TWI666321B - Construction of oncolytic herpes simplex viruses (ohsv) obligate vector and constructs for cancer therapy - Google Patents

Abstract

The invention provides an obligate oHSV vector comprising a modified viral DNA genome. The invention also provides recombinant oHSV-1 constructs comprising an obligate oHSV vector and an exogenous nucleic acid sequence encoding an immunostimulatory agent and/or an immunotherapeutic agent. Compositions comprising recombinant oHSV-1 constructs of the invention are useful for treating cancer.

Description

Oncolytic herpes simplex virus (oHSV) specific vector for cancer treatment and construction of its construct

The present invention generally relates to the treatment of cancer using oncolytic herpes simplex virus (oHSV). In particular, the invention relates to the preparation of an obligate HSV vector which can carry and present a plurality of genes encoding immunocostimulatory molecules and/or immunotherapeutic agents. The invention also relates to an innovatively designed genome that can serve as a vector for carrying and expressing a variety of therapeutic genes for treating cancer.

Oncolytic herpes simplex virus (oHSV) is being widely studied for the treatment of solid solid tumors. Oncolytic herpes simplex virus has many advantages over traditional cancer therapies as a whole (Markert et al., 2000; Russell et al., 2012; Shen and Nemunaitis, 2006). In particular, oHSVs typically contain mutations to make them susceptible to inhibition by innate immunity. Thus, they are able to replicate in cancer cells, but not in normal cells, because one or more of these cancer cells are compromised by the innate immune response to infection, which is intact in normal cells. The oHSV is typically delivered directly to the tumor entity and the virus can replicate in the tumor entity. Since the virus is delivered to the target tissue rather than systemically, this anticancer drug does not cause any side effects. A feature of the virus is the ability to induce adaptive immune responses, which leads to them not Can be administered multiple times. oHSV has been administered to tumors multiple times, but there is no evidence of their loss of efficacy or the induction of side effects (such as inflammatory reactions). HSVs are large DNA viruses that are capable of adding foreign DNA to their genome and regulating the performance of these genes upon administration to a tumor. Exogenous genes suitable for use with oHSV are those that help induce an adaptive immune response to a tumor.

Overcoming the defect of the innate immune response of the cell determines the tumor range in which the virus can be oncolytic as an anticancer agent. The more sequences that are missing, the narrower the range of cancer cells that can be treated, and the effectiveness of oHSV depends on the function of the deleted viral gene. Most recent oHSVs incorporate at least one cellular gene to support their anti-cancer activity (Cheema et al., 2013; Goshima et al., 2014; Markert et al., 2012; Walker et al., 2011).

The structure of the oHSV (referred to as the backbone) and the foreign gene suitable for insertion are considered separately for research. As mentioned above, the structure of the scaffold determines the range of susceptible cancers. The foreign gene causes the host to treat the cancer cell as a legitimate target for an adaptive immune response.

The HSV-1 genome consists of two covalently linked components, L and S, respectively. Each component consists of a unique sequence (L component is UL and S component is US), and the unique sequence is flanked by inverted repeats. The inverted repeat sequences of the L component are referred to as ab and b'a'. The inverted repeat sequences of the S component are referred to as a'c' and ca. The inverted repeat sequences b'a' and a'c' constitute an internal inverted repeat region. It is known that the inverted repeat region of the L and S components comprises two copies of five genes and a large number of transcribed but not protein-encoding DNAs encoding the proteins ICP0, ICP4, ICP34.5, ORF P and OFR O, respectively. .

The viruses currently tested in cancer patients fall into three broad categories. The first was designed based on the finding that the deletion of the ICP34.5 gene significantly attenuated viral toxicity ((Andreansky et al., 1997; Chou et al., 1995; Chou et al., 1990; Chou and Roizman, 1992). .to make sure For the safety of malignant glioma, G207, the first virus tested in patients, was attenuated by further mutations in the gene encoding viral ribonucleotide reductase (Mineta et al., 1995). However, G207 carrying the ICP34.5 mutation and the ribonucleotide reductase gene mutation was too weak to completely stop replication in cancer cells expressing wild-type protein kinase R (Smith et al., 2006).

The second design is based on the fact that if the Us11 viral protein is expressed early in the infection, it partially compensates for the consequences of ICP34.5 deletion and restores the ability to grow in cells expressing wild-type protein kinase R ( Cassady et al., 1998a). The skeleton design of this virus follows the results disclosed by Cassady (Cassady et al., 1998b), and the promoters of the Us12 gene and Us11 are deleted. Therefore, Us11 is expressed as an immediate early gene (rather than as a late gene).

The skeleton of the third type of virus, originally called R7020, was later renamed NV1020, which was formed by spontaneous mutation modification and was originally tested as a live attenuated vaccine (Meignier et al., 1988; Weichselbaum et al., 2012). This mutation lacks an internal inverted repeat region (consisting of b'a' and a'c', encoding one copy of the genes ICP0, ICP4, ICP34.5, ORF P and ORF O) and genes encoding UL56 and UL24. In addition, it has a bacterial sequence and, because it was originally intended to be used as a vaccine, it also contains a gene encoding several HSV-2 glycoproteins. R7020 has been extensively tested in patients with liver metastases from colon cancer. In addition, it was tested in head and neck epithelial squamous cell carcinoma, athymic nude mouse prostate cancer xenografts, and gallbladder tumor models (Cozzi et al., 2002; Cozzi et al., 2001; Currier et al., 2005). Fong et al., 2009; Geevarghese et al., 2010; Kelly et al., 2008; Kemeny et al., 2006; Wong et al., 2001).

The success of oHSV therapy depends on the extent of damage to cancer cells. In oHSV therapy During the early development process, it was realized that HSV could not kill all cancer cells in solid solid tumors alone. OHSV treatment is unlikely to effectively eliminate all cancer cells. In clinical trials, the destruction of tumors by oHSV must include tumors. Adaptive immune response. Further studies have shown that anti-tumor immune responses caused by infected tumor cell debris can be amplified by the addition of cytokines. The comparison of the oHSV of the cytokine-free gene with the oHSV of the immunostimulatory cytokine confirms this conjecture (Andreanski et al.) and ultimately leads to the addition of GM-CSF to oHSV for the treatment of melanoma (Andtbacka et Al., 2015).

The safety of oHSV depends on the absence of one or more genes that disable the functional inactivation of the host's innate immune response to the infection. Analysis of published data indicates that oHSV in clinical trials to date has been over-attenuated and can be improved (Miest and Cattaneo, 2014).

The addition of a gene encoding an immunostimulatory cytokine enhances the immune response to the tumor, but does not effectively enhance the cytotoxicity caused by T cells, which is essential for anti-tumor effects. Tumors silence the immune system through the PD-1 and CTLA-4 inhibition pathways. PD-1 is expressed on activated T cells and other hematopoietic cells, while CTLA-4 is expressed in activated T cells, including regulatory T cells (Fife and Pauken, 2011; Francisco et al., 2010; Keir et al. , 2008; Krummel and Allison, 1995; Walunas et al., 1994). Tumors use PD-1 and CTLA-4 inhibition pathways to evade host immune responses. In order to maximize anti-tumor response, it is necessary to neutralize PD-1 by PD-1 antibody and, in some cases, neutralize CTLA4 present on the surface of T cells to activate killer T cells (Topalian et al., 2015) . Although systemic administration of single-chain antibodies against PD-1 or CTLA4 is effective in enhancing the efficacy of oHSV, it is often accompanied by side effects and cannot be administered multiple times over a long period of time.

Therefore, there is an urgent need in the clinic to develop a safe and more effective oHSV and use it in combination with immunotherapeutics.

One aspect herein relates to a modified herpes simplex virus type 1 (hereinafter also referred to as HSV-1, obligate vector, vector, HSV-1 virus) comprising a modified HSV-1 genome. The modification comprises deleting the sequence between the promoter of the UL56 gene of the wild-type HSV-1 genome and the promoter of US1 such that (i) one copy of all double-copy genes is deleted, and (ii) is used to express the deletion The sequences required for all open reading frames (ORFs) present in the resulting viral DNA are intact.

Another aspect of the invention provides an oncolytic type I herpes simplex virus (HSV-1) construct comprising (i) a sequence required for expression of all single copies of an open reading frame in a viral genome; (ii) a viral genome a single copy of each of all double copy genes; and (iii) a single copy of the duplicated DNA encoding the non-coding RNA.

Another aspect of the invention relates to a recombinant oncolytic type I herpes simplex virus (HSV-1) comprising (a) a modified HSV-1 genome, wherein the modification comprises the UL56 gene in the wild-type HSV-1 genome The sequence between the promoter and the promoter of the US1 gene is deleted such that (i) one copy of all double copy genes is deleted, and (ii) is used to express all open reading frames present in the deleted viral DNA. The sequence required for (open reading frame, ORF) is intact; and (b) an exogenous nucleic acid sequence encoding an immunostimulatory agent and/or an immunotherapeutic agent, wherein the exogenous nucleic acid sequence is stably added to at least Is the deleted region of the modified HSV-1 genome.

