WO2019035901A1 - Compositions and methods for modulating sting protein - Google Patents
Compositions and methods for modulating sting protein Download PDFInfo
- Publication number
- WO2019035901A1 WO2019035901A1 PCT/US2018/000169 US2018000169W WO2019035901A1 WO 2019035901 A1 WO2019035901 A1 WO 2019035901A1 US 2018000169 W US2018000169 W US 2018000169W WO 2019035901 A1 WO2019035901 A1 WO 2019035901A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- sting
- mutation
- composition
- vaccine
- variant
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/335—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
- A61K31/34—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having five-membered rings with one oxygen as the only ring hetero atom, e.g. isosorbide
- A61K31/341—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having five-membered rings with one oxygen as the only ring hetero atom, e.g. isosorbide not condensed with another ring, e.g. ranitidine, furosemide, bufetolol, muscarine
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
- A61K31/44—Non condensed pyridines; Hydrogenated derivatives thereof
- A61K31/445—Non condensed piperidines, e.g. piperocaine
- A61K31/4523—Non condensed piperidines, e.g. piperocaine containing further heterocyclic ring systems
- A61K31/4545—Non condensed piperidines, e.g. piperocaine containing further heterocyclic ring systems containing a six-membered ring with nitrogen as a ring hetero atom, e.g. pipamperone, anabasine
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
- A61K31/505—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
- A61K31/519—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with heterocyclic rings
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7028—Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages
- A61K31/7034—Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages attached to a carbocyclic compound, e.g. phloridzin
- A61K31/704—Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages attached to a carbocyclic compound, e.g. phloridzin attached to a condensed carbocyclic ring system, e.g. sennosides, thiocolchicosides, escin, daunorubicin
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/39—Medicinal preparations containing antigens or antibodies characterised by the immunostimulating additives, e.g. chemical adjuvants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
- A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
- A61P37/04—Immunostimulants
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
- C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
- C07K14/4702—Regulators; Modulating activity
- C07K14/4705—Regulators; Modulating activity stimulating, promoting or activating activity
Definitions
- the present disclosure relates, in general, to modulating signaling activity of STING (STimulator of INterferon Genes) in a subject having an ongoing immune response.
- STING STimulator of INterferon Genes
- the disclosure describes use of constitutively active variants of STING as therapy to stimulate STING activity and increase activity of immune cells.
- inhibitors of AMPK to increase STING activity in a subject in need thereof.
- the cellular sensor STING resides in the endoplasmic reticulum (ER) and is activated by cyclic dinucleotides (CDN's) such as c-GMP and c-AMP secreted by intracellular bacteria after infection 5 .
- CDN's cyclic dinucleotides
- STING can be activated by cGAMP generated by a cellular synthase cGAS (MB21 D1 ) following the latter's association with aberrant cytosolic dsDNA species, which can include microbial DNA, self-DNA leaked from the nucleus or even mitochondria DNA 6,7
- a conformational change causes STING to traffic through the golgi, with tank binding kinase 1 (TBK1) to activate the transcription factors IRF3 and NF- ⁇ which stimulate the production of type I interferon (IFN) and pro-inflammatory cytokines which facilitate adaptive immunity 8,9 .
- TNK1 tank binding kinase 1
- IFN type I interferon
- pro-inflammatory cytokines which facilitate adaptive immunity 8,9 .
- chronic activation of STING signaling has been shown to be cause lethal inflammatory disease.
- loss of function mutation in the DNase TREX1 has been found to cause severe SLE referred to as Aicardi-Goutieres Syndrome (AGS) in human patients 1 .
- Aicardi-Goutieres Syndrome Aicardi-Goutieres Syndrome
- loss of DNasell causes lethal pre-natal inflammatory disease in mice through comparable STING-dependent pathways 11 .
- Inflammatory disease caused by STING overactivity has also been shown to occur in patients with mutations in the ADAR and Ribonuclease H2 enzyme complex 12,13 .
- STING germ-line missense mutations in the coding region of the STING gene itself (V147L/M, N154S, V155M, C206Y, R281Q, R284G, and S102P/F279L), which exert a gain-of-function phenotype referred to as SAVI (STING-associated vasculopathy with onset in infancy) 14"19 .
- SAVI STING-associated vasculopathy with onset in infancy
- the present disclosure shows that gain of function mutants of the human STING protein may be useful to stimulate an immune response and may be useful as vaccines to treat indications in which an immune response is needed.
- the disclosure also shows that certain kinase inhibitors suppress STING-dependent IRF3 activation may be useful for the treatment of a wide-range of autoinflammatory disorders.
- the disclosure provides a vector comprising a variant of a human STimulator of INterferon Genes (STING) polynucleotide encoding a STING protein having a mutation that makes the STING protein constitutively active.
- the mutation is at residue 154 or 284 of the STING protein of SEQ ID NO: 1.
- the mutation is N154S or R284S of SEQ ID NO: 1.
- a composition comprising the vector described herein.
- the disclosure also contemplates a vaccine comprising a variant of a human
- STimulator of INterferon Genes polynucleotide encoding a STING protein having a mutation that makes the STING protein constitutively active, wherein the variant induces STING signaling.
- the mutation is at residue 154 or 284 of the STING protein of SEQ ID NO: 1.
- the mutation is N154S or R284S of SEQ ID NO: 1.
- the polynucleotide is in a vector.
- vector is a viral vector or a plasmid vector.
- the viral vector is selected from the group consisting of vesicular stomatitis virus (VSV), a lentivirus, an adenovirus, an adeno-associated virus, a vaccinia virus and a modified vaccinia Ankara (MVA) virus.
- VSV vesicular stomatitis virus
- a lentivirus lentivirus
- an adenovirus adeno-associated virus
- vaccinia virus a modified vaccinia Ankara
- MVA modified vaccinia Ankara
- composition comprising the vaccine described herein.
- the disclosure provides a method of activating STimulator of INterferon Genes (STING) in a subject in need thereof comprising administering a composition comprising a variant of a human STING protein having a mutation that makes the STING protein constitutively active, wherein the composition induces STING signaling.
- STING STimulator of INterferon Genes
- a method of stimulating an immune response in a subject in need thereof comprising administering a composition comprising a STING variant having a mutation that makes the STING protein constitutively active, wherein the composition induces STING signaling.
- the subject is suffering from cancer or a microbial infection.
- the disclosure contemplates a method of decreasing the size of a tumor in a subject comprising administering a composition a STimulator of INterferon Genes (STING) variant having a mutation that makes the STING protein constitutively active, wherein the composition induces STING signaling.
- the disclosure provides a method of treating cancer in a subject comprising administering a composition comprising an activator of STING (STimulator of INterferon Genes) comprising a STING variant having a mutation that makes the STING protein constitutively active, wherein the composition induces STING signaling.
- the cancer is ovarian cancer, colon cancer, melanoma, breast cancer or lung cancer.
- the tumor size in the subject is decreased by about 25-50%, about 40-70% or about 50-90% or more.
- the composition is administered intratumorally, intravenously, intra-arterially, intraperitoneally, intranasally, intramuscularly, intradermally or subcutaneously.
- the composition induces infiltration of immune cells into the tumor.
- the immune cells are macrophages or other phagocytes.
- the composition administered is a vector or a vaccine described herein.
- the disclosure contemplates a method of inhibiting STING signaling in a subject in need thereof comprising administering to the subject a therapeutically effective amount of an inhibitor of 5' adenosine monophosphate-activated protein kinase (AMPK).
- AMPK 5' adenosine monophosphate-activated protein kinase
- Also contemplated is a method of treating an inflammatory disease in which STING signaling is upregulated comprising administering to a subject in need thereof a therapeutically effective amount of an inhibitor of 5' adenosine monophosphate-activated protein kinase (AMPK).
- AMPK 5' adenosine monophosphate-activated protein kinase
- the disease is an autoimmune disease.
- the autoimmune disease is selected from the group consisting of inflammatory bowel disease, ulcerative colitis, Crohn's disease, a peripheral vascular disease, a disorder characterized by lesions having inflammatory cell infiltration, a disorder where amyloid plaques are present in the brain, Alzheimer's disease, Aicardi-Goutieres syndrome, juvenile arthritis, rheumatoid arthritis, osteoporosis, amyotrophic lateral sclerosis, systemic lupus erythmatosis and multiple sclerosis.
- the subject expresses a mutation in STING that makes the STING protein constitutively active.
- the STING mutation is selected from the group consisting of N154S and R284S of SEQ ID NO: 1.
- the AMPK inhibitor is selected from the group consisting of dorsomorphin, doxorubicin hydrochloride, GSK690693, BML-275, STO-609, a fasudil salt, gamma-D-glutamylaminomethylsulfonic acid, WZ4003 and HTH-01-015.
- an adjuvant comprising a STimulator of INterferon Genes (STING) variant having a mutation that makes the STING protein constitutively active.
- the STING variant is a polynucleotide and an adjuvant for a nucleic acid vaccine.
- the STING variant is a polypeptide.
- the STING mutation is selected from the group consisting of N154S and R284S of SEQ ID NO: 1.
- the disclosure further provides a method of enhancing an immune response to a vaccine in a subject receiving said vaccine comprising administering an adjuvant comprising a STimulator of INterferon Genes (STING) variant having a mutation that makes the STING protein constitutively active in conjunction with the vaccine.
- STING STimulator of INterferon Genes
- Figures 1 A-1 E show the characterization of the Ecuador mutant (R284S) as hyperactive.
- Figure 1A The patient had a missense heterozygous mutation in STING
- FIG. 1 B R284S mutation is on the a-helix loop 5 in STING C-terminus.
- the crystal structure of apo-STING dimer indicates that R284 may not be involved in STING dimerization or cGAMP-binding. R284 is highly conserved among different species.
- Figure 1 C HEK293T cells were transfected with plasmid encoding human STING (hSTING) or its mutants (N154S, R284S) and the indicated reporter plasmids. Human cGAS (hcGAS) was expressed to generate cGAMP.
- FIG. 1 D The indicated plasmids were transfected into HEK293T cells.
- the cell lysates were incubated with biotin-labeled cGAMP for 30 min at 4 °C and then irradiated with UV for 10 min at 1 J/cm 2 for crosslinking. After precipitation with streptavidin-beads, the precipitants were washed and then boiled in SDS-sample buffer. Western blots were performed with the indicated antibodies.
- Figures 2A-2F describe that the Ecuador mutant (R284S) constitutively moves and induces inflammation.
- Figure 2A Primary Sting '1' EF cells were reconstituted with wild-type
- Figure 2A ( Figure 2C) Total RNA was purified from the reconstituted cells after treated with dsDNA as described in Figure 2A and then examined for gene expression using Affymetrix
- FIGS 3A-3F show IFN is transiently produced during trafficking.
- A Realtime PCR was performed for Ifnbl expression in the reconstituted primary Sting '1' MEF cells.
- B and C Wild-type STING or its mutants (N154S, R284S) were expressed in primary Sting * ' * and Sting '1' MEF cells using retrovirus. The cells were treated with dsDNA (4 ⁇ g/ml) using lipofectamine 2000 for 15 h. The amounts of IFNp (B) or CXCL 0 (C) in the supernatants were measured by ELISA.
- Figures 4A-4F show that AMPK inhibitors are potential therapeutic drugs for STING- induced inflammatory diseases.
- Figure 4A The reconstituted primary Sting '1' MEF cells were treated with tofacitinib (5 ⁇ ) or BFA (5 ⁇ g/ml) for 9 h and then CXCL10 in the supernatants was measured by ELISA.
- Figure 4B The reconstituted cells were treated with tofacitinib or BFA as described in Figure 4A and then realtime PCR was performed with Ifitl probe.
- Figure 4C Western blots were performed with the indicated antibodies for the cell lysates after the supernatants that were used in Figure 4A were collected.
- FIG. 4D The reconstituted cells expressing R284S were treated with the indicated drugs (compound C (10 ⁇ ), doxorubicin (10 ⁇ ), GSK 690693 (20 ⁇ ), tofacitinib (5 ⁇ )) for 9 h. Total RNA was purified and then examined for gene expression compared to vehicle as describes in Figure 2C. The scale represents the intensity of gene expression (log2 scale).
- Figure 4E The reconstituted cells expressing N 54S or R284S were treated with the indicated drugs as described in Figure 4D. Realtime PCR was performed with Ifitl, Oasl1, or Rsad2 probe.
- Figure 4F The reconstituted cells expressing R284S were treated with the drugs at the indicated concentration for 9 h.
- STING Reported herein is the identification of an alternate de novo germline missense mutation in exon 5 of STING (R284S). Subsequent examination indicated that STING (R284S) was a constitutively active gain-of-function, dominant-negative mutant that could traffic through the golgi and trigger innate immune signaling in the absence of CDN's. JAK inhibitors such as tofacitinib failed to significantly repress STING (R284S) function, but use of an AMPK/AKT inhibitor GSK 690693, which affected ULK1 activity, robustly inhibited STING-dependent IRF3 activation. This disclosure underscores the growing incidence of deregulated STING signaling in manifesting chronic cytokine related disease and indicates that suppression of STING- dependent IRF3 activation may be useful for the treatment of a wide-range of autoinflammatory disorders.
- STimulator of INterferon Genes includes, without limitation, nucleic acids, polynucleotides, oligonucleotides, sense and antisense polynucleotide strands, complementary sequences, peptides, polypeptides, proteins, homologous and/or orthologous STING molecules, isoforms, precursors, mutants, variants, derivatives, splice variants, alleles, different species, and active fragments thereof.
- an "active STING mutant” refers to a mutant of STING protein which results in a gain- of-function mutant in which STING is constitutively active.
- An active STING mutant is also a STING variant polynucleotide having a mutation in the wild type STING protein.
- Exemplary constitutively active mutations include, but are not limited to, N154S or R284S of SEQ ID NO: 1.
- polynucleotide and “nucleic acid”, used interchangeably herein, refer to a polymeric form of nucleotides of any length, either ribonucleotides or deoxyribonucleotides. These terms include a single-, double- or triple-stranded DNA, genomic DNA, cDNA, genomic RNA, mRNA, DNA-RNA hybrid, or a polymer comprising purine and pyrimidine bases, or other natural, chemically, biochemically modified, non-natural or derivatized nucleotide bases.
- the backbone of the polynucleotide can comprise sugars and phosphate groups (as may typically be found in RNA or DNA), or modified or substituted sugar or phosphate groups.
- the backbone of the polynucleotide can comprise a polymer of synthetic subunits such as phosphoramidates and thus can be a oligodeoxynucleoside phosphoramidate (P-NH2) or a mixed phosphoramidate-phosphodiester oligomer.
- P-NH2 oligodeoxynucleoside phosphoramidate
- Peyrottes et al. (1996) Nucleic Acids Res. 24: 1841-8; Chaturvedi et al. (1996) Nucleic Acids Res. 24: 2318-23; Schultz et al. (1996) Nucleic Acids Res.
- a double-stranded polynucleotide can be obtained from the single stranded polynucleotide product of chemical synthesis either by synthesizing the complementary strand and annealing the strands under appropriate conditions, or by synthesizing the complementary strand de novo using a DNA polymerase with an appropriate primer.
- Reference to a polynucleotide sequence (such as referring to a SEQ ID NO) also includes the complement sequence.
- polynucleotides a gene or gene fragment, exons, introns, genomic RNA, mRNA, tRNA, rRNA, ribozymes, cDNA, recombinant
- polynucleotides branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers.
- a polynucleotide may comprise modified nucleotides, such as methylated nucleotides and nucleotide analogs, uracyl, other sugars and linking groups such as fluororibose and thioate, and nucleotide branches.
- the sequence of nucleotides may be interrupted by non-nucleotide components.
- a polynucleotide may be further modified after polymerization, such as by conjugation with a labeling component.
- caps substitution of one or more of the naturally occurring nucleotides with an analog, and introduction of means for attaching the polynucleotide to proteins, metal ions, labeling components, other polynucleotides, or a solid support.
- Encoding refers to the inherent property of specific sequences of nucleotides in a polynucleotide, such as a gene, a cDNA, or an mRNA, to serve as templates for synthesis of other polymers and macromolecules in biological processes having either a defined sequence of nucleotides (i.e., rRNA, tRNA and mRNA) or a defined sequence of amino acids and the biological properties resulting therefrom.
- a gene encodes a protein if transcription and translation of mRNA produced by that gene produces the protein in a cell or other biological system.
- coding strand the nucleotide sequence of which is identical to the mRNA sequence and is usually provided in sequence listings
- non-coding strand used as the template for transcription
- a "nucleotide sequence encoding an amino acid sequence" includes all nucleotide sequences that are degenerate versions of each other and that encode the same amino acid sequence. Nucleotide sequences that encode proteins and RNA may include introns.
- Under transcriptional control is a term well understood in the art and indicates that transcription of a polynucleotide sequence depends on its being operably (operatively) linked to an element which contributes to the initiation of, or promotes, transcription.
- "Operably linked” refers to a juxtaposition wherein the elements are in an arrangement allowing them to function.
- heterologous polynucleotide or “heterologous gene” or “transgene” is any polynucleotide or gene that is not present in wild-type viral vector.
- a heterologous promoter is one which is not associated with or derived from the vector itself.
- a "host cell” includes an individual cell or cell culture which can be or has been a recipient of a vector(s) described herein.
- Host cells include progeny of a single host cell, and the progeny may not necessarily be completely identical (in morphology or in total DNA complement) to the original parent cell due to natural, accidental, or deliberate mutation and/or change.
- a host cell includes cells transfected, transformed or infected in vivo or in vitro with a vector herein.
- a “vector” (sometimes referred to as gene delivery or gene transfer “vehicle”) refers to a macromolecule or complex of molecules comprising a polynucleotide to be delivered to a host cell, either in vitro or in vivo.
- the polynucleotide to be delivered may comprise a coding sequence of interest in gene therapy.
- Vectors include, for example, viral vectors, such as vesicular stomatitis virus (VSV), lentivirus, adenovirus, adeno-associated virus, vaccinia virus, or modified vaccinia Ankara (MVA) virus vectors, liposomes and other lipid-containing complexes, and other macromolecular complexes capable of mediating delivery of a
- viral vectors such as vesicular stomatitis virus (VSV), lentivirus, adenovirus, adeno-associated virus, vaccinia virus, or modified vaccinia Ankara (MVA) virus vectors, liposomes and other lipid-containing complexes, and other macromolecular complexes capable of mediating delivery of a
- VSV vesicular stomatitis virus
- lentivirus lentivirus
- adenovirus adeno-associated virus
- vaccinia virus or modified vaccinia Ankara
- Vectors may be, for example, "cloning vectors” which are designed for isolation, propagation and replication of inserted nucleotides, "expression vectors” which are designed for expression of a nucleotide sequence in a host cell, or a “viral vector” which is designed to result in the production of a recombinant virus or virus-like particle, or "shuttle vectors", which comprise the attributes of more than one type of vector.
- Vectors can also comprise other components or functionalities that further modulate gene delivery and/or gene expression, or that otherwise provide beneficial properties to the targeted cells.
- such other components include, for example, components that influence binding or targeting to cells (including components that mediate cell-type or tissue-specific binding); components that influence uptake of the vector nucleic acid by the cell; components that influence localization of the
- polynucleotide within the cell after uptake such as agents mediating nuclear localization
- components that influence expression of the polynucleotide also might include markers, such as detectable and/or selectable markers that can be used to detect or select for cells that have taken up and are expressing the nucleic acid delivered by the vector.
- markers such as detectable and/or selectable markers that can be used to detect or select for cells that have taken up and are expressing the nucleic acid delivered by the vector.
- Such components can be provided as a natural feature of the vector (such as the use of certain viral vectors which have components or functionalities mediating binding and uptake), or vectors can be modified to provide such functionalities.
