RNA, mRNA, tRNA, rRNA, ribozymes, cDNA, recombinant
  • polynucleotides branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers.
  • a polynucleotide may comprise modified nucleotides, such as methylated nucleotides and nucleotide analogs, uracyl, other sugars and linking groups such as fluororibose and thioate, and nucleotide branches.
  • the sequence of nucleotides may be interrupted by non-nucleotide components.
  • a polynucleotide may be further modified after polymerization, such as by conjugation with a labeling component.
  • caps substitution of one or more of the naturally occurring nucleotides with an analog, and introduction of means for attaching the polynucleotide to proteins, metal ions, labeling components, other polynucleotides, or a solid support.
  • Encoding refers to the inherent property of specific sequences of nucleotides in a polynucleotide, such as a gene, a cDNA, or an mRNA, to serve as templates for synthesis of other polymers and macromolecules in biological processes having either a defined sequence of nucleotides (i.e., rRNA, tRNA and mRNA) or a defined sequence of amino acids and the biological properties resulting therefrom.
  • a gene encodes a protein if transcription and translation of mRNA produced by that gene produces the protein in a cell or other biological system.
  • coding strand the nucleotide sequence of which is identical to the mRNA sequence and is usually provided in sequence listings
  • non-coding strand used as the template for transcription
  • a "nucleotide sequence encoding an amino acid sequence" includes all nucleotide sequences that are degenerate versions of each other and that encode the same amino acid sequence. Nucleotide sequences that encode proteins and RNA may include introns.
  • Under transcriptional control is a term well understood in the art and indicates that transcription of a polynucleotide sequence depends on its being operably (operatively) linked to an element which contributes to the initiation of, or promotes, transcription.
  • "Operably linked” refers to a juxtaposition wherein the elements are in an arrangement allowing them to function.
  • heterologous polynucleotide or “heterologous gene” or “transgene” is any polynucleotide or gene that is not present in wild-type viral vector.
  • a heterologous promoter is one which is not associated with or derived from the vector itself.
  • a "host cell” includes an individual cell or cell culture which can be or has been a recipient of a vector(s) described herein.
  • Host cells include progeny of a single host cell, and the progeny may not necessarily be completely identical (in morphology or in total DNA complement) to the original parent cell due to natural, accidental, or deliberate mutation and/or change.
  • a host cell includes cells transfected, transformed or infected in vivo or in vitro with a vector herein.
  • a “vector” (sometimes referred to as gene delivery or gene transfer “vehicle”) refers to a macromolecule or complex of molecules comprising a polynucleotide to be delivered to a host cell, either in vitro or in vivo.
  • the polynucleotide to be delivered may comprise a coding sequence of interest in gene therapy.
  • Vectors include, for example, viral vectors, such as vesicular stomatitis virus (VSV), lentivirus, adenovirus, adeno-associated virus, vaccinia virus, or modified vaccinia Ankara (MVA) virus vectors, liposomes and other lipid-containing complexes, and other macromolecular complexes capable of mediating delivery of a
  • viral vectors such as vesicular stomatitis virus (VSV), lentivirus, adenovirus, adeno-associated virus, vaccinia virus, or modified vaccinia Ankara (MVA) virus vectors, liposomes and other lipid-containing complexes, and other macromolecular complexes capable of mediating delivery of a
  • VSV vesicular stomatitis virus
  • lentivirus lentivirus
  • adenovirus adeno-associated virus
  • vaccinia virus or modified vaccinia Ankara
  • Vectors may be, for example, "cloning vectors” which are designed for isolation, propagation and replication of inserted nucleotides, "expression vectors” which are designed for expression of a nucleotide sequence in a host cell, or a “viral vector” which is designed to result in the production of a recombinant virus or virus-like particle, or "shuttle vectors", which comprise the attributes of more than one type of vector.
  • Vectors can also comprise other components or functionalities that further modulate gene delivery and/or gene expression, or that otherwise provide beneficial properties to the targeted cells.
  • such other components include, for example, components that influence binding or targeting to cells (including components that mediate cell-type or tissue-specific binding); components that influence uptake of the vector nucleic acid by the cell; components that influence localization of the
  • polynucleotide within the cell after uptake such as agents mediating nuclear localization
  • components that influence expression of the polynucleotide also might include markers, such as detectable and/or selectable markers that can be used to detect or select for cells that have taken up and are expressing the nucleic acid delivered by the vector.
  • markers such as detectable and/or selectable markers that can be used to detect or select for cells that have taken up and are expressing the nucleic acid delivered by the vector.
  • Such components can be provided as a natural feature of the vector (such as the use of certain viral vectors which have components or functionalities mediating binding and uptake), or vectors can be modified to provide such functionalities.
  • Other vectors include those described by Chen et al; BioTechniques, 34: 167-171 (2003). A large variety of such vectors are known in the art and are generally available.
  • expression vector refers to a vector containing a nucleic acid sequence coding for at least part of a gene product capable of being transcribed. In some cases, RNA molecules are then translated into a protein, polypeptide, or peptide. In other cases, these sequences are not translated, for example, in the production of antisense molecules, siRNA, ribozymes, and the like.
  • Expression vectors can contain a variety of control sequences, which refer to nucleic acid sequences necessary for the transcription and possibly translation of an operatively linked coding sequence in a particular host organism. In addition to control sequences that govern transcription and translation, vectors and expression vectors may contain nucleic acid sequences that serve other functions as well.
  • a "DNA Vaccine” or "DNA vector” as used herein refers to a synthetic DNA structure that can be transcribed in target cells and can comprise a linear nucleic acid such as a purified DNA, a DNA incorporated in a plasmid vector, or a DNA incorporated into any other vector suitable for introducing DNA into a host cell.
  • the DNA vaccine can be naked DNA.
  • a naked DNA vaccine is provided herein.
  • the vaccine may comprise viruslike particles (VLPs).
  • VSV cular stomatitis virus
  • a VSV construct herein may be in any of several forms, including, but not limited to, genomic RNA, mRNA, cDNA, part or all of the VSV RNA encapsulated in the nucleocapsid core, VSV complexed with compounds such as PEG and VSV conjugated to a nonviral protein.
  • VSV vectors useful herein encompass replication-competent and replication-defective VSV vectors, such as, VSV vectors lacking G glycoprotein.