Another aspect of the text is a viral vector comprising all open reading frames A single copy (i.e., UL1 to UL56 and US1 to US12) contains the "a" sequence at the end of the genome, which is an obligate vector, i.e., it is not itself replicable in highly susceptible Vero cells. The vector is capable of replication after insertion of a DNA comprising (a) a cellular DNA coding sequence or a non-coding sequence or (b) a viral DNA comprising a non-coding sequence. The obligate vector is tolerant to a total DNA length of at least 15 KB or up to 22 KB.

Another aspect herein relates to a pharmaceutical composition comprising an effective amount of recombinant oncolytic HSV-1 herein and a pharmaceutically acceptable carrier. The composition can be formulated for intratumoral administration.

Another aspect of the invention relates to a method of treating cancer, the method comprising administering to a subject in need thereof an effective amount of recombinant oncolytic HSV-1 or the pharmaceutical composition of the invention. Furthermore, the invention relates to the use of said recombinant oncolytic HSV-1 in a method of treating cancer.

A further aspect of the invention relates to the use of said recombinant oncolytic HSV-1 or a pharmaceutical composition for the preparation of a medicament for the treatment of an anticancer.

The aspects and advantages of the present invention, as well as other aspects and other advantages, will be apparent from the

Figure 1. Schematic representation of the HSV-1 virus. HSV-1, wild-type HSV-1 genomic structure, showing the internal inverted repeat region b'a'-a'c' between bp117005 and bp132096; IMMV201, oHSV-1 genomic structure, also known as obligate vector; IMMV202, oHSV-1 representing murine IL12; IMMV203, oHSV-1 expressing IL12; IMMV303, oHSV-1 representing human CTLA-4 scFv; IMMV403, oHSV-1 representing human PD-1 scFv.

Figure 2. Schematic representation of an oncolytic HSV-1 virus based on an obligatory vector Stimulant and / or immunotherapeutic agents. IMMV502, oHSV-1 expressing human anti-PD-1 scFv and murine IL 12; IMMV504, oHSV-1 expressing murine anti-CTLA-4 scFv and murine IL 12; IMMV503, expressing human anti-PD-1 scFv and human IL 12 oHSV-1; IMMV505, oHSV-1 showing human anti-CTLA-4 scFv and human IL 12; IMMV507, oHSV-1 showing human anti-CTLA-4 scFv and human anti-PD-1 scFv; IMMV603, showing human anti-CTLA- 4 scFv, human anti-PD-1 scFv and human IL 12 oHSV-1.

Figure 3. Performance of anti-PD-1 scFv from secretion test constructs. The His-tagged scFv-anti-PD-1 is driven by the CMV promoter along with signal peptide coding regions from different natural sources. Cell lysates and supernatants were collected, subjected to SDS-PAGE, and blotted with anti-His antibody. Lane 1, GM-CSF signal peptide; Lane 2, Gaussia luciferase signal peptide; Lane 3, Hidden Markov Model 38 (HMM38) signal peptide; Lane 4, Antibody V gene signal peptide.

Figure 4. Affinity assay of scFv-anti-PD-1 targeting PD-1. CMV promoter driven ELISA assay of His-tagged scFv-anti-PD-1 and HMM38 signal peptides. The supernatant was collected for ELISA assay and detected by anti-His antibody.

Figure 5. In vitro cell growth survival assay. (a) T24, human bladder cancer cells; (b) ECA109, human esophageal cancer cells; (c) CNE1, human nasopharyngeal carcinoma cells; (d) HCT116, human colon cancer cells; (e) Hep2, human laryngeal cancer cells (f) MD-MB-231, human adenoid cancer cells; (g) Hela, human epithelial cancer cells; (h) A549, human lung cancer epithelial cells; (i) H460, human non-small cell lung cancer cells.

definition

It should be noted that the term "one" or "one" entity refers to one of the entities. One or more; for example, "recombinant oncolytic HSV-1" is understood to mean one or more recombinant oncolytic HSV-1 viruses. Thus, the terms "a", "an", "an"

"Homology" or "identity" or "similarity" refers to sequence similarity between two peptides or between two nucleic acid molecules. Homology can be determined by comparing the positions that can be aligned in each sequence. When the position in the comparison sequence is occupied by the same thiol or amino acid, then the molecule is homologous at that position. The degree of homology between sequences is related to the number of matches or homologous positions shared by the sequences. An "unrelated" or "non-homologous" sequence shares less than 40% identity, preferably less than 25% identity with one of the sequences herein.

One polynucleotide or polynucleotide region has a specific percentage (eg, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99%) to another sequence. "Sequence identity" means that when aligned, the percentage of sulfhydryl groups (or amino acids) is the same when comparing the two sequences. This alignment and percent homology or sequence identity can be determined using software programs known in the art.

As used herein, "antibody" or "antigen binding polypeptide" refers to a polypeptide or polypeptide complex that specifically recognizes and binds to one or more antigens. The antibody can be an intact antibody and any antigen binding fragment thereof or a single strand thereof. Thus, the term "antibody" includes any protein or peptide having at least a portion of an immunoglobulin molecule having antigen binding biological activity. Such examples include, but are not limited to, a complementarity determining region (CDR) of a heavy or light chain or a ligand binding portion thereof, a heavy or light chain variable region, a heavy or light chain constant region, a framework (FR) region Or any part thereof, or at least a portion of a binding protein. The term antibody also encompasses polypeptide or polypeptide complexes that have antigen binding ability upon initiation.

The term "antibody fragment" or "antigen-binding fragment" as used herein is part of an antibody, such as F(ab')2, F(ab)2, Fab', Fab, Fv, scFv, and the like. Regardless of the structure, the antibody fragment binds to the same antigen recognized by the intact antibody. The term "antibody fragment" includes aptamers, mirror image isomers, and diabody. The term "antibody fragment" also includes any synthetic or genetically engineered protein that acts like an antibody by binding to a particular antigen to form a complex.

The antibodies, antigen-binding polypeptides or variants or derivatives thereof herein include, but are not limited to, polyclonal, monoclonal, multispecific, human, humanized, primatized or chimeric antibodies, single chain antibodies , epitope-binding fragments (eg, Fab, Fab', and F(ab')2), Fd, Fv, single-chain Fv (scFv), single-chain antibodies, disulfide-linked Fv (sdFv), including VK or VH structures Fragments of the domain, fragments produced by the Fab expression library, and anti-idiotypic (anti-Id) antibodies. The immunoglobulin or antibody molecule herein can be any type of immunoglobulin molecule (eg, IgG, IgE, IgM, IgD, IgA, and IgY), or a subclass (eg, IgGl, IgG2, IgG3, IgG4, IgA1, and IgA2).

"Specific binding" or "having specificity" generally refers to the binding of an antibody to an epitope via its antigen binding domain, and such binding requires some complementarity between the antigen binding domain and the epitope. According to this definition, an antibody is considered to "specifically bind" to an epitope when it is easier to bind to the epitope through its antigen-binding domain than to a random, unrelated epitope. The term "specificity" is used herein to quantify the relative affinity of an antibody for binding to an epitope. For example, antibody "A" can be considered to have a higher specificity for a given epitope than antibody "B", or antibody "A" can be described as having a higher specificity than binding associated epitope "D" Binding epitope "C".

As used herein, "cancer" or "tumor" as used interchangeably herein, refers to a group of diseases that can be treated according to the present disclosure and that are involved in abnormal cell growth, which may invade or Spread to the body. Not all tumors are cancerous; benign tumors do not spread to other parts of the body. Possible signs and symptoms include: new bumps, abnormal bleeding, prolonged cough, unexplained weight loss, and changes in bowel movements. There are over 100 different known cancers that affect humans. The present disclosure is preferably applicable to a solid solid tumor. Non-limiting examples of tumors or cancer include gallbladder carcinoma, basal cell tumor, extrahepatic cholangiocarcinoma, colon cancer, endometrial cancer, esophageal cancer, Ewing sarcoma, prostate cancer, gastric cancer, glioma, hepatocellular carcinoma, Huo Qijin lymphoma, laryngeal cancer, liver cancer, lung cancer, melanoma, mesothelioma, pancreatic cancer, rectal cancer, kidney cancer, thyroid cancer, malignant peripheral nerve cell tumor, malignant peripheral nerve sheath tumor (MPNST), skin and plexus Neurofibromatosis, leiomyomas, fibroids, uterine fibroids, leiomyosarcoma, papillary thyroid carcinoma, thyroid undifferentiated carcinoma, medullary thyroid carcinoma, thyroid follicular carcinoma, hurthle cell carcinoma, thyroid cancer, ascites, Malignant ascites, mesothelioma, salivary gland tumor, salivary gland mucoepidermoid carcinoma, salivary gland acinar cell carcinoma, gastrointestinal stromal tumor (GIST), tumor causing potential spatial effusion, pleural effusion, pericardial effusion, peritoneal effusion Giant cell tumor (GCT), bone GCT, pigmented villonodular synovitis (PVNS), giant cell tumor of the tendon sheath (TGCT), TCGT (TGCT-TS) of the tendon sheath, and other sarcomas. In a preferred embodiment, the invention is for the treatment of esophageal cancer, lung cancer, prostate cancer or bladder cancer.