- Other vectors include those described by Chen et al; BioTechniques, 34: 167-171 (2003). A large variety of such vectors are known in the art and are generally available.
- expression vector refers to a vector containing a nucleic acid sequence coding for at least part of a gene product capable of being transcribed. In some cases, RNA molecules are then translated into a protein, polypeptide, or peptide. In other cases, these sequences are not translated, for example, in the production of antisense molecules, siRNA, ribozymes, and the like.
- Expression vectors can contain a variety of control sequences, which refer to nucleic acid sequences necessary for the transcription and possibly translation of an operatively linked coding sequence in a particular host organism. In addition to control sequences that govern transcription and translation, vectors and expression vectors may contain nucleic acid sequences that serve other functions as well.
- a "DNA Vaccine” or "DNA vector” as used herein refers to a synthetic DNA structure that can be transcribed in target cells and can comprise a linear nucleic acid such as a purified DNA, a DNA incorporated in a plasmid vector, or a DNA incorporated into any other vector suitable for introducing DNA into a host cell.
- the DNA vaccine can be naked DNA.
- a naked DNA vaccine is provided herein.
- the vaccine may comprise viruslike particles (VLPs).
- VSV cular stomatitis virus
- a VSV construct herein may be in any of several forms, including, but not limited to, genomic RNA, mRNA, cDNA, part or all of the VSV RNA encapsulated in the nucleocapsid core, VSV complexed with compounds such as PEG and VSV conjugated to a nonviral protein.
- VSV vectors useful herein encompass replication-competent and replication-defective VSV vectors, such as, VSV vectors lacking G glycoprotein.
- vaccine refers to a composition comprising a vector comprising a mutated STING as described herein, which is useful in the treatment of cancer or other conditions in which enhanced immune response is indicated. It is contemplated that the vaccine comprises a pharmaceutically acceptable carrier and/or an adjuvant. It is contemplated that vaccines are prophylactic or therapeutic.
- a "prophylactic” treatment is a treatment administered to a subject who does not exhibit signs of a disease or exhibits only early signs for the purpose of decreasing the risk of developing pathology.
- the compounds of the invention may be given as a prophylactic treatment to reduce the likelihood of developing a pathology or to minimize the severity of the pathology, if developed.
- a “therapeutic” treatment is a treatment administered to a subject who exhibits signs or symptoms of pathology for the purpose of diminishing or eliminating those signs or symptoms.
- the signs or symptoms may be biochemical, cellular, histological, functional, subjective or objective.
- the term "induces or enhances an immune response” as used herein refers to causing a statistically measurable induction or increase in an immune response over a control sample to which the peptide, polypeptide or protein has not been administered.
- the induction or enhancement of the immune response results in a prophylactic or therapeutic response in a subject. Examples of immune responses are increased production of type I IFN, increased resistance to viral and other types of infection by alternate pathogens.
- the enhancement of immune responses to tumors (anti-tumor responses), or the development of vaccines to prevent tumors or eliminate existing tumors.
- the "treatment of cancer” refers to one or more of the following effects: (1) inhibition, to some extent, of tumor growth, including, (i) slowing down and (ii) complete growth arrest; (2) reduction in the number of tumor cells; (3) maintaining tumor size; (4) reduction in tumor size; (5) inhibition, including (i) reduction, (ii) slowing down or (iii) complete prevention, of tumor cell infiltration into peripheral organs; (6) inhibition, including (i) reduction, (ii) slowing down or (iii) complete prevention, of metastasis; (7) enhancement of anti-tumor immune response, which may result in (i) maintaining tumor size, (ii) reducing tumor size, (iii) slowing the growth of a tumor, (iv) reducing, slowing or preventing invasion and/or (8) relief, to some extent, of the severity or number of one or more symptoms associated with the disorder.
- isolated refers to a polynucleotide, virus or antigenic composition that is removed from its native environment.
- an isolated biological material is free of some or all cellular components, i.e., components of the cells in which the native material occurs naturally (e.g., cytoplasmic or membrane component).
- a polynucleotide, virus or antigenic composition is deemed isolated if it is present in a cell extract or supernatant.
- an isolated nucleic acid includes a PCR product, an isolated mRNA, a cDNA, or a restriction fragment.
- purified refers to a virus or immunogenic composition that has been isolated under conditions that reduce or eliminate the presence of unrelated materials, i.e., contaminants, including endogenous materials from which the composition is obtained.
- a purified virion is substantially free of host cell or culture components, including tissue culture or cell proteins and non-specific pathogens.
- purified material substantially free of contaminants is at least 50% pure; at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or even at least 99% pure. Purity can be evaluated by chromatography, gel electrophoresis, immunoassay, composition analysis, biological assay, and other methods known in the art.
- pharmaceutical composition refers to a composition suitable for administration to a subject animal, including humans and mammals.
- a pharmaceutical composition comprises a pharmacologically effective amount of a virus or antigenic composition of the invention and also comprises a pharmaceutically acceptable carrier.
- a pharmaceutical composition encompasses a composition comprising the active ingredient(s), and the inert ingredient(s) that make up the pharmaceutically acceptable carrier, as well as any product which results, directly or indirectly, from combination, complexation or aggregation of any two or more of the ingredients.
- the pharmaceutical compositions of the present invention encompass any composition made by admixing a compound or conjugate of the present invention and a pharmaceutically acceptable carrier.
- pharmaceutically acceptable carrier include any and all clinically useful solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, buffers, and excipients, such as a phosphate buffered saline solution, 5% aqueous solution of dextrose or mannitol, and emulsions, such as an oil/water or water/oil emulsion, and various types of wetting agents and/or adjuvants. Suitable
- compositions useful for the composition depend upon the intended mode of administration of the active agent. Typical modes of administration include, but are not limited to, enteral (e.g., oral) or parenteral (e.g., subcutaneous, intramuscular, intravenous or intraperitoneal injection; or topical, transdermal, or transmucosal administration).
- enteral e.g., oral
- parenteral e.g., subcutaneous, intramuscular, intravenous or intraperitoneal injection; or topical, transdermal, or transmucosal administration.
- a "pharmaceutically acceptable salt” is a salt that can be formulated into a compound or conjugate for pharmaceutical use including, e.g., metal salts (sodium, potassium, magnesium, calcium, etc.) and salts of ammonia or organic amines.
- pharmaceutically acceptable refers to a material which is not biologically or otherwise undesirable, i.e., the material may be administered to an individual without causing any undesirable biological effects or interacting in a deleterious manner with any of the components of the composition in which it is contained, or when administered using routes well-known in the art, as described below.
- STING Stimulator of Interferon Genes
- TM transmembrane
- ER endoplasmic reticulum
- IRF3 Interferon Regulatory Factor 3
- Human STING is a 379 amino acid protein, having an amino acid sequence set out in Genbank Accession No. NP_938023 and nucleotide sequence set out in Genbank Accession No. NM_198282, though alternate protein isoforms may exist (Genbank Accession Nos.
- Loss of STING reduced the ability of polyl:C to activate type I IFN and rendered murine embryonic fibroblasts lacking STING ( " ' " MEFs) generated by targeted homologous recombination, susceptible to vesicular stomatitis virus (VSV) infection.
- VSV vesicular stomatitis virus
- RNAi ablation of TRAP inhibited STING function and impeded the production of type I IFN in response to polylC.
- STING itself binds nucleic acids including single- and double-stranded DNA such as from pathogens and apoptotic DNA, and plays a central role in regulating proinflammatory gene expression in inflammatory conditions such as DNA-mediated arthritis and cancer. Certain inhibitors and activators of STING are discussed in International Patent Publication No. WO 2013/166000.
- the disclosure provides a method of activating the immune system using a constitutively active mutant of the STING protein. Contemplated is
- a vector or vaccine comprising the active STING protein or polynucleotide encoding the protein to a subject in need of immune system stimulation.
- the immune response is an ongoing immune response in cancer, a microbial infection or an autoimmune disease.
- the STING mutant may be administered prophylactically in a disease or disorder in which an immune response is in a remission phase, e.g., in cancer or an autoimmune disease.
- the disclosure provides a method of suppressing STING in a subject in need thereof comprising administering a composition comprising an inhibitor of AMPK, wherein the kinase inhibitor inhibits STING signaling.
- AMPK inhibitors include, but are not limited to, dorsomorphin, doxorubicin hydrochloride, GSK690693, BML-275, STO-609, a fasudil salt, gamma-D-glutamylaminomethylsulfonic acid, WZ4003 and HTH-01- 015.
- the disclosure provides a method of decreasing the size of a tumor in a subject having a tumor or cancer comprising administering a composition comprising an active mutant of STING. Also provided is a method for treating cancer or preventing the recurrence of cancer comprising administering to a subject in need thereof a therapeutically effective amount of a active STING mutant or a pharmaceutical composition comprising an active STING mutant or vector or vaccine comprising a active mutant as described herein.
- Exemplary conditions or disorders that can be treated with an active STING mutant include cancers, such as esophageal cancer, pancreatic cancer, metastatic pancreatic cancer, metastatic adenocarcinoma of the pancreas, bladder cancer, stomach cancer, fibrotic cancer, glioma, malignant glioma, diffuse intrinsic pontine glioma, recurrent childhood brain neoplasm renal cell carcinoma, clear-cell metastatic renal cell carcinoma, kidney cancer, prostate cancer, metastatic castration resistant prostate cancer, stage IV prostate cancer, metastatic melanoma, melanoma, malignant melanoma, recurrent melanoma of the skin, melanoma brain metastases, stage IIIA skin melanoma; stage IIIB skin melanoma, stage NIC skin melanoma; stage IV skin melanoma, malignant melanoma of head and neck, lung cancer, non-small cell lung cancer (NSCLC), squamous cell non-small cell
- RUNX1-RUNX1T1 adult acute myeloid leukemia with t(9;1 1)(p22;q23); MLLT3-MLL; adult acute promyelocytic leukemia with t(15;17)(q22;q12); PML-RARA; alkylating agent-related acute myeloid leukemia, chronic lymphocytic leukemia, richter's syndrome; Waldenstrom
- cancers that can be treated with the present invention include ovarian cancer, colon cancer, melanoma, breast cancer or lung cancer.
- the methods herein reduce tumor size or tumor burden in the subject, and/or reduce metastasis in the subject.
- the methods reduce the tumor size by 10%, 20%, 30% or more.
- the methods reduce tumor size by 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100%.
- the methods herein reduce tumor burden, and also reduce or prevent the recurrence of tumors once the cancer has gone into remission.
- the active STING mutant compositions described herein modulates immune cells in a tumor.
- the active STING mutant compositions increases the number of macrophages or other phagocytes or antigen presenting cells in a tumor and/or increases phagocytic activity of cells in the area of the tumor.
- infectious diseases or autoimmune disease in which an increase in immune response may be desired.
- exemplary conditions include, but are not limited to, an inflammatory bowel disease (e.g., ulcerative colitis or Crohn's disease), a peripheral vascular disease, a cerebral vascular accident (stroke), a disorder characterized by lesions having inflammatory cell infiltration, a disorder where amyloid plaques are present in the brain (e.g., Alzheimer's disease), Aicardi-Goutieres syndrome, juvenile arthritis, osteoporosis, amyotrophic lateral sclerosis, or multiple sclerosis.
- an inflammatory bowel disease e.g., ulcerative colitis or Crohn's disease
- peripheral vascular disease e.g., a peripheral vascular disease
- stroke cerebral vascular accident
- a disorder characterized by lesions having inflammatory cell infiltration e.g., Alzheimer's disease
- Aicardi-Goutieres syndrome e.g., juvenile arthritis, osteoporosis, amyotrophic lateral
- Exemplary microbial infections contemplated include viral, bacterial or fungal infection.
- Many methods may be used to administer or introduce the active STING mutant or vectors, vaccines or viral particles comprising the active STING mutant into individuals (i.e., including subjects or patients), including but not limited to, intratumorally, intravenously, intra- arterially, intraperitoneally, intranasally, intramuscularly, intradermally, subcutaneously, orally or by continuous infusion.
- the individual to which a vector or viral particle is administered is a primate, or in other examples, a mammal, or in other examples, a human, but can also be a non-human mammal including but not limited to cows, horses, sheep, pigs, fowl, cats, dogs, hamsters, mice and rats.
- a vector, vaccines or viral particles the individual can be any animal in which a vector or virus is capable introducing the active STING mutant and results in activation of the immune response.
- compositions comprising active STING mutants, vectors, vaccines or viral particles wherein said compositions can further comprise a pharmaceutically acceptable carrier.
- the amount of vector(s) to be administered will depend on several factors, such as route of administration, the condition of the individual, the degree of aggressiveness of the malignancy, and the particular vector employed. Also, the vector may be used in conjunction with other treatment modalities.
- vaccines or viral particles from about 10 2 up to about 10 7 p.f.u., in other examples, from about 10 3 up to about 10 6 p.f.u., and in other examples, from about 10 4 up to about 10 s p.f.u. is administered.
- a polynucleotide construct i.e., not packaged as a virus
- about 0.01 ⁇ g to about 100 pg of a viral construct of the present invention can be administered, in other examples, 0.1 pg to about 500 pg, and in other examples, about 0.5 pg to about 200 pg can be administered.
- More than one vector can be administered, either simultaneously or sequentially. Administrations are typically given periodically, while monitoring any response. Administration can be given, for example, intramuscularly, intravenously, intratumorally or intraperitoneally.
- an effective amount of the active STING mutant, vector(s), vaccines or viral particles is administered.
- An "effective amount” is an amount sufficient to achieve a desired biological effect such as to induce enough humoral or cellular immunity. This may be dependent upon the type of vaccine, the age, sex, health, and weight of the recipient. Examples of desired biological effects include, but are not limited to, increase in immune response, increase in STING stimulation, decrease in tumor size or tumor burden, production of no symptoms or reduction in symptoms related to disease or condition being treated.
- a vaccine or composition of the present invention is physiologically significant if its presence results in a detectable change in the physiology of a recipient patient that enhances at least one primary or secondary humoral or cellular immune response against a tumor or other targeted cell or microbe.
- the active STING mutant increases infiltration of immune cells into the tumor or site of infection.
- the immune cells are macrophages, dendritic cells or other phaogcytes.
- the composition can also contain minor amounts of wetting or emulsifying agents or pH buffering agents.
- the composition can be a liquid solution, suspension, emulsion, tablet, pill, capsule, sustained release formulation, or powder.
- Oral formulation can include standard carriers such as pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate, etc.
- the ingredients are supplied either separately or mixed together in unit dosage form, for example, as a dry lyophilized powder or water free concentrate in a hermetically sealed container such as an ampoule or sachet indicating the quantity of active agent.
- a hermetically sealed container such as an ampoule or sachet indicating the quantity of active agent.
- an ampoule of sterile diluent can be provided so that the ingredients may be mixed prior to administration.
- compositions of the present disclosure containing the inhibitors described herein as an active ingredient may contain pharmaceutically acceptable carriers or additives depending on the route of administration.
- carriers or additives include water, a pharmaceutical acceptable organic solvent, collagen, polyvinyl alcohol, polyvinylpyrrolidone, a carboxyvinyl polymer, carboxymethylcellulose sodium, polyacrylic sodium, sodium alginate, water-soluble dextran, carboxymethyl starch sodium, pectin, methyl cellulose, ethyl cellulose, xanthan gum, gum Arabic, casein, gelatin, agar, diglycerin, glycerin, propylene glycol, polyethylene glycol, Vaseline, paraffin, stearyl alcohol, stearic acid, human serum albumin (HSA), mannitol, sorbitol, lactose, a pharmaceutically acceptable surfactant and the like.
- Additives used are chosen from, but not limited to, the above or combinations thereof, as appropriate, depending on the dosage
- Formulation of the pharmaceutical composition will vary according to the route of administration selected (e.g., solution, emulsion).
- An appropriate composition comprising the inhibitor, e.g., an antibody, to be administered can be prepared in a physiologically acceptable vehicle or carrier.
- suitable carriers include, for example, aqueous or alcoholic/aqueous solutions, emulsions or suspensions, including saline and buffered media.
- Parenteral vehicles can include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's or fixed oils.
- Intravenous vehicles can include various additives, preservatives, or fluid, nutrient or electrolyte replenishers.
- aqueous carriers e.g., sterile phosphate buffered saline solutions, bacteriostatic water, water, buffered water, 0.4% saline, 0.3% glycine, and the like, and may include other proteins for enhanced stability, such as albumin, lipoprotein, globulin, etc., subjected to mild chemical modifications or the like.
- Therapeutic formulations of the inhibitors are prepared for storage by mixing the inhibitor having the desired degree of purity with optional physiologically acceptable carriers, excipients or stabilizers (Remington's Pharmaceutical Sciences 16th edition, Osol, A. Ed.
- Acceptable carriers, excipients, or stabilizers are nontoxic to recipients at the dosages and concentrations employed, and include buffers such as phosphate, citrate, and other organic acids; antioxidants including ascorbic acid and methionine; preservatives (such as octadecyldimethylbenzyl ammonium chloride; hexamethonium chloride; benzalkonium chloride, benzethonium chloride; phenol, butyl or benzyl alcohol; alkyl parabens such as methyl or propyl paraben; catechol; resorcinol;
- polypeptides such as serum albumin, gelatin, or immunoglobulins
- hydrophilic polymers such as polyvinylpyrrolidone
- amino acids such as glycine, glutamine, asparagine, histidine, arginine, or lysine
- chelating agents such as EDTA
- sugars such as sucrose, mannitol, trehalose or sorbitol
- salt-forming counter-ions such as sodium
- metal complexes e.g., Zn-protein complexes
- non-ionic surfactants such as TWEENTM, PLURONICSTM or polyethylene glycol (PEG).
- the formulation herein may also contain more than one active compound as necessary for the particular indication being treated, preferably those with complementary activities that do not adversely affect each other.
- Such molecules are suitably present in combination in amounts that are effective for the purpose intended.
- the active ingredients may also be entrapped in microcapsule prepared, for example, by coacervation techniques or by interfacial polymerization, for example,
- hydroxymethylcellulose or gelatin-microcapsule and poly-(methylmethacylate) microcapsule respectively, in colloidal drug delivery systems (for example, liposomes, albumin microspheres, microemulsions, nano-particles and nanocapsules) or in macroemulsions.
- colloidal drug delivery systems for example, liposomes, albumin microspheres, microemulsions, nano-particles and nanocapsules
- macroemulsions for example, liposomes, albumin microspheres, microemulsions, nano-particles and nanocapsules
- formulations to be used for in vivo administration must be sterile. This is readily accomplished by filtration through sterile filtration membranes.
- the dose of vector, vaccine or viral particle to be employed in the formulation will also depend on the route of administration, and the nature of the patient, and should be decided according to the judgment of the practitioner and each patient's circumstances according to standard clinical techniques.
- the exact amount of vector or virus utilized in a given preparation is not critical provided that the minimum amount of virus necessary to produce immunologic activity is given.
- Effective doses of the vector or viral particle of the disclosure may also be extrapolated from dose-response curves derived from animal model test systems.
- administration is performed at the site of a cancer or affected tissue needing treatment by direct injection into the site or via a sustained delivery or sustained release mechanism, which can deliver the formulation internally.
- a sustained delivery or sustained release mechanism which can deliver the formulation internally.
- biodegradable microspheres or capsules or other biodegradable polymer configurations capable of sustained delivery of a composition e.g., a soluble polypeptide, antibody, or small molecule
- a composition e.g., a soluble polypeptide, antibody, or small molecule
- Therapeutic compositions may also be delivered to the patient at multiple sites.
- the multiple administrations may be rendered simultaneously or may be administered over a period of time. In certain cases it is beneficial to provide a continuous flow of the therapeutic composition.