  • vaccine refers to a composition comprising a vector comprising a mutated STING as described herein, which is useful in the treatment of cancer or other conditions in which enhanced immune response is indicated. It is contemplated that the vaccine comprises a pharmaceutically acceptable carrier and/or an adjuvant. It is contemplated that vaccines are prophylactic or therapeutic.
  • a "prophylactic” treatment is a treatment administered to a subject who does not exhibit signs of a disease or exhibits only early signs for the purpose of decreasing the risk of developing pathology.
  • the compounds of the invention may be given as a prophylactic treatment to reduce the likelihood of developing a pathology or to minimize the severity of the pathology, if developed.
  • a “therapeutic” treatment is a treatment administered to a subject who exhibits signs or symptoms of pathology for the purpose of diminishing or eliminating those signs or symptoms.
  • the signs or symptoms may be biochemical, cellular, histological, functional, subjective or objective.
  • the term "induces or enhances an immune response” as used herein refers to causing a statistically measurable induction or increase in an immune response over a control sample to which the peptide, polypeptide or protein has not been administered.
  • the induction or enhancement of the immune response results in a prophylactic or therapeutic response in a subject. Examples of immune responses are increased production of type I IFN, increased resistance to viral and other types of infection by alternate pathogens.
  • the enhancement of immune responses to tumors (anti-tumor responses), or the development of vaccines to prevent tumors or eliminate existing tumors.
  • the "treatment of cancer” refers to one or more of the following effects: (1) inhibition, to some extent, of tumor growth, including, (i) slowing down and (ii) complete growth arrest; (2) reduction in the number of tumor cells; (3) maintaining tumor size; (4) reduction in tumor size; (5) inhibition, including (i) reduction, (ii) slowing down or (iii) complete prevention, of tumor cell infiltration into peripheral organs; (6) inhibition, including (i) reduction, (ii) slowing down or (iii) complete prevention, of metastasis; (7) enhancement of anti-tumor immune response, which may result in (i) maintaining tumor size, (ii) reducing tumor size, (iii) slowing the growth of a tumor, (iv) reducing, slowing or preventing invasion and/or (8) relief, to some extent, of the severity or number of one or more symptoms associated with the disorder.
  • isolated refers to a polynucleotide, virus or antigenic composition that is removed from its native environment.
  • an isolated biological material is free of some or all cellular components, i.e., components of the cells in which the native material occurs naturally (e.g., cytoplasmic or membrane component).
  • a polynucleotide, virus or antigenic composition is deemed isolated if it is present in a cell extract or supernatant.
  • an isolated nucleic acid includes a PCR product, an isolated mRNA, a cDNA, or a restriction fragment.
  • purified refers to a virus or immunogenic composition that has been isolated under conditions that reduce or eliminate the presence of unrelated materials, i.e., contaminants, including endogenous materials from which the composition is obtained.
  • a purified virion is substantially free of host cell or culture components, including tissue culture or cell proteins and non-specific pathogens.
  • purified material substantially free of contaminants is at least 50% pure; at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or even at least 99% pure. Purity can be evaluated by chromatography, gel electrophoresis, immunoassay, composition analysis, biological assay, and other methods known in the art.
  • pharmaceutical composition refers to a composition suitable for administration to a subject animal, including humans and mammals.
  • a pharmaceutical composition comprises a pharmacologically effective amount of a virus or antigenic composition of the invention and also comprises a pharmaceutically acceptable carrier.
  • a pharmaceutical composition encompasses a composition comprising the active ingredient(s), and the inert ingredient(s) that make up the pharmaceutically acceptable carrier, as well as any product which results, directly or indirectly, from combination, complexation or aggregation of any two or more of the ingredients.
  • the pharmaceutical compositions of the present invention encompass any composition made by admixing a compound or conjugate of the present invention and a pharmaceutically acceptable carrier.
  • pharmaceutically acceptable carrier include any and all clinically useful solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, buffers, and excipients, such as a phosphate buffered saline solution, 5% aqueous solution of dextrose or mannitol, and emulsions, such as an oil/water or water/oil emulsion, and various types of wetting agents and/or adjuvants. Suitable
  • compositions useful for the composition depend upon the intended mode of administration of the active agent. Typical modes of administration include, but are not limited to, enteral (e.g., oral) or parenteral (e.g., subcutaneous, intramuscular, intravenous or intraperitoneal injection; or topical, transdermal, or transmucosal administration).
  • enteral e.g., oral
  • parenteral e.g., subcutaneous, intramuscular, intravenous or intraperitoneal injection; or topical, transdermal, or transmucosal administration.
  • a "pharmaceutically acceptable salt” is a salt that can be formulated into a compound or conjugate for pharmaceutical use including, e.g., metal salts (sodium, potassium, magnesium, calcium, etc.) and salts of ammonia or organic amines.
  • pharmaceutically acceptable refers to a material which is not biologically or otherwise undesirable, i.e., the material may be administered to an individual without causing any undesirable biological effects or interacting in a deleterious manner with any of the components of the composition in which it is contained, or when administered using routes well-known in the art, as described below.
  • STING Stimulator of Interferon Genes
  • TM transmembrane
  • ER endoplasmic reticulum
  • IRF3 Interferon Regulatory Factor 3
  • Human STING is a 379 amino acid protein, having an amino acid sequence set out in Genbank Accession No. NP_938023 and nucleotide sequence set out in Genbank Accession No. NM_198282, though alternate protein isoforms may exist (Genbank Accession Nos.
  • Loss of STING reduced the ability of polyl:C to activate type I IFN and rendered murine embryonic fibroblasts lacking STING ( " ' " MEFs) generated by targeted homologous recombination, susceptible to vesicular stomatitis virus (VSV) infection.
  • VSV vesicular stomatitis virus
  • RNAi ablation of TRAP inhibited STING function and impeded the production of type I IFN in response to polylC.
  • STING itself binds nucleic acids including single- and double-stranded DNA such as from pathogens and apoptotic DNA, and plays a central role in regulating proinflammatory gene expression in inflammatory conditions such as DNA-mediated arthritis and cancer. Certain inhibitors and activators of STING are discussed in International Patent Publication No. WO 2013/166000.
  • the disclosure provides a method of activating the immune system using a constitutively active mutant of the STING protein. Contemplated is
  • a vector or vaccine comprising the active STING protein or polynucleotide encoding the protein to a subject in need of immune system stimulation.
  • the immune response is an ongoing immune response in cancer, a microbial infection or an autoimmune disease.