As used herein, the term "treating" refers to therapeutic treatments and prophylactic measures for the purpose of preventing or slowing (alleviating) undesirable physiological changes or disorders, such as the progression of cancer. Beneficial or desirable clinical outcomes include, but are not limited to, alleviating symptoms, reducing the extent of the disease, stabilizing (ie, not worsening) the disease state, delaying or slowing the progression of the disease, ameliorating or ameliorating the disease state, and disappearing the symptoms (either in part or in whole ), whether it is detectable or undetectable. "Treatment" also means prolonging survival compared to the expected survival when not receiving treatment. Patient in need of treatment These include those who already have a disease or condition, as well as those who are prone to have the disease or condition, or those who prevent the disease or condition.

"Object" or "individual" or "animal" or "patient" or "mammal" refers to any article, particularly a mammalian item, that is desired to be diagnosed, prognosed or treated. Mammalian items include humans, domestic animals, farm animals and zoo animals, competitive animals or pets such as dogs, cats, guinea pigs, rabbits, rats, mice, horses, cows, cows and the like.

As used herein, phrases such as "patients in need of treatment" or "objects in need of treatment" include articles that benefit from the administration of the antibodies or compositions of the present disclosure, for example, for detection, diagnostic procedures, and/or treatment, for example, Mammal objects.

It will also be understood by one of ordinary skill in the art that the modified genomes as disclosed herein can be modified such that they differ in nucleotide sequence from the modified polynucleotides from which they are derived. For example, a polynucleotide or nucleotide sequence derived from a specified DNA sequence can be similar, for example, having a certain percent identity to the starting sequence, eg, it can be 60%, 70%, 75% identical to the starting sequence, 80%, 85%, 90%, 95%, 98% or 99% are the same.

In addition, nucleotide or amino acid substitutions, deletions or insertions can be made to make conservative substitutions or alterations in "non-essential" regions. For example, a polypeptide or amino acid sequence derived from a specified protein, except for one or more separate amino acid substitutions, insertions or deletions (eg 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20) The remainder may be identical to the starting sequence except for a single amino acid substitution, insertion or deletion. In certain embodiments, the polypeptide or amino acid sequence derived from the specified protein has from 1 to 5, from 1 to 10, from 1 to 15, or from 1 to 20 individual amino acid substitutions, insertions or deletions relative to the starting sequence.

Antibodies can be detected by coupling them to chemiluminescent compounds Remember. The presence of the chemiluminescent-labeled antigen-binding polypeptide is then determined by detecting the presence of luminescence that occurs during the chemical reaction. Examples of particularly useful chemiluminescent labeling compounds are luminol, isoluminol, aromatic acridinium esters, imidazoles, acridinium salts and oxalates.

Modified HSV-1 specific carrier

In one aspect, the invention provides an HSV-1 virus comprising a modified HSV-1 genome, also known as an HSV-1 obligate vector. The HSV-1 genome consists of two covalently linked components (called L and S). Each component consists of a unique sequence (L component is UL, S component is US) with inverted repeats on both sides. The inverted repeats of the L component are referred to as ab and b'a'. The inverted repeats of the S component are referred to as a'c' and ca. The inverted repeat region contains a double copy of the transcription unit. At least 5 open reading frames with double copies are known in the art, and the proteins are designated as ICP0, ICP4, ICP34.5, ORF P and ORF O, respectively. The inverted repeat sequences b'a' and a'c' (b'a'-a'c') combine to form an internal inverted repeat region. In contrast, the inverted repeat sequences ab and ca are referred to herein as external repeat regions.

In one embodiment of the invention, the modification comprises a sequence deletion between a promoter of the UL56 gene of the wild-type HSV-1 genome and a promoter of the US1 gene. In fact, the deleted sequences include: (a) a single copy of the transcription unit encoding at least 5 proteins (ICP0, ICP4, ICP34.5, ORF-O, and ORF-P), retaining all other open reading frames; a transcription unit that is wholly contained within the sequence of b'a'-a'c'; (c) a transcription unit that begins in a unique region but extends to the deleted region.

In this context, the deletion is performed in a precise manner to ensure that the sequence required for the expression of all open reading frames (ORFs) in the viral DNA after deletion is intact. In this case, "the sequence required for the performance of all existing open reading frames" The ORF itself and the regulatory sequences required for each ORF (eg, promoter and enhancer) are included to ensure that the expression of the ORF is successful and that the translated protein is functional. "Complete" means that the sequence so defined is at least functional, but does not mean that the sequence must be 100% identical to the naturally occurring sequence. By including, for example, a conservative substitution or variation in a "non-essential" region, the sequence can have a slight change in nucleotide sequence compared to a naturally occurring sequence. In this case, the sequence may have 90%, 95%, 98% or 99% identity to the naturally occurring sequence.

Those skilled in the art will appreciate that the exact starting and ending positions of the deleted nucleotides of the invention depend on the strain and genomic isoform of the HSV-1 virus and can be readily obtained by techniques known in the art. determine. It should be understood that the present disclosure is not intended to be limited to any particular genomic isoform or strain of HSV-1 virus. In one embodiment, the deletion results in excision of nucleotides 117005 to 132096 in the genome. Those skilled in the art will also appreciate that other strains can also be used in the present invention as long as their genomic DNA is sequenced. Sequencing technology is readily available in the literature and on the market. For example, in another embodiment, deletions can be made on HSV-1 strain 17, the genome of which can be obtained by GenBank accession number NC_001806.2. In another embodiment, deletions can be made on the KOS 1.1 strain, the genome of which can be obtained by GenBank accession number KT899744. In yet another embodiment, deletions can be made on strain F, the genome of which can be obtained by GenBank accession number GU734771.1.

In some embodiments, the deletion is made precisely at a predetermined position, starting from the promoter of the last known gene in the L component (eg, UL56) to the first known gene in the S component (eg, US1) A DNA fragment at the end of the promoter sequence is excised. Thus, all of the ORFs from US1 to US12 in the UL1 to UL56 genes and US components in the UL component and the sequences required for the expression of these ORFs are intact. All of the presence of viral DNA after the precise excision and deletion The retention of the sequence required for the performance of the open reading frame (ORF) has many advantages. "Reserved" refers to a modified vector comprising only one copy of all genes in the unique sequences (UL and US) and all double copy genes (eg, genes for ICP0, ICP4, ICP34.5, ORF P, and ORF O). It should be noted that most of the deleted sequences do not encode a protein, but instead occupy a repetitive non-coding sequence in the deleted region (eg, an intron of the ICPO, a LAT domain, an "a" sequence, etc.). The obligate vector of the invention is also intended to include only one copy of the repeated non-coding sequence.

The retention of all ORFs provides a more robust virus, either before or after insertion of the foreign gene, to the greatest extent possible against environmental factors such as temperature, pressure, UV light, and the like. It also maximizes the anti-cancer range of the oncolytic HSV-1.

Various genetic manipulation methods known in the art can be used to obtain a modified HSV-1 vector as described in the present disclosure. For example, bacterial artificial chromosome (BAC) technology is used. See, for example, Horsburgh BC, Hubinette MM, Qiang D, et al. Allele replacement: an application that permits rapid manipulation of herpes simplex virus type 1 genome. Gene Ther, 1999, 6(5): 922-30. As another example, a COS plasmid can be used in the present invention. See, for example, van Zijl M., Quint W, Briaire J, et al. Regeneration of herpes viruses from molecularly cloned subgenomic fragments. J Virol, 1988, 62(6): 2191-5.

A key feature of the constructs described herein is that it acts as an obligate carrier. A suitable definition for such constructs is that they do not multiply in susceptible cells, but instead propagate after insertion of a viral or cellular DNA sequence, thus acting as a vector for the expression of the gene inserted into the vector sequence.

Recombinant oncolytic HSV-1 virus

The amount of exogenous DNA sequence that can be inserted into a wild-type virus is limited because it interferes with the packaging of DNA into virions. The precise deletion in the designated region provides an ideal space for insertion of foreign DNA sequences. According to one embodiment of the present disclosure, the deletion removes at least 15 Kbp of the oncolytic viral vector such that a similar amount of exogenous DNA sequence can be accommodated. Other studies have shown that the wild-type genome can tolerate 7KB of DNA.

Accordingly, in another aspect, the present disclosure provides recombinant oncolytic type 1 herpes simplex virus (HSV-1) comprising (a) a modified HSV-1 genome, wherein the modification is contained in a wild-type HSV- A sequence deletion between the promoter of the UL56 gene of the genome and the promoter of the US1 gene, such that (i) one copy of all double-copy genes is deleted, and (ii) is used to express the presence of the viral DNA after the deletion The sequence required for all open reading frames (ORFs) is intact; and (b) an exogenous nucleic acid sequence encoding an immunostimulatory agent and/or an immunotherapeutic agent, wherein the exogenous nucleic acid sequence is Stably added to at least the deleted region of the modified HSV-1 genome.