- Additional therapy may be administered on a period basis, for example, hourly, daily, every other day, twice weekly, three times weekly, weekly, every 2 weeks, every 3 weeks, monthly, or at a longer interval.
- the AMPK inhibitor may also be administered in the methods of the disclosure in a manner described above. Additionally, the AMPK compositions may be formulated as described above.
- a vector or vaccine of the present disclosure or composition thereof is administered with a second agent useful for treating a condition or disorder for which active STING mutant therapy is used, e.g., cancer, infection or autoimmune disease.
- a second agent useful for treating a condition or disorder for which active STING mutant therapy is used e.g., cancer, infection or autoimmune disease.
- AMPK inhibitor a second agent useful for treating a condition or disorder as described herein.
- Concurrent administration of two therapeutic agents does not require that the agents be administered at the same time or by the same route, as long as there is an overlap in the time period during which the agents are exerting their therapeutic effect. Simultaneous or sequential administration is contemplated, as is administration on different days or weeks.
- the second agent may be other therapeutic agents, such as cytokines, growth factors, other inhibitors and antibodies to target antigens useful for treating cancer or immunological disorders, for example ipilimumab (YERVOY ® , Bristol-Myers Squibb Company), an antibody to CTLA-4; bevacizumab (AVASTIN®, Genentech), an antibody to VEGF-A; erlotinib
- TARCEVA® Genentech and OSI Pharmaceuticals
- a tyrosine kinase inhibitor which acts on EGFR dasatinib (SPRYCEL®, Bristol-Myers Squibb Company), an oral Bcr-AbI tyrosone kinase inhibitor; IL-21 ; pegylated IFN-a2b; axitinib (INLYTA®, Pfizer, Inc.), a tyrosine kinase inhibitor; and trametinib (MEKINIST®, GlaxoSmith line), a MEK inhibitor (Philips and Atkins, Int
- the active STING mutant of the present disclosure, or AMPK inhibitor, and second agent may be given simultaneously, in the same formulation. It is further contemplated that the active STING mutant, or AMPK inhibitor, and second agent are administered in a separate formulation and administered concurrently, with concurrently referring to agents given within 30 minutes of each other. It is further contemplated that the third agent may be given simultaneously with the inhibitors.
- a active STING mutant, or AMPK inhibitor is administered prior to administration of the second agent.
- Prior administration refers to administration of an active STING mutant, or AMPK inhibitor, within the range of one week prior to treatment with the second agent, up to 30 minutes before administration of the second agent. It is further contemplated that an active STING mutant, or AMPK inhibitor, is administered subsequent to administration a second agent. Subsequent administration is meant to describe administration from 30 minutes after active STING mutant, or AMPK inhibitor, treatment up to one week after active STING mutant, or AMPK inhibitor, administration.
- adjunct therapies may be administered, where appropriate.
- the patient may also be administered surgical therapy,
- the active STING mutant, or AMPK inhibitor, composition herein are administered in combination with a second agent, such as for example, wherein the second agent is a cytokine or growth factor, or a chemotherapeutic agent, the administration also includes use of a radiotherapeutic agent or radiation therapy.
- a radiotherapeutic agent or radiation therapy is administered as determined by the treating physician, and at doses typically given to patients being treated for cancer.
- a cytotoxic agent refers to a substance that inhibits or prevents the function of cells and/or causes destruction of cells.
- the term is intended to include radioactive isotopes (e.g.,
- a non- cytotoxic agent refers to a substance that does not inhibit or prevent the function of cells and/or does not cause destruction of cells.
- a non-cytotoxic agent may include an agent that can be activated to be cytotoxic.
- a non-cytotoxic agent may include a bead, liposome, matrix or particle (see, e.g., U.S. Patent Publications 2003/0028071 and 2003/0032995 which are incorporated by reference herein). Such agents may be conjugated, coupled, linked or associated with an antibody according to the disclosure.
- Chemotherapeutic agents contemplated for use with the antibodies of the present disclosure include, but are not limited to those listed in Table I:
- VLB chlorambucil vinblastine
- TEM thriethylenemelamine
- Triazines splicamycin mithramycin
- Type 1 Topoisomerase Inhibitors Anthracenedione
- Hormones and antagonists ainoglutethimide
- dexamethasone interferon ( ⁇ , ⁇ , ⁇ )
- kits which comprise one or more compounds or compositions packaged in a manner which facilitates their use to practice methods of the disclosure.
- a kit includes a compound or composition described herein (e.g., a composition comprising a target-specific antibody alone or in combination with another antibody or a third agent), packaged in a container such as a sealed bottle or vessel, with a label affixed to the container or included in the package that describes use of the compound or composition in practicing the method.
- the compound or composition is packaged in a unit dosage form.
- the kit may further include a device suitable for administering the composition according to a specific route of administration or for practicing a screening assay.
- the kit contains a label that describes use of the inhibitor compositions.
- Cells, Reagents, and Viruses Primary Sting +I+ and Sting '1' MEF cells, HEK293T cells, and Platinum-E retroviral packaging cells were prepared as previously described. Primary MEF cells, HEK293T cells, and Platinum-E cells were cultured in DMEM (Gibco) supplemented with 10% FBS and antibiotics. dsDNA (ISD 90-mer) was prepared as previously described. Biotin-labeled cGAMP were purchased from Biolog. Poly l:C was obtained from American Biosciences. BFA, compound C, and tofacitinib were purchased from SIGMA. Doxorubicin and GSK 690693 were purchased from Santa Cruz Biotechnology. Lipofectamine 2000 was purchased from Invitrogen. Anti-STING rabbit polyclonal antibody was prepared as previously described. Other antibodies used in this paper were as follows: ⁇ -actin (SIGMA, A5441);
- calreticulin (Abeam, ab14234); phospho-IRF3 (Cell Signaling, 4947); IRF3 (Cell signaling, 4302); phospho-p65 (Cell Signaling, 3031 ); p65 (Cell Signaling, 3987); phospho-TBK1 (Cell Signaling, 5483); TBK1 (Abeam, ab40676); phospho-AMPK (T172) (Cell Signaling, 2535);
- AMPK Cell Signaling, 5832
- phospho-STAT1 Cell Signaling, 9167
- HA SIGMA, H9658
- FLAG SIGMA, F1804
- IPS-1 Bethyl, A300-783A
- anti-GM130 BD bioscience, 558712, Alexa Fluor 647-conjugated
- HSV-1 KOS strain
- VSV was prepared as previously described.
- TaqMan probe for Infb, Cc/5, Ifitl, Statl, Oasl1, Rsad2, and Gapdh were purchased from Applied Biosystems.
- ELISA kit for IFN and CXCL10/IL-6 were purchased from PBL Interferon Source and R&D systems, respectively.
- Plasmids and Mutagenesis Reporter plasmids and thymidine kinase (TK)-luc were obtained as previously described.
- pcDNA-hSTING, pBabe-hSTING, pBabe-mSTING, and pcDNA-IPS-1 were made as previously described.
- pCMV-hcGAS was purchased from OriGene. To make STING mutants, QuickChange II XL site directed mutagenesis kit (Stratagene) was used with the following primers;
- hSTING_N154S-F GAAAAAGGGAATTTCAGCGTGGCCCATGGGCTG (SEQ ID NO:2)
- hSTING_N154S-R CAGCCCATGGGCCACGCTGAAATTCCC I I I I I C (SEQ ID NO:3)
- hSTING_R284S-F TTTAGCCGGGAGGATTCTCTTGAGCAGGCCAAA (SEQ ID NO:4)
- hSTING_R284S-R TTTGGCCTGCTCAAGAGAATCCTCCCGGCTAAA (SEQ ID NO:5)
- mSTING_N153S-F GAAGAAAAGAAGTTATCTGTTGCCCACGGGCTG (SEQ ID NO:6)
- mSTING_N153S-R CAGCCCGTGGGCAACAGATAACTTCTTTTCTTC (SEQ ID N0.7 )
- mSTING_R283S-F TTCAGTCGGGAGGATTCCCTTGAGCAGGCTAAA (SEQ ID NO:8)
- mSTING_R283S-R TTTAGCCTGCTCAAGGGAATCCTCCCGACTGAA. (SEQ ID NO:9)
- the PCR condition is as follows; 95 °C for 5 min, 40 cycles of 94 °C for 30 sec/62 °C for 1 min/72 °C for 1 min, 72 °C for 10 min.
- Luciferase Reporter Assay HEK293T cells were transfected with pcDNA3-hSTING or mutants and reporter plasmids (IFNp-luc, NF-KB-IUC, pRD lll-l-luc, ISRE-luc) using lipofectamine 2000. TK-luc was used for transfection control.
- luciferase activity was measured using luciferase assay substrate (Promega) for firefly luciferase activity (reporter plasmids) and renilla luciferase assay system (Promega) for renilla luciferase activity (TK-luc).
- cGAMP-binding Assay HEK293T cells were transfected with the indicated plasmids for 24 h. The cells were lysed by TNE buffer (50 mM Tris-HCI (pH 7.5), 150 mM NaCI, 1 mM EDTA, 1 % NP-40) with protease and phosphatase inhibitors. The cell lysates were incubated with biotin-labeled cGAMP (Biolog) for 30 min at 4 °C and then irradiated with UV for 10 min at 1 J/cm 2 for crosslinking. Streptavidin-conjugated beads (Thermo) were added to the lysates. After incubation for 2 h at 4 "C, the precipitants were washed with TNE buffer five times and then boiled in SDS-sample buffer to elute the binding proteins.
- TNE buffer 50 mM Tris-HCI (pH 7.5), 150 mM NaCI, 1 m
- HEK293T cells were transfected with the indicated plasmids for 24 h and then lysed with TNE buffer with protease and phosphatase inhibitors. The cell lysates were incubated with anti-FLAG antibody overnight at 4 "C and then protein G beads (Thermo) was added to the lysates. After incubation for 1 h at 4 °C, the precipitants were washed with TNE buffer five times and then boiled in SDS-sample buffer to elute the
- the coverslips were incubated with Alexa Fluor 488-goat anti-rabbit IgG and Alexa Fluor-647 goat anti-chicken IgG (Invitrogen) for 1 h at RT in wet chamber. After washing three times with PBS, the coverslips were mounted onto the glass slides with ProLong Gold antifade reagent (Invitrogen). The coverslips were observed using Leica confocal microscope SP5.
- RNA from the reconstituted MEF cells was purified using RNeasy RNA extraction kit (QIAGEN).
- GeneChip Mouse Gene 2.0 ST Array (Affymetrix) was used to observe the gene expression. The data collection and analysis were performed at the Center for Genome Technology (CGT), John P. Hussman, Institute for Human Genomics, University of Miami Miller School of Medicine.
- Realtime PCR was performed with the indicated TaqMan probes (Applied Biosystems) using LightCycler 2.0 (Roche) or StepOnePlus realtime PCR system (Applied Biosystems). Gapdh was used for normalization.
- STING R284S is constitutively active.
- the cDNA was cloned and transiently co-transfected HEK293T cells with the variant and a luciferase gene under control of the type I IFN promoter(ref, ishikawa/barber).
- expression of wild type STING activates the type I IFN promoter, by stimulating IRF3 and NF- ⁇ signaling, to generate luciferase.
- N154S known STING (N154S) variant that was reported to be
- STING R284S cannot be retained in the ER.
- primary Sting '1' mouse embryonic fibroblast (MEF) cells were reconstituted with wild-type STING, STING N154S (SAVI), or STING R284S (Ecuador) using retrovirus delivery. It had been previously reported that SAVI variants leak out from the ER to likely trigger innate immune signaling 22 . Therefore the localization of STING (R284S) in the cell was examined by confocal microscopy. The data indicated that wild type STING could only traffic in the presence of transfected cytosolic dsDNA (Figure 2A).
- STING retains its ability to bind to TBK1.
- the constitutive trafficking of R284S could be blocked by brefeldin A (BFA) confirming that this variant traffics from the ER through the golgi apparatus 9 ( Figure 1 B).
- STING N154S or R284S The observed high level of constitutive IL6 production was reminiscent of the situation observed in the Ecuador patient.
- the observed elevated levels of host defense related proteins being produced by cells expressing STING N154S or R284S may be expected to contribute towards resistance to viral infection.
- the reconstituted MEF's were infected with herpes simplex virus-1 (HSV-1 ; DNA virus) or vesicular stomatitis virus (VSV; RNA virus) and indeed noted that cells expressing the STING variants were more resistant to viral replication (Figure 2F).
- STING leads to the potent induction of type I IFN and pro inflammatory genes in response to
- ULK1 regulators are potential therapeutic drugs for STING-induced inflammatory diseases.
- Three putative regulators of AMPK were examined, Compound C, Doxorubicin (an anthracycline) and GSK690693 (an AKT/AMPK inhibitor) 26'28 . It was hypothesized that suppression of AMPK may release ULK1 to phosphorylate STING, an event that can prevent STING-dependent IRF3 activation 25 . Complete blocking of IRF3 activity may conceivably prevent the stimulation of interferon and subsequently ISG's 8 .
- experiments to evaluate use of the JAK inhibitor Tofacitinib which is efficacious in rodent models, as well as the golgi trafficking blocker BFA were conducted.
- Tofacitinib and IRF3 phosphorylation in the presence and absence of cytosolic dsDNA activator was measured by immunoblot. This analysis confirmed that GSK 690693, but not tofacitinib, could inhibit dsDNA triggered, STING-dependent IRF3 phosphorylation ( Figure 4D). It was further observed that GSK 690693 could suppress ULK1 phosphorylation, suggesting a role for this kinase in controlling IRF3 activity 25 . The examination of hTERT cells confirmed that GSK 690693 could suppress the production of type I IFN production as well as other proinflammatory genes. Thus, GSK 690693 may be useful either alone, or in conjunction with other accepted drugs such as Tofacitinib, as a treatment for 'interferonopathies' mediated by chronic STING signaling 4 .
- tofacitinib failed to effectively inhibit CXCL10 production and Ifitl induction in the reconstituted Sting-/- MEF cells expressing N154S or R284S ( Figure 4A, B). It was confirmed that tofacitinib inhibits STAT1 but not IRF3 by western blots ( Figure 4C). It should be noted that expression of wild-type STING also promoted STAT1 phosphorylation, which may be consistent with the results that inflammatory genes were induced in cells expressing wild-type STING ( Figure 2C, 2D, 3C, 4A, 4B).
- BFA is known to inhibit protein transport of secretory and membrane proteins between the ER and the Golgi apparatus. Therefore, BFA treatment for patients may cause strong side effects. Instead, it is useful to discover STING-specific inhibitors.
- STING-specific inhibitors For this purpose, AMPK inhibitors were considered because it was previously shown that compound C (also known as dorsomorphin) is an ATP competitive inhibitor for AMPKa subunit suppresses STING- dependent inflammation. Consistently, Prantner et al. showed that inflammatory responses to STING agonists in ⁇ 1/ ⁇ 2 deficient cells are dramatically suppressed. Thus, AMPK inhibitors were evaluated to target STING-dependent inflammation.
- doxorubicin and GSK 690693 were selected because doxorubicin has been clinically used for cancer treatment and GSK 690693 was initially planned for clinical trial use.
- Doxorubicin is a DNA intercalator used to prevent DNA replication but a report showed that AMPKa kinase activity can be inhibited by doxorubicin.
- GSK 690693 was originally developed for the inhibition of protein kinase B (AKT) but was shown to inhibit AMPKa in vitro. The microarray data showed that compound C and GSK 690693 suppressed the expression of many inflammatory genes in the reconstituted cells expressing R284S ( Figure 4D).
- doxorubicin treatment enhanced the expression of some inflammatory genes (Figure 4D). This may be because doxorubicin is known to cause DNA damage response that activates STING pathway. Tofacitinib could also suppress the inflammatory gene expression ( Figure 4D).
- AMPK inhibitors may be potential therapeutic drugs for STING- induced inflammatory diseases and useful for treatment of STING-induced inflammatory diseases, or inflammatory diseases in which STING signaling is aberrant.
- the AMPK inhibitors cou!d optionally be used in combination with JAK inhibitors that target IFN signaling.
- Burdette, D. L. et al. STING is a direct innate immune sensor of cyclic di-GMP. Nature 478, 515-518, (2011).
- Cyclic GMP-AMP is an endogenous second messenger in innate immune signaling by cytosolic DNA. Science 339, 826-830, (2013).
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Medicinal Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Veterinary Medicine (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Epidemiology (AREA)
- Immunology (AREA)
- Organic Chemistry (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Genetics & Genomics (AREA)
- Biochemistry (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Gastroenterology & Hepatology (AREA)
- Zoology (AREA)
- Toxicology (AREA)
- Microbiology (AREA)
- Mycology (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The present disclosure relates, in general, to inhibiting signaling activity of STING (STimulator of INterferon Genes) in a subject having an ongoing immune response and use of constitutively active STING mutants to stimulate an immune response in a patient.
Description
COMPOSITIONS AND METHODS FOR MODULATING STING PROTEIN
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims priority to U.S. Provisional Patent Application No. 62/545,626 filed on August 15, 2017, the disclosure of which is hereby incorporated by reference in its entirety.
INCORPORATION BY REFERENCE OF MATERIALS SUBMITTED ELECTRONICALLY
[0002] This application contains, as a separate part of the disclosure, a Sequence Listing in computer readable form (Filename: 52292_Seqlisting.txt; Size: 5,989 bytes; Created: August 14, 2018), which is incorporated by reference in its entirety.
FIELD OF THE DISCLOSURE
[0003] The present disclosure relates, in general, to modulating signaling activity of STING (STimulator of INterferon Genes) in a subject having an ongoing immune response. For example, the disclosure describes use of constitutively active variants of STING as therapy to stimulate STING activity and increase activity of immune cells. Further contemplated are uses of inhibitors of AMPK to increase STING activity in a subject in need thereof.
BACKGROUND
[0004] Autoinflammatory disease, such as arthritis and systemic lupus erythematosus (SLE) affects millions worldwide and although the exact mechanisms remain to be clarified it is thought that deregulation of innate immunity likely plays a key role in manifesting these disorders1,2. Innate immune sensors, such as STING (stimulator of interferon genes), RIG-I/MDA5 or the Toll-Like Receptors have evolved to detect microbial infection of the cell, predominantly through recognition of pathogen-derived nucleic acids, an event which triggers the transcript/on of numerous host defense-related proteins including pro-inflammatory cytokines3,4. While essential for host defense against pathogens, the activation of innate immune signaling is tightly controlled to avoid chronic pro-inflammatory disease, which can be fatal4.
[0005] The cellular sensor STING resides in the endoplasmic reticulum (ER) and is activated by cyclic dinucleotides (CDN's) such as c-GMP and c-AMP secreted by intracellular bacteria after infection5. Alternatively, STING can be activated by cGAMP generated by a cellular synthase cGAS (MB21 D1 ) following the latter's association with aberrant cytosolic dsDNA species, which can include microbial DNA, self-DNA leaked from the nucleus or even
mitochondria DNA6,7 After association with CDN's a conformational change causes STING to traffic through the golgi, with tank binding kinase 1 (TBK1) to activate the transcription factors IRF3 and NF-κΒ which stimulate the production of type I interferon (IFN) and pro-inflammatory cytokines which facilitate adaptive immunity8,9. However, chronic activation of STING signaling has been shown to be cause lethal inflammatory disease. For example, loss of function mutation in the DNase TREX1 (DNaselll) has been found to cause severe SLE referred to as Aicardi-Goutieres Syndrome (AGS) in human patients1. The cause was shown to be due to the accumulation of undigested self-DNA in the cytoplasm, which triggered STING-signaling10. Similarly, loss of DNasell causes lethal pre-natal inflammatory disease in mice through comparable STING-dependent pathways11. Inflammatory disease caused by STING overactivity has also been shown to occur in patients with mutations in the ADAR and Ribonuclease H2 enzyme complex12,13.