  • the STING mutant may be administered prophylactically in a disease or disorder in which an immune response is in a remission phase, e.g., in cancer or an autoimmune disease.
  • the disclosure provides a method of suppressing STING in a subject in need thereof comprising administering a composition comprising an inhibitor of AMPK, wherein the kinase inhibitor inhibits STING signaling.
  • AMPK inhibitors include, but are not limited to, dorsomorphin, doxorubicin hydrochloride, GSK690693, BML-275, STO-609, a fasudil salt, gamma-D-glutamylaminomethylsulfonic acid, WZ4003 and HTH-01- 015.
  • the disclosure provides a method of decreasing the size of a tumor in a subject having a tumor or cancer comprising administering a composition comprising an active mutant of STING. Also provided is a method for treating cancer or preventing the recurrence of cancer comprising administering to a subject in need thereof a therapeutically effective amount of a active STING mutant or a pharmaceutical composition comprising an active STING mutant or vector or vaccine comprising a active mutant as described herein.
  • Exemplary conditions or disorders that can be treated with an active STING mutant include cancers, such as esophageal cancer, pancreatic cancer, metastatic pancreatic cancer, metastatic adenocarcinoma of the pancreas, bladder cancer, stomach cancer, fibrotic cancer, glioma, malignant glioma, diffuse intrinsic pontine glioma, recurrent childhood brain neoplasm renal cell carcinoma, clear-cell metastatic renal cell carcinoma, kidney cancer, prostate cancer, metastatic castration resistant prostate cancer, stage IV prostate cancer, metastatic melanoma, melanoma, malignant melanoma, recurrent melanoma of the skin, melanoma brain metastases, stage IIIA skin melanoma; stage IIIB skin melanoma, stage NIC skin melanoma; stage IV skin melanoma, malignant melanoma of head and neck, lung cancer, non-small cell lung cancer (NSCLC), squamous cell non-small cell
  • RUNX1-RUNX1T1 adult acute myeloid leukemia with t(9;1 1)(p22;q23); MLLT3-MLL; adult acute promyelocytic leukemia with t(15;17)(q22;q12); PML-RARA; alkylating agent-related acute myeloid leukemia, chronic lymphocytic leukemia, richter's syndrome; Waldenstrom
  • cancers that can be treated with the present invention include ovarian cancer, colon cancer, melanoma, breast cancer or lung cancer.
  • the methods herein reduce tumor size or tumor burden in the subject, and/or reduce metastasis in the subject.
  • the methods reduce the tumor size by 10%, 20%, 30% or more.
  • the methods reduce tumor size by 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100%.
  • the methods herein reduce tumor burden, and also reduce or prevent the recurrence of tumors once the cancer has gone into remission.
  • the active STING mutant compositions described herein modulates immune cells in a tumor.
  • the active STING mutant compositions increases the number of macrophages or other phagocytes or antigen presenting cells in a tumor and/or increases phagocytic activity of cells in the area of the tumor.
  • infectious diseases or autoimmune disease in which an increase in immune response may be desired.
  • exemplary conditions include, but are not limited to, an inflammatory bowel disease (e.g., ulcerative colitis or Crohn's disease), a peripheral vascular disease, a cerebral vascular accident (stroke), a disorder characterized by lesions having inflammatory cell infiltration, a disorder where amyloid plaques are present in the brain (e.g., Alzheimer's disease), Aicardi-Goutieres syndrome, juvenile arthritis, osteoporosis, amyotrophic lateral sclerosis, or multiple sclerosis.
  • an inflammatory bowel disease e.g., ulcerative colitis or Crohn's disease
  • peripheral vascular disease e.g., a peripheral vascular disease
  • stroke cerebral vascular accident
  • a disorder characterized by lesions having inflammatory cell infiltration e.g., Alzheimer's disease
  • Aicardi-Goutieres syndrome e.g., juvenile arthritis, osteoporosis, amyotrophic lateral
  • Exemplary microbial infections contemplated include viral, bacterial or fungal infection.
  • Many methods may be used to administer or introduce the active STING mutant or vectors, vaccines or viral particles comprising the active STING mutant into individuals (i.e., including subjects or patients), including but not limited to, intratumorally, intravenously, intra- arterially, intraperitoneally, intranasally, intramuscularly, intradermally, subcutaneously, orally or by continuous infusion.
  • the individual to which a vector or viral particle is administered is a primate, or in other examples, a mammal, or in other examples, a human, but can also be a non-human mammal including but not limited to cows, horses, sheep, pigs, fowl, cats, dogs, hamsters, mice and rats.
  • a vector, vaccines or viral particles the individual can be any animal in which a vector or virus is capable introducing the active STING mutant and results in activation of the immune response.
  • compositions comprising active STING mutants, vectors, vaccines or viral particles wherein said compositions can further comprise a pharmaceutically acceptable carrier.
  • the amount of vector(s) to be administered will depend on several factors, such as route of administration, the condition of the individual, the degree of aggressiveness of the malignancy, and the particular vector employed. Also, the vector may be used in conjunction with other treatment modalities.
  • vaccines or viral particles from about 10 2 up to about 10 7 p.f.u., in other examples, from about 10 3 up to about 10 6 p.f.u., and in other examples, from about 10 4 up to about 10 s p.f.u. is administered.
  • a polynucleotide construct i.e., not packaged as a virus
  • about 0.01 ⁇ g to about 100 pg of a viral construct of the present invention can be administered, in other examples, 0.1 pg to about 500 pg, and in other examples, about 0.5 pg to about 200 pg can be administered.
  • More than one vector can be administered, either simultaneously or sequentially. Administrations are typically given periodically, while monitoring any response. Administration can be given, for example, intramuscularly, intravenously, intratumorally or intraperitoneally.
  • an effective amount of the active STING mutant, vector(s), vaccines or viral particles is administered.
  • An "effective amount” is an amount sufficient to achieve a desired biological effect such as to induce enough humoral or cellular immunity. This may be dependent upon the type of vaccine, the age, sex, health, and weight of the recipient. Examples of desired biological effects include, but are not limited to, increase in immune response, increase in STING stimulation, decrease in tumor size or tumor burden, production of no symptoms or reduction in symptoms related to disease or condition being treated.
  • a vaccine or composition of the present invention is physiologically significant if its presence results in a detectable change in the physiology of a recipient patient that enhances at least one primary or secondary humoral or cellular immune response against a tumor or other targeted cell or microbe.
  • the active STING mutant increases infiltration of immune cells into the tumor or site of infection.
  • the immune cells are macrophages, dendritic cells or other phaogcytes.
  • the composition can also contain minor amounts of wetting or emulsifying agents or pH buffering agents.
  • the composition can be a liquid solution, suspension, emulsion, tablet, pill, capsule, sustained release formulation, or powder.
  • Oral formulation can include standard carriers such as pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate, etc.