In one embodiment, the recombinant oncolytic HSV-1 comprises an exogenous nucleic acid sequence encoding an immunostimulatory agent. In some embodiments, the immunostimulatory agent is selected from the group consisting of GM-CSF, IL 2, IL 5, IL 12, IL 15, IL 24, and IL 27. In one embodiment, the immunostimulatory agent is IL12. In one embodiment, the immunostimulatory agent is human IL 12 or humanized IL 12 . In one embodiment, the immunostimulatory agent is murine IL12. In another embodiment, the immunostimulatory agent is IL15.

In one embodiment, the recombinant oncolytic HSV-1 comprises an exogenous nucleic acid sequence encoding an immunotherapeutic agent. In some embodiments, the immunotherapeutic agent is selected from the group consisting of an anti-PD-1 agent and an anti-CTLA-4 agent. In one embodiment, the immunotherapeutic agent is an anti-PD-1 agent. In another In an embodiment, the immunotherapeutic agent is an anti-CTLA-4 agent.

When only one exogenous nucleic acid sequence encoding an immunostimulatory or immunotherapeutic agent is inserted, the exogenous nucleic acid sequence is preferably integrated into the deleted region of the genome. In one embodiment, the exogenous nucleic acid sequence has a length similar to the deleted region. In one embodiment, the length of the exogenous nucleic acid sequence is 20% longer or shorter than the length of the deleted region. In another embodiment, the exogenous nucleic acid sequence is 15% longer, 10%, 5%, 4%, 3%, 2% or 1% longer than the deleted region.

In one embodiment, the exogenous nucleic acid sequence has a length of less than about 18 Kbp, about 17 Kbp, or about 16 Kbp. In one embodiment, the exogenous nucleic acid sequence has a length greater than about 10 Kbp, 11 Kbp, 12 Kbp, 13 Kbp, or 14 Kbp. In one embodiment, the exogenous nucleic acid sequence is between about 14 Kbp and about 16 Kbp in length. In one embodiment, the exogenous nucleic acid sequence has a length of about 15 Kbp.

In some embodiments, the recombinant oncolytic HSV-1 comprises at least two exogenous nucleic acid sequences encoding an immunostimulatory agent and/or an immunotherapeutic agent. In some embodiments, recombinant oncolytic HSV-1 comprises an exogenous nucleic acid sequence encoding two different immunostimulatory agents. For example, in one embodiment, recombinant oncolytic HSV-1 comprises an exogenous nucleic acid sequence encoding IL-12 and GM-CSF. In another embodiment, the recombinant oncolytic HSV-1 comprises an exogenous nucleic acid sequence encoding IL-15 and GM-CSF. In another embodiment, recombinant oncolytic HSV-1 comprises an exogenous nucleic acid sequence encoding IL12 and IL15.

In some embodiments, recombinant oncolytic HSV-1 comprises an exogenous nucleic acid sequence encoding two different immunotherapeutic agents. In one embodiment, for example, recombinant oncolytic HSV-1 comprises an exogenous nucleic acid sequence encoding an anti-PD-1 agent and an anti-CTLA-4 agent.

In some embodiments, recombinant oncolytic HSV-1 comprises an exogenous nucleic acid sequence encoding three different immunostimulatory agents and/or immunotherapeutic agents. For example, in one embodiment, recombinant oncolytic HSV-1 comprises an exogenous nucleic acid sequence encoding an IL12, an anti-CTLA4 agent, and an anti-PD-1 agent.

When more than one exogenous nucleic acid sequence encoding an immunostimulatory agent and/or an immunotherapeutic agent is introduced, it is preferred to insert the first exogenous nucleic acid sequence into the deleted region of the genome. A second or additional exogenous nucleic acid sequence can be inserted into the L component of the genome. In one embodiment, the second exogenous nucleic acid sequence is inserted between the UL3 and UL4 genes of the L component. In one embodiment, a second exogenous nucleic acid sequence is inserted between the UL37 and UL38 genes of the L component.

In one embodiment, the first exogenous nucleic acid sequence is inserted into the deleted region of the genome and the second exogenous nucleic acid sequence is inserted between the UL3 and UL4 genes. In one embodiment, the first exogenous nucleic acid sequence is inserted into the deleted internal inverted repeat region of the genome and the second exogenous nucleic acid sequence is inserted between the UL37 and UL38 genes of the L component. In one embodiment, the first exogenous nucleic acid sequence is inserted into the deleted internal inverted repeat region of the genome, the second exogenous nucleic acid sequence is inserted between the UL3 gene and the UL4 gene, and the third foreign source is The nucleic acid sequence is inserted between the UL37 gene of the L component and the UL38 gene.

In one embodiment, the first exogenous nucleic acid sequence encodes IL12. In one embodiment, the second exogenous nucleic acid sequence encodes an anti-CTLA4 agent or an anti-PD-1 agent. In one embodiment, the third exogenous nucleic acid sequence encodes an anti-PD-1 agent or an anti-CTLA4 agent.

It will be appreciated that insertion of one or more exogenous nucleic acid sequences into the oncolytic HSV-1 genome does not interfere with the expression of the native HSV-1 gene, and that the exogenous nucleic acid sequence is stably integrated into the modified HSV-1 genome. Thus, functional expression of the exogenous nucleic acid sequence can be expected.

Recombinant genes encoding immunostimulatory and/or immunotherapeutic agents contain nucleic acids encoding proteins as well as regulatory elements for protein expression. Typically, the regulatory elements present in the recombinant gene are operably linked to the nucleic acid sequence to be expressed and selected based on the host cell to be used for expression, and may include a transcriptional promoter, a ribosome binding site, and a terminator. Within a recombinant expression vector, "operably linked" is intended to mean a nucleotide sequence of interest to permit expression of the nucleotide sequence (eg, in an in vitro transcription/translation system, or in a host when the virus is introduced into a host cell) The manner in which cells are expressed) is linked to regulatory sequences. The term "regulatory sequence" is intended to include promoters, enhancers, and other expression control elements (eg, polyadenylation signals). Regulatory sequences include those that direct the constitutive expression of a nucleotide sequence in many types of host cells, as well as regulatory sequences that direct the expression of a nucleotide sequence in certain host cells (eg, tissue-specific regulatory sequences) .

One newly discovered regulatory sequence is an insulator that includes a class of DNA elements found on the chromosomes of cells that protect genes in one region of a chromosome from the regulation of another. Amelio et al. found a 1.5-kb region containing a cluster of CTCF motifs in the LAT region, which has insulator activity, particularly enhancer blockade and silencing (Amelio et al.. A Chromatin Insulator-Like Element in the Herpes Simplex Virus Type 1 Latency-Associated Transcript Region Binds CCCTC-Binding Factor and Displays Enhancer-Blocking and Silencing Activities. Journal of Virology, Vol. 80, No. 5, Mar. 2006, p. 2358-2368).

A promoter is a DNA sequence that directs RNA polymerase to bind to DNA and initiate RNA synthesis. A powerful promoter can cause high frequency initiation of mRNA. A suitable element for processing in eukaryotic cells is a polyadenylation signal. There may also be antibody-related inclusions child. Examples of expression sheets for antibody or antibody fragment production are well known in the art (e.g., Persic et al., 1997, Gene 187: 9-18; Boel et al., 2000, J Immunol. Methods 239: 153-166; Liang et al., 2001, J. Immunol. Methods 247: 1 19-130; Tsurushita et al., 2005, Methods 36: 69-83.).

One of ordinary skill in the art can select a suitable regulatory element based on, for example, desired tissue specificity and performance level. For example, cell type specific or tumor specific promoters can be used to limit the performance of a gene product to a particular cell type. In addition to the use of tissue-specific promoters, topical application of the virus can achieve localized manifestations and effects. Examples of non-tissue specific promoters that can be used include the early cytomegalovirus (CMV) promoter (U.S. Patent No. 4,168,062) and the Rous sarcoma virus promoter. Moreover, an HSV promoter, such as the HSV-1E promoter, can be used. In some embodiments, the promoter is selected from the promoters in the table below.

For example, examples of tissue-specific promoters that can be used in the present technology include prostate specific antigen (PSA) promoters, which are specific for prostate cells; intermuscular protein promoters, which are specific for myocytes; An alcoholase promoter that is specific for neurons; a beta globulin promoter that is specific for erythroid cells; a tau-globin promoter that is also specific for erythroid cells; a growth hormone promoter , which is specific for pituitary cells; insulin promoter, which is specific for pancreatic beta cells; glial fibrillary acidic protein promoter, which is a star-shaped gel The cytoplasmic cell is specific; the tyrosine hydroxylase promoter, which is specific for catecholaminergic neurons; the amyloid precursor protein promoter, which is specific for neurons; dopamine beta-hydroxylase Promoter, which is specific for noradrenergic and adrenergic neurons; tryptophan hydroxylase promoter, specific for serotonin/pine cells; choline acetyltransferase , which is specific for cholinergic neurons; an aromatic L-amino acid decarboxylase (AADC) promoter specific for catecholaminergic/5-HT/D type cells; an enkephalin promoter , which is specific for neuronal/spermectal epididymal cells; reg (froststone protein) promoter, which is specific for colon and rectal tumors as well as pancreatic and renal cells; and parathyroid hormone-related peptide (PTHrP) a promoter that is specific for liver and cecal tumors as well as schwannomas, kidney cells, pancreatic cells, and adrenal cells.