[0006] In addition, evidence indicates inflammatory disease can be caused by germ-line missense mutations in the coding region of the STING gene itself (V147L/M, N154S, V155M, C206Y, R281Q, R284G, and S102P/F279L), which exert a gain-of-function phenotype referred to as SAVI (STING-associated vasculopathy with onset in infancy)14"19. Mutations in STING (G116E) have also been shown to be implicated with familial chilblain lupus20.
SUMMARY OF THE DISCLOSURE
[0007] The present disclosure shows that gain of function mutants of the human STING protein may be useful to stimulate an immune response and may be useful as vaccines to treat indications in which an immune response is needed. The disclosure also shows that certain kinase inhibitors suppress STING-dependent IRF3 activation may be useful for the treatment of a wide-range of autoinflammatory disorders.
[0008] The disclosure provides a vector comprising a variant of a human STimulator of INterferon Genes (STING) polynucleotide encoding a STING protein having a mutation that makes the STING protein constitutively active. In one embodiment, the mutation is at residue 154 or 284 of the STING protein of SEQ ID NO: 1. In various embodiments, the mutation is N154S or R284S of SEQ ID NO: 1. Also provided is a composition comprising the vector described herein.
[0009] The disclosure also contemplates a vaccine comprising a variant of a human
STimulator of INterferon Genes (STING) polynucleotide encoding a STING protein having a
mutation that makes the STING protein constitutively active, wherein the variant induces STING signaling. In one embodiment, the mutation is at residue 154 or 284 of the STING protein of SEQ ID NO: 1. In various embodiment, the mutation is N154S or R284S of SEQ ID NO: 1. In various embodiments of the vaccine, the polynucleotide is in a vector. In one embodiment, vector is a viral vector or a plasmid vector. In various embodiments, the viral vector is selected from the group consisting of vesicular stomatitis virus (VSV), a lentivirus, an adenovirus, an adeno-associated virus, a vaccinia virus and a modified vaccinia Ankara (MVA) virus. Also provided is a composition comprising the vaccine described herein.
[00 0] In various embodiments, the disclosure provides a method of activating STimulator of INterferon Genes (STING) in a subject in need thereof comprising administering a composition comprising a variant of a human STING protein having a mutation that makes the STING protein constitutively active, wherein the composition induces STING signaling.
[0011] Also provided is a method of stimulating an immune response in a subject in need thereof comprising administering a composition comprising a STING variant having a mutation that makes the STING protein constitutively active, wherein the composition induces STING signaling. In various embodiments, the subject is suffering from cancer or a microbial infection.
[0012] In various embodiments, the disclosure contemplates a method of decreasing the size of a tumor in a subject comprising administering a composition a STimulator of INterferon Genes (STING) variant having a mutation that makes the STING protein constitutively active, wherein the composition induces STING signaling. In one embodiment, the disclosure provides a method of treating cancer in a subject comprising administering a composition comprising an activator of STING (STimulator of INterferon Genes) comprising a STING variant having a mutation that makes the STING protein constitutively active, wherein the composition induces STING signaling. In various embodiments, the cancer is ovarian cancer, colon cancer, melanoma, breast cancer or lung cancer. In various embodiments, the tumor size in the subject is decreased by about 25-50%, about 40-70% or about 50-90% or more.
[0013] In various embodiments, the composition is administered intratumorally, intravenously, intra-arterially, intraperitoneally, intranasally, intramuscularly, intradermally or subcutaneously.
[0014] In various embodiments, the composition induces infiltration of immune cells into the tumor. In certain embodiments, the immune cells are macrophages or other phagocytes.
[0015] In various embodiments of the methods, the composition administered is a vector or a vaccine described herein.
[0016] In various embodiments, the disclosure contemplates a method of inhibiting STING signaling in a subject in need thereof comprising administering to the subject a therapeutically effective amount of an inhibitor of 5' adenosine monophosphate-activated protein kinase (AMPK).
[0017] Also contemplated is a method of treating an inflammatory disease in which STING signaling is upregulated comprising administering to a subject in need thereof a therapeutically effective amount of an inhibitor of 5' adenosine monophosphate-activated protein kinase (AMPK). In one embodiment, the disease is an autoimmune disease. In various embodiments, the autoimmune disease is selected from the group consisting of inflammatory bowel disease, ulcerative colitis, Crohn's disease, a peripheral vascular disease, a disorder characterized by lesions having inflammatory cell infiltration, a disorder where amyloid plaques are present in the brain, Alzheimer's disease, Aicardi-Goutieres syndrome, juvenile arthritis, rheumatoid arthritis, osteoporosis, amyotrophic lateral sclerosis, systemic lupus erythmatosis and multiple sclerosis.
[0018] In various embodiments, the subject expresses a mutation in STING that makes the STING protein constitutively active. In certain embodiments, the STING mutation is selected from the group consisting of N154S and R284S of SEQ ID NO: 1.
[0019] In various embodiments, the AMPK inhibitor is selected from the group consisting of dorsomorphin, doxorubicin hydrochloride, GSK690693, BML-275, STO-609, a fasudil salt, gamma-D-glutamylaminomethylsulfonic acid, WZ4003 and HTH-01-015.
[0020] Also provided herein is an adjuvant comprising a STimulator of INterferon Genes (STING) variant having a mutation that makes the STING protein constitutively active. In various embodiments, the STING variant is a polynucleotide and an adjuvant for a nucleic acid vaccine. In various embodiments, the STING variant is a polypeptide. In various embodiments, the STING mutation is selected from the group consisting of N154S and R284S of SEQ ID NO: 1.
[0021] The disclosure further provides a method of enhancing an immune response to a vaccine in a subject receiving said vaccine comprising administering an adjuvant comprising a STimulator of INterferon Genes (STING) variant having a mutation that makes the STING protein constitutively active in conjunction with the vaccine.
BRIEF DESCRIPTION OF THE FIGURES
[0022] Figures 1 A-1 E show the characterization of the Ecuador mutant (R284S) as hyperactive. (Figure 1A) The patient had a missense heterozygous mutation in STING
(TMEM173) gene (c.852G>T; p.R284S). (Figure 1 B) R284S mutation is on the a-helix loop 5 in STING C-terminus. The crystal structure of apo-STING dimer (PDB ID: 4F5W) indicates that R284 may not be involved in STING dimerization or cGAMP-binding. R284 is highly conserved among different species. (Figure 1 C) HEK293T cells were transfected with plasmid encoding human STING (hSTING) or its mutants (N154S, R284S) and the indicated reporter plasmids. Human cGAS (hcGAS) was expressed to generate cGAMP. After 24 h, the luciferase activity was measured. (Figure 1 D) The indicated plasmids were transfected into HEK293T cells. The cell lysates were incubated with biotin-labeled cGAMP for 30 min at 4 °C and then irradiated with UV for 10 min at 1 J/cm2 for crosslinking. After precipitation with streptavidin-beads, the precipitants were washed and then boiled in SDS-sample buffer. Western blots were performed with the indicated antibodies. (Figure 1 E) After transfection with the indicated plasmids into HEK293T cells for 24 h, the cell lysates were incubated with anti-FLAG antibody followed by immunoprecipitation using protein G beads. Western blots were performed for the precipitants with the indicated antibodies. The STING dimer that is resistant to boiling in SDS sample buffer in the same cell lysates was also detected by the indicated antibodies. Data shown here are the averages ± SD (n = 3). * and ** indicate significant difference p < 0.05 and p<0.01 respectively that were determined by Student's t-test. ns means not significant.
[0023] Figures 2A-2F describe that the Ecuador mutant (R284S) constitutively moves and induces inflammation. (Figure 2A) Primary Sting'1' EF cells were reconstituted with wild-type
STING or its mutants (N154S, R284S) using retrovirus. The reconstituted cells were treated with dsDNA (4 μg/ml) using lipofectamine 2000 for 9 h. After fixation, the cells were stained with the indicated antibodies and then the localization of STING and phosphorylated TBK1 (pTBK1 ) was observed using a confocal microscope. (Figure 2B) The reconstituted cells with R284S were treated with BFA (5 μg/ml) for 9 h. The localization of STING was observed as described in
Figure 2A. (Figure 2C) Total RNA was purified from the reconstituted cells after treated with dsDNA as described in Figure 2A and then examined for gene expression using Affymetrix
GeneChip array. The scale represents the intensity of gene expression (log2 scale). (Figure 2D)
The amounts of CXCL10 or IL-6 in the supernatants of the reconstituted cells were measured by
ELISA after treated with poly I.C (1 μg/ml) using lipofectamine 2000 or LPS (10 μg/ml) for 15 h.
(Figure 2E) cDNA was synthesized from total RNA that was extracted from the reconstituted cells and then realtime PCR was performed with Cc/5 probe. (Figure 2F) The reconstituted cells were infected with HSV-1 or VSV at MOI = 1 for 24 h and then plaque assay was performed to
decide the viral titers. Data shown here are the averages ± SD (n = 3). ** indicates significant difference p<0.01 that was determined by Student's t-test.
[0024] Figures 3A-3F show IFN is transiently produced during trafficking. (A) Realtime PCR was performed for Ifnbl expression in the reconstituted primary Sting'1' MEF cells. (B and C) Wild-type STING or its mutants (N154S, R284S) were expressed in primary Sting*'* and Sting'1' MEF cells using retrovirus. The cells were treated with dsDNA (4 μg/ml) using lipofectamine 2000 for 15 h. The amounts of IFNp (B) or CXCL 0 (C) in the supernatants were measured by ELISA. (D) The reconstituted cells were incubated with BFA (5 μg/ml) for 3 h and then washed with culture media twice to remove residual BFA. The indicated times show the time after washing. UT means untreated with BFA. The supernatants were collected at the indicated times and the amounts of IFNp were measured by ELISA. (E) The reconstituted cells expressing R284S were treated with BFA as described in Figure 3D. Total RNA was extracted at the indicated times and then realtime PCR was performed with the indicated probes. (F) The reconstituted cells were lysed after the supernatants were collected as described in Figure 3D and then western blots were performed with the indicated antibodies. Data shown here are the averages ± SD (n = 3). ** indicates significant difference p<0.01 that was determined by Student's t-test. ns means not significant, nd means not detected.
[0025] Figures 4A-4F show that AMPK inhibitors are potential therapeutic drugs for STING- induced inflammatory diseases. (Figure 4A) The reconstituted primary Sting'1' MEF cells were treated with tofacitinib (5 μΜ) or BFA (5 μg/ml) for 9 h and then CXCL10 in the supernatants was measured by ELISA. (Figure 4B) The reconstituted cells were treated with tofacitinib or BFA as described in Figure 4A and then realtime PCR was performed with Ifitl probe. (Figure 4C) Western blots were performed with the indicated antibodies for the cell lysates after the supernatants that were used in Figure 4A were collected. (Figure 4D) The reconstituted cells expressing R284S were treated with the indicated drugs (compound C (10 μΜ), doxorubicin (10 μΜ), GSK 690693 (20 μΜ), tofacitinib (5 μΜ)) for 9 h. Total RNA was purified and then examined for gene expression compared to vehicle as describes in Figure 2C. The scale represents the intensity of gene expression (log2 scale). (Figure 4E) The reconstituted cells expressing N 54S or R284S were treated with the indicated drugs as described in Figure 4D. Realtime PCR was performed with Ifitl, Oasl1, or Rsad2 probe. (Figure 4F) The reconstituted cells expressing R284S were treated with the drugs at the indicated concentration for 9 h.
Wester blots were performed for the cell lysates with the indicated antibodies. Data shown here
are the averages ± SD (n = 3). * and ** indicate significant difference p < 0.05 and p<0.01 respectively that were determined by Student's t-test. ns means not significant.
DETAILED DESCRIPTION
[0026] Reported herein is the identification of an alternate de novo germline missense mutation in exon 5 of STING (R284S). Subsequent examination indicated that STING (R284S) was a constitutively active gain-of-function, dominant-negative mutant that could traffic through the golgi and trigger innate immune signaling in the absence of CDN's. JAK inhibitors such as tofacitinib failed to significantly repress STING (R284S) function, but use of an AMPK/AKT inhibitor GSK 690693, which affected ULK1 activity, robustly inhibited STING-dependent IRF3 activation. This disclosure underscores the growing incidence of deregulated STING signaling in manifesting chronic cytokine related disease and indicates that suppression of STING- dependent IRF3 activation may be useful for the treatment of a wide-range of autoinflammatory disorders.
[0027] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The following references provide one of skill with a general definition of many of the terms used in this invention: Singleton, et al., DICTIONARY OF MICROBIOLOGY AND
MOLECULAR BIOLOGY (2d ed. 1994); THE CAMBRIDGE DICTIONARY OF SCIENCE AND TECHNOLOGY (Walker ed., 1988); THE GLOSSARY OF GENETICS, 5TH ED., R. Rieger, et al. (eds.), Springer Verlag (1991); and Hale and Marham, THE HARPER COLLINS
DICTIONARY OF BIOLOGY (1991).
[0028] Each publication, patent application, patent, and other reference cited herein is incorporated by reference in its entirety to the extent that it is not inconsistent with the present disclosure.
[0029] It is noted here that, as used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural reference unless the context clearly dictates otherwise.
[0030] As used herein, the following terms have the meanings ascribed to them unless specified otherwise.
Definitions
[0031] The term "STimulator of INterferon Genes" or "STING" as used herein includes, without limitation, nucleic acids, polynucleotides, oligonucleotides, sense and antisense polynucleotide strands, complementary sequences, peptides, polypeptides, proteins, homologous and/or orthologous STING molecules, isoforms, precursors, mutants, variants, derivatives, splice variants, alleles, different species, and active fragments thereof.
[0032] An "active STING mutant" refers to a mutant of STING protein which results in a gain- of-function mutant in which STING is constitutively active. An active STING mutant is also a STING variant polynucleotide having a mutation in the wild type STING protein. Exemplary constitutively active mutations include, but are not limited to, N154S or R284S of SEQ ID NO: 1.
[0033] The terms "polynucleotide" and "nucleic acid", used interchangeably herein, refer to a polymeric form of nucleotides of any length, either ribonucleotides or deoxyribonucleotides. These terms include a single-, double- or triple-stranded DNA, genomic DNA, cDNA, genomic RNA, mRNA, DNA-RNA hybrid, or a polymer comprising purine and pyrimidine bases, or other natural, chemically, biochemically modified, non-natural or derivatized nucleotide bases. The backbone of the polynucleotide can comprise sugars and phosphate groups (as may typically be found in RNA or DNA), or modified or substituted sugar or phosphate groups. Alternatively, the backbone of the polynucleotide can comprise a polymer of synthetic subunits such as phosphoramidates and thus can be a oligodeoxynucleoside phosphoramidate (P-NH2) or a mixed phosphoramidate-phosphodiester oligomer. Peyrottes et al. (1996) Nucleic Acids Res. 24: 1841-8; Chaturvedi et al. (1996) Nucleic Acids Res. 24: 2318-23; Schultz et al. (1996) Nucleic Acids Res. 24: 2966-73. A phosphorothioate linkage can be used in place of a phosphodiester linkage. Braun et al. (1988) J. Immunol. 141 : 2084-9; Latimer et al. (1995) Molec. Immunol. 32: 1057-1064. In addition, a double-stranded polynucleotide can be obtained from the single stranded polynucleotide product of chemical synthesis either by synthesizing the complementary strand and annealing the strands under appropriate conditions, or by synthesizing the complementary strand de novo using a DNA polymerase with an appropriate primer. Reference to a polynucleotide sequence (such as referring to a SEQ ID NO) also includes the complement sequence.
[0034] The following are non-limiting examples of polynucleotides: a gene or gene fragment, exons, introns, genomic RNA, mRNA, tRNA, rRNA, ribozymes, cDNA, recombinant
polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers. A polynucleotide may
comprise modified nucleotides, such as methylated nucleotides and nucleotide analogs, uracyl, other sugars and linking groups such as fluororibose and thioate, and nucleotide branches. The sequence of nucleotides may be interrupted by non-nucleotide components. A polynucleotide may be further modified after polymerization, such as by conjugation with a labeling component. Other types of modifications included in this definition are caps, substitution of one or more of the naturally occurring nucleotides with an analog, and introduction of means for attaching the polynucleotide to proteins, metal ions, labeling components, other polynucleotides, or a solid support.
[0035] "Encoding" refers to the inherent property of specific sequences of nucleotides in a polynucleotide, such as a gene, a cDNA, or an mRNA, to serve as templates for synthesis of other polymers and macromolecules in biological processes having either a defined sequence of nucleotides (i.e., rRNA, tRNA and mRNA) or a defined sequence of amino acids and the biological properties resulting therefrom. Thus, a gene encodes a protein if transcription and translation of mRNA produced by that gene produces the protein in a cell or other biological system. Both the coding strand, the nucleotide sequence of which is identical to the mRNA sequence and is usually provided in sequence listings, and non-coding strand, used as the template for transcription, of a gene or cDNA can be referred to as encoding the protein or other product of that gene or cDNA. Unless otherwise specified, a "nucleotide sequence encoding an amino acid sequence" includes all nucleotide sequences that are degenerate versions of each other and that encode the same amino acid sequence. Nucleotide sequences that encode proteins and RNA may include introns.
[0036] "Under transcriptional control" is a term well understood in the art and indicates that transcription of a polynucleotide sequence depends on its being operably (operatively) linked to an element which contributes to the initiation of, or promotes, transcription. "Operably linked" refers to a juxtaposition wherein the elements are in an arrangement allowing them to function.
[0037] As used herein, in the context of the viral vectors , a "heterologous polynucleotide" or "heterologous gene" or "transgene" is any polynucleotide or gene that is not present in wild-type viral vector.
[0038] As used herein, in the context of the vectors, a "heterologous" promoter is one which is not associated with or derived from the vector itself.
[0039] A "host cell" includes an individual cell or cell culture which can be or has been a recipient of a vector(s) described herein. Host cells include progeny of a single host cell, and the progeny may not necessarily be completely identical (in morphology or in total DNA
complement) to the original parent cell due to natural, accidental, or deliberate mutation and/or change. A host cell includes cells transfected, transformed or infected in vivo or in vitro with a vector herein.
[0040] A "vector" (sometimes referred to as gene delivery or gene transfer "vehicle") refers to a macromolecule or complex of molecules comprising a polynucleotide to be delivered to a host cell, either in vitro or in vivo. The polynucleotide to be delivered may comprise a coding sequence of interest in gene therapy. Vectors include, for example, viral vectors, such as vesicular stomatitis virus (VSV), lentivirus, adenovirus, adeno-associated virus, vaccinia virus, or modified vaccinia Ankara (MVA) virus vectors, liposomes and other lipid-containing complexes, and other macromolecular complexes capable of mediating delivery of a
polynucleotide to a host cell. Vectors may be, for example, "cloning vectors" which are designed for isolation, propagation and replication of inserted nucleotides, "expression vectors" which are designed for expression of a nucleotide sequence in a host cell, or a "viral vector" which is designed to result in the production of a recombinant virus or virus-like particle, or "shuttle vectors", which comprise the attributes of more than one type of vector.
[0041] Vectors can also comprise other components or functionalities that further modulate gene delivery and/or gene expression, or that otherwise provide beneficial properties to the targeted cells. As described and illustrated in more detail below, such other components include, for example, components that influence binding or targeting to cells (including components that mediate cell-type or tissue-specific binding); components that influence uptake of the vector nucleic acid by the cell; components that influence localization of the
polynucleotide within the cell after uptake (such as agents mediating nuclear localization); and components that influence expression of the polynucleotide. Such components also might include markers, such as detectable and/or selectable markers that can be used to detect or select for cells that have taken up and are expressing the nucleic acid delivered by the vector. Such components can be provided as a natural feature of the vector (such as the use of certain viral vectors which have components or functionalities mediating binding and uptake), or vectors can be modified to provide such functionalities. Other vectors include those described by Chen et al; BioTechniques, 34: 167-171 (2003). A large variety of such vectors are known in the art and are generally available.