  • the ingredients are supplied either separately or mixed together in unit dosage form, for example, as a dry lyophilized powder or water free concentrate in a hermetically sealed container such as an ampoule or sachet indicating the quantity of active agent.
  • a hermetically sealed container such as an ampoule or sachet indicating the quantity of active agent.
  • an ampoule of sterile diluent can be provided so that the ingredients may be mixed prior to administration.
  • compositions of the present disclosure containing the inhibitors described herein as an active ingredient may contain pharmaceutically acceptable carriers or additives depending on the route of administration.
  • carriers or additives include water, a pharmaceutical acceptable organic solvent, collagen, polyvinyl alcohol, polyvinylpyrrolidone, a carboxyvinyl polymer, carboxymethylcellulose sodium, polyacrylic sodium, sodium alginate, water-soluble dextran, carboxymethyl starch sodium, pectin, methyl cellulose, ethyl cellulose, xanthan gum, gum Arabic, casein, gelatin, agar, diglycerin, glycerin, propylene glycol, polyethylene glycol, Vaseline, paraffin, stearyl alcohol, stearic acid, human serum albumin (HSA), mannitol, sorbitol, lactose, a pharmaceutically acceptable surfactant and the like.
  • Additives used are chosen from, but not limited to, the above or combinations thereof, as appropriate, depending on the dosage
  • Formulation of the pharmaceutical composition will vary according to the route of administration selected (e.g., solution, emulsion).
  • An appropriate composition comprising the inhibitor, e.g., an antibody, to be administered can be prepared in a physiologically acceptable vehicle or carrier.
  • suitable carriers include, for example, aqueous or alcoholic/aqueous solutions, emulsions or suspensions, including saline and buffered media.
  • Parenteral vehicles can include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's or fixed oils.
  • Intravenous vehicles can include various additives, preservatives, or fluid, nutrient or electrolyte replenishers.
  • aqueous carriers e.g., sterile phosphate buffered saline solutions, bacteriostatic water, water, buffered water, 0.4% saline, 0.3% glycine, and the like, and may include other proteins for enhanced stability, such as albumin, lipoprotein, globulin, etc., subjected to mild chemical modifications or the like.
  • Therapeutic formulations of the inhibitors are prepared for storage by mixing the inhibitor having the desired degree of purity with optional physiologically acceptable carriers, excipients or stabilizers (Remington's Pharmaceutical Sciences 16th edition, Osol, A. Ed.
  • Acceptable carriers, excipients, or stabilizers are nontoxic to recipients at the dosages and concentrations employed, and include buffers such as phosphate, citrate, and other organic acids; antioxidants including ascorbic acid and methionine; preservatives (such as octadecyldimethylbenzyl ammonium chloride; hexamethonium chloride; benzalkonium chloride, benzethonium chloride; phenol, butyl or benzyl alcohol; alkyl parabens such as methyl or propyl paraben; catechol; resorcinol;
  • polypeptides such as serum albumin, gelatin, or immunoglobulins
  • hydrophilic polymers such as polyvinylpyrrolidone
  • amino acids such as glycine, glutamine, asparagine, histidine, arginine, or lysine
  • chelating agents such as EDTA
  • sugars such as sucrose, mannitol, trehalose or sorbitol
  • salt-forming counter-ions such as sodium
  • metal complexes e.g., Zn-protein complexes
  • non-ionic surfactants such as TWEENTM, PLURONICSTM or polyethylene glycol (PEG).
  • the formulation herein may also contain more than one active compound as necessary for the particular indication being treated, preferably those with complementary activities that do not adversely affect each other.
  • Such molecules are suitably present in combination in amounts that are effective for the purpose intended.
  • the active ingredients may also be entrapped in microcapsule prepared, for example, by coacervation techniques or by interfacial polymerization, for example,
  • hydroxymethylcellulose or gelatin-microcapsule and poly-(methylmethacylate) microcapsule respectively, in colloidal drug delivery systems (for example, liposomes, albumin microspheres, microemulsions, nano-particles and nanocapsules) or in macroemulsions.
  • colloidal drug delivery systems for example, liposomes, albumin microspheres, microemulsions, nano-particles and nanocapsules
  • macroemulsions for example, liposomes, albumin microspheres, microemulsions, nano-particles and nanocapsules
  • formulations to be used for in vivo administration must be sterile. This is readily accomplished by filtration through sterile filtration membranes.
  • the dose of vector, vaccine or viral particle to be employed in the formulation will also depend on the route of administration, and the nature of the patient, and should be decided according to the judgment of the practitioner and each patient's circumstances according to standard clinical techniques.
  • the exact amount of vector or virus utilized in a given preparation is not critical provided that the minimum amount of virus necessary to produce immunologic activity is given.
  • Effective doses of the vector or viral particle of the disclosure may also be extrapolated from dose-response curves derived from animal model test systems.
  • administration is performed at the site of a cancer or affected tissue needing treatment by direct injection into the site or via a sustained delivery or sustained release mechanism, which can deliver the formulation internally.
  • a sustained delivery or sustained release mechanism which can deliver the formulation internally.
  • biodegradable microspheres or capsules or other biodegradable polymer configurations capable of sustained delivery of a composition e.g., a soluble polypeptide, antibody, or small molecule
  • a composition e.g., a soluble polypeptide, antibody, or small molecule
  • Therapeutic compositions may also be delivered to the patient at multiple sites.
  • the multiple administrations may be rendered simultaneously or may be administered over a period of time. In certain cases it is beneficial to provide a continuous flow of the therapeutic composition.
  • Additional therapy may be administered on a period basis, for example, hourly, daily, every other day, twice weekly, three times weekly, weekly, every 2 weeks, every 3 weeks, monthly, or at a longer interval.
  • the AMPK inhibitor may also be administered in the methods of the disclosure in a manner described above. Additionally, the AMPK compositions may be formulated as described above.
  • a vector or vaccine of the present disclosure or composition thereof is administered with a second agent useful for treating a condition or disorder for which active STING mutant therapy is used, e.g., cancer, infection or autoimmune disease.
  • a second agent useful for treating a condition or disorder for which active STING mutant therapy is used e.g., cancer, infection or autoimmune disease.
  • AMPK inhibitor a second agent useful for treating a condition or disorder as described herein.
  • Concurrent administration of two therapeutic agents does not require that the agents be administered at the same time or by the same route, as long as there is an overlap in the time period during which the agents are exerting their therapeutic effect. Simultaneous or sequential administration is contemplated, as is administration on different days or weeks.