Examples of promoters that specifically act in tumor cells include a matrix lysin 3 promoter specific for breast cancer cells; a surface active protein A promoter specific for non-small cell lung cancer cells; and cancer-specific secretion of SLPI Leukocyte protease inhibitor (SLPI) promoter; tyrosinase promoter specific for melanoma cells; stress-induced grp78/BiP promoter specific for fibrosarcoma/tumoriblasts; AP2 specific for adipocytes Fat enhancer; α-1 antitrypsin transthyretin promoter specific for hepatocytes; interleukin-10 promoter specific for pleomorphic glioblastoma; for pancreas, breast, stomach, ovary and non- Small cell lung cell-specific c-erbB-2 promoter; alpha-B-crystallin/heat shock protein 27 promoter specific for brain tumor cells; basic fibroblast specific for glioma and meningioma cells Cell growth factor promoter; epidermal growth factor receptor promoter specific for squamous cell carcinoma, glioma, and breast tumor cells; mucin-like sugar eggs specific for breast cancer cells (DF3, MUC1) promoter; metastatic tumors mts1 specific promoter; for small cell lung cancer cell-specific promoter NSE a somatostatin receptor promoter specific for small cell lung cancer cells; a c-erbB-3 and c-erbB-2 promoter specific for breast cancer cells; and a c-erbB4 promoter specific for breast cancer and gastric cancer; a thyroglobulin promoter specific for thyroid cancer cells; an alpha-fetoprotein (AFP) promoter specific for liver cancer cells; a villin promoter specific for gastric cancer cells; and an albumin promoter specific for liver cancer cells. In another embodiment, a TERT promoter or a survivin promoter is used.

For example, in some embodiments, the exogenous nucleic acid sequence is operably linked to a promoter, such as a CMV promoter or an Egr promoter. In one embodiment, the nucleotide sequence encoding mIL12 is operably linked to an Egr promoter. In another embodiment, the nucleotide sequence encoding scFv-anti-hPDl is operably linked to a CMV promoter.

Immunostimulant or immunosuppressant

In certain embodiments, oHSV-1 of the present disclosure encodes one or more immunostimulatory agents (also known as immunostimulatory molecules), including cytokines (eg, IL-2, IL4, IL-12, GM-CSF, IFNγ). ), chemokines (such as MIP-1, MCP-1, IL-8) and growth factors (such as FLT3 ligand).

Alternatively or additionally, oHSV-1 of the present disclosure encodes one or more immunotherapeutic agents, such as a PD-1 binding agent (or anti-PD-1 agent) or a CTLA-4 binding agent (or anti-CTLA-4 agent), Included are antibodies or fragments thereof, such as an anti-PD1 antibody that specifically binds to PD-1 or an anti-CTLA-4 antibody that specifically binds to CTLA-4. The anti-PD-1 antibody may be a single chain antibody that antagonizes PD-1 activity. In other embodiments, the oncolytic virus exhibits an agent that antagonizes binding of the PD-1 ligand to the receptor, such as an anti-PD-L1 antibody and/or a PD-L2 antibody, a PD-L1 and/or a PD-L2 decoy, or Soluble PD-1 receptor.

PD-1 signaling pathway plays an important role in tumor-associated immune dysfunction use. Infection and lysis of tumor cells can elicit a highly specific anti-tumor immune response that kills tumor-inoculated cells as well as distantly established uninoculated tumor cells. Tumors and their microenvironments have formed mechanisms to evade, inhibit and inactivate natural anti-tumor immune responses. For example, a tumor may down-regulate a target receptor, wrap itself in a fibrous extracellular matrix or upregulate a host receptor or ligand involved in the activation or recruitment of regulatory immune cells. Natural and/or adaptive T regulatory cells (Treg) are involved in tumor-mediated immunosuppression. Without wishing to be bound by theory, PD-1 blockade inhibits Treg activity and improves the efficacy of tumor-reactive CTLs. Other aspects of the technique are described in further detail below. PD-1 blockade can also stimulate an anti-tumor immune response by blocking the inactivation of T cells (CTL and helper cells) and B cells.

In one aspect, the present technology provides an oncolytic virus carrying a gene encoding a PD-1 binding agent. Programmed Cell Death 1 (PD-1) is a 50-55 kDa type I transmembrane receptor originally identified by subtractive hybridization of a mouse T cell line undergoing apoptosis (Ishida et al., 1992, Embo J. 11: 3887-95). PD-1, a member of the CD28 gene family, is expressed on activated T cells, B cells, and bone marrow lineage cells (Greenwald et al., 2005, Annu. Rev. Immunol. 23: 515-48; Sharpe et al., 2007, Nat .Immunol.8:239-45). Human and murine PD-1 have approximately 60% amino acid identity with four potential N-glycosylation site and the conservation of residues defining the Ig-V domain. Both ligands PD-1 (PD-L1) and Ligand 2 (PD-L2) of PD-1 have been identified and belong to the B7 superfamily. PD-L1 is expressed on many cell types, including T cells, B cells, endothelial cells and epithelial cells, and antigen presenting cells. In contrast, PD-L2 is only expressed on professional antigen presenting cells such as dendritic cells and macrophages.

PD-1 negatively regulates T cell activation and is associated with its immunogenic receptor tyrosine-based inhibitory motif (ITIM) in its cytoplasmic domain (Parry et al., 2005, Mol. Cell. Biol. 25:9543-53). This inhibition of PD-1 disruption can lead to autoimmunity. The opposite situation can also be harmful. In many pathological conditions, such as tumor immune escape and chronic viral infection, persistent negative signaling of PD-1 is involved in T cell dysfunction.

Host anti-tumor immunity is primarily affected by tumor infiltrating lymphocytes (TIL) (Galore et al., 2006, Science 313: 1960-4). Multiple lines of evidence suggest that TIL is inhibited by PD-1. First, the expression of PD-L1 was confirmed in many human and mouse tumor lines, and this expression can be further upregulated by IFN-γ in vitro (Dong et al., 2002, Nat. Med. 8: 793-800). Second, PD-L1 expressed by tumor cells is directly related to its lytic resistance against tumor T cells in vitro (Blank et al., 2004, Cancer Res. 64: 1 140-5). Third, PD-1 knockout mice are resistant to tumor challenge (Iwai et al., 2005, Int. Immunol. 17: 133-44), and T cells from PD-1 knockout mice are adoptively transferred to Tumor-bearing mice are highly effective in tumor rejection (Blank et al., supra). Fourth, blockade of PD-1 inhibitory signals by monoclonal antibodies enhances host anti-tumor immunity in mice (Iwai et al., supra; Hirano et al., 2005, Cancer Res. 65: 1089-96). . Fifth, high PD-L1 expression in tumors (detected by immunohistochemical staining) is associated with poor prognosis in many human cancer types (Hamanishi et al., 2007, Proc. Natl. Acad. Sci. USA 104:3360-5) ).

Oncolytic virus therapy is an effective method for forming a host immune system by amplifying a tumor-specific antigen (post-oncolytic release)-specific T or B cell population. The immunogenicity of tumor-specific antigens is highly dependent on the affinity of the host immune receptor (B cell receptor or T cell receptor) for epitopes and host tolerance thresholds. High-affinity interactions drive host immune cells into long-acting memory cells through multiple rounds of proliferation and differentiation. The host tolerance mechanism will counteract this proliferation and expansion to minimize potential tissue damage caused by local immune initiation. PD-1 suppression signal is such a sink Part of the main tolerance mechanism, which can be supported by the following evidence. First, PD-1 is elevated in actively proliferating T cells, particularly in T cells with a terminally differentiated phenotype (effector phenotype). Effector cells are often associated with efficient cytotoxic function and cytokine production. Second, PD-L1 is important for maintaining peripheral tolerance and locally limiting overactive T cells. Thus, PD-1 inhibition using PD-1 binding agents expressed in the tumor microenvironment can be an effective strategy to increase the activity of TIL and stimulate an effective and long-lasting anti-tumor immune response.