[0042] The term "expression vector" as used herein refers to a vector containing a nucleic acid sequence coding for at least part of a gene product capable of being transcribed. In some cases, RNA molecules are then translated into a protein, polypeptide, or peptide. In other cases,
these sequences are not translated, for example, in the production of antisense molecules, siRNA, ribozymes, and the like. Expression vectors can contain a variety of control sequences, which refer to nucleic acid sequences necessary for the transcription and possibly translation of an operatively linked coding sequence in a particular host organism. In addition to control sequences that govern transcription and translation, vectors and expression vectors may contain nucleic acid sequences that serve other functions as well.
[0043] A "DNA Vaccine" or "DNA vector" as used herein refers to a synthetic DNA structure that can be transcribed in target cells and can comprise a linear nucleic acid such as a purified DNA, a DNA incorporated in a plasmid vector, or a DNA incorporated into any other vector suitable for introducing DNA into a host cell. In various embodiments, the DNA vaccine can be naked DNA. Provided herein is a naked DNA vaccine, a plasmid DNA vaccine or a viral vector vaccine. It is contemplated that the vaccine is a live viral vaccine, live attenuated viral vaccine, or inactivated or killed viral vaccine. In various embodiments, the vaccine may comprise viruslike particles (VLPs).
[0044] "Vesicular stomatitis virus" or "VSV" as used herein refers to any strain of VSV or mutant forms of VSV, such as those described in WO 01/19380 or US20140088177. A VSV construct herein may be in any of several forms, including, but not limited to, genomic RNA, mRNA, cDNA, part or all of the VSV RNA encapsulated in the nucleocapsid core, VSV complexed with compounds such as PEG and VSV conjugated to a nonviral protein. VSV vectors useful herein encompass replication-competent and replication-defective VSV vectors, such as, VSV vectors lacking G glycoprotein.
[0045] As used herein, "vaccine" refers to a composition comprising a vector comprising a mutated STING as described herein, which is useful in the treatment of cancer or other conditions in which enhanced immune response is indicated. It is contemplated that the vaccine comprises a pharmaceutically acceptable carrier and/or an adjuvant. It is contemplated that vaccines are prophylactic or therapeutic. A "prophylactic" treatment is a treatment administered to a subject who does not exhibit signs of a disease or exhibits only early signs for the purpose of decreasing the risk of developing pathology. The compounds of the invention may be given as a prophylactic treatment to reduce the likelihood of developing a pathology or to minimize the severity of the pathology, if developed. A "therapeutic" treatment is a treatment administered to a subject who exhibits signs or symptoms of pathology for the purpose of diminishing or eliminating those signs or symptoms. The signs or symptoms may be biochemical, cellular, histological, functional, subjective or objective.
[0046] The term "induces or enhances an immune response" as used herein refers to causing a statistically measurable induction or increase in an immune response over a control sample to which the peptide, polypeptide or protein has not been administered. Preferably the induction or enhancement of the immune response results in a prophylactic or therapeutic response in a subject. Examples of immune responses are increased production of type I IFN, increased resistance to viral and other types of infection by alternate pathogens. The enhancement of immune responses to tumors (anti-tumor responses), or the development of vaccines to prevent tumors or eliminate existing tumors.
[0047] The "treatment of cancer", refers to one or more of the following effects: (1) inhibition, to some extent, of tumor growth, including, (i) slowing down and (ii) complete growth arrest; (2) reduction in the number of tumor cells; (3) maintaining tumor size; (4) reduction in tumor size; (5) inhibition, including (i) reduction, (ii) slowing down or (iii) complete prevention, of tumor cell infiltration into peripheral organs; (6) inhibition, including (i) reduction, (ii) slowing down or (iii) complete prevention, of metastasis; (7) enhancement of anti-tumor immune response, which may result in (i) maintaining tumor size, (ii) reducing tumor size, (iii) slowing the growth of a tumor, (iv) reducing, slowing or preventing invasion and/or (8) relief, to some extent, of the severity or number of one or more symptoms associated with the disorder.
[0048] As used herein, "isolated" refers to a polynucleotide, virus or antigenic composition that is removed from its native environment. Thus, an isolated biological material is free of some or all cellular components, i.e., components of the cells in which the native material occurs naturally (e.g., cytoplasmic or membrane component). In one aspect, a polynucleotide, virus or antigenic composition is deemed isolated if it is present in a cell extract or supernatant. In the case of nucleic acid molecules, an isolated nucleic acid includes a PCR product, an isolated mRNA, a cDNA, or a restriction fragment.
[0049] "Purified" as used herein refers to a virus or immunogenic composition that has been isolated under conditions that reduce or eliminate the presence of unrelated materials, i.e., contaminants, including endogenous materials from which the composition is obtained. By way of example, and without limitation, a purified virion is substantially free of host cell or culture components, including tissue culture or cell proteins and non-specific pathogens. In various embodiments, purified material substantially free of contaminants is at least 50% pure; at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or even at least 99% pure. Purity can be evaluated by chromatography, gel
electrophoresis, immunoassay, composition analysis, biological assay, and other methods known in the art.
[0050] As used herein, "pharmaceutical composition" refers to a composition suitable for administration to a subject animal, including humans and mammals. A pharmaceutical composition comprises a pharmacologically effective amount of a virus or antigenic composition of the invention and also comprises a pharmaceutically acceptable carrier. A pharmaceutical composition encompasses a composition comprising the active ingredient(s), and the inert ingredient(s) that make up the pharmaceutically acceptable carrier, as well as any product which results, directly or indirectly, from combination, complexation or aggregation of any two or more of the ingredients. Accordingly, the pharmaceutical compositions of the present invention encompass any composition made by admixing a compound or conjugate of the present invention and a pharmaceutically acceptable carrier.
[0051] As used herein, "pharmaceutically acceptable carrier" include any and all clinically useful solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, buffers, and excipients, such as a phosphate buffered saline solution, 5% aqueous solution of dextrose or mannitol, and emulsions, such as an oil/water or water/oil emulsion, and various types of wetting agents and/or adjuvants. Suitable
pharmaceutical carriers and formulations are described in Remington's Pharmaceutical
Sciences, 19th Ed. (Mack Publishing Co., Easton, 1995). Pharmaceutical carriers useful for the composition depend upon the intended mode of administration of the active agent. Typical modes of administration include, but are not limited to, enteral (e.g., oral) or parenteral (e.g., subcutaneous, intramuscular, intravenous or intraperitoneal injection; or topical, transdermal, or transmucosal administration). A "pharmaceutically acceptable salt" is a salt that can be formulated into a compound or conjugate for pharmaceutical use including, e.g., metal salts (sodium, potassium, magnesium, calcium, etc.) and salts of ammonia or organic amines.
[0052] As used herein, "pharmaceutically acceptable" or "pharmacologically acceptable" refers to a material which is not biologically or otherwise undesirable, i.e., the material may be administered to an individual without causing any undesirable biological effects or interacting in a deleterious manner with any of the components of the composition in which it is contained, or when administered using routes well-known in the art, as described below.
[0053] As used herein, a "condition" or "disorder" associated with a "target" in which modification of target activity described herein is beneficial and also includes other disorders in which high levels of target have been shown to be or are suspected of being either responsible
for the pathophysiology of the disorder or a factor that contributes to a worsening of the disorder, as well as diseases and other disorders in which modulation of the target is associated with changes in clinical signs or symptoms. Such disorders may be evidenced, for example, by an increase in the levels of target secreted and/or on the cell surface and/or modified target signaling in the affected cells or tissues of a subject suffering from the disorder. Exemplary diseases, conditions or disorders that can be treated with a STING activator are described in more detail in the Detailed Description.
STING (Stimulator of Interferon Genes)
[0054] STING (Stimulator of Interferon Genes), a molecule that plays a key role in the innate immune response, includes 5 putative transmembrane (TM) regions, predominantly resides in the endoplasmic reticulum (ER), and is able to activate both NF-κΒ and Interferon Regulatory Factor 3 (IRF3) transcription pathways to induce type I IFN and to exert a potent anti-viral state following expression. Human STING is a 379 amino acid protein, having an amino acid sequence set out in Genbank Accession No. NP_938023 and nucleotide sequence set out in Genbank Accession No. NM_198282, though alternate protein isoforms may exist (Genbank Accession Nos. NP_001288667.1, XP_011535942.1, XP_011535941.1). See e.g., U.S. patent publication 20130039933 and PCT/US2009/052767, herein incorporated by reference in their entirety. The amino acid sequence of human STING (379 amino acids) (SEQ ID NO: 1) is set out below: M P H S S L H P S I P C P R G H G A Q K A A L V L L S A C L V T L W
G L G E P P E H T L R Y L V L H L A S L Q L G L L L N G V C S L A E E L R H I H S R Y R G S Y W R T V R A C L G C P L R R G A L L L L S I Y F Y Y S L P N A V G P P F T W M L A L L G L S Q A L N I L L G L K G L A P A E I S A V C E G N F N V A H G L A W S Y Y I G Y L R L I L P E L Q A R I R T Y N Q H Y N N L L R G A V S Q R L Y I L L P L D C G V P D N L S A D P N I R F L D K L P Q Q T G D H A G I K D R V Y S N S I Y E L L E N G Q R A G T C V L E Y A T P L Q T L F A M S Q Y S Q A G F S R E D R L E Q A K L F C R T L E D I L A D A P E S Q N N C R L I A Y Q E P A D D S S F S L S Q E V L R H L R Q E E K E E V T V G S L K T S A V P S T S T M S Q E P E L L I S G E K P L P L R T D F S.
[0055] Loss of STING reduced the ability of polyl:C to activate type I IFN and rendered murine embryonic fibroblasts lacking STING ("'" MEFs) generated by targeted homologous recombination, susceptible to vesicular stomatitis virus (VSV) infection. In the absence of STING, DNA-mediated type I IFN responses were inhibited, indicating that STING may play an important role in recognizing DNA from viruses, bacteria, and other pathogens which can infect cells. Yeast-two hybrid and co-immunoprecipitation studies indicated that STING interacts with
RIG-I and with Ssr2/TRAPP, a member of the translocon-associated protein (TRAP) complex required for protein translocation across the ER membrane following translation. RNAi ablation of TRAP inhibited STING function and impeded the production of type I IFN in response to polylC.
[0056] Additional experiments have shown that STING itself binds nucleic acids including single- and double-stranded DNA such as from pathogens and apoptotic DNA, and plays a central role in regulating proinflammatory gene expression in inflammatory conditions such as DNA-mediated arthritis and cancer. Certain inhibitors and activators of STING are discussed in International Patent Publication No. WO 2013/166000.
Methods of Use
[0057] In various embodiments, the disclosure provides a method of activating the immune system using a constitutively active mutant of the STING protein. Contemplated is
administration of a vector or vaccine comprising the active STING protein or polynucleotide encoding the protein to a subject in need of immune system stimulation. In various
embodiments, the immune response is an ongoing immune response in cancer, a microbial infection or an autoimmune disease. In various embodiments, the STING mutant may be administered prophylactically in a disease or disorder in which an immune response is in a remission phase, e.g., in cancer or an autoimmune disease.
[0058] In various embodiments, the disclosure provides a method of suppressing STING in a subject in need thereof comprising administering a composition comprising an inhibitor of AMPK, wherein the kinase inhibitor inhibits STING signaling. Exemplary AMPK inhibitors include, but are not limited to, dorsomorphin, doxorubicin hydrochloride, GSK690693, BML-275, STO-609, a fasudil salt, gamma-D-glutamylaminomethylsulfonic acid, WZ4003 and HTH-01- 015.
[0059] In one embodiment, the disclosure provides a method of decreasing the size of a tumor in a subject having a tumor or cancer comprising administering a composition comprising an active mutant of STING. Also provided is a method for treating cancer or preventing the recurrence of cancer comprising administering to a subject in need thereof a therapeutically effective amount of a active STING mutant or a pharmaceutical composition comprising an active STING mutant or vector or vaccine comprising a active mutant as described herein.
[0060] Exemplary conditions or disorders that can be treated with an active STING mutant include cancers, such as esophageal cancer, pancreatic cancer, metastatic pancreatic cancer,
metastatic adenocarcinoma of the pancreas, bladder cancer, stomach cancer, fibrotic cancer, glioma, malignant glioma, diffuse intrinsic pontine glioma, recurrent childhood brain neoplasm renal cell carcinoma, clear-cell metastatic renal cell carcinoma, kidney cancer, prostate cancer, metastatic castration resistant prostate cancer, stage IV prostate cancer, metastatic melanoma, melanoma, malignant melanoma, recurrent melanoma of the skin, melanoma brain metastases, stage IIIA skin melanoma; stage IIIB skin melanoma, stage NIC skin melanoma; stage IV skin melanoma, malignant melanoma of head and neck, lung cancer, non-small cell lung cancer (NSCLC), squamous cell non-small cell lung cancer, breast cancer, recurrent metastatic breast cancer, hepatocellular carcinoma, hodgkin's lymphoma, follicular lymphoma, non-hodgkin's lymphoma, advanced B-cell NHL, HL including diffuse large B-cell lymphoma (DLBCL), multiple myeloma, chronic myeloid leukemia, adult acute myeloid leukemia in remission; adult acute myeloid leukemia with Inv(16)(p13.1q22); CBFB-MYH11 ; adult acute myeloid leukemia with t(16;16)(p13.1 ;q22); CBFB-MYH11 ; adult acute myeloid leukemia with t(8;21)(q22;q22);
RUNX1-RUNX1T1 ; adult acute myeloid leukemia with t(9;1 1)(p22;q23); MLLT3-MLL; adult acute promyelocytic leukemia with t(15;17)(q22;q12); PML-RARA; alkylating agent-related acute myeloid leukemia, chronic lymphocytic leukemia, richter's syndrome; Waldenstrom
macroglobulinemia, adult glioblastoma; adult gliosarcoma, recurrent glioblastoma, recurrent childhood rhabdomyosarcoma, recurrent Ewing sarcoma/ peripheral primitive neuroectodermal tumor, recurrent neuroblastoma; recurrent osteosarcoma, colorectal cancer, MSI positive colorectal cancer; MSI negative colorectal cancer, nasopharyngeal nonkeratinizing carcinoma; recurrent nasopharyngeal undifferentiated carcinoma, cervical adenocarcinoma; cervical adenosquamous carcinoma; cervical squamous cell carcinoma; recurrent cervical carcinoma; stage IVA cervical cancer; stage IVB cervical cancer, anal canal squamous cell carcinoma; metastatic anal canal carcinoma; recurrent anal canal carcinoma, recurrent head and neck cancer; carcinoma, squamous cell of head and neck, head and neck squamous cell carcinoma (HNSCC), ovarian carcinoma, colon cancer, gastric cancer, advanced Gl cancer, gastric adenocarcinoma; gastroesophageal junction adenocarcinoma, bone neoplasms, soft tissue sarcoma; bone sarcoma, thymic carcinoma, urothelial carcinoma, recurrent merkel cell carcinoma; stage III merkel cell carcinoma; stage IV merkel cell carcinoma, myelodysplasia syndrome and recurrent mycosis fungoides and Sezary syndrome.
[0061] In some embodiments, cancers that can be treated with the present invention include ovarian cancer, colon cancer, melanoma, breast cancer or lung cancer.
[0062] It is contemplated that the methods herein reduce tumor size or tumor burden in the subject, and/or reduce metastasis in the subject. In various embodiments, the methods reduce
the tumor size by 10%, 20%, 30% or more. In various embodiments, the methods reduce tumor size by 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100%.
[0063] It is contemplated that the methods herein reduce tumor burden, and also reduce or prevent the recurrence of tumors once the cancer has gone into remission.
[0064] In various embodiments, the active STING mutant compositions described herein modulates immune cells in a tumor. In some embodiments, the active STING mutant compositions increases the number of macrophages or other phagocytes or antigen presenting cells in a tumor and/or increases phagocytic activity of cells in the area of the tumor.
[0065] Other conditions or disorders contemplated for treatment with an active STING mutant as described herein include infectious diseases or autoimmune disease in which an increase in immune response may be desired. Exemplary conditions include, but are not limited to, an inflammatory bowel disease (e.g., ulcerative colitis or Crohn's disease), a peripheral vascular disease, a cerebral vascular accident (stroke), a disorder characterized by lesions having inflammatory cell infiltration, a disorder where amyloid plaques are present in the brain (e.g., Alzheimer's disease), Aicardi-Goutieres syndrome, juvenile arthritis, osteoporosis, amyotrophic lateral sclerosis, or multiple sclerosis.
[0066] Exemplary microbial infections contemplated include viral, bacterial or fungal infection. Methods of Administration
[0067] Many methods may be used to administer or introduce the active STING mutant or vectors, vaccines or viral particles comprising the active STING mutant into individuals (i.e., including subjects or patients), including but not limited to, intratumorally, intravenously, intra- arterially, intraperitoneally, intranasally, intramuscularly, intradermally, subcutaneously, orally or by continuous infusion.
[0068] The individual to which a vector or viral particle is administered is a primate, or in other examples, a mammal, or in other examples, a human, but can also be a non-human mammal including but not limited to cows, horses, sheep, pigs, fowl, cats, dogs, hamsters, mice and rats. In the use of a vector, vaccines or viral particles, the individual can be any animal in which a vector or virus is capable introducing the active STING mutant and results in activation of the immune response.
[0069] The present invention encompasses compositions comprising active STING mutants, vectors, vaccines or viral particles wherein said compositions can further comprise a
pharmaceutically acceptable carrier. The amount of vector(s) to be administered will depend on several factors, such as route of administration, the condition of the individual, the degree of aggressiveness of the malignancy, and the particular vector employed. Also, the vector may be used in conjunction with other treatment modalities.
[0070] If administered as a viral vector(s), vaccines or viral particles from about 102 up to about 107 p.f.u., in other examples, from about 103 up to about 106 p.f.u., and in other examples, from about 104 up to about 10s p.f.u. is administered. If administered as a polynucleotide construct (i.e., not packaged as a virus), about 0.01 μg to about 100 pg of a viral construct of the present invention can be administered, in other examples, 0.1 pg to about 500 pg, and in other examples, about 0.5 pg to about 200 pg can be administered. More than one vector can be administered, either simultaneously or sequentially. Administrations are typically given periodically, while monitoring any response. Administration can be given, for example, intramuscularly, intravenously, intratumorally or intraperitoneally.
[0071] It is contemplated that an effective amount of the active STING mutant, vector(s), vaccines or viral particles is administered. An "effective amount" is an amount sufficient to achieve a desired biological effect such as to induce enough humoral or cellular immunity. This may be dependent upon the type of vaccine, the age, sex, health, and weight of the recipient. Examples of desired biological effects include, but are not limited to, increase in immune response, increase in STING stimulation, decrease in tumor size or tumor burden, production of no symptoms or reduction in symptoms related to disease or condition being treated.
[0072] A vaccine or composition of the present invention is physiologically significant if its presence results in a detectable change in the physiology of a recipient patient that enhances at least one primary or secondary humoral or cellular immune response against a tumor or other targeted cell or microbe. For example, in certain embodiments, the active STING mutant increases infiltration of immune cells into the tumor or site of infection. In certain embodiments, the immune cells are macrophages, dendritic cells or other phaogcytes.
[0073] The composition, if desired, can also contain minor amounts of wetting or emulsifying agents or pH buffering agents. The composition can be a liquid solution, suspension, emulsion, tablet, pill, capsule, sustained release formulation, or powder. Oral formulation can include standard carriers such as pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate, etc.