  • the second agent may be other therapeutic agents, such as cytokines, growth factors, other inhibitors and antibodies to target antigens useful for treating cancer or immunological disorders, for example ipilimumab (YERVOY ® , Bristol-Myers Squibb Company), an antibody to CTLA-4; bevacizumab (AVASTIN®, Genentech), an antibody to VEGF-A; erlotinib
  • TARCEVA® Genentech and OSI Pharmaceuticals
  • a tyrosine kinase inhibitor which acts on EGFR dasatinib (SPRYCEL®, Bristol-Myers Squibb Company), an oral Bcr-AbI tyrosone kinase inhibitor; IL-21 ; pegylated IFN-a2b; axitinib (INLYTA®, Pfizer, Inc.), a tyrosine kinase inhibitor; and trametinib (MEKINIST®, GlaxoSmith line), a MEK inhibitor (Philips and Atkins, Int
  • the active STING mutant of the present disclosure, or AMPK inhibitor, and second agent may be given simultaneously, in the same formulation. It is further contemplated that the active STING mutant, or AMPK inhibitor, and second agent are administered in a separate formulation and administered concurrently, with concurrently referring to agents given within 30 minutes of each other. It is further contemplated that the third agent may be given simultaneously with the inhibitors.
  • a active STING mutant, or AMPK inhibitor is administered prior to administration of the second agent.
  • Prior administration refers to administration of an active STING mutant, or AMPK inhibitor, within the range of one week prior to treatment with the second agent, up to 30 minutes before administration of the second agent. It is further contemplated that an active STING mutant, or AMPK inhibitor, is administered subsequent to administration a second agent. Subsequent administration is meant to describe administration from 30 minutes after active STING mutant, or AMPK inhibitor, treatment up to one week after active STING mutant, or AMPK inhibitor, administration.
  • adjunct therapies may be administered, where appropriate.
  • the patient may also be administered surgical therapy,
  • the active STING mutant, or AMPK inhibitor, composition herein are administered in combination with a second agent, such as for example, wherein the second agent is a cytokine or growth factor, or a chemotherapeutic agent, the administration also includes use of a radiotherapeutic agent or radiation therapy.
  • a radiotherapeutic agent or radiation therapy is administered as determined by the treating physician, and at doses typically given to patients being treated for cancer.
  • a cytotoxic agent refers to a substance that inhibits or prevents the function of cells and/or causes destruction of cells.
  • the term is intended to include radioactive isotopes (e.g.,
  • a non- cytotoxic agent refers to a substance that does not inhibit or prevent the function of cells and/or does not cause destruction of cells.
  • a non-cytotoxic agent may include an agent that can be activated to be cytotoxic.
  • a non-cytotoxic agent may include a bead, liposome, matrix or particle (see, e.g., U.S. Patent Publications 2003/0028071 and 2003/0032995 which are incorporated by reference herein). Such agents may be conjugated, coupled, linked or associated with an antibody according to the disclosure.
  • Chemotherapeutic agents contemplated for use with the antibodies of the present disclosure include, but are not limited to those listed in Table I:
  • VLB chlorambucil vinblastine
  • TEM thriethylenemelamine
  • Triazines splicamycin mithramycin
  • Type 1 Topoisomerase Inhibitors Anthracenedione
  • Hormones and antagonists ainoglutethimide
  • dexamethasone interferon ( ⁇ , ⁇ , ⁇ )
  • kits which comprise one or more compounds or compositions packaged in a manner which facilitates their use to practice methods of the disclosure.
  • a kit includes a compound or composition described herein (e.g., a composition comprising a target-specific antibody alone or in combination with another antibody or a third agent), packaged in a container such as a sealed bottle or vessel, with a label affixed to the container or included in the package that describes use of the compound or composition in practicing the method.
  • the compound or composition is packaged in a unit dosage form.
  • the kit may further include a device suitable for administering the composition according to a specific route of administration or for practicing a screening assay.
  • the kit contains a label that describes use of the inhibitor compositions.
  • Cells, Reagents, and Viruses Primary Sting +I+ and Sting '1' MEF cells, HEK293T cells, and Platinum-E retroviral packaging cells were prepared as previously described. Primary MEF cells, HEK293T cells, and Platinum-E cells were cultured in DMEM (Gibco) supplemented with 10% FBS and antibiotics. dsDNA (ISD 90-mer) was prepared as previously described. Biotin-labeled cGAMP were purchased from Biolog. Poly l:C was obtained from American Biosciences. BFA, compound C, and tofacitinib were purchased from SIGMA. Doxorubicin and GSK 690693 were purchased from Santa Cruz Biotechnology. Lipofectamine 2000 was purchased from Invitrogen. Anti-STING rabbit polyclonal antibody was prepared as previously described. Other antibodies used in this paper were as follows: ⁇ -actin (SIGMA, A5441);
  • calreticulin (Abeam, ab14234); phospho-IRF3 (Cell Signaling, 4947); IRF3 (Cell signaling, 4302); phospho-p65 (Cell Signaling, 3031 ); p65 (Cell Signaling, 3987); phospho-TBK1 (Cell Signaling, 5483); TBK1 (Abeam, ab40676); phospho-AMPK (T172) (Cell Signaling, 2535);
  • AMPK Cell Signaling, 5832
  • phospho-STAT1 Cell Signaling, 9167
  • HA SIGMA, H9658
  • FLAG SIGMA, F1804
  • IPS-1 Bethyl, A300-783A
  • anti-GM130 BD bioscience, 558712, Alexa Fluor 647-conjugated
  • HSV-1 KOS strain
  • VSV was prepared as previously described.
  • TaqMan probe for Infb, Cc/5, Ifitl, Statl, Oasl1, Rsad2, and Gapdh were purchased from Applied Biosystems.
  • ELISA kit for IFN and CXCL10/IL-6 were purchased from PBL Interferon Source and R&D systems, respectively.
  • Plasmids and Mutagenesis Reporter plasmids and thymidine kinase (TK)-luc were obtained as previously described.
  • pcDNA-hSTING, pBabe-hSTING, pBabe-mSTING, and pcDNA-IPS-1 were made as previously described.
  • pCMV-hcGAS was purchased from OriGene. To make STING mutants, QuickChange II XL site directed mutagenesis kit (Stratagene) was used with the following primers;
  • hSTING_N154S-F GAAAAAGGGAATTTCAGCGTGGCCCATGGGCTG (SEQ ID NO:2)
  • hSTING_N154S-R CAGCCCATGGGCCACGCTGAAATTCCC I I I I I C (SEQ ID NO:3)
  • hSTING_R284S-F TTTAGCCGGGAGGATTCTCTTGAGCAGGCCAAA (SEQ ID NO:4)
  • hSTING_R284S-R TTTGGCCTGCTCAAGAGAATCCTCCCGGCTAAA (SEQ ID NO:5)
  • mSTING_N153S-F GAAGAAAAGAAGTTATCTGTTGCCCACGGGCTG (SEQ ID NO:6)
  • mSTING_N153S-R CAGCCCGTGGGCAACAGATAACTTCTTTTCTTC (SEQ ID N0.7 )
  • mSTING_R283S-F TTCAGTCGGGAGGATTCCCTTGAGCAGGCTAAA (SEQ ID NO:8)
  • mSTING_R283S-R TTTAGCCTGCTCAAGGGAATCCTCCCGACTGAA. (SEQ ID NO:9)
  • the PCR condition is as follows; 95 °C for 5 min, 40 cycles of 94 °C for 30 sec/62 °C for 1 min/72 °C for 1 min, 72 °C for 10 min.
  • Luciferase Reporter Assay HEK293T cells were transfected with pcDNA3-hSTING or mutants and reporter plasmids (IFNp-luc, NF-KB-IUC, pRD lll-l-luc, ISRE-luc) using lipofectamine 2000. TK-luc was used for transfection control.
  • luciferase activity was measured using luciferase assay substrate (Promega) for firefly luciferase activity (reporter plasmids) and renilla luciferase assay system (Promega) for renilla luciferase activity (TK-luc).