Cytotoxic T lymphocyte antigen 4 (CTLA-4) is a member of the immunoglobulin (Ig) protein superfamily. The Ig superfamily is a group of proteins with key structural features of the variable (V) or constant (C) domains of the Ig molecule. Members of the Ig superfamily include, but are not limited to, immunoglobulins themselves, major histocompatibility complex (MHC) class molecules (ie, class I and class II MHC) and TCR molecules. T cells require two types of signals from antigen presenting cells (APCs) for initiation and subsequent differentiation into effector functions. First, there is an antigen-specific signal produced by the interaction between the TCR on the T cell and the MHC molecule presenting the peptide on the APC. Second, there is an antigen-independent signal mediated by interaction of CD28 with members of the B7 family (B7-1 (CD80) or B7-2 (CD86)). The environment in which CTLA-4 is integrated into the immune response is initially evasive. Mouse CTLA-4 was first identified and cloned by Brunet et al. as part of a molecule seeking to be preferentially expressed on cytotoxic T lymphocytes (Brunet et al. Nature 328:267-270 (1987)). Dariavach et al. found human CTLA-4 and soon cloned it (Dariavach et al. Eur. J. Immunol. 18: 1901-1905 (1988)). The murine and human CTLA-4 molecules have approximately 76% overall sequence homology and have near complete sequence identity in their cytoplasmic domains (Dariavach et al. Eur. J. Immunol. 18: 1901-1905 (1988) )).

Researchers began in 1993 and peaked in 1995 to depict CTLA-4 The role in T cell stimulation. By using a monoclonal antibody against CTLA-4, Walunas et al. (Walunas et al. Immunity 1: 405-13 (1994)) first provided evidence that CTLA-4 can act as a negative regulator of T cell activation.

In the area of cancer, Kwon et al. PNAS USA 94: 8099-103 (1997) established an isogenic mouse prostate cancer model and examined two different operations aimed at eliciting an anti-prostate cancer response by enhanced T cell costimulation. : (i) direct co-stimulation by transduction of prostate cancer cells expressing B7.1 ligand and (ii) in vivo antibody-mediated blockade of T cell CTLA-4, which prevents T cell down-regulation. In vivo antibody-mediated blockade of CTLA-4 has been shown to enhance anti-prostate cancer immune responses. Furthermore, Yang et al. Cancer Res 57:4036-41 (1997) investigated whether blockade of CTLA-4 function leads to enhanced anti-tumor T cell responses at different stages of tumor growth. Based on in vitro and in vivo results, they found that CTLA-4 blockade in tumor-bearing individuals enhanced the ability to produce an anti-tumor T cell response, but this enhancement was limited in its model to the early stages of tumor growth. In addition, Hurwitz et al. Proc Natl Acad Sci USA 95: 10067-71 (1998) investigated the production of T cell-mediated anti-tumor responses depending on the major histocompatibility complex/antigen T cell receptor junction and B7 Connection to CD28. Certain tumors, such as SM1 breast cancer, are difficult to treat by anti-CTLA-4 immunoassay. Therefore, regression of the parental SM1 tumor was observed by a combination therapy using a CTLA-4 blocker and a vaccine consisting of SM1 cells expressing a granulocyte-macrophage colony-stimulating factor, but the treatment alone was ineffective. This combination therapy has long-lasting immunity to SM1 and is dependent on CD4(+) and CD8(+) T cells. These findings suggest that CTLA-4 blockade plays a role in the level of host-derived antigen presenting cells.

anti-PD-1 agent and anti-CTLA-4 agent

In one aspect, the technology provides for encoding an anti-PD-1 agent and/or an anti-CTLA-4 The oncolytic virus of the exogenous nucleic acid of the agent. In some embodiments, the anti-PD-1 agent or anti-CTLA-4 agent comprises an antibody variable region that provides for specific binding to a PD-1 or CTLA-4 epitope. Antibody variable regions can be present, for example, in intact antibodies, antibody fragments, and recombinant derivatives of antibodies or antibody fragments. The term "antibody" refers to an immunoglobulin which may be natural, partially synthetic or fully synthetic. Thus, an anti-PD-1 agent or an anti-CTLA-4 agent of the present technology includes any polypeptide or protein having a binding domain that specifically binds to a PD-1 or CTLA-4 epitope.

Different kinds of antibodies have different structures. Reference can be made to IgG to illustrate different antibody regions. An IgG molecule contains four polypeptide chains, two longer heavy chains and two shorter light chains interconnected by disulfide bonds. The heavy and light chains each comprise a constant region and a variable region. The heavy chain consists of a heavy chain variable region (VH) and a heavy chain constant region (CH1, CH2 and CH3). The light chain consists of a light chain variable region (VL) and a light chain constant region (CL). There are three hypervariable regions responsible for antigen specificity in the variable region. (See, for example, Breitling et al., Recombinant Antibodies, John Wiley & Sons, Inc. and Spektrum Akademischer Verlag, 1999; and Lewin, Genes IV, Oxford University Press and Cell Press, 1990.)

The hypervariable regions are often referred to as complementarity determining regions ("CDRs") and are located between more conserved flanking regions referred to as framework regions ("FW"). There are four (4) FW regions and three (3) CDRs from the NH2 terminus to the COOH terminus: FW1, CDR1, FW2, CDR2, FW3, CDR3, FW4. Amino acids associated with the framework regions and CDRs can be obtained by Kabat et al., Sequences of Proteins of Immunological Interest, USD of Department of Health and Human Services, 1991; C. Chothia and AM Lesk, J Mol Biol 196(4): 901 (1987) Or; B. Al-Lazikani, et al., J Mol Biol 273(4): 27, 1997 describes methods for numbering and alignment. For example, framework regions and CDRs can be identified by considering the Kabat and Chothia definitions. The variable regions of the heavy and light chains contain antigens The binding domain of the interaction. The two heavy chain carboxyl regions are joined by disulfide bonds to create a constant region of the Fc region. The Fc region is important to provide effector function. (Presta, Advanced Drug Delivery Reviews 58: 640-656, 2006.). Each of the two heavy chains constituting the Fc region extends through a hinge region to a different Fab region.

Anti-PD-1 agents or anti-CTLA-4 agents typically contain antibody variable regions. Such antibody fragments include, but are not limited to, (i) Fab fragments, monovalent fragments consisting of VH, VL, CH, and CL domains; (ii) Fab2 fragments comprising two Fab fragments joined by disulfide bonds in the hinge region a bivalent fragment; (iii) an Fd fragment consisting of the VH and CH1 domains; (iv) an Fv fragment consisting of the VH and VL domains of the antibody's one arm; (v) a dAb fragment comprising the VH or VL domain (vi) scAb, antibody fragments containing VH and VL and C1 or CH1, and (vii) protein scaffold-based artificial antibodies, including but not limited to fibronectin type III polypeptide antibodies (see, e.g., U.S. Patent No. 6,703,199). Furthermore, although the two domains VL and VH of the Fv fragment are encoded by separate genes, they can be joined by synthetic methods using recombinant methods such that they can be made into a single protein chain in which the VL and VH regions are paired to form a monovalent molecule, It is a single-chain Fv (scFv). Thus, an antibody variable region can be present in a recombinant derivative. Examples of recombinant derivatives include single chain antibodies, diabodies, triabodies, tetrabodies, and minibodies. The anti-PD-1 agent or anti-CTLA-4 agent may also contain one or more variable regions that recognize the same or different epitopes.

In some embodiments, the anti-PD-1 agent or anti-CTLA-4 agent is encoded by an oncolytic virus produced using recombinant nucleic acid technology. Different anti-PD-1 agents can be produced by different techniques, including, for example, single-chain proteins (such as scFv) comprising the VH and VL regions joined by a linker sequence, as well as antibodies or fragments thereof; and VHs on separate polypeptides And multi-chain proteins of the VL region. Recombinant nucleic acid technology involves the construction of nucleic acid templates for protein synthesis. Suitable recombinant nucleic acid technology is in the art It is well known. (See, for example, Ausubel, Current Protocols in Molecular Biology, John Wiley, 2005; Harlow et al., Antibodies, A Laboratory Manual, Cold Spring Harbor Laboratory, 1988). A recombinant nucleic acid encoding an anti-PD-1 antibody or an anti-CTLA-4 antibody can be expressed in cells that have been infected with an oncolytic virus and released into the tumor microenvironment after viral lysis. Cells actually act as a factory for encoding proteins.

A nucleic acid comprising one or more recombinant genes encoding either or both of the VH or VL regions of the anti-PD-1 or anti-CTLA-4 agent can be used to produce an intact protein/polypeptide that binds to PD-1/CTLA-4. For example, a single gene is used to encode a single chain protein (such as a scFv) comprising a VH and VL regions joined by a linker, or multiple recombination regions are used to generate a VH region and a VL region, thereby providing a complete binding agent.

Exemplary anti-PD-1 antibodies or anti-CTLA-4 antibodies or fragments or derivatives thereof useful in the present disclosure are available in the art. See, for example, WO 2006/121168, WO 2014/055648, WO 2008/156712, US 2014/0234296 or U.S. Patent No. 6,984,720.

The recombinant oHSV-1 in the present disclosure delivers an immunopotentiating protein (rather than systemic delivery) precisely in the tumor in need of them. Furthermore, by reducing the production of proteins in tumors, and possibly also reducing protein uptake, cytotoxic performance may be greatly reduced or absent.

Exemplary anti-PD-1 scFv and anti-CTLA-4 scFv sequences

combination

The oncolytic virus can be prepared in a suitable pharmaceutically acceptable carrier or excipient. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms. The pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the preparation of sterile injectable solutions or dispersions (U.S. Patent No. 5,466,468). In all cases, the formulation must be sterile and must be fluid for easy injection. It must be stable under the conditions of manufacture and storage and must be protected against the contamination of microorganisms such as bacteria and fungi.