[0074] Generally, the ingredients are supplied either separately or mixed together in unit dosage form, for example, as a dry lyophilized powder or water free concentrate in a
hermetically sealed container such as an ampoule or sachet indicating the quantity of active agent. Where the composition is administered by injection, an ampoule of sterile diluent can be provided so that the ingredients may be mixed prior to administration.
[0075] Pharmaceutical compositions of the present disclosure containing the inhibitors described herein as an active ingredient may contain pharmaceutically acceptable carriers or additives depending on the route of administration. Examples of such carriers or additives include water, a pharmaceutical acceptable organic solvent, collagen, polyvinyl alcohol, polyvinylpyrrolidone, a carboxyvinyl polymer, carboxymethylcellulose sodium, polyacrylic sodium, sodium alginate, water-soluble dextran, carboxymethyl starch sodium, pectin, methyl cellulose, ethyl cellulose, xanthan gum, gum Arabic, casein, gelatin, agar, diglycerin, glycerin, propylene glycol, polyethylene glycol, Vaseline, paraffin, stearyl alcohol, stearic acid, human serum albumin (HSA), mannitol, sorbitol, lactose, a pharmaceutically acceptable surfactant and the like. Additives used are chosen from, but not limited to, the above or combinations thereof, as appropriate, depending on the dosage form of the present disclosure.
[0076] Formulation of the pharmaceutical composition will vary according to the route of administration selected (e.g., solution, emulsion). An appropriate composition comprising the inhibitor, e.g., an antibody, to be administered can be prepared in a physiologically acceptable vehicle or carrier. For solutions or emulsions, suitable carriers include, for example, aqueous or alcoholic/aqueous solutions, emulsions or suspensions, including saline and buffered media. Parenteral vehicles can include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's or fixed oils. Intravenous vehicles can include various additives, preservatives, or fluid, nutrient or electrolyte replenishers.
[0077] A variety of aqueous carriers, e.g., sterile phosphate buffered saline solutions, bacteriostatic water, water, buffered water, 0.4% saline, 0.3% glycine, and the like, and may include other proteins for enhanced stability, such as albumin, lipoprotein, globulin, etc., subjected to mild chemical modifications or the like.
[0078] Therapeutic formulations of the inhibitors are prepared for storage by mixing the inhibitor having the desired degree of purity with optional physiologically acceptable carriers, excipients or stabilizers (Remington's Pharmaceutical Sciences 16th edition, Osol, A. Ed.
(1980)), in the form of lyophilized formulations or aqueous solutions. Acceptable carriers, excipients, or stabilizers are nontoxic to recipients at the dosages and concentrations employed, and include buffers such as phosphate, citrate, and other organic acids; antioxidants including ascorbic acid and methionine; preservatives (such as octadecyldimethylbenzyl ammonium
chloride; hexamethonium chloride; benzalkonium chloride, benzethonium chloride; phenol, butyl or benzyl alcohol; alkyl parabens such as methyl or propyl paraben; catechol; resorcinol;
cyclohexanol; 3-pentanol; and m-cresol); low molecular weight (less than about 10 residues) polypeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, histidine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins; chelating agents such as EDTA; sugars such as sucrose, mannitol, trehalose or sorbitol; salt-forming counter-ions such as sodium; metal complexes (e.g., Zn-protein complexes); and/or non-ionic surfactants such as TWEEN™, PLURONICS™ or polyethylene glycol (PEG).
[0079] The formulation herein may also contain more than one active compound as necessary for the particular indication being treated, preferably those with complementary activities that do not adversely affect each other. Such molecules are suitably present in combination in amounts that are effective for the purpose intended.
[0080] The active ingredients may also be entrapped in microcapsule prepared, for example, by coacervation techniques or by interfacial polymerization, for example,
hydroxymethylcellulose or gelatin-microcapsule and poly-(methylmethacylate) microcapsule, respectively, in colloidal drug delivery systems (for example, liposomes, albumin microspheres, microemulsions, nano-particles and nanocapsules) or in macroemulsions. Such techniques are disclosed in Remington's Pharmaceutical Sciences 16th edition, Osol, A. Ed. (1980).
[0081] The formulations to be used for in vivo administration must be sterile. This is readily accomplished by filtration through sterile filtration membranes.
[0082] The dose of vector, vaccine or viral particle to be employed in the formulation will also depend on the route of administration, and the nature of the patient, and should be decided according to the judgment of the practitioner and each patient's circumstances according to standard clinical techniques. The exact amount of vector or virus utilized in a given preparation is not critical provided that the minimum amount of virus necessary to produce immunologic activity is given. A dosage range of as little as about 10 mg, up to amount a milligram or more, is contemplated.
[0083] Effective doses of the vector or viral particle of the disclosure may also be extrapolated from dose-response curves derived from animal model test systems.
[0084] In one embodiment, administration is performed at the site of a cancer or affected tissue needing treatment by direct injection into the site or via a sustained delivery or sustained release mechanism, which can deliver the formulation internally. For example, biodegradable microspheres or capsules or other biodegradable polymer configurations capable of sustained delivery of a composition (e.g., a soluble polypeptide, antibody, or small molecule) can be included in the formulations of the disclosure implanted near or at site of the cancer.
[0085] Therapeutic compositions may also be delivered to the patient at multiple sites. The multiple administrations may be rendered simultaneously or may be administered over a period of time. In certain cases it is beneficial to provide a continuous flow of the therapeutic composition. Additional therapy may be administered on a period basis, for example, hourly, daily, every other day, twice weekly, three times weekly, weekly, every 2 weeks, every 3 weeks, monthly, or at a longer interval.
[0086] It is further contemplated that the AMPK inhibitor may also be administered in the methods of the disclosure in a manner described above. Additionally, the AMPK compositions may be formulated as described above.
Combination Therapy
[0087] It is contemplated that a vector or vaccine of the present disclosure or composition thereof is administered with a second agent useful for treating a condition or disorder for which active STING mutant therapy is used, e.g., cancer, infection or autoimmune disease.
[0088] Also contemplated is use of an AMPK inhibitor with a second agent useful for treating a condition or disorder as described herein.
[0089] Concurrent administration of two therapeutic agents does not require that the agents be administered at the same time or by the same route, as long as there is an overlap in the time period during which the agents are exerting their therapeutic effect. Simultaneous or sequential administration is contemplated, as is administration on different days or weeks.
[0090] The second agent may be other therapeutic agents, such as cytokines, growth factors, other inhibitors and antibodies to target antigens useful for treating cancer or immunological disorders, for example ipilimumab (YERVOY®, Bristol-Myers Squibb Company), an antibody to CTLA-4; bevacizumab (AVASTIN®, Genentech), an antibody to VEGF-A; erlotinib
(TARCEVA®, Genentech and OSI Pharmaceuticals), a tyrosine kinase inhibitor which acts on EGFR, dasatinib (SPRYCEL®, Bristol-Myers Squibb Company), an oral Bcr-AbI tyrosone kinase inhibitor; IL-21 ; pegylated IFN-a2b; axitinib (INLYTA®, Pfizer, Inc.), a tyrosine kinase inhibitor;
and trametinib (MEKINIST®, GlaxoSmith line), a MEK inhibitor (Philips and Atkins, Int
Immunol., 27(1):39-46 (2015) which is incorporated herein by reference).
[0091] It is contemplated that the active STING mutant of the present disclosure, or AMPK inhibitor, and second agent may be given simultaneously, in the same formulation. It is further contemplated that the active STING mutant, or AMPK inhibitor, and second agent are administered in a separate formulation and administered concurrently, with concurrently referring to agents given within 30 minutes of each other. It is further contemplated that the third agent may be given simultaneously with the inhibitors.
[0092] In another aspect, a active STING mutant, or AMPK inhibitor, is administered prior to administration of the second agent. Prior administration refers to administration of an active STING mutant, or AMPK inhibitor, within the range of one week prior to treatment with the second agent, up to 30 minutes before administration of the second agent. It is further contemplated that an active STING mutant, or AMPK inhibitor, is administered subsequent to administration a second agent. Subsequent administration is meant to describe administration from 30 minutes after active STING mutant, or AMPK inhibitor, treatment up to one week after active STING mutant, or AMPK inhibitor, administration.
[0093] It is further contemplated that other adjunct therapies may be administered, where appropriate. For example, the patient may also be administered surgical therapy,
chemotherapy, a cytotoxic agent, photodynamic therapy or radiation therapy where appropriate.
[0094] It is further contemplated that when the active STING mutant, or AMPK inhibitor, composition herein are administered in combination with a second agent, such as for example, wherein the second agent is a cytokine or growth factor, or a chemotherapeutic agent, the administration also includes use of a radiotherapeutic agent or radiation therapy. The radiation therapy administered in combination with an antibody composition is administered as determined by the treating physician, and at doses typically given to patients being treated for cancer.
[0095] A cytotoxic agent refers to a substance that inhibits or prevents the function of cells and/or causes destruction of cells. The term is intended to include radioactive isotopes (e.g.,
1131 , 1125, Y90 and Re186), chemotherapeutic agents, and toxins such as enzymatically active toxins of bacterial, fungal, plant or animal origin or synthetic toxins, or fragments thereof. A non- cytotoxic agent refers to a substance that does not inhibit or prevent the function of cells and/or does not cause destruction of cells. A non-cytotoxic agent may include an agent that can be activated to be cytotoxic. A non-cytotoxic agent may include a bead, liposome, matrix or
particle (see, e.g., U.S. Patent Publications 2003/0028071 and 2003/0032995 which are incorporated by reference herein). Such agents may be conjugated, coupled, linked or associated with an antibody according to the disclosure.
[0096] Chemotherapeutic agents contemplated for use with the antibodies of the present disclosure include, but are not limited to those listed in Table I:
Table I
Alkylating aqents Natural products
Nitroaen mustards Antimitotic druqs
mechlorethamine
cyclophosphamide Taxanes
if osf amide paclitaxel
melphalan Vinca alkaloids
chlorambucil vinblastine (VLB)
vincristine
Nitrosoureas vinorelbine
carmustine (BCNU) Taxotere® (docetaxel)
lomustine (CCNU) estramustine
semustine (methyl-CCNU) estramustine phosphate
Ethvlenimine/Methvl-melamine EpipodODhvlotoxins
thriethylenemelamine (TEM) etoposide
triethylene thiophosphoramide teniposide
(thiotepa)
hexamethylmelamine Antibiotics
(HMM, altretamine) actimomycin D
daunomycin (rubido-mycin)
Alkvl sulfonates doxorubicin (adria-mycin)
busulfan mitoxantroneidarubicin
bleomycin
Triazines splicamycin (mithramycin)
dacarbazine (DTIC) mitomycinC
dactinomyr.in
Antimetabolites aphidicolin
Folic Acid analoqs
methotrexate Enzvmes
Trimetrexate L-asparaginase
Pemetrexed L-arginase
(Multi-targeted antifolate)
Radiosensitizers
Pvrimidine analoqs metronidazole
5-fluorouracil misonidazole
fluorodeoxyuridine desmethylmisonidazole
gemcitabine pimonidazole
cytosine arabinoside etanidazole
(AraC, cytarabine) nimorazole
5-azacytidine RSU 069
2,2'- difluorodeoxy-cytidine E09
RB 6145
Purine analogs SR4233
6-mercaptopurine nicotinamide
6-thioguanine 5-bromodeozyuridine
azathioprine 5-iododeoxyuridine
2'-deoxycoformycin bromodeoxycytidine
(pentostatin)
erythrohydroxynonyl-adenine (EHNA) Miscellaneous aqents
fludarabine phosphate Platinium coordination complexes
2-chlorodeoxyadenosine cisplatin
(cladribine, 2-CdA) Carboplatin
oxaliplatin
Type 1 Topoisomerase Inhibitors Anthracenedione
camptothecin mitoxantrone
topotecan
irinotecan Substituted urea
hydroxyurea
Bioloqical response modifiers
G-CSF Methylhydrazine derivatives
GM-CSF N-methylhydrazine (MIH)
procarbazine
Differentiation Aqents
retinoic acid derivatives Adrenocortical suppressant
mitotane (ο,ρ'- DDD)
Hormones and antagonists ainoglutethimide
Adrenocorticosteroids/ antagonists
prednisone and equiv-alents Cytokines
dexamethasone interferon (α, β, γ)
ainoglutethimide interleukin-2
Progestins Photosensitizers
hydroxyprogesterone caproate hematoporphyrin derivatives medroxyprogesterone acetate Photofrin®
megestrol acetate benzoporphyrin derivatives
Npe6
Estrogen? tin etioporphyrin (SnET2) diethylstilbestrol pheoboride-a
ethynyl estradiol/ equivalents bacteriochlorophyll-a
naphthalocyanines
Antiestrogen phthalocyanines
tamoxifen zinc phthalocyanines
Androgens Radiation
testosterone propionate X-ray
fluoxymesterone/equivalents ultraviolet light
gamma radiation
Antiandrogens visible light
flutamide infrared radiation
gonadotropin-releasing microwave radiation
hormone analogs
leuprolide
Nonsteroidal antiandroqens
flutamide
Kits
[0097] As an additional aspect, the disclosure includes kits which comprise one or more compounds or compositions packaged in a manner which facilitates their use to practice methods of the disclosure. In one embodiment, such a kit includes a compound or composition described herein (e.g., a composition comprising a target-specific antibody alone or in combination with another antibody or a third agent), packaged in a container such as a sealed bottle or vessel, with a label affixed to the container or included in the package that describes use of the compound or composition in practicing the method. Preferably, the compound or composition is packaged in a unit dosage form. The kit may further include a device suitable for administering the composition according to a specific route of administration or for practicing a screening assay. Preferably, the kit contains a label that describes use of the inhibitor compositions.
[0098] Additional aspects and details of the disclosure will be apparent from the following examples, which are intended to be illustrative rather than limiting.
Example 1 -Identification of a Novel, Constitutively Active STING Mutant
[0099] Materials and Methods
[00100] Cells, Reagents, and Viruses: Primary Sting+I+ and Sting'1' MEF cells, HEK293T cells, and Platinum-E retroviral packaging cells were prepared as previously described. Primary MEF cells, HEK293T cells, and Platinum-E cells were cultured in DMEM (Gibco) supplemented with 10% FBS and antibiotics. dsDNA (ISD 90-mer) was prepared as previously described. Biotin-labeled cGAMP were purchased from Biolog. Poly l:C was obtained from American Biosciences. BFA, compound C, and tofacitinib were purchased from SIGMA. Doxorubicin and GSK 690693 were purchased from Santa Cruz Biotechnology. Lipofectamine 2000 was purchased from Invitrogen. Anti-STING rabbit polyclonal antibody was prepared as previously described. Other antibodies used in this paper were as follows: β-actin (SIGMA, A5441);
calreticulin (Abeam, ab14234); phospho-IRF3 (Cell Signaling, 4947); IRF3 (Cell signaling, 4302); phospho-p65 (Cell Signaling, 3031 ); p65 (Cell Signaling, 3987); phospho-TBK1 (Cell
Signaling, 5483); TBK1 (Abeam, ab40676); phospho-AMPK (T172) (Cell Signaling, 2535);
AMPK (Cell Signaling, 5832); phospho-STAT1 (Cell Signaling, 9167); HA (SIGMA, H9658); FLAG (SIGMA, F1804), IPS-1 (Bethyl, A300-783A); anti-GM130 (BD bioscience, 558712, Alexa Fluor 647-conjugated). HSV-1 (KOS strain) was purchased from ATCC. VSV was prepared as previously described. TaqMan probe for Infb, Cc/5, Ifitl, Statl, Oasl1, Rsad2, and Gapdh were purchased from Applied Biosystems. ELISA kit for IFN and CXCL10/IL-6 were purchased from PBL Interferon Source and R&D systems, respectively.
[00101] Plasmids and Mutagenesis: Reporter plasmids and thymidine kinase (TK)-luc were obtained as previously described. pcDNA-hSTING, pBabe-hSTING, pBabe-mSTING, and pcDNA-IPS-1 were made as previously described. pCMV-hcGAS was purchased from OriGene. To make STING mutants, QuickChange II XL site directed mutagenesis kit (Stratagene) was used with the following primers;
[0100] hSTING_N154S-F: GAAAAAGGGAATTTCAGCGTGGCCCATGGGCTG (SEQ ID NO:2)
[0101] hSTING_N154S-R: CAGCCCATGGGCCACGCTGAAATTCCC I I I I I C (SEQ ID NO:3)
[0102] hSTING_R284S-F: TTTAGCCGGGAGGATTCTCTTGAGCAGGCCAAA (SEQ ID NO:4)
[0103] hSTING_R284S-R: TTTGGCCTGCTCAAGAGAATCCTCCCGGCTAAA (SEQ ID NO:5)
[0104] mSTING_N153S-F: GAAGAAAAGAAGTTATCTGTTGCCCACGGGCTG (SEQ ID NO:6)
[0105] mSTING_N153S-R: CAGCCCGTGGGCAACAGATAACTTCTTTTCTTC (SEQ ID N0.7 )
[0106] mSTING_R283S-F: TTCAGTCGGGAGGATTCCCTTGAGCAGGCTAAA (SEQ ID NO:8)
[0107] mSTING_R283S-R: TTTAGCCTGCTCAAGGGAATCCTCCCGACTGAA. (SEQ ID NO:9)
[0108] Whole Exome Sequencing: Written informed consent was obtained by the family. Whole exome sequencing was performed as part of an ongoing collaboration with the Baylor Hopkins Center for Mendelian Genomics (BHCMG). Exome capture was performed with the in-
house developed BCM-HGSC Core design (52 Mb; Roche NimbleGen) as previously described. The variant calling was performed by the ATLAS2 suite. In order to confirm the mutation, PCR was used to amplify the DNA region of interest with the primers (forward:
ggaccctccattctccatcc(SEQ ID NO:10 ), reverse: aggcggcagttgttctgag(SEQ ID NO:11 )) prior to Sanger sequencing. The PCR condition is as follows; 95 °C for 5 min, 40 cycles of 94 °C for 30 sec/62 °C for 1 min/72 °C for 1 min, 72 °C for 10 min.
[0109] Luciferase Reporter Assay: HEK293T cells were transfected with pcDNA3-hSTING or mutants and reporter plasmids (IFNp-luc, NF-KB-IUC, pRD lll-l-luc, ISRE-luc) using lipofectamine 2000. TK-luc was used for transfection control. After 24 h, the cells were lysed in Cell Culture Lysis Reagent (Promega) and then luciferase activity was measured using luciferase assay substrate (Promega) for firefly luciferase activity (reporter plasmids) and renilla luciferase assay system (Promega) for renilla luciferase activity (TK-luc).
[0110] Western Blot: Samples were separated in an acrylamide gel and then transferred to Immobilon-P membrane (Millipore). The membrane was treated with 5% Blotting-Grade Blocker (BIO-RAD) in TBS-T buffer (TBS with 0.1% Tween20) for blocking and then incubated with the indicated primary antibody. The membrane was washed three times using TBS-T buffer, and then incubated with HRP-conjugated anti-rabbit or mouse IgG (Promega). After three washing, Super Signal West Pico or Femto (Thermo) was used to develop signal and the membranes were exposed to Premium X-ray film (Phenix).
[01 11] cGAMP-binding Assay: HEK293T cells were transfected with the indicated plasmids for 24 h. The cells were lysed by TNE buffer (50 mM Tris-HCI (pH 7.5), 150 mM NaCI, 1 mM EDTA, 1 % NP-40) with protease and phosphatase inhibitors. The cell lysates were incubated with biotin-labeled cGAMP (Biolog) for 30 min at 4 °C and then irradiated with UV for 10 min at 1 J/cm2 for crosslinking. Streptavidin-conjugated beads (Thermo) were added to the lysates. After incubation for 2 h at 4 "C, the precipitants were washed with TNE buffer five times and then boiled in SDS-sample buffer to elute the binding proteins.