  • cGAMP-binding Assay HEK293T cells were transfected with the indicated plasmids for 24 h. The cells were lysed by TNE buffer (50 mM Tris-HCI (pH 7.5), 150 mM NaCI, 1 mM EDTA, 1 % NP-40) with protease and phosphatase inhibitors. The cell lysates were incubated with biotin-labeled cGAMP (Biolog) for 30 min at 4 °C and then irradiated with UV for 10 min at 1 J/cm 2 for crosslinking. Streptavidin-conjugated beads (Thermo) were added to the lysates. After incubation for 2 h at 4 "C, the precipitants were washed with TNE buffer five times and then boiled in SDS-sample buffer to elute the binding proteins.
  • TNE buffer 50 mM Tris-HCI (pH 7.5), 150 mM NaCI, 1 m
  • HEK293T cells were transfected with the indicated plasmids for 24 h and then lysed with TNE buffer with protease and phosphatase inhibitors. The cell lysates were incubated with anti-FLAG antibody overnight at 4 "C and then protein G beads (Thermo) was added to the lysates. After incubation for 1 h at 4 °C, the precipitants were washed with TNE buffer five times and then boiled in SDS-sample buffer to elute the
  • the coverslips were incubated with Alexa Fluor 488-goat anti-rabbit IgG and Alexa Fluor-647 goat anti-chicken IgG (Invitrogen) for 1 h at RT in wet chamber. After washing three times with PBS, the coverslips were mounted onto the glass slides with ProLong Gold antifade reagent (Invitrogen). The coverslips were observed using Leica confocal microscope SP5.
  • RNA from the reconstituted MEF cells was purified using RNeasy RNA extraction kit (QIAGEN).
  • GeneChip Mouse Gene 2.0 ST Array (Affymetrix) was used to observe the gene expression. The data collection and analysis were performed at the Center for Genome Technology (CGT), John P. Hussman, Institute for Human Genomics, University of Miami Miller School of Medicine.
  • Realtime PCR was performed with the indicated TaqMan probes (Applied Biosystems) using LightCycler 2.0 (Roche) or StepOnePlus realtime PCR system (Applied Biosystems). Gapdh was used for normalization.
  • STING R284S is constitutively active.
  • the cDNA was cloned and transiently co-transfected HEK293T cells with the variant and a luciferase gene under control of the type I IFN promoter(ref, ishikawa/barber).
  • expression of wild type STING activates the type I IFN promoter, by stimulating IRF3 and NF- ⁇ signaling, to generate luciferase.
  • N154S known STING (N154S) variant that was reported to be
  • STING R284S cannot be retained in the ER.
  • primary Sting '1' mouse embryonic fibroblast (MEF) cells were reconstituted with wild-type STING, STING N154S (SAVI), or STING R284S (Ecuador) using retrovirus delivery. It had been previously reported that SAVI variants leak out from the ER to likely trigger innate immune signaling 22 . Therefore the localization of STING (R284S) in the cell was examined by confocal microscopy. The data indicated that wild type STING could only traffic in the presence of transfected cytosolic dsDNA (Figure 2A).
  • STING retains its ability to bind to TBK1.
  • the constitutive trafficking of R284S could be blocked by brefeldin A (BFA) confirming that this variant traffics from the ER through the golgi apparatus 9 ( Figure 1 B).
  • STING N154S or R284S The observed high level of constitutive IL6 production was reminiscent of the situation observed in the Ecuador patient.
  • the observed elevated levels of host defense related proteins being produced by cells expressing STING N154S or R284S may be expected to contribute towards resistance to viral infection.
  • the reconstituted MEF's were infected with herpes simplex virus-1 (HSV-1 ; DNA virus) or vesicular stomatitis virus (VSV; RNA virus) and indeed noted that cells expressing the STING variants were more resistant to viral replication (Figure 2F).
  • STING leads to the potent induction of type I IFN and pro inflammatory genes in response to
  • ULK1 regulators are potential therapeutic drugs for STING-induced inflammatory diseases.
  • Three putative regulators of AMPK were examined, Compound C, Doxorubicin (an anthracycline) and GSK690693 (an AKT/AMPK inhibitor) 26'28 . It was hypothesized that suppression of AMPK may release ULK1 to phosphorylate STING, an event that can prevent STING-dependent IRF3 activation 25 . Complete blocking of IRF3 activity may conceivably prevent the stimulation of interferon and subsequently ISG's 8 .
  • experiments to evaluate use of the JAK inhibitor Tofacitinib which is efficacious in rodent models, as well as the golgi trafficking blocker BFA were conducted.
  • Tofacitinib and IRF3 phosphorylation in the presence and absence of cytosolic dsDNA activator was measured by immunoblot. This analysis confirmed that GSK 690693, but not tofacitinib, could inhibit dsDNA triggered, STING-dependent IRF3 phosphorylation ( Figure 4D). It was further observed that GSK 690693 could suppress ULK1 phosphorylation, suggesting a role for this kinase in controlling IRF3 activity 25 . The examination of hTERT cells confirmed that GSK 690693 could suppress the production of type I IFN production as well as other proinflammatory genes. Thus, GSK 690693 may be useful either alone, or in conjunction with other accepted drugs such as Tofacitinib, as a treatment for 'interferonopathies' mediated by chronic STING signaling 4 .
  • tofacitinib failed to effectively inhibit CXCL10 production and Ifitl induction in the reconstituted Sting-/- MEF cells expressing N154S or R284S ( Figure 4A, B). It was confirmed that tofacitinib inhibits STAT1 but not IRF3 by western blots ( Figure 4C). It should be noted that expression of wild-type STING also promoted STAT1 phosphorylation, which may be consistent with the results that inflammatory genes were induced in cells expressing wild-type STING ( Figure 2C, 2D, 3C, 4A, 4B).
  • BFA is known to inhibit protein transport of secretory and membrane proteins between the ER and the Golgi apparatus. Therefore, BFA treatment for patients may cause strong side effects. Instead, it is useful to discover STING-specific inhibitors.
  • STING-specific inhibitors For this purpose, AMPK inhibitors were considered because it was previously shown that compound C (also known as dorsomorphin) is an ATP competitive inhibitor for AMPKa subunit suppresses STING- dependent inflammation. Consistently, Prantner et al. showed that inflammatory responses to STING agonists in ⁇ 1/ ⁇ 2 deficient cells are dramatically suppressed. Thus, AMPK inhibitors were evaluated to target STING-dependent inflammation.
  • doxorubicin and GSK 690693 were selected because doxorubicin has been clinically used for cancer treatment and GSK 690693 was initially planned for clinical trial use.
  • Doxorubicin is a DNA intercalator used to prevent DNA replication but a report showed that AMPKa kinase activity can be inhibited by doxorubicin.
  • GSK 690693 was originally developed for the inhibition of protein kinase B (AKT) but was shown to inhibit AMPKa in vitro. The microarray data showed that compound C and GSK 690693 suppressed the expression of many inflammatory genes in the reconstituted cells expressing R284S ( Figure 4D).
  • doxorubicin treatment enhanced the expression of some inflammatory genes (Figure 4D). This may be because doxorubicin is known to cause DNA damage response that activates STING pathway. Tofacitinib could also suppress the inflammatory gene expression ( Figure 4D).
  • AMPK inhibitors may be potential therapeutic drugs for STING- induced inflammatory diseases and useful for treatment of STING-induced inflammatory diseases, or inflammatory diseases in which STING signaling is aberrant.
  • the AMPK inhibitors cou!d optionally be used in combination with JAK inhibitors that target IFN signaling.
  • Burdette, D. L. et al. STING is a direct innate immune sensor of cyclic di-GMP. Nature 478, 515-518, (2011).
  • Cyclic GMP-AMP is an endogenous second messenger in innate immune signaling by cytosolic DNA. Science 339, 826-830, (2013).