The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and/or vegetable oils. The proper fluidity is maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required fineness in the case of dispersion and by the use of surfactants. The action of microorganisms can be prevented by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be preferable to include an isotonic agent such as sugar or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions in the compositions of the compositions, such as, for example, aluminum monostearate and gelatin.

For parenteral administration in aqueous solutions, for example, the solution should be suitably buffered (eg If necessary, and first osmotic pressure with a liquid diluent or the like with sufficient saline or glucose. These particular aqueous solutions are particularly suitable for intravenous, intramuscular, subcutaneous, intratumoral and intraperitoneal administration. In this regard, sterile aqueous media that can be used in accordance with the present disclosure will be known to those skilled in the art. For example, one dose can be dissolved in 1 mL of isotonic NaCl solution and added to 1000 mL of subcutaneous perfusate or injected at the recommended infusion site (see for example "Remington's Pharmaceutical Sciences" 15th Edition, pages 1035 -1038 and 1570-1580). Some changes will inevitably occur depending on the condition of the subject being treated. In any event, the person responsible for administration will determine the appropriate dosage for the individual subject. In addition, for human administration, the formulation should meet the sterility, pyrogen-free, general safety and purity standards required by the FDA Biologicals Standard.

Sterile injectable solutions are prepared by incorporating the active compound in the required amount in the liquid in the liquid in a suitable solvent, as needed, and then sterilized by filtration. In general, dispersions are prepared by incorporating the various sterilized active ingredients into a sterile vehicle containing the base dispersion medium and the additional ingredients from the ones listed above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred preparation methods are vacuum drying and freeze drying techniques which produce a powder comprising the active ingredient and any additional desired ingredients from a previously sterile filtered solution.

The compositions disclosed herein can be formulated in a neutral or salt form. Pharmaceutically acceptable salts include acid addition salts (forming acid addition salts with the free amino groups of the protein), including with inorganic acids such as hydrochloric acid or phosphoric acid or organic acids such as acetic acid, oxalic acid, tartaric acid, mandelic acid, and the like. Salt. Salts formed with free carboxyl groups can also be derived from inorganic hydrazines such as sodium, potassium, ammonium, calcium or ferric hydroxide, as well as organic hydrazines such as isopropylamine, trimethylamine, histidine, procaine and the like. When formulated, the solution will be administered in a manner compatible with the dosage formulation and in a therapeutically effective amount. The preparation is easy to use various agents Type (such as injectable solution, drug release capsule) and the like.

As used herein, "carrier" includes any and all solvents, dispersion media, carriers, coatings, diluents, antibacterial and antifungal agents, isotonic and absorption delaying agents, buffers, carrier solutions, suspensions, Colloids, etc. Such media and agents for pharmaceutically active substances are well known in the art. In addition to any conventional media or agents that are incompatible with the active ingredients, other media or agents are contemplated for use in the therapeutic compositions. Supplementary active ingredients can also be incorporated into the compositions.

The phrase "pharmaceutically acceptable" refers to molecular entities and ingredients that do not produce an allergic or similar untoward reaction when administered to a human. The preparation of aqueous compositions containing proteins as active ingredients is well understood in the art. Typically, such compositions are prepared as injectables, whether as a liquid solution or suspension; solid forms suitable for dissolving or suspending in a liquid prior to injection may also be prepared.

therapy

Another aspect of the present disclosure provides a method of treating or ameliorating cancer comprising administering to a subject in need thereof an effective amount of a recombinant oncolytic HSV-1 virus or a medicament comprising the recombinant oncolytic HSV-1 virus as described above combination. As such, the present disclosure provides an oncolytic HSV-1 virus for use in a method of treating or ameliorating cancer as described above.

In certain embodiments, the recombinant oncolytic HSV-1 virus or pharmaceutical composition is administered in an intratumoral manner. In one embodiment, the HSV-1 virus or pharmaceutical composition is injected directly into the tumor mass in the form of an injectable solution.

In some embodiments, an oncolytic virus carrying a gene encoding an immunostimulatory agent and/or an immunotherapeutic agent can be combined with other agents effective to treat cancer. For example, the treatment of cancer Treatment can be performed with oncolytic viruses and other anti-cancer therapies (eg, anticancer agents or surgery). In the art, oncolytic virus therapy is contemplated for use in combination with a chemotherapeutic agent, a radiotherapeutic agent, an immunotherapeutic agent, or other biological intervention.

"Anticancer" agents can negatively affect cancer in a subject, for example by killing cancer cells, inducing apoptosis in cancer cells, reducing the rate of cancer cell growth, reducing the incidence or number of metastases, reducing tumor size, and inhibiting tumor growth. The blood supply to tumors or cancer cells is reduced, the immune response against cancer cells or tumors is promoted, the progression of cancer is prevented or inhibited, or the lifespan of cancer patients is increased. Anticancer agents include biological agents (biotherapeutics), chemotherapeutic agents, and radiotherapeutic agents. More generally, these other compositions will be provided in a combined amount effective to kill or inhibit cell proliferation. This process may involve contacting the cells with the expression construct and reagent or multiple factors simultaneously. This can be achieved by contacting the cells with a single composition or pharmacological formulation comprising the two agents, or by contacting the cells simultaneously with two different compositions or formulations, one of which comprises an expression construct and the other Contains a second reagent.

In some embodiments, an oncolytic virus carrying a gene encoding an immunostimulatory agent and/or an immunotherapeutic agent is combined with an adjuvant. In one embodiment, the adjuvant is an oligonucleotide comprising an unmethylated CpG motif. The unmethylated dinucleotide CpG motif in bacterial deoxyribonucleic acid (DNA) has the advantage of stimulating the secretion of cytokines by several immune cells to enhance innate and adaptive immunity.

Viral therapy can be performed at intervals of a few minutes to weeks before or after other medications. In embodiments in which other agents and oncolytic viruses are separately administered to the cells, it will generally be ensured that there is no interval between each delivery time for a substantial period of time, so that the agents and viruses can still advantageously exert a combined effect on the cells. . In such a situation, anticipation The cells can be contacted with both therapies within about 12-24 hours of each other. However, in some cases, each application is separated by a few days (2, 3, 4, 5, 6 or 7 days) to several weeks (1, 2, 3, 4, 5, 6, 7 or 8 weeks) The time may be significantly extended by the time of treatment.

Construction of oHSVs expressing immunostimulatory genes or immunotherapeutic genes

Construction of modified oHSV-1 specific vector (IMMV201)

In the production of the obligate vector-IMMV201 by the bacterial artificial chromosome (BAC) technique, the cassette of the CMV promoter fragment 匣ATGCAGGTGCAGTAATAGTAA which produced three stop codons was inserted into the T-Easy vector. HSV-1 arranged using the prototype (P). The following gene fragments were amplified from the HSV-1 viral genome by two sets of primers (GAAGATCTAATATTTTTATTGCAACTCCCTG, CTAGCTAGCTTATAAAAGGCGCGTCCCGTGG) and (GCTCTAGATTGCGACGCCCCGGCTC, CCTTAATTAAGGTTACCACCCTGTAGCCCCGATGT): upstream flank nucleotide 117005, downstream ligated nucleotide 132096, and inserted into the In the above CMV and the three stop codon plasmids, the gene replacement plasmid was then constructed into pKO5 to generate pKO-CMV-STOP. IMMV201 was obtained by electroporating pKO-CMV-STOP into E. coli RecA+ carrying BAC HSV.

BAC-IMMV201 is unable to propagate viruses in mammalian cells

2-3 μg of BAC-IMMV201 as constructed above was transfected into Vero cells with 70% confluence using OptiMEM agency (Life Technologies, Inc.) according to the instructions. Incubate for 4 hours at 37 ° C in a 5% CO 2 incubator. After incubation, 4 ml of fresh complete growth medium (5% newborn calf serum/DMEM) was used instead. No viral plaque appeared within 3-4 days. The experiment was repeated three times. No viral plaques appeared.

Construction of oHSV-1 (IMMV202, 203, 303, 403) that expresses a single immunostimulatory or immunotherapeutic gene

CMV promoter gene fragment driving an immunostimulatory gene (murine IL12, human IL12) or immunotherapeutic gene (human PD-1 scFV (SEQ ID No. 1 or 3), human CTLA-4 scFV (SEQ ID No. 5) This was obtained by electroporating the pKO gene fragment into E. coli RecA+ carrying IMMV201 (as shown in Figure 1).

Construction of oHSV-1 (IMMV502, 503, 504, 505, 507) showing two immunostimulatory genes or immunotherapeutic genes

The CMV promoter fragment driving the immunostimulatory gene (IL12) and the immunotherapeutic gene (PD-1 scFV, CTLA-4 scFV) was further inserted between the UL3 and UL4 genes in the IMMV202, 203, 303, 403 vector to generate an immunostimulatory gene. Recombinant oHSV (shown in Figure 2) in combination with (IL12) and immunotherapeutic genes.