[0112] Immunoprecipitation Assay: HEK293T cells were transfected with the indicated plasmids for 24 h and then lysed with TNE buffer with protease and phosphatase inhibitors. The cell lysates were incubated with anti-FLAG antibody overnight at 4 "C and then protein G beads (Thermo) was added to the lysates. After incubation for 1 h at 4 °C, the precipitants were washed with TNE buffer five times and then boiled in SDS-sample buffer to elute the
precipitated proteins.
[0113] Immunostaining: The cells on poly-D-Lysine coated round coverslips (BD bioscience) were fixed with 4% paraformaldehyde/PBS for 15 min and then permeabilized with 0.2% Triton X-100/PBS for 15 min. After blocking with 1% bovine serum albumin (BSA)/PBS for 30 min, the coverslips were incubated with the indicated primary antibodies in 1% BSA/PBS for 1 h at room temperature (RT) in wet chamber. After washing three times with PBS, the coverslips were incubated with Alexa Fluor 488-goat anti-rabbit IgG and Alexa Fluor-647 goat anti-chicken IgG (Invitrogen) for 1 h at RT in wet chamber. After washing three times with PBS, the coverslips were mounted onto the glass slides with ProLong Gold antifade reagent (Invitrogen). The coverslips were observed using Leica confocal microscope SP5.
[0 14] Gene Expression Array. Total RNA from the reconstituted MEF cells was purified using RNeasy RNA extraction kit (QIAGEN). GeneChip Mouse Gene 2.0 ST Array (Affymetrix) was used to observe the gene expression. The data collection and analysis were performed at the Center for Genome Technology (CGT), John P. Hussman, Institute for Human Genomics, University of Miami Miller School of Medicine.
[0115] Realtime PCR: Total RNA was extracted using RNeasy Mini Kit (QIAGEN) and cDNA was synthesized using QuantiTect Reverse Transcription Kit (QIAGEN) following the
manufacturer's instruction. Realtime PCR was performed with the indicated TaqMan probes (Applied Biosystems) using LightCycler 2.0 (Roche) or StepOnePlus realtime PCR system (Applied Biosystems). Gapdh was used for normalization.
[0116] Plaque Assay: The cells were infected with HSV-1 or VSV at MOI = 1 for 24 hr. The infected cells were freeze-thawed three times to release HSV-1 from the cells. Vero cells were incubated with the supernatants including viruses for 1 h and then cultured in 1 % low melting agarose (lnvitrogen)/DMEM/1 % FBS to avoid secondary colony. After 24 h for VSV or 48 h for HSV-1 , the cells were fixed with methanol after removing the overlaid gel and then stained with 0.1% crystal violet/30% methanol solution to visualize plaques.
[0117] Results
[01 18] STING R284S is constitutively active. A 6-month-old boy with fever (101.6 °F/38.6 °C) and a severe neck abscess was admitted to hospital and noted to have an IL-6 concentration
(34 mg/dl) approximately five times above normal. However, subsequent studies indicated that there was no indication of any severe bacterial infection. Neither were there any rashes on cheek, nose, or fingers that are typically observed in SAVI patients. The patient died shortly after admission with the mechanistic causes unknown. Whole-exome sequencing was carried out and after filtering against allele frequencies from available databases and comparing against
the parents genome a de novo heterozygous mutation was noted to occur in the STING gene, c.852G→T (p.R284S), which was confirmed by Sanger sequencing (Figure 1A). The parents did not present this variant, which occurred in a highly conserved region of STING (Figure 1 B). To determine if the amino acid substitution (R284S) affected STING function, the cDNA was cloned and transiently co-transfected HEK293T cells with the variant and a luciferase gene under control of the type I IFN promoter(ref, ishikawa/barber). In this assay, expression of wild type STING activates the type I IFN promoter, by stimulating IRF3 and NF-κΒ signaling, to generate luciferase. For comparison, a known STING (N154S) variant that was reported to be
hyperactive and known to cause SAVI (ref)14 was also transfected. This analysis indicated that STING (R284S) was potently able to trigger activation of the type I IFN promoter, almost 10-fold higher than wild-type STING and almost twice as much as the SAVI variant, according to this assay (Figure 1C). This data was confirmed by demonstrating that STING (R284S) could also trigger luciferase transcription under control of the pRD lll-l promoter (specifically activated by IRF3), NF-KB promoter, or an interferon stimulated response element (ISRE) promoter (ref)8 (Figure 1C). It was also examined whether STING R284S could be additionally activated in the presence of transfected cGAS plasmid DNA (hcGAS), which generates CDN's (cGAMP) to further augment wild type STING activity21 (Figure 1C). However, it was not observed that cGAS could further stimulate STING (R284S) activity significantly in this assay, in contrast to wild type STING or the SAVI variant. Indeed, STING (R284S) appeared highly constitutively active. The amino acid change in the Ecuador variant (S284R) did not appear to be in the known STING dimerization domain, according to structural analysis (Figure 1A). Accordingly, co- immunoprecipitation analysis suggested that STING (R284S) retained its ability to dimerize with wild-type STING (Figure 1 D). Collectively, this data indicates that STING R284S is a
hyperactive variant that does not require CDN's to be activated.
[0119] STING R284S cannot be retained in the ER. To analyze STING R284S function further, primary Sting'1' mouse embryonic fibroblast (MEF) cells were reconstituted with wild-type STING, STING N154S (SAVI), or STING R284S (Ecuador) using retrovirus delivery. It had been previously reported that SAVI variants leak out from the ER to likely trigger innate immune signaling22. Therefore the localization of STING (R284S) in the cell was examined by confocal microscopy. The data indicated that wild type STING could only traffic in the presence of transfected cytosolic dsDNA (Figure 2A). MEFs reconstituted with the SAVI (N153S) variant were also not seen to robustly traffic in the absence of cytosolic dsDNA activators although a murine equivalent (N153S) was seen to traffic more readily (Figure 2A). However, the human STING (R284S) variant was seen to traffic to perinuclear regions without the requirement of
STING agonists, again suggesting that it was permanently active (Figure 2A). Wild-type STING is known to escort and activate TBK1 during trafficking, an event required to activate IRF39. Confocal analysis further indicated that TBK1 constitutively accompanied STING (R284S) to perinuclear regions that harbor IRF3 transcription factors (Figure 2A). Thus, STING (R284S) retains its ability to bind to TBK1. The constitutive trafficking of R284S could be blocked by brefeldin A (BFA) confirming that this variant traffics from the ER through the golgi apparatus9 (Figure 1 B).
[0120] It was confirmed that STING (R284S) was potently able to trigger the transcription of innate immune genes using microarray analysis. This study indicated that the STING N154 and R284S variant robustly induced innate immune gene transcription even in the absence of cytosolic dsDNA activator, in this assay (Figure 2C). The reconstitution of wild type human STING in these cells also appeared to trigger innate immune gene activity, but not to the extent seen with the STING N154 and R284S variants. ELISA or real-time PCR confirmed the microarray results and indicated high levels of CXCL10, IL-6 and Cc/5 production in cells expressing N154S or R284S (Figure 2D, E). The observed high level of constitutive IL6 production was reminiscent of the situation observed in the Ecuador patient. The observed elevated levels of host defense related proteins being produced by cells expressing STING N154S or R284S may be expected to contribute towards resistance to viral infection. Thus, the reconstituted MEF's were infected with herpes simplex virus-1 (HSV-1 ; DNA virus) or vesicular stomatitis virus (VSV; RNA virus) and indeed noted that cells expressing the STING variants were more resistant to viral replication (Figure 2F). These results suggest that STING (R284S) is a highly active STING variant.
[0121] Suppression of type 1 1 FN production through negative-feedback. The activation of
STING leads to the potent induction of type I IFN and pro inflammatory genes in response to
CDN's. However, the induction of Ifnbl and Ifna family genes was not robustly detected by RT-
PCR or microarray analysis in the Sting '' MEF cells that were reconstituted with N154S or
R284S (Figure 3 A). Wild type MEFs were seen to generate type I IFN as determined from
ELISA analysis, following transfection of cytosolic dsDNA, but little detectable type IFN was detected in the Sting''' cells reconstituted with the STING mutants, likely due to the diminutive amounts made (Figure 3B). However, treatment of the reconstituted MEFs with dsDNA did trigger detectable type I IFN, in all cells except the MEFs reconstituted with STING R284S
(Figure 3B). In contrast, the production of alternate innate immune genes such as CxcHO was unaffected (Figure 3C and Figure 2C). It is possible that N154S and R284S may need to interact with wild-type STING to exert activity since all reported SAVI patients are heterozygous
(as was the Ecuador patient). However, Sting MEFs expressing N154S or R284S also failed to secrete type I IFN, while CXCL10 was readily detected, possibly due to low level transcription of the former gene (Figure 3B, C). It is known that the transcription of type I IFN induction is controlled via a negative-feedback mechanism, likely to prevent pro inflammatory complications and toxicity 23 '. Given the highly constitutive nature of STING R284S, it is plausible that this mutant could be driving the negative-feedback regulation of type I IFN transcription. To address this, reconstituted MEF cells were treated with Brefeldin A (BFA), which would block STING R284S trafficking and hence its activity. After removing the BFA, the ability of STING R284S to trigger type I IFN production was monitored. This analysis confirmed that both the N154S or R284S mutants could drive type I IFN production in the absence of cytosolic dsDNA activators and were constitutively active and able to produce type I IFN (Figure 3D). In contrast, CxcHO and Ifitl expression was suppressed in presence of BFA but constitutively detected after BFA washing (Figure 3E).
[0122] Consistent with these results, immunoblot analysis confirmed that IRF3
phosphorylation was not readily detectable in MEFs constitutively expressing STING N 54S and R284S (Figure 1 F, UT). However, after blocking STING trafficking, IRF3 phosphorylation was readily detected 2 hours after the removal of the BFA (Figure 3F). The activation of NF-KB, as determined through analysis of p65 phosphorylation, seemed to retain modest constitutive activity, unlike IRF3. These results suggest that STING N154S and R284S are indeed able to activate IRF3 as well as NF-κΒ and suggest that the lack of IRF3 phosphorylation may be due to negative feedback regulation of this transcription factor24. Since type I IFN requires both NF- kB as well as IRF3 for transcription, the lack of type I IFN induction may conceivably be explained by low level IRF3 activity. In contrast, since CxcH O harbors NF- Β activation sites in its promoter region, its expression would be less affected by high IRF3 turnover (Figure 3C). This concept is enforced by demonstrating that the JAK inhibitor Tofacitinib, which inhibits ISG signaling, failed to significantly suppress CXCL10 expression (Figure 3G). This affect may also explain why there is little association between the interferon scores in patients suffering from the STING-related disease AGS (as determined from measuring expression of 6 pro-inflammatory genes, IFI27, IFI44L, IFIT1 , ISG15, RSAD2 and SIGLEC1) and levels of interferon activity (Rice et al. Lancet Neurology 2015).
Example 2-Analysis of Kinase Inhibitors on STING Activity
[0123] It has previously been shown that AMPK can influence ULK1 and the control of STING-dependent IRF3 activity25. It was therefore evaluated whether regulators of AMPK activity could influence STING-dependent innate immune signaling.
[0124] ULK1 regulators are potential therapeutic drugs for STING-induced inflammatory diseases. Three putative regulators of AMPK were examined, Compound C, Doxorubicin (an anthracycline) and GSK690693 (an AKT/AMPK inhibitor)26'28. It was hypothesized that suppression of AMPK may release ULK1 to phosphorylate STING, an event that can prevent STING-dependent IRF3 activation25. Complete blocking of IRF3 activity may conceivably prevent the stimulation of interferon and subsequently ISG's8. As a comparison, experiments to evaluate use of the JAK inhibitor Tofacitinib, which is efficacious in rodent models, as well as the golgi trafficking blocker BFA were conducted. Principally, treatment of MEFs expressing STING (R284S) with Tofacitinib led to suppression of ISG's predominantly harboring STAT1 sites, such as Usp18 and Irgm2 (indicated by blue), but less suppression of genes with NF-KB and/or IRF1 transcription sites such as Cmpk2 and Rsad2 which were more evidently suppressible by GSK 690693 (Figure 4A). In this analysis, Doxorubicin, an intercalating agent, appeared less able to suppress innate immune gene induction compared to Compound C. RT- PCR analysis confirmed that GSK 690693 was most competent at suppressing the transcription of Ifitl , Oas1 and Rsad2 induced by both STING N154S and R284S (Figure 4B). Immunoblot analysis indicated that Compound C, Doxorubicin and GSK 609693 could suppress AMPK phosphorylation, albeit to different degrees, as well as IRF3 phosphorylation (Figure 4C). In contrast, Tofacitinib more robustly suppressed STAT1 phosphorylation as expected (Figure 4C). To extend this study, human cell (hTERT fibroblasts) were treated with GSK 690693 or
Tofacitinib and IRF3 phosphorylation in the presence and absence of cytosolic dsDNA activator was measured by immunoblot. This analysis confirmed that GSK 690693, but not tofacitinib, could inhibit dsDNA triggered, STING-dependent IRF3 phosphorylation (Figure 4D). It was further observed that GSK 690693 could suppress ULK1 phosphorylation, suggesting a role for this kinase in controlling IRF3 activity25. The examination of hTERT cells confirmed that GSK 690693 could suppress the production of type I IFN production as well as other proinflammatory genes. Thus, GSK 690693 may be useful either alone, or in conjunction with other accepted drugs such as Tofacitinib, as a treatment for 'interferonopathies' mediated by chronic STING signaling4.
[0125] Surprisingly, tofacitinib failed to effectively inhibit CXCL10 production and Ifitl induction in the reconstituted Sting-/- MEF cells expressing N154S or R284S (Figure 4A, B). It was confirmed that tofacitinib inhibits STAT1 but not IRF3 by western blots (Figure 4C). It
should be noted that expression of wild-type STING also promoted STAT1 phosphorylation, which may be consistent with the results that inflammatory genes were induced in cells expressing wild-type STING (Figure 2C, 2D, 3C, 4A, 4B). In contrast, BFA suppressed CXCL10 and IFIT1 expression and inhibited IRF3 and STAT1 activation (Figure 3E, 4A-4C). These results indicate that the STING mutants activate IRF3 to induce STING-dependent inflammatory genes such as CxcHO and Ifitl and also promote IFN production during the trafficking, which in turn activates JAK-STAT pathway to further induce ISGs. Thus, inhibition of STING signaling may be able to effectively suppress inflammation than that of IFN signaling.
[0126] BFA is known to inhibit protein transport of secretory and membrane proteins between the ER and the Golgi apparatus. Therefore, BFA treatment for patients may cause strong side effects. Instead, it is useful to discover STING-specific inhibitors. For this purpose, AMPK inhibitors were considered because it was previously shown that compound C (also known as dorsomorphin) is an ATP competitive inhibitor for AMPKa subunit suppresses STING- dependent inflammation. Consistently, Prantner et al. showed that inflammatory responses to STING agonists in ΑΜΡΚα1/α2 deficient cells are dramatically suppressed. Thus, AMPK inhibitors were evaluated to target STING-dependent inflammation.
[0127] In addition to compound C that is not approved for clinical use, doxorubicin and GSK 690693 were selected because doxorubicin has been clinically used for cancer treatment and GSK 690693 was initially planned for clinical trial use. Doxorubicin is a DNA intercalator used to prevent DNA replication but a report showed that AMPKa kinase activity can be inhibited by doxorubicin. GSK 690693 was originally developed for the inhibition of protein kinase B (AKT) but was shown to inhibit AMPKa in vitro. The microarray data showed that compound C and GSK 690693 suppressed the expression of many inflammatory genes in the reconstituted cells expressing R284S (Figure 4D). On the other hand, doxorubicin treatment enhanced the expression of some inflammatory genes (Figure 4D). This may be because doxorubicin is known to cause DNA damage response that activates STING pathway. Tofacitinib could also suppress the inflammatory gene expression (Figure 4D). These results suggest that not only JAK inhibitors but also AMPK inhibitors are potential therapeutic drugs for STING-induced inflammatory diseases. It is noted herein that regulation of AMPK/ULK1 can control STING signaling.
[0128] The microarray data were further confirmed by realtime PCR. In the reconstituted cells expressing N154S or R284S, GSK 690693 effectively suppressed inflammatory genes such as Ifitl and Rsad2 that are used for IFN score (Figure 4E). Compound C might specifically inhibit
R284S (Figure 4E). While the trafficking of R284S was not affected by tested drugs, Western blots showed that compound C and GSK 690693 inhibit both IRF3 and NF-κΒ (Figure 4F).
Again, tofacitinib didn't affect IRF3 and NF- Β (Figure 4F). It is shown here for the first time that GSK 690693 can effect IRF3 function and impede STING or dsDNA or innate immune signaling.
[0129] Taken together, AMPK inhibitors may be potential therapeutic drugs for STING- induced inflammatory diseases and useful for treatment of STING-induced inflammatory diseases, or inflammatory diseases in which STING signaling is aberrant. The AMPK inhibitors cou!d optionally be used in combination with JAK inhibitors that target IFN signaling.
[0130] Numerous modifications and variations of the invention as set forth in the above illustrative examples are expected to occur to those skilled in the art. Consequently only such limitations as appear in the appended claims should be placed on the invention.
[0131] References
[0132] 1. Crow, Y. J. & Manel, N. Aicardi-Goutieres syndrome and the type I
interferonopathies. Nat Rev Immunol, 15, 429-40 (2015).
[0133] 2. Mohan, C. & Putterman, C. Genetics and pathogenesis of systemic lupus erythematosus and lupus nephritis. Nat Rev Nephrol 11 , 329-341 , (2015).
[0 34] 3. Pandey, S., Kawai, T. & Akira, S. Microbial sensing by Toll-like receptors and intracellular nucleic acid sensors. Cold Spring Harb Perspect Biol 7, a016246, (2015).
[0135] 4. Barber, G. N. STING: infection, inflammation and cancer. Nat Rev Immunol 15, 760-770, (2015).
[0136] 5. Burdette, D. L. et al. STING is a direct innate immune sensor of cyclic di-GMP. Nature 478, 515-518, (2011).
[0137] 6. Wu, J. et al. Cyclic GMP-AMP is an endogenous second messenger in innate immune signaling by cytosolic DNA. Science 339, 826-830, (2013).
[0138] 7. Sun, L, Wu, J., Du, F., Chen, X. & Chen, Z. J. Cyclic GMP-AMP synthase is a cytosolic DNA sensor that activates the type I interferon pathway. Science 339, 786-791 ,(2013).
[0139] 8. Ishikawa, H. & Barber, G. N. STING is an endoplasmic reticulum adaptor that facilitates innate immune signalling. Nature 455, 674-678, (2008).
[0140] 9. Ishikawa, H., Ma, Z. & Barber, G. N. STING regulates intracellular DNA- mediated, type I interferon-dependent innate immunity. Nature 461 , 788-792, (2009).
[0141] 10. Gall, A. et al. Autoimmunity initiates in nonhematopoietic cells and progresses via lymphocytes in an interferon-dependent autoimmune disease. Immunity 36, 120-131 , (2012).
[0142] 11. Ahn, J., Gutman, D., Saijo, S. & Barber, G. N. STING manifests self DNA- dependent inflammatory disease. Proceedings of the National Academy of Sciences of the United States of America 109, 19386-19391 , (2012).
[0143] 12. Mackenzie, K. J. et al. Ribonuclease H2 mutations induce a cGAS/STING- dependent innate immune response. The EMBO journal 35, 831-844, (2016).
[0144] 13. Pokatayev, V. er al. RNase H2 catalytic core Aicardi-Goutieres syndrome-related mutant invokes cGAS-STING innate immune-sensing pathway in mice. The Journal of
Experimental Medicine 213, 329-336, (2016).