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Epidemiology (AREA)
  • Immunology (AREA)
  • Organic Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Engineering & Computer Science (AREA)
  • Toxicology (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Microbiology (AREA)
  • Mycology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

La présente invention concerne, de manière générale, l'inhibition de l'activité de signalisation de STING (stimulateur des gènes d'interféron) chez un sujet présentant une réponse immunitaire en cours et l'utilisation de mutants de STING constitutivement actifs pour stimuler une réponse immunitaire chez un patient.
PCT/US2018/000169 2017-08-15 2018-08-15 Compositions et méthodes pour la modulation de la protéine sting WO2019035901A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201762545626P 2017-08-15 2017-08-15
US62/545,626 2017-08-15

Publications (2)

Publication Number Publication Date
WO2019035901A1 true WO2019035901A1 (fr) 2019-02-21
WO2019035901A9 WO2019035901A9 (fr) 2019-04-25

Family

ID=65362605

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2018/000169 WO2019035901A1 (fr) 2017-08-15 2018-08-15 Compositions et méthodes pour la modulation de la protéine sting

Country Status (1)

Country Link
WO (1) WO2019035901A1 (fr)

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110714007A (zh) * 2019-10-08 2020-01-21 江苏省人民医院（南京医科大学第一附属医院） 人sting基因启动子抑制调控区域及其应用
WO2020023361A1 (fr) * 2018-07-23 2020-01-30 H. Lee Moffitt Cancer Center And Research Institute Inc. Renforcement de la réponse anti-tumorale dans des cellules de mélanome présentant une signalisation sting défectueuse
WO2021077018A1 (fr) * 2019-10-16 2021-04-22 Dana-Farber Cancer Institute, Inc. Compositions et procédés pour moduler les voies de signalisation du système immunitaire inné
WO2021097144A3 (fr) * 2019-11-12 2021-06-17 Actym Therapeutics, Inc. Plateformes d'administration de bactéries immunostimulatrices et leur utilisation pour l'administration de produits thérapeutiques
WO2022270946A1 (fr) * 2021-06-23 2022-12-29 한국생명공학연구원 Vecteur recombinant pour améliorer l'expression d'une protéine d'intérêt par suppression de la réponse immunitaire intracellulaire et application associée
US11638716B2 (en) 2017-08-31 2023-05-02 F-star Therapeutics, Inc. Compounds, compositions, and methods for the treatment of disease
US12024709B2 (en) 2020-03-19 2024-07-02 Actym Therapeutics, Inc. Immunostimulatory bacteria engineered to colonize tumors, tumor-resident immune cells, and the tumor microenvironment

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20130039933A1 (en) * 2008-08-04 2013-02-14 University Of Miami Sting (stimulator of interferon genes), a regulator of innate immune responses
US20160067334A1 (en) * 2013-03-15 2016-03-10 David Weiner Vaccines With Biomolecular Adjuvants
US20170146519A1 (en) * 2015-11-20 2017-05-25 Oregon Health & Science University Sting agonists and methods of selecting sting agonists
WO2018081459A9 (fr) * 2016-10-26 2018-11-22 Modernatx, Inc. Acides ribonucléiques messagers pour l'amélioration de réponses immunitaires et leurs méthodes d'utilisation