Construction of an oHSV-1 (IMMV603) that expresses an immunostimulatory gene and two immunotherapeutic genes

All three immunostimulatory cDNAs and immunotherapeutic cDNAs encoding human IL12, PD-1 scFV and CTLA-4 scFV were constructed by inserting CTLA-4 scFV between the UL37 and UL38 genes of the IMMV503 vector (shown in Figure 2). IMMV603.

In vitro test

PD-1 scFV performance

In a series of experiments described herein, 2×10 ⁶ H293T cells transfected with mocks or plasmids contain cDNA encoding the His-tagged scFV-anti-PD-1 driven by the CMV promoter and from various natural The signal peptide coding region of the source. Cell lysates and supernatants were collected 46 hours after transfection, then subjected to SDS-PAGE and immunoblotted by anti-His antibody. 40 μL of 2 μL of the supernatant and 30 μL of 200 μL of cell lysate were loaded onto a 12% PAGE gel. The amount of PD-1 scFV accumulated in the cell culture supernatant (Figure 3) reflects the efficiency of the different signal peptides.

Binding affinity of PD-1 scFV to PD-1

2 x 10 ⁶ H293T cells transfected with mock or plasmid contained a cDNA encoding His-tagged scFV-anti-PD-1 driven by the CMV promoter and an HMM38 signal peptide. The supernatant was collected 46 hours after transfection, and then subjected to ELISA assay, and detected with an anti-His antibody (Fig. 4). Secreted PD-1 scFV binds to PD-1 in a dose-dependent manner.

Growth cell viability in vitro

Simultaneous (negative control) or IMMV507 (oHSV-1 expressing PD-1 antibody and CTLA-4 antibody) were used to inoculate 5x10 in 96-well plates at 0.01, 0.1, 1, 10, 100-fold PFU per cell, respectively. ^Three of the following human tumor cells. Cell growth was measured by using CCK-8 Reagent Tablets and measured every 24 hours up to 96 hours (Figure 5). The absorbance was measured at 450 nm by a microplate reader (Biotek Epoch).

Tumor cell lines in these studies: T24, human bladder cancer; ECA109, human esophageal cancer; CNE1, human nasopharyngeal carcinoma; HCT116, human colon cancer; Hep2, human laryngeal cancer; MD-MB-231, human breast cancer; , human epithelial adenocarcinoma; A549, human lung cancer epithelial cells; H460, human non-small cell lung cancer cells.

IMMV507 kills tumor cells in a dose dependent manner. After contact with the oHSV-1 virus, tumor cells decrease over time.

Those skilled in the art will readily appreciate that the present invention is well suited for obtaining the And the objects and advantages inherent in this document. The methods, variations and compositions described herein are merely exemplary and are not intended to limit the scope of the invention. Variations and other uses may occur to those skilled in the art, but are also included within the spirit of the invention as defined by the scope of the claims.

The invention exemplarily described herein can be suitably implemented in the absence of any one or more elements, one or more limitations not specifically disclosed herein. The use of the terms and expressions are used to describe and not to limit the invention, and are not intended to exclude any equivalents of the features shown or described, or All may be within the scope of the invention. Therefore, it is to be understood that the invention may be modified and changed by the presently disclosed embodiments, and the modifications and variations are It is within the scope of the invention as defined by the appended claims.

Moreover, when features or aspects of the present invention are described in the form of a Markusi group or other alternative group, those skilled in the art will appreciate that the present invention also employs any of the Markusi groups or other groups. The form of a single member or subgroup member is described.

Claims (22)

A modified herpes simplex virus type 1 (HSV-1) capable of acting as a vector for a cellular or viral gene, the HSV-1 comprising a modified HSV-1 genome, wherein the modification comprises deletion of wild The sequence between the promoter of the U _L 56 gene of the HSV-1 genome to the promoter of the U _S 1 gene, such that (i) one copy of all double copy genes is deleted, and (ii) is used to express the deletion The sequence required for all open reading frames (ORFs) present in the viral DNA is intact. The modified HSV-1 of claim 1, wherein the double copy gene comprises a gene encoding ICP0, ICP4, ICP34.5, ORF P, and ORF O, and a repeating non-occupation in the deleted region Coding sequence. The modified HSV-1 of claim 1, wherein the HSV-1 has a prototype (P) genomic isoform. The modified HSV-1 of claim 1, wherein the HSV-1 is selected from any of the existing HSV strains, including the F strain, the KOS strain, and the 17 strain. The modified HSV-1 of claim 3, wherein the deletion results in excision of nucleotides 117005 to 132096 in the genome of the F strain. A recombinant oncolytic type I herpes simplex virus (HSV-1) comprising (a) a modified HSV-1 genome, wherein the modification comprises a promoter of the U _L 56 gene in the wild-type HSV-1 genome A sequence deletion between the promoter of the U _S 1 gene, such that (i) one copy of all double copy genes is deleted, and (ii) is used to express all open reading frames present in the deleted viral DNA ( The desired sequence of the ORF) is intact; and (b) an exogenous nucleic acid sequence encoding an immunostimulatory agent and/or an immunotherapeutic agent, wherein the exogenous nucleic acid sequence is stably added to at least the modified The deleted region of the HSV-1 genome. The recombinant oncolytic HSV-1 according to claim 6, wherein the immunostimulating agent is selected from the group consisting of GM-CSF, IL 2, IL 5, IL 12, IL 15, IL 24 and IL 27. The recombinant oncolytic HSV-1 according to claim 6, wherein the immunotherapeutic agent is selected from the group consisting of an anti-PD-1 agent and an anti-CTLA-4 agent. The recombinant oncolytic HSV-1 of claim 6, wherein the recombinant oncolytic HSV-1 comprises an exogenous nucleic acid sequence encoding an IL-12, an anti-PD-1 agent, and/or an anti-CTLA-4 agent. The recombinant oncolytic HSV-1 of claim 6, wherein the recombinant oncolytic HSV-1 comprises a first exogenous nucleic acid sequence encoding IL-12 and encoding an anti-PD-1 agent or anti-CTLA-4 A second exogenous nucleic acid sequence of the agent. The recombinant oncolytic HSV-1 of claim 6, wherein the recombinant oncolytic HSV-1 comprises a first exogenous nucleic acid sequence encoding an anti-PD-1 agent and a second encoding an anti-CTLA-4 agent. Exogenous nucleic acid sequence. The recombinant oncolytic HSV-1 of claim 6, wherein the recombinant oncolytic HSV-1 comprises a first exogenous nucleic acid sequence encoding IL-12, and a second exogenous source encoding an anti-PD-1 agent. A nucleic acid sequence and a third exogenous nucleic acid sequence encoding an anti-CTLA-4 agent. The recombinant oncolytic HSV-1 according to the scope of claim 6, wherein the recombinant oncolytic property HSV-1 further comprises a promoter sequence operably linked to the exogenous nucleic acid sequence. The recombinant oncolytic HSV-1 according to claim 10 or 11, wherein the first exogenous nucleic acid sequence is inserted in a deleted region of the modified HSV-1 genome, and the second An exogenous nucleic acid sequence is inserted between the U _L 3 and U _L 4 genes of the U _L component of the modified HSV-1 genome. The recombinant oncolytic HSV-1 according to claim 12, wherein the first exogenous nucleic acid sequence is inserted in a deleted region of the modified HSV-1 genome, the second exogenous nucleic acid A sequence is inserted between the U _L 3 and U _L 4 genes of the U _L component of the modified HSV-1 genome, and a third exogenous nucleic acid sequence is inserted in the modified HSV-1 genome Between the U _L 37 and U _L 38 genes of the U _L component. The recombinant oncolytic HSV-1 according to claim 12, wherein the first exogenous nucleic acid sequence is inserted in a deleted region of the modified HSV-1 genome, the second exogenous nucleic acid A sequence is inserted between U _L 37 and U _L 38 of the U _L component of the modified HSV-1 genome, and a third exogenous nucleic acid sequence is inserted into the U of the modified HSV-1 genome Between the U _L 3 and U _L 4 gene genes of the _L component. The recombinant oncolytic HSV-1 of claim 13, wherein the promoter sequence is a CMV promoter or an Egr promoter. The recombinant oncolytic HSV-1 of claim 6, wherein the immunostimulatory agent and/or immunotherapeutic agent is humanized. Recombinant oncolytic HSV-1 according to claim 8 wherein anti-PD-1 agent or anti-PD-1 agent The CTLA-4 agents comprise antibody variable regions that provide specific binding to the PD-1 or CTLA-4 epitope, respectively. The recombinant oncolytic HSV-1 of claim 19, wherein the antibody variable region is an intact antibody, an antibody fragment, or a recombinant derivative of the antibody or antibody fragment. A pharmaceutical composition comprising an effective amount of the recombinant oncolytic HSV-1 of any one of claims 6 to 20 and a pharmaceutically acceptable carrier. The pharmaceutical composition according to claim 21, wherein the composition is formulated for intratumoral administration.