[0145] 14. Liu, Y. et al. Activated STING in a vascular and pulmonary syndrome. The New England Journal of Medicine 371 , 507-518, (2014).
[0146] 15. Seo, J. ef al. Tofacitinib relieves symptoms of stimulator of interferon genes (STING)-associated vasculopathy with onset in infancy caused by 2 de novo variants in TME 173. J Allergy Clin Immunol 139, 1396-1399 e1312, (2017).
[0147] 16. Melki, I. et al. Disease-associated mutations identify a novel region in human STING necessary for the control of type I interferon signaling. J Allergy Clin Immunol, (2017).
[0148] 17. Fremond, M. L. ef al. Efficacy of the Janus kinase 1/2 inhibitor ruxolitinib in the treatment of vasculopathy associated with TMEM173-activating mutations in 3 children. J Allergy Clin Immunol 138, 1752-1755, (2016).
[0149] 18. Clarke, S. L. et al. Interstitial Lung Disease Caused by STING-associated Vasculopathy with Onset in Infancy. Am J Respir Crit Care Med 194, 639-642, (2016).
[0150] 19. Jeremiah, N. et al. Inherited STING-activating mutation underlies a familial inflammatory syndrome with lupus-like manifestations. J Clin Invest 124, 5516-5520, (2014).
[0151] 20. Konig, N. ef al. Familial chilblain lupus due to a gain-of-function mutation in STING. Ann Rheum Dis 76, 468-472, (2017).
[0152] 21. Barber, G. N. STING-dependent cytosolic DNA sensing pathways. Trends in immunology 25, 88-93, (2014).
[0153] 22. Dobbs, N. et al. STING Activation by Translocation from the ER Is Associated with Infection and Autoinflammatory Disease. Cell host & microbe 18, 157-168, (2015).
[0154] 23. Yoshimura, A., Mori, H., Ohishi, M., Aki, D. & Hanada, T. Negative regulation of cytokine signaling influences inflammation. Current Opinion in lmmunology\5, 704-708 (2003).
[0155] 24. Saitoh, T. et al. Negative regulation of interferon-regulatory factor 3-dependent innate antiviral response by the prolyl isomerase Pin1. Nature immunology 7, 598-605, (2006).
[0156] 25. Konno, H., Konno, K. & Barber, G. N. Cyclic dinucleotides trigger ULK1 (ATG1) phosphorylation of STING to prevent sustained innate immune signaling. Cell 155, 688-698, (2013).
[0157] 26. Wang, S., Song, P. & Zou, M. H. Inhibition of AMP-activated protein kinase alpha (AMPKalpha) by doxorubicin accentuates genotoxic stress and cell death in mouse embryonic
fibroblasts and cardiomyocytes: role of p53 and SIRT1. The Journal of Biological Chemistry 287, 8001-8012, (2012).
[0158] 27. Vogt, J., Traynor, R. & Sapkota, G. P. The specificities of small molecule inhibitors of the TGFss and BMP pathways. Cell Signal 23, 1831 -1842, (2011 ).
[0159] 28. Heerding, D. A. et al. Identification of 4-(2-(4-amino-1 ,2,5-oxadiazol-3-yl)-1 -ethyl- 7-{[(3S)-3-piperidinylmethyl]oxy}-1 H- imidazo[4,5-c]pyridin-4-yl)-2-methyl-3-butyn-2-ol
(GSK690693), a novel inhibitor of AKT kinase. J Med Chem 51, 5663-5679, (2008).
Claims
1. A vector comprising a variant of a human STimulator of INterferon Genes (STING) polynucleotide encoding a STING protein having a mutation that makes the STING protein constitutively active.
2. The vector of claim 1 wherein the mutation is N154S or R284S of SEQ ID NO: 1.
3. A composition comprising the vector of claim 1 or 2.
4. A vaccine comprising a variant of a human STimulator of INterferon Genes (STING) polynucleotide encoding a STING protein having a mutation that makes the STING protein constitutively active, wherein the variant induces STING signaling.
5. The vaccine of claim 4 wherein the mutation is N154S or R284S of SEQ ID NO:
1.
6. The vaccine of claim 4 wherein the polynucleotide is in a vector.
7. The vaccine of claim 6 wherein the vector is a viral or a plasmid vector.
8. The vaccine of claim 7, wherein the viral vector is selected from the group consisting of vesicular stomatitis virus (VSV), a lentivirus, an adenovirus, an adeno-associated virus, a vaccinia virus and a modified vaccinia Ankara (MVA) virus.
9. A composition comprising the vaccine of any one of claims 4-8.
10. A method of activating STimulator of INterferon Genes (STING) in a subject in need thereof comprising administering a composition comprising a variant of a human STING protein having a mutation that makes the STING protein constitutively active, wherein the composition induces STING signaling.
1 1. A method Of stimulating an immune response in a subject in need thereof comprising administering a composition comprising a STING variant having a mutation that makes the STING protein constitutively active, wherein the composition induces STING signaling.
12. The method of claim 1 wherein the subject is suffering from cancer or a microbial infection.
13. A method of decreasing the size of a tumor in a subject comprising administering a composition a STimulator of INterferon Genes (STING) variant having a mutation that makes the STING protein constitutively active, wherein the composition induces STING signaling.
14. A method of treating cancer in a subject comprising administering a composition comprising an activator of STING (STimulator of INterferon Genes) comprising a STING variant having a mutation that makes the STING protein constitutively active, wherein the composition induces STING signaling.
15. The method of claim 14 wherein the cancer is ovarian cancer, colon cancer, melanoma, breast cancer or lung cancer.
16. The method of any one of claims 13 or 14 wherein tumor size in the subject is decreased by about 25-50%, about 40-70% or about 50-90% or more.
7. The method of any one of claims 10-16 wherein the composition is administered intratumorally, intravenously, intra-arterially, intraperitoneally, intranasally, intramuscularly, intradermally or subcutaneously.
18. The method of any one of claims 0-17 wherein the composition induces infiltration of immune cells into the tumor.
19. The method of claim 18 wherein the immune cells are macrophages or other phagocytes.
20. The method of any one of claims 10-19 wherein the composition is a vaccine of any one of claims 4-8.
21. A method of inhibiting STING signaling in a subject in need thereof comprising administering to the subject a therapeutically effective amount of an inhibitor of 5' adenosine monophosphate-activated protein kinase (AMPK).
22. A method of treating an inflammatory disease in which STING signaling is upregulated comprising administering to a subject in need thereof a therapeutically effective amount of an inhibitor of 5' adenosine monophosphate-activated protein kinase (AMPK).
23. The method of any one of claims 21-22 wherein the disease is an autoimmune disease.
24. The method of claim 23 wherein the autoimmune disease is selected from the group consisting of inflammatory bowel disease, ulcerative colitis, Crohn's disease, a peripheral vascular disease, a disorder characterized by lesions having inflammatory cell infiltration, a disorder where amyloid plaques are present in the brain, Alzheimer's disease, Aicardi-Goutieres syndrome, juvenile arthritis, rheumatoid arthritis, osteoporosis, amyotrophic lateral sclerosis, systemic lupus erythmatosis and multiple sclerosis.
25. The method of any one of claims 21-24 wherein the subject expresses a mutation in STING that makes the STING protein constitutively active.
26. The method of any one of claims 10-24 wherein the STING mutation is selected from the group consisting of N154S and R284S of SEQ ID NO: 1.
27. The method of any one of claims 21-26 wherein the AMPK inhibitor is selected from the group consisting of dorsomorphin, doxorubicin hydrochloride, GSK690693, BML-275, STO-609, a fasudil salt, gamma-D-glutamylaminomethylsulfonic acid, WZ4003 and HTH-01 - 015.
28. An adjuvant comprising a STimulator of INterferon Genes (STING) variant having a mutation that makes the STING protein constitutively active.
29. The adjuvant of claim 28 wherein the STING variant is a polynucleotide and an adjuvant for a nucleic acid vaccine.
30. The adjuvant of claim 28 wherein the STING variant is a polypeptide.
31. The adjuvant of any one of claims 28-30 wherein the STING mutation is selected from the group consisting of N154S and R284S of SEQ ID NO: 1.
32. A method of enhancing an immune response to a vaccine in a subject receiving said vaccine comprising administering an adjuvant comprising a STimulator of INterferon Genes (STING) variant having a mutation that makes the STING protein constitutively active in conjunction with the vaccine.
33. The method of claim 32 wherein the STING mutation is selected from the group consisting of N154S and R284S of SEQ ID NO: 1.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201762545626P | 2017-08-15 | 2017-08-15 | |
| US62/545,626 | 2017-08-15 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2019035901A1 true WO2019035901A1 (en) | 2019-02-21 |
| WO2019035901A9 WO2019035901A9 (en) | 2019-04-25 |
Family
ID=65362605
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2018/000169 Ceased WO2019035901A1 (en) | 2017-08-15 | 2018-08-15 | Compositions and methods for modulating sting protein |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2019035901A1 (en) |
Cited By (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110714007A (en) * | 2019-10-08 | 2020-01-21 | 江苏省人民医院(南京医科大学第一附属医院) | Human STING gene promoter inhibition and regulation region and application thereof |
| WO2020023361A1 (en) * | 2018-07-23 | 2020-01-30 | H. Lee Moffitt Cancer Center And Research Institute Inc. | Enhancing anti-tumor response in melanoma cells with defective sting signaling |
| WO2021077018A1 (en) * | 2019-10-16 | 2021-04-22 | Dana-Farber Cancer Institute, Inc. | Compositions and methods for modulating innate immune signaling pathways |
| WO2021097144A3 (en) * | 2019-11-12 | 2021-06-17 | Actym Therapeutics, Inc. | Immunostimulatory bacteria delivery platforms and their use for delivery of therapeutic products |
| WO2022270946A1 (en) * | 2021-06-23 | 2022-12-29 | 한국생명공학연구원 | Recombinant vector for improving expression of protein of interest via suppression of intracellular immune response and application thereof |
| US11638716B2 (en) | 2017-08-31 | 2023-05-02 | F-star Therapeutics, Inc. | Compounds, compositions, and methods for the treatment of disease |
| US12024709B2 (en) | 2019-02-27 | 2024-07-02 | Actym Therapeutics, Inc. | Immunostimulatory bacteria engineered to colonize tumors, tumor-resident immune cells, and the tumor microenvironment |
| US12134605B2 (en) | 2019-12-18 | 2024-11-05 | Stinginn, Llc | Substituted 1,2,4-triazoles and methods of use |
| CN120114453A (en) * | 2025-03-31 | 2025-06-10 | 江南大学 | Application of compound C-08 in improving ulcerative colitis and intestinal barrier function |
| WO2025201437A1 (en) * | 2024-03-29 | 2025-10-02 | 仁景(苏州)生物科技有限公司 | Sting protein mutant, nucleic acid encoding sting protein mutant, and use of sting protein mutant |
| CN121154824A (en) * | 2025-11-19 | 2025-12-19 | 安徽省立医院(中国科学技术大学附属第一医院) | NUAK1 application of biological marker in clinical diagnosis and prevention of osteoporosis and kit thereof |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2022524951A (en) * | 2019-02-27 | 2022-05-11 | アクティム・セラピューティクス・インコーポレイテッド | Tumors, tumor-resident immune cells and immunostimulatory bacteria engineered to colonize the tumor microenvironment |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20130039933A1 (en) * | 2008-08-04 | 2013-02-14 | University Of Miami | Sting (stimulator of interferon genes), a regulator of innate immune responses |
| US20160067334A1 (en) * | 2013-03-15 | 2016-03-10 | David Weiner | Vaccines With Biomolecular Adjuvants |
| US20170146519A1 (en) * | 2015-11-20 | 2017-05-25 | Oregon Health & Science University | Sting agonists and methods of selecting sting agonists |
| WO2018081459A9 (en) * | 2016-10-26 | 2018-11-22 | Modernatx, Inc. | Messenger ribonucleic acids for enhancing immune responses and methods of use thereof |
-
2018
- 2018-08-15 WO PCT/US2018/000169 patent/WO2019035901A1/en not_active Ceased
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20130039933A1 (en) * | 2008-08-04 | 2013-02-14 | University Of Miami | Sting (stimulator of interferon genes), a regulator of innate immune responses |
| US20160067334A1 (en) * | 2013-03-15 | 2016-03-10 | David Weiner | Vaccines With Biomolecular Adjuvants |
| US20170146519A1 (en) * | 2015-11-20 | 2017-05-25 | Oregon Health & Science University | Sting agonists and methods of selecting sting agonists |
| WO2018081459A9 (en) * | 2016-10-26 | 2018-11-22 | Modernatx, Inc. | Messenger ribonucleic acids for enhancing immune responses and methods of use thereof |
Non-Patent Citations (4)
| Title |
|---|
| KONNO, H ET AL.: "Pro-inflammation Associated with a Gain-of-Function Mutation (R284S) in the Innate Immune Sensor STING", CELL, vol. 23, no. 4, 24 April 2018 (2018-04-24), pages 1112 - 1123, XP055598035, DOI: 10.1016/j.celrep.2018.03.115 * |
| LIU, Y ET AL.: "Activated STING in a Vascular and Pulmonary Syndrome", NEW ENGLAND JOURNAL OF MEDICINE, vol. 371, no. 6, 7 August 2014 (2014-08-07), pages 507 - 518, XP055598018, DOI: 10.1056/NEJMoa131262 * |
| MUKAI, K ET AL.: "Activation of STING requires palmitoylation at the Golgi", NATURE, vol. 7, no. 11932, 21 June 2016 (2016-06-21), pages 1 - 10, XP055598001, DOI: 10.1038/ncomms11932 * |
| WEISS, JULIA M. ET AL.: "The STING agonist DMXAA triggers a cooperation between T lymphocytes and myeloid cells that leads to tumor regression", ONCOIMMUNOLOGY, vol. 6, no. 10, 7 July 2017 (2017-07-07), pages e1346765-2 - e1346765-11, XP055598032, DOI: 10.1080/2162402X.2017.1346765 * |
Cited By (16)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US11638716B2 (en) | 2017-08-31 | 2023-05-02 | F-star Therapeutics, Inc. | Compounds, compositions, and methods for the treatment of disease |
| WO2020023361A1 (en) * | 2018-07-23 | 2020-01-30 | H. Lee Moffitt Cancer Center And Research Institute Inc. | Enhancing anti-tumor response in melanoma cells with defective sting signaling |
| US12599621B2 (en) | 2018-07-23 | 2026-04-14 | H. Lee Moffitt Cancer Center | Enhancing anti-tumor response in melanoma cells with defective sting signaling |
| US12024709B2 (en) | 2019-02-27 | 2024-07-02 | Actym Therapeutics, Inc. | Immunostimulatory bacteria engineered to colonize tumors, tumor-resident immune cells, and the tumor microenvironment |
| CN110714007B (en) * | 2019-10-08 | 2023-11-03 | 江苏省人民医院(南京医科大学第一附属医院) | Human STING gene promoter repression regulatory region and its application |
| CN110714007A (en) * | 2019-10-08 | 2020-01-21 | 江苏省人民医院(南京医科大学第一附属医院) | Human STING gene promoter inhibition and regulation region and application thereof |
| WO2021077018A1 (en) * | 2019-10-16 | 2021-04-22 | Dana-Farber Cancer Institute, Inc. | Compositions and methods for modulating innate immune signaling pathways |
| AU2020382614B2 (en) * | 2019-11-12 | 2025-12-11 | Actym Therapeutics, Inc. | Immunostimulatory bacteria delivery platforms and their use for delivery of therapeutic products |
| JP2023501539A (en) * | 2019-11-12 | 2023-01-18 | アクティム・セラピューティクス・インコーポレイテッド | An immunostimulatory bacterial delivery platform and its use for delivery of therapeutic products |
| JP2026021469A (en) * | 2019-11-12 | 2026-02-10 | アクティム・セラピューティクス・インコーポレイテッド | Immunostimulatory bacterial delivery platform and its use for the delivery of therapeutic products - Patent Application 20070122999 |
| WO2021097144A3 (en) * | 2019-11-12 | 2021-06-17 | Actym Therapeutics, Inc. | Immunostimulatory bacteria delivery platforms and their use for delivery of therapeutic products |
| US12134605B2 (en) | 2019-12-18 | 2024-11-05 | Stinginn, Llc | Substituted 1,2,4-triazoles and methods of use |
| WO2022270946A1 (en) * | 2021-06-23 | 2022-12-29 | 한국생명공학연구원 | Recombinant vector for improving expression of protein of interest via suppression of intracellular immune response and application thereof |
| WO2025201437A1 (en) * | 2024-03-29 | 2025-10-02 | 仁景(苏州)生物科技有限公司 | Sting protein mutant, nucleic acid encoding sting protein mutant, and use of sting protein mutant |
| CN120114453A (en) * | 2025-03-31 | 2025-06-10 | 江南大学 | Application of compound C-08 in improving ulcerative colitis and intestinal barrier function |
| CN121154824A (en) * | 2025-11-19 | 2025-12-19 | 安徽省立医院(中国科学技术大学附属第一医院) | NUAK1 application of biological marker in clinical diagnosis and prevention of osteoporosis and kit thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2019035901A9 (en) | 2019-04-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| WO2019035901A1 (en) | Compositions and methods for modulating sting protein | |
| JP7223055B2 (en) | Combination immunotherapy and cytokine control therapy for cancer treatment | |
| US20250134978A1 (en) | Rna cancer vaccines | |
| US9381228B2 (en) | FKBP-L and uses thereof | |
| BR112020026386A2 (en) | COMPOSITIONS AND METHODS FOR MODULATION OF INFLAMMATORY PHENOTYPES WITH MONOCYTES AND MACROPHAGES AND IMMUNOTHERAPY USES OF THE SAME | |
| US20230242913A1 (en) | Sting-dependent activators for treatment of disease | |
| BR112020004389A2 (en) | composition, and, method for treating or preventing a disease or disorder in an individual in need of it. | |
| WO2020223279A1 (en) | VECTORIZED ANTIBODIES (vAb) AND USES THEREOF | |
| US20250188493A1 (en) | Recombinant viral vector and uses thereof | |
| US20230139944A1 (en) | Targeting alpha3beta1 integrin for treatment of cancer and other diseases | |
| KR20210102331A (en) | Identification and targeting of tumor-promoting carcinoma-associated fibroblasts for diagnosis and treatment of cancer and other diseases | |
| AU2011278227A1 (en) | Superior efficacy of CD37 antibodies in CLL blood samples | |
| EP4532557A2 (en) | Development of a novel therapeutic cd99 antibody to treat aggressive solid tumors in children | |
| US12558351B2 (en) | Compositions and methods for enhancing cancer immune checkpoint therapy | |
| JP7750644B2 (en) | Intestinal expression of programmed cell death ligand 1 | |
| US20240423927A1 (en) | Compositions and methods for use in immunotherapy | |
| US20230107770A1 (en) | Method of enhancing immunotherapy using er stress pathway inhibitors | |
| TWI666321B (en) | Construction of oncolytic herpes simplex viruses (ohsv) obligate vector and constructs for cancer therapy | |
| WO2015069745A2 (en) | Tumors expressing igg1 fc induce robust cd8 cell responses | |
| WO2023081663A1 (en) | Methods of treating lung cancer and other cancers by recombinant sars-cov-2 spike s1 | |
| WO2015120298A1 (en) | Oligomerization domain of p53 to bypass the dominant-negative effect of mutant | |
| JP2016023182A (en) | Medicine for treating cancer | |
| HK1261030B (en) | Cancer therapy with an oncolytic virus combined with a checkpoint inhibitor |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 18846208 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 18846208 Country of ref document: EP Kind code of ref document: A1 |