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20130039933A1 (en) * 2008-08-04 2013-02-14 University Of Miami Sting (stimulator of interferon genes), a regulator of innate immune responses
US20160067334A1 (en) * 2013-03-15 2016-03-10 David Weiner Vaccines With Biomolecular Adjuvants
US20170146519A1 (en) * 2015-11-20 2017-05-25 Oregon Health & Science University Sting agonists and methods of selecting sting agonists
WO2018081459A9 (fr) * 2016-10-26 2018-11-22 Modernatx, Inc. Acides ribonucléiques messagers pour l'amélioration de réponses immunitaires et leurs méthodes d'utilisation

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
KONNO, H ET AL.: "Pro-inflammation Associated with a Gain-of-Function Mutation (R284S) in the Innate Immune Sensor STING", CELL, vol. 23, no. 4, 24 April 2018 (2018-04-24), pages 1112 - 1123, XP055598035, DOI: 10.1016/j.celrep.2018.03.115 *
LIU, Y ET AL.: "Activated STING in a Vascular and Pulmonary Syndrome", NEW ENGLAND JOURNAL OF MEDICINE, vol. 371, no. 6, 7 August 2014 (2014-08-07), pages 507 - 518, XP055598018, DOI: 10.1056/NEJMoa131262 *
MUKAI, K ET AL.: "Activation of STING requires palmitoylation at the Golgi", NATURE, vol. 7, no. 11932, 21 June 2016 (2016-06-21), pages 1 - 10, XP055598001, DOI: 10.1038/ncomms11932 *
WEISS, JULIA M. ET AL.: "The STING agonist DMXAA triggers a cooperation between T lymphocytes and myeloid cells that leads to tumor regression", ONCOIMMUNOLOGY, vol. 6, no. 10, 7 July 2017 (2017-07-07), pages e1346765-2 - e1346765-11, XP055598032, DOI: 10.1080/2162402X.2017.1346765 *

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11638716B2 (en) 2017-08-31 2023-05-02 F-star Therapeutics, Inc. Compounds, compositions, and methods for the treatment of disease
WO2020023361A1 (fr) * 2018-07-23 2020-01-30 H. Lee Moffitt Cancer Center And Research Institute Inc. Renforcement de la réponse anti-tumorale dans des cellules de mélanome présentant une signalisation sting défectueuse
CN110714007A (zh) * 2019-10-08 2020-01-21 江苏省人民医院（南京医科大学第一附属医院） 人sting基因启动子抑制调控区域及其应用
CN110714007B (zh) * 2019-10-08 2023-11-03 江苏省人民医院（南京医科大学第一附属医院） 人sting基因启动子抑制调控区域及其应用
WO2021077018A1 (fr) * 2019-10-16 2021-04-22 Dana-Farber Cancer Institute, Inc. Compositions et procédés pour moduler les voies de signalisation du système immunitaire inné
WO2021097144A3 (fr) * 2019-11-12 2021-06-17 Actym Therapeutics, Inc. Plateformes d'administration de bactéries immunostimulatrices et leur utilisation pour l'administration de produits thérapeutiques
US12024709B2 (en) 2020-03-19 2024-07-02 Actym Therapeutics, Inc. Immunostimulatory bacteria engineered to colonize tumors, tumor-resident immune cells, and the tumor microenvironment
WO2022270946A1 (fr) * 2021-06-23 2022-12-29 한국생명공학연구원 Vecteur recombinant pour améliorer l'expression d'une protéine d'intérêt par suppression de la réponse immunitaire intracellulaire et application associée

Also Published As

Publication number Publication date
WO2019035901A9 (fr) 2019-04-25

Similar Documents

Publication Publication Date Title
WO2019035901A1 (fr) Compositions et méthodes pour la modulation de la protéine sting
RU2768829C2 (ru) Противораковые рнк-вакцины
JP7223055B2 (ja) 癌治療のための併用免疫療法及びサイトカイン制御療法
US9381228B2 (en) FKBP-L and uses thereof
BR112020026386A2 (pt) Composições e métodos para modulação de fenótipos inflamatórios com monócitos e macrófagos e usos de imunoterapia dos mesmos
US20190314429A1 (en) Cancer Treatment and Diagnosis
WO2019189780A1 (fr) Composition pharmaceutique pour le traitement et/ou la prévention du cancer
US20230075314A1 (en) VECTORIZED ANTIBODIES (vAb) AND USES THEREOF
US20230242913A1 (en) Sting-dependent activators for treatment of disease
CN109069601B (zh) 使用与检查点抑制剂组合的溶瘤病毒的癌症疗法
JP2020524149A (ja) Ａｐｒｉｌ−ｔａｃｉ間相互作用のモジュレーターを用いた制御性ｔ細胞、制御性ｂ細胞、及び免疫応答の調節方法
KR20170063722A (ko) 선천적 면역 반응의 종양 유도된 면역억제를 차단하기 위한 방법으로서의 아넥신 v의 사용
EP3986426A1 (fr) Ciblage de l'intégrine alpha3bêta1 pour le traitement du cancer et d'autres maladies
US20210017541A1 (en) Recombinant viral vector and uses thereof
US20220175763A1 (en) Compositions and methods for enhancing cancer immune checkpoint therapy
JP2024514707A (ja) 免疫療法における使用のための組成物及び方法
TWI666321B (zh) 用於癌症治療的溶瘤性單純皰疹病毒（ｏＨＳＶ）專性載體及其建構體的建構
EP3515435A1 (fr) Petites molécules de protection de wasp, compositions, procédés et utilisations de celles-ci dans le traitement de troubles ou d'états liés à l'immunité innée et acquise
WO2023081663A1 (fr) Procédés de traitement du cancer du poumon et d'autres cancers par le spicule s1 de sras-cov-2 recombinant
WO2015069745A2 (fr) Induction d'une forte réponse lymphocytaire t cd8 sous l'effet de tumeurs exprimant le fragment fc de l'igg1
WO2023235767A2 (fr) Développement d'un nouvel anticorps thérapeutique cd99 pour traiter des tumeurs solides agressives chez des enfants
JP2016023182A (ja) がんを処置するための医薬
NZ793715A (en) RNA cancer vaccines
EP3102221A1 (fr) Domaine d'oligomérisation de p53 servant à contourner l'effet dominant négatif d'un mutant

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18846208

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 18846208

Country of ref document: EP

Kind code of ref document: A1